Новая постоянная линия клеток человека



Новая постоянная линия клеток человека
Новая постоянная линия клеток человека
Новая постоянная линия клеток человека
Новая постоянная линия клеток человека
Новая постоянная линия клеток человека
Новая постоянная линия клеток человека
Новая постоянная линия клеток человека
Новая постоянная линия клеток человека
Новая постоянная линия клеток человека
Новая постоянная линия клеток человека
Новая постоянная линия клеток человека

 


Владельцы патента RU 2569181:

СЕВЕК ФАРМАСЬЮТИКАЛЗ ГМБХ (DE)

Изобретение относится к области молекулярной биологии. Предложен способ получения постоянной линии клеток-амниоцитов человека, включающий трансфекцию зародышевых клеток-амниоцитов человека молекулой нуклеиновой кислоты, содержащей последовательность нуклеиновой кислоты, кодирующую продукты генов аденовирусов Е1А и Е1В, причем указанную последовательность нуклеиновой кислоты получают из серотипа 5 аденовируса человека, и последующую трансфекцию постоянной линии клеток-амниоцитов человека, полученной на первом этапе, молекулой нуклеиновой кислоты, содержащей последовательность нуклеиновой кислоты, кодирующую большой SV40 Т-антиген. 3 з.п. ф-лы, 7 ил., 9 пр.

 

Заявленное изобретение относится к постоянной линии клеток человека, включающей полинуклеотидную последовательность для функций генов аденовируса Е1А и Е1В и полинуклеотидную последовательность для большого SV40 Т-антигена или ядерного антигена 1 (EBNA-1) вируса Эпштейна-Барра (ВЭБ). Кроме того, заявленное изобретение относится к способу транзиторной экспрессии рекомбинантных полипептидов и белков в упомянутой постоянной линии клеток человека.

Помимо бактерий, дрожжевых и растительных клеток, для получения рекомбинантных полипептидов и белков используют, в частности, животные клетки. В настоящее время, примерно 60-70% всех лечебных белков получают в клетках млекопитающих (Wurm, Nat. Biotechnology 22, 1393-1398, 2004). Получение рекомбинантных полипептидов или белков в клеточной культуре, т.е. в лабораторных условиях, для терапевтических, диагностических или технических целей могут осуществлять двумя различными способами. В стабильных, устойчивых или постоянных установившихся линиях клеток, нуклеиновая кислота, кодирующая заданный полипептид или белок, интегрирована в хромосомный ДНК клетки с, как минимум, одной копией и переносится вместе с набором клеточных хромосом дочерним клеткам при клеточном делении (так называемая стабильная экспрессия при получении линий клеток). Для получения данных стабильных продуктивных линий клеток необходимо, чтобы как минимум одна из нуклеиновых кислот, введенных в клетку путем трансфекции, несла бы такой генный фактор, который обладал бы преимуществами относительно селекции в клеточной культуре во время роста. Нуклеиновая кислота с таким генным фактором, с необязательным расположением на той же самой молекуле, что и кассета экспрессии для требуемого полипептида или белка. Упомянутый генный фактор представляет собой либо ген устойчивости к антибиотикам, либо ген устойчивости к химиотерапевтическим веществам (например, к тем, которые часто используют в клетках млекопитающих; Wurm, Nat. Biotechnology 22, 1393-1398, 2004), ген с генным продуктом с комплементарным действием в отношении дефектного метаболического пути (например, в дрожжевых клетках), или с трансформирующим генным фактором (для клеток-амниоцитов человека; Schiedner et al., BMC Biotechnology 8, 13, 2008). В данном случае гарантируют, что такие клетки со стабильной интеграцией трансфицированной нуклеиновой кислоты в хромосомную ДНК клетки и производящие упомянутый генный продукт, опережают в росте прочие клетки, не обладающие такой интеграцией, и селективны. При получении продуктивных клеток путем трансфекции в так называемой линии клеток-хозяев, с одной стороны, переносят нуклеиновую кислоту, кодирующую рекомбинантный полипептид (так называемый трансген) вместе с необходимыми транскрипционными регуляторными элементами, а, с другой стороны, переносят вторую кассету экспрессии, в которой есть ген, кодирующий маркер выделения, чей генный продукт представляет определенное преимущество по параметрам селекции.

Несколькими днями позднее после переноса гена, во время которого культивируют клетки, например, в культуральной среде без реагента селекции, к среде добавляют подходящий реагент селекции. В присутствии упомянутого реагента селекции, выживают и растут только те клетки, которые интегрировали нуклеиновые кислоты, применяемые для трансфекции и экспрессии маркера. Традиционно используемыми маркерами выделения являются ген устойчивости к неомицину, ген устойчивости к гидромицину и дигидрофолатредуктазе (ДГФР) (Wurm, Nat. Biotechnology 22, 1393-1398, 2004; Wurm and Jordan, 309-333 in: Makrides (Hrsg.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003). Соответственно, селекцию осуществляют на культуральной среде с реагентами селекции, как, например, антибиотики неомицин или гидромицин и синтетический глюкокортикоидный метотрексат, соответственно. Обычно, клетки с маркером выделения и трансгеном, прошедшие процесс селекции и пролиферирующие (так называемые трансформанты), впоследствии выделяют (клонируют) для обеспечения генетической идентичности всех клеток в культуре, и разделения требуемых продуктивных линий клеток с наилучшими показателями (скоростью) произведения от менее продуктивных клеточных линий.

Как отличие, в случае так называемой транзиентной экспрессии, нуклеиновая кислота, введенная в клетку путем трансфекции и кодирующая требуемый полипептид или белок, не интегрирована в хромосомную ДНК клетки и, соответственно, не подвергается селекции по данному результату. Таким образом, концентрация введенной нуклеиновой кислоты, как правило, уменьшается и вовсе «размывается» в процессе деления клеток во время роста в культуре, что предполагает временный, переходный характер данного способа экспрессии. Выбор стабильных продуктивных линий клеток с хорошими параметрами эффективности экспрессии занимает несколько месяцев и является высокозатратным процессом, в то время, как при помощи транзиентной экспрессии в течение нескольких дней можно получить количества в объеме нескольких миллиграммов требуемого полипептида или белка. Скорость и затратность технического процесса являются важными факторами промышленного внедрения биофармацевтических и диагностических продуктов. Таким образом, транзиентную экспрессию белков в малых объемах или в различных вариативных сочетаниях белков осуществляют одновременно с проведением фундаментальных НИР с целью получения результатов ранних опытных и доклинических исследований, например, для целевой идентификации, количественного анализа, получения биохимических характеристик генных продуктов, с целью проведения последующих токсикологических и фармакокинетических (фармакодинамических) опытов (Baldi et al., Biotechnol. Lett. 29, 677-684, 2007; Pham et al., Molecular Biotechnology 34, 225-237, 2006). В отличие от этого, промышленное производство белков в объемах от нескольких граммов до килограммов с целью использования в дальнейших, более широкомасштабных клинических исследований и поставок на рынок в коммерческих объемах, фактически осуществляют с применением стабильных продуктивных линий клетох.

Например, в патенте ЕР 1948789 описан способ получения постоянной линии клеток-амниоцитов человека путем трансфекции клеточного трансформирующего фактора без применения маркера выделения.

Таким образом, секретируемые, мембраносвязанные и внутриклеточные белки могут получать при помощи способа транзиентной экспрессии генов. В настоящее время клетки млекопитающих традиционно применяют в качестве систем экспрессии при получении множества комплексных белков, в частности, в случае, когда упомянутые белки предназначены для использования в терапевтических целях, поскольку прокариотические и простые эукариотические клеточные системы (например, дрожжи) явно уступают по своим характеристикам по сравнению с посттрансляционными модификациями. На настоящий момент для транзиентной экспрессии белков, как правило, используют четыре линии клеток млекопитающих: COS-1 и COS-7 клетки, соответственно, производные от линии клеток CV-1, полученных из клеток почек африканской зеленой макаки; клетки ВНК, полученные из клеток почек детенышей хомяка; клетки СНО, полученные из яйцеклеток китайского хомяка; и клетки НЕК293, линия клеток, полученная из клеток почек человеческого эмбриона с нейронными характеристиками (Pham et al., Molecular Biotechnology 34, 225-237, 2006; Wurm et Bernard, Current Opinion in Biotechnology 10, 156-159, 1999). Транзиентная экспрессия в линиях клеток млекопитающих обычно основана на трансфекции плазмидного вектора, включающего кассету экспрессии с последовательностью, кодирующей требуемый генный продукт. Также, могут быть использованы вирусные экспрессирующие векторы, как, например, вирус леса Семлики или аденовирус, но, в то же время, данные вирусы имеют редкое применение вследствие их высокой затратности во временном плане и повышенных требований к технике безопасности при работе с ними (при одновременной несомненной эффективности). Разработан комплекс физических и химических способов исследований для передачи ДНК в культивируемые клетки млекопитающих. Физические методы генного переноса включают электропорацию, нуклеофекцию и микроинъекцию. При способах химической трансфекции, применяют неорганические вещества (например, одновременную преципитацию с фосфатом кальция/ДНК), катионные полимеры (например, полиэтиленимин, способ с диэтиламиноэтилдекстраном) или катионные липиды (так называемая липофекция). Наиболее часто используемыми реагентами для трансфекции переноса нуклеиновых кислот в больших объемах (до нескольких литров) являются фосфат кальция и полиэтиленимин (Baldi et al., Biotechnol. Lett. 29, 677-684, 2007).

Описанные способы транзиентной экспрессии полипептидов и белков, основанные на линиях клеток, широко известных в мировой практике, обладают рядом недостатков. Низкие показатели эффективности экспрессии представляют определенную проблему в сочетании со способами транзиентной (экспрессии). Для улучшения показателей эффективности выхода клеточной экспрессии, применяют различные генные системы, которые способствуют повышению числа (количества) генных копий в расчете на клетку путем эписомальной репликации введенной нуклеиновой кислоты. Клетки COS экспрессируют большой Т-антиген вируса обезьяны 40 (SV40), фактор репликации, оказывающий влияние на эписомальную репликацию на большом количестве плазмидных копий с точкой начала репликации SV40 (SV40 on). Начальной стадией упомянутой репликации является связывание Т-антигена с точкой начала репликации SV40 (SV40 ori), при котором факторы клеточной репликации привязаны к ДНК/Т-антигенному комплексу, а репликация индуцируется (вызывается) клеточной ДНК-полимеразой. Описаны два генетических варианта линии клеток НЕК293, полученной в ходе проведения испытания примерно 30 лет назад по трансформации клеток почек человеческого эмбриона с ослабленным типом аденовируса 5 ДНК, и показавшей приемлемые параметры по трансфицируемости. Упомянутые варианты также экспрессируют вышеуказанные большой Т-антиген SV40 (НЕК293Т) и ядерный антиген 1 (EBNA-1) (HEK293E or 293EBNA-1) вируса Эпштейна-Барра (ВЭБ), соответственно. Упомянутая линия клеток должна предоставлять эписомальную репликацию или амплификацию плазмид с SV40-ori и EBV-oriP, соответственно. Фактор репликации EBNA-1 взаимодействует в последнем случае с точкой начала репликации oriP EBV. Как минимум, в случае с клетками HEK293E, наблюдали повышение выхода экспрессии гена при помощи oriP, содержащего плазмиды экспрессии. В сравнении с использованием EBNA-1 в сочетании с точкой начала репликации oriP, некоторые исследования показывают, что в клетках НЕК293Т не наблюдается какой-либо значительной репликации плазмид с SV40-ori (Durocher et al. Nucleic Acid Research 30, e9, 2002). Был получен стабильный вариант клеток СНО, который экспрессирует большой Т-антиген (LT) полиомавируса (Epi-CHO) и который можно использовать в сочетании с плазмидой, несущей точку начала репликации полиомавируса (PyOri) (Kunaparaju et al„ Biotechnology and Bioengineering 91, 670-677, 2005). Значения выходов, определенные в пределах примерно 10-20 мг/литр, получены при помощи упомянутого способа транзиентной экспрессии рекомбинантных белков с использованием вышеуказанных систем клеток млекопитающих (Baldi et al., Biotechnol. Lett. 29, 677-684, 2007). В отличие от этого, выходы в пределах нескольких граммов на литр вполне достижимы с использованием стабильных, постоянных продуктивных линий клеток, как и упомянуто выше, тем не менее, при достаточно высоких временных и финансовых затратах.

Еще одним недостатком систем клеток, используемых для экспрессии рекомбинантных белков, является то, что некоторые линии клеток на самом деле подходят для транзиентной экспрессии, вследствие их способности легко подвергаться трансфекции и делать возможной амплификацию эписомальной плазмиды (например, клетки НЕК293Т или НЕК293Е), но для получения стабильных линий клеток, вследствие их свойств в культивировании и выходе (например, клетки СНО), более предпочтительно используют другие линии клеток. Тем не менее, поскольку системы клеток различаются друг от друга по некоторых аспектам посттрансляционной модификации, информация по структуре и функциям (свойствам) упомянутых генных продуктов, полученных для специфической клеточной системы после транзиентной экспрессии (в большинстве случаев, в раннюю фазу развития терапевтического белкового продукта) может передаваться только в очень ограниченном объеме в структуру и свойства упомянутых генных продуктов после экспрессии в стабильных линиях клеток четкой системы клеток (в большинстве случаев, в поздней стадии развития, в клинических испытаниях и промышленных объемах). Посттрансляционные модификации, как, например, гликозилирование, фосфорилирование, карбоксилирование, пальмитоилирование или специфические деградации имеют первостепенное значение для различных свойств продуктов экспрессии, применяемых в дальнейшем в качестве терапевтических продуктов. Они могут оказывать влияние на активность, растворимость, время полужизни, стабильность или иммуногенность. Таким образом, системы клеток человека играют все более существенную роль в получении терапевтических белков; только клетки человека в качестве продуктивного механизма представляют аутентичную, подобную человеческим клеткам, модификацию продуктов экспрессии и уменьшают вследствие этого риск ухудшения качества продукта или возникновения нежелательных побочных эффектов. К примеру, известно, что рекомбинантный эритропоэтин применяется в лечебных дозах при лечении заболеваний у человека, и то, что белок, производимый в клетках СНО (Эпоэтин Альфа, Epoetin Alpha) показывает по углеводородным концам цепочек фрагменты N-гликолилнейраминовой кислоты, в то время, как белок, производимый в клетках человека (Эпоэтин Дельта, Epoetin Delta) - как и натуральный эритропоэтин человека - не содержит таких сахарных компонентов. Исходя из того, что человеческий организм вырабатывает антитела к упомянутым «чужеродным» сахарным структурам, использование систем экспрессии на человеческих клетках представляется предпочтительным решением (Varki, Am. J. Phys. Anthropol. 33, 54-69, 2001). На настоящий момент, еще не разработаны системы клеток человека с идеальными параметрами для транзиентной экспрессии и получения стабильных продуктивных линий клеток, что, в свою очередь, позволяет получить повторяемый стабильный профиль конечного продукта в течение всего периода разработки терапевтического препарата на основе получаемого белка.

Клетки человека особенно хорошо подходят для получения биотерапевтических препаратов вследствие способности к экспрессии комплексных белков - в отличие от клеток других млекопитающих или клеток прочих животных - с аутентичной структурой посттрансляционной модификации. Структура гликолизирования комплексных рекомбинантных белков, а также структура и расположение сахарных остатков в молекуле, намного полнее воспроизводят структуру аутентичного полипептида человека в процессе получения в системах клеток человека, чем в системах с клетками не-человека. Упомянутая структура гликолизирования часто играет важнейшую роль для получения критически необходимых свойств полипептидов, таких, как биологическая активность, стабильность, растворимость и иммуногенность.

Таким образом, целью заявленного изобретения является предоставление системы клеток человека со сравнительно более подходящими параметрами для транзиентной экспрессии полипептидов и получения стабильных продуктивных клеточных линий.

Упомянутой цели достигают, придерживаясь способа, раскрытого в формуле заявленного изобретения.

Следующие фигуры иллюстрируют заявленное изобретение.

Фиг.1 представляет в схематическом виде сборку плазмид для постоянной экспрессии Т-антигена. В pGS158 (Фиг.1а) экспрессируют Т-антиген под контролем промотора человеческого ЦАГ (цитозин-аденин-гуанин) (гибридный промотор предраннего энхансера человеческого ЦМВ (цитомегаловируса) и модифицированного куриного D активного промотора с первым интроном) (Niwa et al., Gene 108: 193-199, 1991), в pGS159 (Фиг.16) под контролем промотора ВСР (вируса саркомы Рауса) (Makrides, 9-26 in: Makrides (Hrsg.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003) и в pGS161 (Фиг.1в) под контролем промотора ЦМВ человека (цитомегаловируса) (Makrides, 9-26 in: Makrides (Hrsg.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003).

Фиг.2 представляет в схематическом виде сборку плазмид для транзиентной экспрессии человеческого альфа-1-антитрипсина (чАТ) и человеческого эритропоэтина (ЭПО), соответственно, в каждом случае под контролем промотора человеческого ЦМВ. Плазмида pGS116 (Фиг.2а) и pGS151 (Фиг.2б) содержит идентичные кассеты экспрессии для чАТ, а pGS151 дополнительно содержит точку начала репликации ДНК вируса обезьяны 40 (SV40 ori). К тому же, pGS177 содержит точку начала репликации SV40, в дополнение к кассете экспрессии ЭПО.

Фиг.3 представляет в схематическом виде количество чАТ в супернатанте культуры, транзиентно экспрессируемой в различных линиях клеток-амниоцитов, экспрессирующих Т-антиген (САР-Т Z582, Z583 и Z597) в сравнении с родительской линией клеток-амниоцитов (CAP) без экспрессии Т-антигена. В Z582 экспрессируют Т-антиген под контролем промотора CAG (Niwa et al., Gene 108: 193-199, 1991), в Z583 под контролем промотора RSV (вируса саркомы Рауса) (Makrides, 9-26 in: Makrides (Hrsg.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003) и в Z597 под контролем промотора ЦМВ (Makrides, 9-26 in: Makrides (Hrsg.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003).

Фиг.4 представляет в схематическом виде количество транзиентно экспрессируемого чАТ (обозначено столбиками) в супернатанте культуры и количество живых клеток (обозначено линиями) в различные моменты времени после трансфекции плазмиды без точки начала репликации SV40 on (чАТ/количество клеток - ori, плазмида pGS116) и с точкой начала репликации SV40 ori (чАТ/количество клеток + ori, pGS151), соответственно.

Фиг.5 представляет в схематическом виде количество транзиентно экспрессируемого чАТ (обозначено столбиками) в супернатанте культуры и количество живых клеток (обозначено линиями) в различные моменты времени после трансфекции pGS151 (с SV40 ori) с клетками САР-Т и НЕК293Т.

Фиг.6 представляет в схематическом виде внутриклеточную копийность плазмид pGS116 (без SV40 ori) и pGS151 (с SV40 ori), соответственно, в различные моменты времени после трансфекции в клетках САР-Т и НЕК293-Т.

Фиг.7 представляет в схематическом виде количество транзиентно экспрессируемых чАТ (обозначено столбиками) в супернатанте культуры и количество живых клеток (обозначено линиями) в различные моменты времени после трансфекции pGS151 (с SV40 ori) в САР-Т с полиэтиленимином (ПЭИ) в качестве реагента трансфекции.

Термин «амниоциты», в том значении, в котором он используется в описании заявленного изобретения, относится в самом широком смысле ко всем клеткам, которые присутствуют в амниотической жидкости, и могут быть изъяты путем амниоцентеза. Эти клетки происходят либо из амниона, либо тканей плода, соприкасающихся с амниотической жидкостью. По морфологическому признаку, амниоциты подразделяют на три основных класса: фибробластоподобные клетки (Ф-клетки), эпителиоидные клетки (Э-клетки) и клетки амниотической жидкости (АЖ-клетки) (Hohn et al., Pediat. Res. 8: 746-754, 1974). АЖ-клетки являются доминирующим классом.

Термин «кассета экспрессии», в частности, относится к молекуле нуклеиновой кислоты и области около молекулы нуклеиновой кислоты, соответственно, содержащие регуляторный элемент или промотор с расположением впереди кодирующей области, кодирующую область и открытую рамку считывания, соответственно, а также терминирующий элемент транскрипции с расположением позади кодирующей области. Регуляторный элемент и промотор, располагаясь, соответственно, впереди кодирующей области, могут быть конститутивными, т.е., промотер, перманентно активирующий транскрипцию (например, ЦМВ промотор), или регулируемый промотор, т.е.. промотор, который можно включать и/или выключать (например, регулируемый промотор тетрациклина). Кодирующая область кассеты экспрессии может представлять собой непрерывную открытую рамку считывания, как в случае с кДНК с инициирующим кодоном в 5' конце и стоп-кодоном в 3' конце. Кодирующая область также может состоять из геномной или заново комбинированного расположения кодирующих экзонов и рассеянных некодирующих интронов. Тем не менее, кодирующая область кассеты экспрессии может состоять из нескольких открытых рамок считывания, разделенных так называемыми УВПР (участки внутренней посадки рибосомы).

Термин «постоянные линии клеток», в том смысле, в котором он используется в описании заявленного изобретения, относится к клеткам, подвергнутым генетической модификации таким образом, что они могут продолжать расти перманентно в клеточной культуре при стабильных условиях культуры. Такие клетки также получили название «иммортализованных».

Термин «полипептид» или «рекомбинантный полипептид», в том смысле, в котором он используется в описании заявленного изобретения, относится к пептидам, состоящим как минимум из 2 аминокислот. Полипептид можно модифицировать как во время, так и после трансляции, например, путем присоединения сахарных остатков или модификацией аминокислотных остатков. Полипептид может быть линейным, кольцевым или разветвленным. Более того, полипептид может состоять из более чем одной аминокислотной цепочки, причем цепи могут присоединять более или менее комплексные трехмерные структуры при помощи внутри- и/или or межмолекулярных связей (например, вторичные, третичные, четвертичные структуры). Если полипептид состоит из одной аминокислотной цепи, он может присоединять более или менее комплексные трехмерные структуры также при помощи внутримолекулярных связей. Полипептиды могут представлять собой фармакологически или иммунологически активные полипептиды или полипептиды, используемые в диагностических целях.

Термин «зародышевые клетки», в том смысле, в котором он используется в описании заявленного изобретения, относится к клеткам, которые были получены путем прямого изъятия (удаления) из организма или ткани и помещены в культуру. Зародышевые клетки имеют очень ограниченную продолжительность жизни.

Термин «продуктивные линии клеток», в том смысле, в котором он используется в описании заявленного изобретения, относится к постоянным линиям клеток, подвергнутых генетически стабильной модификации путем введения трансгена, кодирующего требуемый полипептид.

Термин «метилированный кэп» («CAP»), в том смысле, в котором он используется в описании заявленного изобретения, относится к постоянной линии амниоцитов человека, полученной путем иммортализации зародышевых амниоцитов человека с факторами гена аденовируса Е1А и Е1В.

Термин «метилированный кэп-Т» («САР-Т»), в том смысле, в котором он используется в описании заявленного изобретения, относится к CAP-клеткам, которые в дополнение были подвергнуты стабильной трансфекции с молекулой нуклеиновой кислоты, содержащей последовательность большого SV40 Т-антигена.

Термин «трансфекция», в том смысле, в котором он используется в описании заявленного изобретения, относится к любому способу, подходящему для введения упомянутой нуклеиновой кислоты (кислот) в клетки. В качестве примеров традиционного практического применения (в т.ч., в сочетании) можно привести способ кальциево-фосфатный, электропорацию, липосомальные системы различных типов.

Термин «транзиентная экспрессия», в том смысле, в котором он используется в описании заявленного изобретения, относится к любому способу, при котором нуклеиновую кислоту (кислоты) вводят в клетку путем трансфекции без выбора (селекции) стабильных линий клеток при помощи приемлемого метода выбора, причем упомянутые стабильные линии клеток можно впоследствии постоянно культивировать в клеточной среде.

Термин «стабильная экспрессия», в том смысле, в котором он используется в описании заявленного изобретения, относится к экспрессии трансгена в продуктивных линиях клеток.

Термин «трансген», в том смысле, в котором он используется в описании заявленного изобретения, относится к последовательности нуклеиновой кислоты, кодирующей рекомбинантный полипептид.

Объект заявленного изобретения относится к способу получения постоянной линии клеток человека, который включает следующие этапы:

а) трансфекцию зародышевых клеток-амниоцитов человека с молекулой нуклеиновой кислоты, содержащей последовательность нуклеиновой кислоты, кодирующую функции генов аденовирусов Е1А и Е1В; так называемая 1. трансфекция, и

б) последующую трансфекцию постоянной линии клеток-амниоцитов человека, полученной в этапе а), с молекулой нуклеиновой кислоты, содержащей последовательность нуклеиновой кислоты, кодирующую большой SV40 Т-антиген, так называемая 2. трансфекция.

Более предпочтительно, упомянутая молекула нуклеиновой кислоты в этапе б) способа получения постоянной линии клеток человека в соответствии с заявленным изобретением содержит последовательность нуклеиновой кислоты, кодирующей несекретирующую форму большого SV40 Т-антигена.

В течение этапа трансфекции б) способа в соответствии с заявленным изобретением, постоянную линию клеток человека подвергают альтернативной трансфекции с молекулой нуклеиновой кислоты, содержащей последовательность нуклеиновой кислоты, кодирующую ядерный антиген 1 (EBNA-1) вируса Эпштейна-Барра (ВЭБ), так называемая 2. трансфекция. Более предпочтительно, упомянутая молекула нуклеиновой кислоты включает последовательность нуклеиновой кислоты, кодирующую несекретирующую форму ядерного антигена 1 (EBNA-1) вируса Эпштейна-Барра (ВЭБ).

Путем трансфекции, осуществляемой в соответствии со способом согласно заявленному изобретению, упомянутые зародышевые клетки человека более предпочтительно стабильно трансфицируют, т.е. трансфицированную ДНК интегрируют (встраивают) в геном клетки. Клетки иммортализуют путем трансфекции упомянутых зародышевых клеток человека с молекулой нуклеиновой кислоты, содержащей последовательности нуклеиновых кислот, кодирующие Е1А и Е1В. Молекула нуклеиновой кислоты, используемая для иммортализации упомянутых зародышевых клеток человека, содержит последовательности нуклеиновых кислот для Е1А и Е1В, более предпочтительно получаемые из аденовирусов человека, в частности, серотипа 5 человеческого аденовируса. В более предпочтительном варианте практического воплощения заявленного изобретения, молекула нуклеиновой кислоты, используемая для иммортализации, содержит последовательность нуклеиновой кислоты, кодирующую фактор (функцию) pIX гена аденовируса, в дополнение к последовательностям нуклеиновых кислот, кодирующих Е1А и Е1В. Полипептид pIX, вирусный структурный белок, выполняет роль транскрипционного активатора на различных вирусных и клеточных промоторах, как, например, тимидинкиназа и промотор бета-глобина. Типовую последовательность можно найти в GenBank асе. no. X02996. В частности, молекулы нуклеиновых кислот содержат нуклеотиды с 1 по 4344 (SEQ ID NO:1 содержит последовательности нуклеиновых кислот, кодирующие Е1А, Е1В и pIX), с 505 по 3522 (SEQ ID NO:2 содержит последовательности нуклеиновых кислот, кодирующие Е1А и Е1В) или нуклеотиды с 505 по 4079 (SEQ ID NO:3 последовательности нуклеиновых кислот, кодирующие Е1А, Е1В and pIX) серотипа 5 аденовируса человека.

В частности, клетки человека трансфицируют (трансфектируют) с последовательностями нуклеиновых кислот, кодирующими требуемый генный фактор (функцию гена), который необходимо экспрессировать, в форме кассеты экспрессии. Упомянутая кассета экспрессии содержит молекулу нуклеиновой кислоты, содержащую регуляторный элемент или промотор, располагаемый впереди кодирующей области, кодирующую область и открытую рамку считывания, соответственно, а также терминирующий элемент транскрипции, расположенный позади кодирующей области.

В частности, в одном из вариантов практического воплощения заявленного изобретения, кассета экспрессии или молекула нуклеиновой кислоты содержит последовательность нуклеиновой кислоты для большого SV40 Т-антигена (SEQ ID NO: 4), последовательность нуклеиновой кислоты для промотора, выбираемого из групп ЦМВ промотора (SEQ ID NO:5), ЦАГ промотора (Niwa et al., Gene 108: 193-199, 1991) и ВСР промотора (GenBank acc. no. DQ075935), последовательность для SV40 SD/SA (интрон) (SEQ ID NO:6) и последовательность нуклеиновой кислоты для SV40 polyA (SEQ ID NO:7).

В еще одном из вариантов практического воплощения заявленного изобретения, кассета экспрессии или молекула нуклеиновой кислоты содержит, в частности, последовательность нуклеиновой кислоты для ядерного антигена 1 (EBNA-1) вируса Эпштейна-Барра (ВЭБ) (SEQ ID NO:8), последовательность нуклеиновой кислоты для промотора, выбираемого из группы ЦМВ промотора (SEQ ID NO:5), ЦАГ промотора (Niwa et al., Gene 108: 193-199, 1991) и ВСР промотора (GenBank асе. по. DQ075935), последовательность нуклеиновой кислоты для SV40 SD/SA (интрон) (SEQ ID NO:6) и последовательность нуклеиновой кислоты для SV40 polyA (SEQ ID NO:7).

Зародышевые клетки человека получают путем прямого изъятия (удаления) из организма или ткани, изъятой из организма и помещенной в культуральную среду. Более предпочтительными являются такие зародышевые клетки организма, которые можно эффективно превратить в постоянные линии клеток человека путем экспрессии аденовирусных Е1А и Е1В, в частности, например, клетки-амниоциты, клетки сетчатки эмбрионов и эмбрионные клетки нейронного происхождения.

Более предпочтительно, постоянные линии клеток-амниоцитов человека получают согласно способу в соответствии с заявленным изобретением.

Способ в соответствии с заявленным изобретением также можно осуществить с использованием традиционных иммортализованных линий клеток вместо этапа а), в частности, с уже имеющимимся иммортализованными линиями клеток-амниоцитов человека, с последовательностями нуклеиновых кислот для функций генов аденовирусов Е1А и Е1В в своем геноме. Более предпочтительно, иммортализованные линии клеток содержат последовательности нуклеиновых кислот для функций генов аденовирусов Е1А, Е1В и pIX в своем геноме. Уже существующие иммортализованные линии клеток человека, в частности, иммортализованные линии клеток-амниоцитов человека, трансфицируют по мере надобности с вышеупомянутой молекулой нуклеиновой кислоты, содержащей кассету экспрессии, кодирующую большой SV40 Т-антиген или ядерный антиген 1 (EBNA-1) вируса Эпштейна-Барра (ВЭБ). Специалисту в данной области техники понятно, что 2. трансфекция, относительно временного параметра, зависит от 1. трансфекции зародышевой клетки человека только в том, что ее необходимо осуществить после 1. трансфекции. Не является обязательным тот факт, что 2. трансфекция проводится синхронно после 1. трансфекции. Так, например, также иммортализованные линии клеток человека, подвергнутые иммортализации с Е1А и/или Е1В и стабилизированные по истечении нескольких лет, можно трансфицировать по мере надобности с вышеупомянутой молекулой нуклеиновой кислоты в этапе 2. трансфекции. Более предпочтительно, с данной целью используют иммортализованные клетки-амниоциты человека, иммортализованные клетки сетчатки эмбриона человека, в частности клетки PER.C6, или иммортализованные клетки человеческого эмбриона нейронного происхождения, в частности, клетки НЕК 293.

Объект заявленного изобретения относится к постоянной линии клеток человека, содержащей последовательность нуклеиновой кислоты для функций генов аденовирусов Е1А и Е1В и последовательность нуклеиновой кислоты для большого SV40 Т-антигена или ядерного антигена 1 (EBNA-1) вируса Эпштейна-Барра (ВЭБ). Предпочтительно, заявленное изобретение относится к постоянной линии клеток человека, содержащей последовательность нуклеиновой кислоты для функций генов аденовирусов Е1А, Е1В и pIX и последовательность нуклеиновой кислоты для большого SV40 Т-антигена или ядерного антигена 1 (EBNA-1) вируса Эпштейна-Барра (ВЭБ). Более предпочтительно, заявленное изобретение относится к постоянной линии клеток-амниоцитов человека, содержащей последовательности нуклеиновых кислот для функций генов аденовирусов Е1А и Е1В и последовательности нуклеиновых кислот для большого SV40 Т-антигена или ядерного антигена 1 (EBNA-1) вируса Эпштейна-Барра (ВЭБ). Наиболее предпочтительно, заявленное изобретение относится к постоянной линии клеток-амниоцитов человека, содержащей последовательность нуклеиновой кислоты для функций генов аденовирусов Е1А, Е1В и pIX и последовательность нуклеиновой кислоты для большого SV40 Т-антигена или ядерного антигена 1 (EBNA-1) вируса Эпштейна-Барра (ВЭБ).

В частности, также, объект заявленного изобретения относится к постоянной линии клеток человека, предпочтительно, постоянной линии клеток-амниоцитов человека, полученной с применением способа в соответствии с заявленным изобретением.

Кроме того, объект заявленного изобретения относится к способу транзиентной экспрессии рекомбинантных полипептидов или белков, с применением постоянной линии клеток человека в соответствии с заявленным изобретением, причем упомянутый способ включает следующие этапы:

а) трансфекцию упомянутой постоянной линии клеток человека с молекулой нуклеиновой кислоты, содержащей последовательность нуклеиновой кислоты, кодирующую требуемый рекомбинантный полипептид или белок, и сайт рестрикции (распознавания) или связывания для большого SV40 Т-антигена или ядерного антигена 1 (EBNA-1) вируса Эпштейна-Барра (ВЭБ),

б) культивирование трансфицированной постоянной линии клеток человека, полученной в этапе а) при условиях, позволяющих осуществлять экспрессию упомянутых требуемых рекомбинантных полипептида или белка, и, последующий этап

в) изолирования упомянутых требуемых рекомбинантных полипептида или белка от клеток или от супернатанта культуры.

Предпочтительный вариант практического воплощения заявленного изобретения относится к способу транзиентной экспрессии рекомбинантных полипептидов или белков, с применением постоянной линии клеток-амниоцитов человека в соответствии с заявленным изобретением, причем упомянутый способ включает следующие этапы:

а) трансфекцию упомянутой постоянной линии клеток-амниоцитов человека с молекулой нуклеиновой кислоты, содержащей последовательность нуклеиновой кислоты, кодирующую требуемый рекомбинантный полипептид или белок, и сайт рестрикции (распознавания) или связывания для большого SV40 Т-антигена или ядерного антигена 1 (EBNA-1) вируса Эпштейна-Барра (ВЭБ),

б) культивирование трансфицированной постоянной линии клеток-амниоцитов человека, полученной в этапе а) при условиях, позволяющих осуществлять экспрессию упомянутых требуемых рекомбинантных полипептида или белка, и, последующий этап

в) изолирования упомянутых требуемых рекомбинантных полипептида или белка от клеток или от супернатанта культуры.

В случае, если постоянная линия клеток человека в соответствии с заявленным изобретением содержит молекулу нуклеиновой кислоты, содержащую последовательность нуклеиновой кислоты, кодирующую большой SV40 Т-антиген, линию клеток, к примеру, трансфицируют с плазмидой экспрессии, включающим кассету экспрессии или молекулу нуклеиновой кислоты, содержащую последовательность нуклеиновой кислоты, кодирующую экспрессируемый трансген и точку начала репликации SV40 (SV40 ori). Большой SV40 Т-антиген, после стабильной внутриклеточной экспрессии в линии клеток, связывается с точкой начала репликации SV40 плазмиды экспрессии, вводимого путем трансфекции в линию клеток, и вызывает эписомальную репликацию плазмиды экспрессии, и, таким образом, осуществляют амплификацию числа копий экспрессируемого трансгена. Требуемый генный продукт, кодируемый трансгеном, можно получить из клеток или из супернатанта культуры, после культивирования клеток в течение нескольких дней. Таким образом, транзиентно экспрессируют упомянутый трансген.

В случае, если постоянная линия клеток человека в соответствии с заявленным изобретением содержит молекулу нуклеиновой кислоты, содержащую последовательность нуклеиновой кислоты, кодирующую ядерный антиген 1 (EBNA-1) вируса Эпштейна-Барра (ВЭБ), линию клеток, к примеру, трансфицируют с плазмидой экспрессии, включающим кассету экспрессии или молекулу нуклеиновой кислоты, содержащую последовательность нуклеиновой кислоты, кодирующую экспрессируемый трансген и точку начала репликации ВЭБ (EBV oriP) (Durocher et al., Nucleic Acids Research Vol.30 Nr. 2 e9, 2002; Tuvesson et al. Cytotechnology 56: 123-136, 2008). EBNA-1 ВЭБ, после стабильной внутриклеточной экспрессии в линии клеток, связывается с точкой начала репликации oriP плазмиды экспрессии, вводимого путем трансфекции в линию клеток, и вызывает эписомальную репликацию плазмиды экспрессии, и, таким образом, осуществляют амплификацию числа копий экспрессируемого трансгена. Требуемый генный продукт, кодируемый трансгеном, можно получить из клеток или из супернатанта культуры, после культивирования клеток в течение нескольких дней. Таким образом, транзиентно экспрессируют упомянутый трансген.

Клетки, в соответствии с заявленным изобретением, можно культивировать при стандартных условиях культивирования эукариотных клеток при температуре примерно 37°С, влажности 95% и присутствии 8% CO2. Клетки, в соответствии с заявленным изобретением, можно культивировать в среде, содержащей сыворотку или в бессывороточной среде, в адгезивной или суспензионной культурах. Культивирование в суспензионной культуре может происходить в разнотиповых ферментационных чанах, например, в реакционных аппаратах с мешалкой, колебательных аппаратах, вибрационных или вращающихся (с постоянным перемешиванием) установках (шейкерах) или в так называемых вращающихся (роллерных) флаконах. Таким образом, с упомянутыми клетками становится возможным получать серии увеличенного масштаба, вплоть до внедрения в массовое производство. Трансфекцию клеток для транзиентной экспрессии можно осуществлять при помощи различных вышеупомянутых способов трансфекции. Трансфекцию и транзиентную экспрессию можно проводить при помощи матрицы и скрининга высокой производительности, соответственно, например, в 96- или 384-луночной матрице.

Т-антиген SV 40 (SV40) представляет собой многофункциональный фосфопротеин, контролирующий как вирусную репликацию, так и клеточные функции после инфекции. Т-антиген является трансформирующим агентом и встраивается в клеточный цикл путем взаимодействия с белком-супрессором опухолевого роста р53. Во время репликации вирусного генома, присутствие Т-антигена необходимо в той же степени, что и ДНК-геликаза для предотвращения двухцепочечного генома. Т-антиген является единственным вирусным белком, необходимым для репликации. Прочие функции выполняются клеточными белками. В первом этапе ДНК-репликации, 12 молекул Т-антигена прикрепляется к точке начала репликации ДНК (on) в геноме SV40 как двойные гексамеры. Далее, необходимые клеточные белки, такие, как ДНК-полимераза, связываются с упомянутым геликазным комплексом и реплицируют ДНК. Так называемая «минимальная точка начала репликации» состоит из коровой (сердцевинной) последовательности длиной 63 пары нуклеотидных оснований. В транзиентной трансфекции клеточных плазмид в клетку-мишень не происходит интеграции в геном-хозяин, результатом чего является тот факт, что плазмидная концентрация неуклонно понижается после деления клеток, а экспрессия генома, лежащего на кодирующей плазмиде, носит сугубо временный характер. Введение SV40 ori-фрагмента в плазмиду экспрессии и экспрессия SV40 Т-антигена в продуктивной линии клеток приводит к появлению повышенного числа плазмид и, соответственно, увеличению эффективности экспрессии.

В сравнении с другими способами, способ транзиентной экспрессии полипептидов и белков в соответствии с заявленным изобретением обладает преимуществом, заключающимся в том, что упомянутый способ более эффективен по количественным и качественным показателям рекомбинантного генного продукта, и, соответственно, менее затратой при промышленной разработке и производстве терапевтических препаратов на основе белков. В частности, преимуществом является высокоэффективная система транзиентной экспрессии на основе линии клеток человека, которая, во-первых, аутентично модифицирует посттрансляционные белки человека, по сравнению с клетками млекопитающих-животных и клетками не-млекопитающих, а, во-вторых, обладает сравнительно более приемлемыми параметрами для получения стабильных продуктивных линий клеток в масштабе промышленного производства. Таким образом, представляется возможным гарантировать, что во время разработки диагностических и терапевтических продуктов, качественные характеристики генного продукта после транзиентной экспрессии на начальном этапе НИР и после стабильной экспрессии в постоянных продуктивных линиях клеток на поздней стадии разработки и промышленного производства, показывают наибольшую возможную идентичность, в частности, что касается различий в параметрах, которые могут быть вызваны природными свойствами клеточных систем.

Еще одним преимуществом заявленного изобретения является то, что постоянные линии клеток согласно заявленному изобретению показывают высокие значения выхода транзиентной экспрессии. Так, к примеру, на удивление очень высокие значения выхода продуктивности, до 60 мг/литр, были получены в супернатанте культуры в транзиентной экспрессии в линиях клеток-амниоцитов, производящих SV40 Т-антиген после трансфекции с плазмидным вектором, в дополнение к последовательности, кодирующей требуемый генный продукт, имеющим точку начала репликации SV40 (SV40 ori). Упомянутые значения выхода продуктивности более чем в 70 раз выше значений, полученных в транзиентной экспрессии в линиях клеток-амниоцитов, не экспрессирующих Т-антиген.

Еще одним преимуществом упомянутой линии клеток человека согласно заявленному изобретению является получение такой линии клеток человека, предпочтительно, на основе иммортализованных клеток-амниоцитов, которая стабильна как для транзиентной экспрессии белков, так и для экспрессии белков в постоянных продуктивных линиях клеток (Schiedner et al., BMC Biotechnology 8, 13, 2008). В сравнении с применением различных систем клеток для транзиентной экспрессии (например, варианты НЕК293 или НЕК293) и стабильной экспрессии (например, СНО), минимизируется риск того, что структурные и функциональные параметры продуктов экспрессии транзиентного и стабильного воспроизводства различны, в случае, если упомянутые структурные и функциональные свойства основаны на природных характеристиках системы экспрессии. Таким образом, улучшается планирование процесса разработки, а сам процесс менее затратен и более эффективен по времени и финансовым вложениям.

Последовательности нуклеиновых кислот для экспрессии как минимум одного рекомбинантного полипептида заключены в как минимум одной кассете экспрессии. Упомянутые кассеты экспрессии содержат промоторы и последовательности транскрипционных стоп-кодонов. В качестве промоторов могут, к примеру, выступать промотор ЦМВ (цитомегаловирус) (Makrides, 9-26 in: Makrides (Hrsg.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003), промотор EF-1α (Kim et al., Gene 91: 217-223, 1990), промотор ЦАГ (гибридный промотор предраннего энхансера человеческго цитомегаловируса и модифицированного куриного D-активного промотора с первым интроном) (Niwa et al., Gene 108: 193-199, 1991), промотор человеческой или мышиной pgk (фосфоглицераткиназа) (Adra et al., Gene 60: 65-74, 1987), промотор ВСР (вирус саркомы Рауса) (Makrides, 9-26 in: Makrides (Hrsg.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003) или промотор SV40 (вирус обезьяны 40) (Makrides, 9-26 in: Makrides (Hrsg.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003). Последовательности полиаденилирования большого SV40 Т-антигена (GenBank асе. no. J02400) или человеческого G-CSF (granulocyte colony stimulating factor) гена (Mizushima und Nagata, Nucl. Acids Res. 18: 5322, 1990) могут выбирать в качестве сайтов полиаденилирования.

Еще одним объектом заявленного изобретения является полипептид или белок, полученные при помощи способа в соответствии с заявленным изобретением.

Рекомбинантным полипептидом, полученным при помощи способа в соответствии с заявленным изобретением, может являться терапевтический белок, как, например, человеческий альфа-1-антитрипсин или факторы роста, как, например, эритропоэтин или интерлейкин-2. Человеческий альфа-1-антитрипсин (чАТ) представляет собой ингибитор протеиназы, который ингибирует элактазу и другие протеиназы и который терапевтически активен в случае наследственного дефицита чАТ, приводящего к тяжелым поражениям легких и печени. Эритропоэтин является важным фактором роста для эритроцитов (красные кровяные тельца), который обладает кроветворной функцией и применяется у пациентов с анемией и в период после пересадки органов. Интерлейкин-2 (Ил-2) является клеточным мессенджером иммунной системы, играющим огромной важности роль в активации иммунного ответа клеток, например, у пациентов со злокачественными опухолями. Факторы свертываемости крови, как, например, фактор VIII и IX, применяемые у пациентов с гемофилией (нарушения механизма свертывания крови), также относятся к терапевтически активным полипептидам. Рекомбинантный полипептид, полученный при помощи способа в соответствии с заявленным изобретением, может представлять собой гормон. Гормоны, полученные методами биотехнологий, применяют в качестве заместительной терапии у пациентов с гормональными заболеваниями. Примерами служат гормон инсулин, понижающий уровень сахара в крови, применяемый у пациентов с инсулинозависимой формой диабета, соматотропин (гормон роста) для лечения карликовости, и гонадотропные факторы, как, например, гормон роста фолликулов (ГРФ) или лютеинизирующий гормон (ЛГ) для коррекции нарушений репродуктивной функции. Кроме того, рекомбинантный полипептид может представлять собой прочие энзим-модифицирующие посттрансляционные рекомбинантные полипептиды, экспрессируемые внутриклеточно либо в супернатанте культуры, синхронно в, например, энзиме, участвующем в гликолизировании. Генные продукты Е1А, Е1В и pIX, экспрессируемые в постоянной линии клеток человека в соответствии с заявленным изобретением, а также большой SV40 Т-антиген и ядерный антиген 1 (EBNA-1) вируса Эпштейна-Барра (ВЭБ) не относятся к желательным для получения полипептидам.

Рекомбинантным полипептидом, полученным при помощи способа в соответствии с заявленным изобретением, может являться рекомбинантное антитело, применяемое в терапевтических или диагностических целях. Антитела к фактору некроза опухолей альфа (ФНО-α) применяют у пациентов с ревматоидным артиритом, антитела к клеточному рецептору эпидермального фактора роста (EGFR) применяют у пациентов со злокачественными новообразованиями. Антитела, применяемые с диагностическими целями, могут представлять собой компоненты диагностических наборов, основанные на таких методах, как ферментный иммуносорбентный анализ (ELISA) или радио-иммуносорбентный анализ (RIA). В упомянутых тестах-анализах, антитела выполняют функцию обнаружения антигенов инфекционных агентов, таких, как, например, вирус гепатита В человека.

Антитела или иммуноглобулины (Иг) состоят из тяжелых и легких цепей, каждая из которых содержит вариабельные и константные области или домены. Последовательности нуклеиновых кислот для трансфицируемых молекул нуклеиновых кислот для экспрессии антител могут содержать две раздельных кассеты экспрессии, одна из которых кодирует легкую цепь, а другая кодирует тяжелую цепь молекулы иммуноглобулина. После экспрессии обеих цепей в клетке, согласно способу в соответствии с заявленным изобретением, данные цепи организуются в форме молекулы активного антитела. Кассеты экспрессии обеих цепей могут присутствовать на раздельных, или на одной и той же молекуле нуклеиновой кислоты. Кодирующие последовательности для легкой и тяжелой цепей могут, тем не менее, присутствовать внутри одной и той же кассеты экспрессии и разделяться последовательностью IRES (участок внутренней посадки рибосомы), представляя возможность осуществления экспрессии как для тяжелой, так и для легкой цепи. Кодирующие последовательности для легкой и тяжелой цепей могут, в принципе, присутствовать внутри одной и той же кассеты экспрессии и разделяться последовательностью, кодирующей сайт ферментативного расщепления протеиназы (например, тромбин), который одновременно экспрессируют внутри клетки и который расщепляет полипептид-предшественник, содержащий последовательность легкой и тяжелой цепей, на активные легкую и тяжелую цепи.

Рекомбинантные антитела, кодируемые последовательностью нуклеиновой кислоты клетки в соответствии с заявленным изобретением, могут также состоять из фрагментов антитела, вместо полной легкой и тяжелой цепи. Так называемые одноцепочечные антитела (scFv, одноцепочечные вариабельные фрагменты) состоят из вариабельных доменов тяжелой и легкой цепей, связываемых аминокислотной последовательностью (так называемым линкером), что дает свободную подвижность обоим доменам. Антиген-связывающая структура образуется за счет межмолекулярной сборки обоих доменов, чья структура соответствует вариабельной области молекулы иммуноглобулина. Биспецифические одноцепочечные антитела (bis-scFv) состоят из двух таких одноцепочечных сборок, образованных вариабельными доменами тяжелой и легкой цепи, которые, в свою очередь, связываются соединительной последовательностью и подвижны относительно друг друга; такие молекулы могут синхронно связываться с двумя антиген-связывающими сайтами (эпитопы), соединяя таким образом две молекулярные структуры за счет нековалентных связей. Биспецифические диатела состоят из двух одиночных цепей, которые экспрессируют отдельно и каждый состоит из вариабельных доменов легкой и тяжелой цепи, разделенных всего лишь весьма коротким линкером или вообще без линкера. Короткий или отсутствующий линкер ингибирует межмолекулярную сборку; за счет межмолекулярной сборки вариабельного тяжелого и легкого домена, заново образуется активная молекула с двумя связывающими валентностями.

Рекомбинантный полипептид, кодируемый молекулой нуклеиновой кислоты, трансфицируемой согласно способу в соответствии с заявленным изобретением, может представлять собой вирусный, бактериальный или паразитарный белок, который требуется производить для применения в качестве профилактической или лечебной вакцины. Поэтому, данный белок может быть как структурным полипептидом, так и регуляторно или энзиматически активным полипептидом вирусного, бактериального или паразитарного происхождения. Вирусные белки могут представлять собой, например, антиген клеточной мембраны вируса гепатита В (HBV) или структурный белок L1, полученный из вирусов папилломы человека. Бактериальный белок, который можно рассматривать как исходный материал для получения вакцин после экспрессии в получении продуктивных линий клеток, представляет собой, например, субъединицы энтеротоксинов, полученные из энтеротоксиногенной Escherichia coli (ETEC) или трансферрин-связывающие белки (ТСБ А и В), полученные из Neisseria gonorrhoeae. Полипептид паразитарного происхождения, который можно кодировать молекулами нуклеиновой кислоты, трансфицированными согласно заявленному способу, например, поверхностный белок мерозоитного происхождения (MSP) или возбудитель малярии Plasmodium falciparum или глутатион-С-трансфераза (ГСТ) из Schistosomajaponicum.

Рекомбинантный полипептид, кодируемый молекулой нуклеиновой кислоты, трансфицируемой согласно способу в соответствии с заявленным изобретением, может представлять собой также вирусный белок, применение которого позволяет осуществлять производство векторов передачи рекомбинантных вирусных генов внутри линий клеток. Данный вирусный белок, также именуемый фактором комплементации, экспрессируют внутри линии клеток и представляет собой энзиматический или структурный компонент, необходимый для получения векторов передачи генов, компонент которых не кодируется на молекуле нуклеиновой кислоты вектора передачи генов. В таких векторах передачи генов, определенные функции вирусных генов обычно подвергают делеции вследствие соображений безопасности. Векторы переноса генов, чьи факторы комплементации можно кодировать трансгеном, введенным согласно заявленному способу, представляют собой, например, векторы, основанные на аденовирусе, ассоциированном с аденовирусом вирусе (AAV), ретровирусе (лейковирусе), лентивирусе или вирусе герпеса. Фактор комплементации, экспрессируемый внутри линии клеток, также может комплементировать делегированные или рекомбинантные вирусы во время их получения, чьи вирусы не содержат трансфицируемый ген и, в связи с этим, не выполняют функции вектора передачи генов, но применяются, например, в качестве вакцины.

Полипептид, транзиентно экспрессируемый согласно заявленному способу, может также представлять собой рецепторный полипептид, который в частности расположен на поверхности клетки и который ответственен за инфицирование клетки вирусом и трансфекцию клетки при помощи вектора передачи вирусного гена, соответственно. В качестве вирусного рецептора на начальном этапе инфицирования клеток серотипом 2 или 5 аденовируса, из которого выделяют наиболее часто применяемые аденовирусные векторы, был выделен (определен) так называемый рецептор вируса Коксаки и аденовируса, CAR (Bergelson et al., Science 275: 1320-1323, 1997). Необходимым предварительным условием достаточной (удовлетворительной) экспрессии CAR на поверхности является то, что клетка отвечает требуемым параметрам для векторов переноса генов аденовирусов. В более предпочтительном варианте практического воплощения заявленного изобретения, рекомбинантный полипептид представляет собой рецептор вируса Коксаки и аденовируса (CAR). Избыточная экспрессия полипептида рецептора может значительно повысить инфицируемость и, таким образом, также эффективность продуктивности данных клеток касательно векторов аденовирусов. Более того, молекула нуклеиновой кислоты может кодировать, помимо CAR, вторичные сенсорные рецепторы или рецепторы интернализирующего типа, как, например, определенные интегрины, которые опосредуют поглощение вируса и вектор передачи генов, соответственно в клетку, и избыточная экспрессия которых является преимуществом в получении клеток для аденовирусных векторов.

Описанный выше способ может также применяться, помимо прочего, в производстве терапевтических полипептидов, факторов свертываемости крови и факторов роста, гормонов и антител, а также вирусных, бактериальных и паразитарных полипептидов для применения в качестве вакцин. Более того, клетки в соответствии с заявленным изобретением можно применять в производстве диагностических белков, как, например, вирусные, бактериальные или паразитарные антигены или соответствующие специфические антитела. Кроме того, клетки в соответствии с заявленным изобретением можно применять в производстве технических или промышленных белков, как, например, энзимы для катализа процессов технического синтеза или для расщепления вредных субстанций. Клетки в соответствии с заявленным изобретением могут экспрессировать один или несколько различных рекомбинантных полипептидов. Число экспрессируемых полипептидов зависит от того, сколько различных последовательностей нуклеиновых кислот, кодирующих рекомбинантные полипептиды, транзиентно трансфицируют в клетки при помощи способа в соответствии с заявленным изобретением.

Более того, заявленное изобретение относится к применению постоянных линий клеток человека, в частности, постоянных линий клеток-амниоцитов человека, получаемых при помощи заявленного способа получения полипептидов или белков.

Следующие примеры иллюстрируют заявленное изобретение и не носят ограничительного характера относительно сути заявленного изобретения. Если не указано иначе, используют стандартные методы молекулярного исследования, как, например, описано Sambrook et al., 1989, Molecular cloning: A Laboratory Manual, 2. Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

1. Клонирование

а. Плазмиды для трансформации зародышевых амниоцитов: р8ТК146, pGS119, pGS122

Плазмида pSTK146 детально описана в ЕР 1230354 В1 и состоит из промотора мышиной фосфоглицераткиназы (ФГК), нуклеотидных (nt.) последовательностей с 505 по 3522 5 аденовируса 5 (Ad5) и сигнала полиаденилирования и сплайсинга SV40. Аденовирусные последовательности в pSTK146 включают область, кодирующую Е1А и Е1В, причем экспрессия Е1А регулируется ФГК-промотором.

Плазмида pGS119 детально описана в WO 2007/056994 и состоит из промотора мышиной фосфоглицераткиназы (ФГК), Ad5 последовательностей nt. 505-3522 (включая область Е1А и Е1В), сигнала полиаденилирования и сплайсинга SV40, с последующей областью pIX Ad5 nt. 3485-4079.

Плазмида pGS122 детально описана в WO 2007/056994 и состоит из аденовирусных последовательностей nt. 1-4344, содержащих области Е1А, Е1В и pIX, включая соответствующий регуляторный промотор и последовательности полиаденилирования. Аденовирусные последовательности в pGS122 фланкируются сайтами рестрикции Pmel.

б. Плазмиды экспрессии для Т-антигена: pGS158, pGS159, pGS161

Плазмиды pGS158, pGS159 и pGS161 содержат кассету экспрессии для Т-антигена SV40 (SEQ ID NO:4), фланкированную интроном SV40 (SEQ ID NO:6) и сайтом полиаденилирования (SEQ ID NO:7). Дополнительно, pGS158 содержит промотор ЦАГ (гибридный промотор, состоящий из ЦМВ энхансера и β-активного промотора) (Niwa et al., Gene 108: 193-199, 1991), pGS159 содержит промотор ВСР (промотор вируса саркомы Рауса) (GenBank acc. no. DQ075935) а pGS161 - промотор ЦМВ (ранний промотор человеческого цитомегаловируса) (SEQ ID NO:5). Для генерации плазмид стабильных линий клеток pGS158, pGS159 и pGS161 содержат кассету экспрессии бластицидина с промотором убиквитина (pUB/Bsd, Invitrogen #V512-20).

В первом этапе, фрагмент 2.6 KB, содержащий последовательность, кодирующую Т-антиген, ввели в плазмиду pGSHO. Плазмида pGS140 содержит промотор ЦМВ человека (SEQ ID NO:5), область интрона SV40 с донором сплайсинга/сайтом акцептора сплайсинга (SEQ ID NO:6), сингулярный (отдельный) NotI сайт рестрикции и последовательность PolyA SV40 (SEQ ID NO:7). Для введения Т-антигена, линеаризовали фрагмент pGS140 с NotI, («липкий») конец 5' заполнили (закрыли) и окружили лигандами с изолированным фрагментом. Плазмиду, полученную данным методом, назвали pGS149.

Плазмиду pGS158 pGS149 расщепили при помощи XbaI и прим 3 KB фрагментом, содержащим интронную последовательность, Т-антиген и изолировали последовательность PolyA. Данный фрагмент ввели в сайт рестрикции NotI (заполненный «липкий» конец 5') pGS152. Ввели pGS152 инсерцией фрагмента промотора ЦАГ размером 1.1 KB (Niwa et al., Gene 108: 193-199, 1991) в сайт рестрикции EcoRV pUB/Bsd.

Для плазмиды pGS159, фрагмент XbaI размером ЗКВ, содержащий Т-антиген, ввели pGS149 в заполненный сайт рестрикции NotI pGS153. pGS153 содержит фрагмент промотора ВСР размером примерно 0,6 KB, введенный в сайт рестрикции EcoRV pUB/Bsd.

Для плазмиды pGS161, расщепили pGS149 на SphI, заполнили «липкие» концы 3' и фрагмент 3,6 KB, содержащий промотор ЦМВ, интрон SV40, изолировали последовательность Т-антигена и PolyA и ввели в сайт рестрикции EcoRV pUB/Bsd.

в. Плазмиды экспрессии для hAAT: pGS116, pGS1S1

Плазмида pGS116 описана детально в ЕР 1948789 и содержит промотор ЦМВ человека, с последующими SV40 донором сплайсинга/сайтом акцептора сплайсинга, hAAT-cDNA (SEQ ID NO:12) и сайтом полиаденилирования SV40.

Плазмида pGS151 (Фиг.2б) содержит упомянутую кассету экспрессии hAAT и точку репликации ДНК (on) SV40. При помощи ДНК SV40 и точками начала репликации праймеров primer ori I (CCGGAATTCTTTGCAAAAGCCTAGGCCTC) (SEQ ID NO:9) и ori 2 (CCGGAATTCTGAGGCGGAAAGAACCAGCT) (SEQ ID NO:10) последовательности SV40 амплифицировали путем цепной реакции полимеризации (PCR), расщепили с EcoRI (каждый из рестрикционных сайтов EcoRI, локализованных на праймере) и ввели в сайт рестрикции EcoRI pGS116.

г. Плазмиды экспрессии для Еро: pGS177

Плазмида pGS127 описана детально в ЕР 1948789 и содержит промотор ЦМВ человека, с последующими SV40 донором сплайсинга/сайтом акцептора сплайсинга, cDNA эритропоэтин человека (Еро) и сайт полиаденилирования SV40.

Для плазмиды pGS177, фрагмент точки начала репликации SV40 амплифицировали в соответствии с вышеописанным способом, с праймерами ori 1 и ori 2 и ввели в pGS127.

2. Верификация конструкций

а. Анализ последовательностей (секвенирование)

Полноту (завершенность) всех вышеописанных плазмид протестировали при помощи рестрикционного картирования. Кроме этого, корректность последовательности и ориентацию фрагментов SV40 ori в pGS151 и pGS177 подтвердили секвенированием. Аденовирусные последовательности в pSTK.146, pGS119 и pGS122 определили секвенированием и их полное совпадение подтвердили геном дикого (немутантного) типа Ad5.

б. Тестирование на транзиентную экспрессию

Плазмиды р8ТК146, pGS119 и pGS122 трансфицировали в клетки HeLa и проанализировали экспрессию белков Е1А и Е1В при помощи метода Вестерн-блоттинга с использованием моноклональных антител (Merck Bioscience). Плазмиды pGS158, pGS159, pGS161 трансфицировали в клетки НЕК293 и установили факт экспрессии Т-антигена при помощи метода Вестерн-блоттинга с использованием моноклонального антитела (Abeam, Cambridge, UK). Плазмиды pGS116 и pGS151 трансфицировали в клетки CAP, а экспрессию и секрецию альфа-1-антитрипсина (чАТ) в супернатанте культуры установили при помощи энзим связанного иммуносорбентного метода исследования ELISA (см.6).

Аналогичным образом, трансфицировали в клетки CAP плазмиды pGS127 и pGS177, а экспрессию эритропоэтина человека Еро установили при помощи энзим связанного иммуносорбентного метода исследования ELISA (см.6).

3. Культивирование клеток

а. Линии клеток

Трансформированные клетки-амниоциты (CAP и САР-Т) культивировали в среде 293SFMII (Invitrogen #11686-029), 0.5% антигрибковый/антимикробный (Invitrogen #15240-062), 4 ммоль L-глутамина (Invitrogen #25030-024) при 37°С, влажности 95%, 8% CO2. Культуральная среда клеток САР-Т дополнительно содержала 5 мкг/мл бластидина (Invitrogen # R210-01). Клетки подвергли традиционному посеву с начальной плотностью 2-4×105 клеток/мл в объеме 12 мл в плоскодонной колбе (лабораторного шейкера) и культивировали в инкубаторе при скорости вращения 100 оборотов в минуту в течение 3-4 дней. При плотности 1-2×106 клеток/мл, клетки собрали центрифугированием и далее выращивали при вышеупомянутом значении начальной плотности в свежей среде. НЕК293, НЕК293-Т (АТСС# CRL-11268), а клетки HeLa культивировали адгезионно в модифицированной по способу Дульбекко среде Игла (Advanced D-МЕМ, Invitrogen #12491-015) с 10% фетальной телячьей сыворотки на чашках с клеточной культурой. Клетки НЕК293-Т поэтапно адаптировали к бессывороточному суспензионному росту в среде 293-SFMII и культивировали в плоскодонных колбах лабораторного шейкера при скорости вращения 100 оборотов в минуту, 37°С, влажности 95% и 8% CO2.

б. Зародышевые амниоциты

Зародышевые амниоциты, в соответствии с традиционными методами, получили в ходе амниоцентеза. 1-2 мл из данной инъекции культивировали с 5 мл среды Ham's F10 (Invitrogen #31550-023), 10% фетальной телячьей сыворотки, 2% препарата Ultroser G (CytoGen GmbH), 1x антимикробный/антигрибковый (Invitrogen #15240-062) при 37°С, влажности 95% и 5% CO2 на чашках с 6 см клеточной культуры Primaria (Falcon). Через 4-6 дней, амниоциты стали проявлять тенденцию к адгезии, и к ним добавили 3 мл свежей среды с добавками (см. предыдущий пример). Как только клетки показали полную адгезию, среду удалили и заменили 5 мл свежей среды с добавками. Для последующих перемещений, сливающиеся клетки промыли с фосфатно-солевым буфером ФСБ, разделили при помощи трипсина (TrypleSelect, Invitrogen #12563011) и поместили, соответственно, в 10 и 25 мл свежей среды с добавками в 10 см и 15 см чашки.

4. Трансформация зародышевых амниоцитов

а. Трансфекция

Культивированные зародышевые амниоциты (см. 36) каждый трансформировали путем трансфекции с плазмидами pSTK146, pGS119 или pGS122. Заблаговременно, линеаризовали соответствующие плазмиды расщеплением с подходящими энзимами ретсрикции (pSTK146, pGS119: Seal; pGS122: Pmel). До трансфекции, амниоциты поэтапно адаптировали к среде Opti-Pro (Invitrogen #12309-019) с 2% препарата Ultroser. С данной целью, каждую клетку спайкировали со свежей средой Ham's F10 (с добавками, см. 3б) плюс среда Opti-Pro (с 2% Ultroser) в соотношении 75:25%, 50:50%, 25:75% и 0:100% каждые 2-3 дня. Для трансфекции, сливающиеся клетки примерно 80% 15 см чашки распределили на 6 см чашки в соответствии с числом клеток 5-7×105 клеток на чашку. На следующий день, клетки на 5 чашках трансфицировали с 2 мкг линеаризованных pSTK146, pGS119 или pGS122 с использованием реагента трансфекции Эффектна Effectene (Qiagen) в соответствии с протоколом производителя. Одну чашку не трансфицировали и оставили далее на культивировании. На следующий день, клетки промыли с ФСБ, разделили с TrypleSelect и трансфицировали в 15 см чашку. Клетки культивировали в течение последующих 10-15 дней, в течение которых среду заменяли на свежую каждые 3-4 дня. В течение данного времени, добавление Ultroser понижали на 1%. Через примерно 10-15 дней клетки показали сливание и были подвергнуты трансфекции на 15 см чашках, в соответствии с вышеизложенной методикой.

б. Изоляция трансформированных клеточных клонов

По истечении нескольких недель после трансфекции, клональные клеточные островки., с выраженными различиями в сравнении с нетрансформированными амниоцитами по морфологическим признакам, наблюдали во всех трансфекциях. Данные клеточные островки выделили и переместили в 24-луночные чашки (в соответствии с перемещением 1). Далее, клетки размножили и первьм переносом переместили в 6 см чашки, позднее - в 15 см чашки. Подтвердили, при помощи метода Вестерн-блоттинга с использованием моноклональных антител, факт экспрессии белка Е1 в каждой из клонированных линий клеток (см. 2б).

Получение линий клеток, экспрессирующих Т-антиген на основе линий трансформированных клеток-амниоцитов описано в следующем примере линии клеток, полученной путем трансфекции с pGS119 (упомянутая линия клеток далее именуется линией клеток CAP). После изоляции и роста клональных клеточных островков, получили генетически однообразные линии клеток из клеточных клонов путем клонирования единственной клетки при помощи «метода ослабленного разбавления». Одновременно, клетку клонируемого клона посеяли в 96-луночную чашку Петри, и в течение последующих дней под микроскопом контролировали действительный рост только одной клетки. Линии, полученные из одной клетки, поэтапно вырастили до чашек 15 см. Путем поэтапного разбавления культуральной среды Opti-Pro/1% Ultroser с 293SFMII, клетки среды адаптировали к росту в суспензии бессывороточной среды. Одноклеточные линии подвергли анализу на стабильную и транзиентную экспрессию белка и плотность быстрорастущей среды, выбрали клон с наилучшими параметрами и далее использовали в нижеописанных примерах.

5. Получение популяций клеток, эксперссирующих Т-антиген

Каждые 1×107 клеток CAP (полученные трансфекцией зародышевых амниоцитов с плазмидой pGS119, адаптированные к суспензионному росту в бессывороточной среде) трансфицировали каждую партию с 5 мкг линеаризованной pGS158-, pGS159- и pGS161 плазмидной ДНК и культивировали в плоскодонной колбе лабораторного шейкера при вышеописанных условиях. Для селекции стабильных трансфицированных клеток, добавили 5 мкг/мл бластицидина по истечении 48 ч после трансфекции, а клетки культивировали далее до получения стабильных растущих популяций клеток по истечении примерно 3-4 недель. Упомянутые популяции клеток получили наименование Z582 (трансфекция с pGS158, Т-антиген, экспрессированный промотором ЦАГ), Z583 (трансфекция с pGS159, Т-антиген, экспрессированный промотором ВСР) и Z597 (трансфекция с pGS161, Т-антиген, экспрессированный промотором ЦМВ). Поскольку неизвестно, является ли повышенная концентрация Т-антигена потенциально токсичной для клеток CAP, задачей опыта явилась экспрессия Т-антигена при помощи промоторов с различной концентрацией. Представилось возможным показать, что экспрессия эталонного белка в клетках CAP была наивысшей с использованием промотора ЦМВ, немного ниже с промотором ЦАГ, и заметно ниже с промотором ВСР. Доказана возможность получения стабильных растущих популяций клеток с использованием всех трех промоторов и экспрессии всех трех популяций клеток в межклеточном Т-антигене.

6. Транзиентная экспрессия белка в клетках CAP и САР-Т

Фрагмент 359-bp ori, в том виде, в каком он применяется в описанных примерах, содержит в сравнении с минимальной точкой начала репликации длиной 63 bp, в дополнение к упомянутой коровой последовательности, также повторяющиеся последовательности 21-bр и 72-bp (SEQ ID NO: 11). Эти две повторяющиеся последовательности, на самом деле, очень важны для функции промотора, перекрывающегося с точкой начала репликации, но также получены данные, что они могут повышать репликацию ДНК SV40 DNA (Chandrasekharappa and Subramanian, J. Virol. 61, 2973-2980, 1987).

Для исследования влияния концентрации Т-антигена в клетке на экспрессию эталонного белка на три популяции клеток Z582, Z583 и Z597, экспрессирующих Т-антиген в присутствии промоторов различной эффективности в сравнении с транзиентной экспрессией в клетках CAP, не экспрессирующих Т-антиген. В связи с этим, каждые 1×107 клеток трансфицировали при помощи нуклеофектора (Amaxa/Lonza, program X-001, Puffer V) с кольцевой плазмидой pGS151 и культивировали в начальном объеме 12 мл. Среду заменили через три и шесть дней после трансфекции, причем на 6 день объем также увеличили до 15 мл. Каждую аликвоту изъяли, начиная с третьего по седьмой день после трансфекции и на девятый день после трансфекции, количество клеток определили, а экспрессию чАТ определили при помощи энзим связанного иммуносорбентного метода исследования ELISA с использованием поликлональных анти-чАТ антител (расцепленные и сцепленные с HRP; ICN Biomedicals). Очищенный от плазмы человека чАТ (ICN Biomedicals) использовали в качестве контроля.

Результат данного испытания графически представлен на Фиг.3. Во всех популяциях клеток CAP-Т получили высокий показатель транзиентной экспрессии в сравнении с клетками CAP. Транзиентная экспрессия в Z582 в 8 раз, в Z583 - в 25 раз и в Z597 - в 70 раз выше, чем в клетках CAP. Также, вторая популяция клеток САР-Т, экспрессирующая Т-антиген с использованием промотора ЦМВ, показывает относительно высокую экспрессию, чем экспрессия, полученная с Z597.

Эти данные показывают, что постоянная экспрессия Т-антигена в клетках CAP и уровень экспрессии Т-антигена оказывают влияние на уровень транзиентной экспрессии.

Далее, в ходе испытания определили уровень транзиентной экспрессии чАТ в популяции клеток Z597 после транзиентной трансфекции плазмид pGS116 и pGS151, соответственно. Обе упомянутые плазмиды отличаются друг от друга только присутствием фрагмента SV40-ori в pGS151. Трансфекцию и количественный анализ чАТ провели в соответствии с вышеописанной методикой, причем, как уровень экспрессии чАТ, так и показатели роста числа клеток, определяли в промежуток времени 9 дней. Результаты упомянутого испытания графически представлены на Фиг.4. Присутствие фрагмента SV40-ori в плазмиде экспрессии приводит к повышенной транзиентной экспрессии, на уровне 30 раз выше. Общее количество 2,5 мг чАТ можно экспрессировать трансфекцией 1×107 клеток САР-Т в объеме 40 мл в течение 9 дней. Данный факт соответствует эффективности экспрессии на уровне примерно 60 мг/л и до 40 пг/клетку в день. Рост клеток начинается примерно через 3 дня после трансфекции, а жизнеспособность клеток остается на уровне выше 80% в течение всего периода проведения испытания.

Для подтверждения факта, что эффективность упомянутой транзиентной экспрессии неспецифична для чАТ, дополнительно транзиентно экспрессировали в клетках САР-Т высокий гликозилированный белок эритропоэтина (Еро). Как описано для клеток чАТ, 1×107 клеток САР-Т популяции клеток Z597 трансфицировали с плазмидами pGS177 (содержащими кассету экспрессии для Еро и фрагмент SV40-on), а количество Еро определили в супернатанте культуры методом ELISA (R&D Systems, Quantikine IVD, Human Еро Immunoassay, DEPOO). 0,73 мг Еро можно экспрессировать с эффективностью 32 мг/л в течение испытательного периода 7 дней.

7. Сравнение с транзиентной экспрессией в других клеточных системах

Уже описанная выше линия клеток человека, так называемая линия клеток НЕК293-Т, стабильно экспрессирует SV40 Т-антиген и основана на линии клеток человека НЕК293, трансформированной с аденовирусом (DuBridge et al., Mol. Cell. Biol. 7, 379-387, 1987). В сравнении с Z597, 1×107 клеток НЕК293-Т (бессывороточная среда, суспензионная культура) трансфицировали с 5 мкг кольцевой плазмиды pGS151 при помощи метода нуклеофактора Атаха согласно протоколу испытаний производителя (программа Х-001, Puffer V) и культивировали. Результат упомянутого испытания графически представлен на Фиг.5. несмотря на то, что на 9 день транзиентной экспрессии количество клеток 293-Т однозначно было выше, чем аналогичный показатель САР-Т, транзиентная экспрессия в САР-Т по сравнению с аналогичным показателем в 293-Т примерно в 40 раз выше.

8. Анализ репликации

Необходимо отметить, что в анализе репликации подтверждение того факта, что экспрессия Т-антигена в клетках САР-Т приводит к более высокому количеству плазмид экспрессии, содержащих точку начала репликации, также объясняет значительное повышение экспрессии транзиентного белка. В связи с этим, клетки Z597- и НЕК293-Т, соответственно, трансфицировали с плазмидами pGS116 и pGS151, и культивировали в соответствии с вышеописанной методикой. Через 6, 12, 24, 48, 72 и 96 часов, выбрали каждые 1×105 клеток, центрифугировали, изъяли при помощи ФСБ и лизировали добавлением фиксированного объема 0,8 N NaOH. Клеточные лизаты подвергли блоттингу в аппарате SlotBlot на положительно заряженной нейлоновой мембране (GE Healthcare, Hybond-N+). Добавили повышенные количества плазмид pGSl 16 и pGS151 к 1×105 клеток Z597 в качестве контроля, лизировали и подвергли блоттингу согласно вышеописанной методике. Упомянутый стандарт соответствует 1000, 2500, 5000, 10000 и 15000 копий на клетку. ДНК зафиксировали инкубированием мембраны при 120°С в течение 30 минут и визуализировали при помощи нерадиоактивной ПЦР пробы, состоящей из hAAT-cDNA согласно протоколу испытаний производителя (AlkPhos Direct Labeling and Detection System, GE Healthcare, RPN 3680 and 3682). Определили количество копий в клетках, трансфицированных с pGSl 16 и pGS151, при помощи установленной концентрации стандартной плазмиды. Результат упомянутого анализа репликации графически представлен на Фиг.6. Как ожидалось, в САР-Т Z597 реплицировалась только pGS151, а не pGS116. Число копий pGS151 повышается от примерно 1500 копий/клетку через 6 часов после трансфекции, до примерно 7000 копий/клетку через 72 часа после трансфекции, причем количество клеток остается неизменным. По сравнению с этим, число копий pGS151 остается неизменным в НЕК293-Т в течение более чем 96 часов. Поскольку число клеток 293-Т удвоилось в тот же промежуток времени, тем не менее, понятно, что низкая репликация pGS151 в упомянутых клетках явно ниже уровня репликации Z597.

Определение экспрессии Т-антигена в линиях клеток-амниоцитов и клеток НЕК293-Т проводили при помощи анализа методом Вестерн-блоттинга. Из трех популяций клеток САР-Т и клеток НЕК293-Т, каждые 1×106 клеток выбрали в 50 мкл 50 ммоль Tris/HCL pH 8, 140 ммоль NaCl, 0.5% NP40, 4 ммоль EDTA, 2 ммоль EGTA, 0,5 ммоль PMSF, 5% глицерола и инкубировали в течение 30 мин на льду. Белковую смесь перемешивали центрифугированием в течение 10 мин при скорости вращения 13000 оборотов в минуту; определили уровень концентрации белка в супернатанте при помощи набора для детекции белка (Coomassie, Bradford, Thermo Life Science# 23200). На полиакриламидном геле с содержанием 12% SDS, разделили каждые 10 мкг белка, трансфицировали на нитроцеллюлозной мембране (Hybond ECL, Amersham Pharmacia Biotech) и визуализировали при помощи специфического антитела Т-антигена (Abeam, Anti-SV40 Т-антиген ab 16879). Можно заметить, что при помощи данного испытания, экспрессировалось большее количество Т-антигена в Z597, чем в двух других популяциях и в клетках НЕК-293-Т.

9. Трансфекция с полиэтиленимином

Поскольку вышеописанный способ трансфекции масштабируется только в ограниченном варианте, далее описывается испытание трансфекционного реагента, полиэтиленимина (PEI, Polysciences, #23966), применяемого для трансфекции в больших объемах. Линейный полиэтиленимин (MW=25,000) разбавили в соответствии с протоколом испытаний производителя с концентрацией 1 мг/мл и использовали в соотношении ДНК : полиэтиленимин =1:3. Для трансфекции, перемешали 10 мкг pGS151 с 30 мкг полиэтиленимина, инкубировали в течение 10 мин при комнатной температуре и добавили к клеткам 1×107 САР-Т Z597 в 6 мл среды FreeStyle (Invitrogen #12338-018). 6 мл среды 293-SFMII добавили через 5 часов, а клетки инкубировали в течение 7 дней. Через три дня после трансфекции, среду заменили на 293-SFMII, и при устойчивом росте клеток, объем повысили до 30 мл. Результат данного испытания представлен на Фиг.7. Путем трансфекции с полиэтиленимином, наблюдали высокую эффективность транзиентной экспрессии белков в САР-Т. Тем не менее, максимальный выход белка находился на уровне почти в 2 раза ниже аналогичного показателя экспрессии, который удалось получить при помощи нуклеофекции. Показательно, что рост клеток происходит значительно быстрее и более устойчиво после трансфекции с полиэтиленимином, причем удается достичь увеличения числа клеток примерно в 10 раз выше по сравнению с нуклеофекцией через 7 дней.

1. Способ получения постоянной линии клеток-амниоцитов человека, включающий:
а) трансфекцию зародышевых клеток-амниоцитов человека с молекулой нуклеиновой кислоты, содержащей последовательность нуклеиновой кислоты, кодирующую продукты генов аденовирусов Е1А и Е1В, причем указанную последовательность нуклеиновой кислоты получают из серотипа 5 аденовируса человека; и
б) последующую трансфекцию постоянной линии клеток-амниоцитов человека, полученной на этапе а), с молекулой нуклеиновой кислоты, содержащей последовательность нуклеиновой кислоты, кодирующую большой SV40 Т-антиген.

2. Способ по п.1, при котором последовательность нуклеиновой кислоты, кодирующая продукты генов аденовирусов Е1А и Е1В, содержит нуклеотиды 1-4344, 505-3522 или нуклеотиды 505-4079 серотипа 5 аденовируса человека.

3. Способ по п.1, при котором последовательность нуклеиновой кислоты, кодирующая большой SV40 Т-антиген, содержит последовательность нуклеиновой кислоты для промотора, выбираемого из группы ЦМВ промотора, ЦАГ промотора и ВСР промотора, последовательность нуклеиновой кислоты для SV40 SD/SA (интрон) и последовательность нуклеиновой кислоты для SV40 polyA.

4. Способ по п. 1, при котором вместо этапа а) используют предварительно «иммортализованные» линии клеток-амниоцитов человека.



 

Похожие патенты:

Настоящее изобретение относится к области иммунологии. Предложено антитело против фракталкина (ФКН, CX3CL1) и его фракталкин-связывающий фрагмент, охарактеризованные последовательностями вариабельных доменов.

Изобретение относится к области иммунологии. Предложены выделенное антитело-антагонист против FGFR3 и его функциональный фрагмент, а также полинуклеотид, вектор экспрессии, клетка-хозяин и способ получения антитела против FGFR3 или его функционального фрагмента.

Изобретение относится к области биотехнологии, конкретно к конъюгатам Apo A с терапевтическими полипептидами, и может быть использовано в медицине. Получают конъюгат, содержащий молекулу Apo A-I или ее функционально-эквивалентный вариант, такой как Apo А-IV или Аро A-V, ковалентно связанную с представляющим терапевтический интерес полипептидом, выбранным из интерферона, ингибитора TGF-бета Р144 или Р17, IL-15, кардиотрофина-1, порфобилиногендеаминазы, инсулина и фактора VII.

Настоящее изобретение относится к области биотехнологии. Предложено гуманизированное антитело и его фрагмент, способные специфически связывать бета-амилоид, охарактеризованные фрагментами последовательностей на основе антитела мыши 8F5, и Fc-областью человеческого IgG1, содержащей аминокислотную замену D265A; а также кодирующая нуклеиновая кислота, вектор экспрессии, продуцирующие антитело или его фрагмент клетки, способ продуцирования антитела или его фрагмента; композиция, применение антитела и его фрагмента для изготовления лекарственного средства, способ предупреждения, лечения или облегчения эффектов амилоидоза; способ диагностики амилоид-ассоциированных заболеваний или состояний, способ определения степени нагрузки амилоидогенных бляшек и тест-набор для выявления и диагностики амилоид-ассоциированных бляшек.

Изобретение относится к области биотехнологии, генной инженерии и вирусологии. Раскрыта конструкция, которая, при экспрессии в клетке-хозяине, является способной продуцировать пустые вирусные капсиды.

Группа изобретений относится к медицине, а именно к гематологии и может быть использована при лечении расстройств, ассоциированных с кровотечением. Способ по изобретению включает введение субъекту химерного полипептида фактора VIIa, где указанный химерный полипептид фактора VIIa включает домен EGF-2 и каталитический домен фактора VII; домен GLA, выбранный из группы, состоящей из домена GLA фактора VII, домена GLA фактора IX и домена GLA белка S; и домен EGF-1, выбранный из группы, состоящей из домена EGF-1 фактора IX и домена EGF-1 белка S.

Изобретение относится к области биотехнологии, генной инженерии и вирусологии. Описан экспрессионный вектор для предотвращения или подавления вхождения, слияния или репликации ВИЧ в клетках млекопитающих.

Изобретение относится к области биотехнологии, конкретно к получению белковых каркасов, связывающихся с IgG, и может быть использовано в диагностике или лечении. Получают белковый каркас на основе консенсусной последовательности десятого повтора фибронектина типа III (FN3) человека, содержащий последовательность аминокислот SEQ ID NO: 16.

Изобретение относится к области биотехнологии, генной инженерии и иммунологии. Раскрыты связывающие gp41 ВИЧ-1 одноцепочечные 3-нитиевые альфа-спиральные суперспирализованные молекулы, обозначенные как "Альфатела".

Настоящее изобретение относится к биотехнологии. Предложено моноклональное антитело, которое специфически связывается со вторым доменом Кунитца ингибитора пути тканевого фактора (TFPI), которое характеризуется тем, что содержит 6 CDR.

Изобретение относится к биотехнологии и трансплантологии (клеточной терапии). Описан способ получения пациент (донор)-специфических фибробластоподобных клеток из индуцированных плюрипотентных стволовых клеток человека.

Изобретение относится к области биотехнологии. Описан способ предифференцировки стромальных стволовых клеток костного мозга.

Группа изобретений относится к области биотехнологии. Способ выделения ганглиозида GM1 предусматривает получение тканей не бычьего и не свиного происхождения, содержащих клетки, продуцирующие GM1; выделение из указанных тканей клеток, продуцирующих ганглиозид GM1; экспансию указанных клеток, продуцирующих GM1, в культуре при подходящих условиях, способствующих экспансии указанных клеток; экспрессию ганглиозида GM1 в культуре при подходящих условиях; выделение указанного ганглиозида GM1 из указанной культуры, который может быть использован для лечения болезни Паркинсона и других неврологических заболеваний.

Изобретение относится к медицине и биотехнологии, в том числе к медицинской и косметической трансплантологии, и представляет собой микротрансплантат (MKT), состоящий из клеток человека, прикрепившихся на поверхности микроносителя, состоящего из полигликолидных волокон, или их группы, диаметром до 20 мкм и длиной от 100 до 1000 мкм.
Группа изобретений относится к области биотехнологии и предназначена для получения биологического референтного материала для производства стандартных образцов состава мочи, содержащих ртуть, кадмий, свинец.
Группа изобретений относится к получению стандартных образцов состава крови, содержащих ртуть, кадмий и свинец, и может быть использована в токсикологии, медицине и ветеринарии при определении содержания указанных токсичных металлов в крови.

Изобретение относится к области биотехнологии и может быть применено для регенерации тканей мезодермального происхождения с использованием фибробластов взрослого организма.
Изобретение относится к области биотехнологии. Предложен способ получения плюрипотентных стволовых клеток, включающий процесс дедифференцировки соматических клеток, культивирование индуцированных плюрипотентных стволовых клеток в присутствии агента, изменяющего эпигенетический статус клетки, и культивирование стволовых клеток в отсутствие указанного агента.

Изобретение относится к области биотехнологии, конкретно к получению стимулированных дендритных клеток (ДК), и может быть использовано в медицине для иммунотерапии рака.
Изобретение относится к биотехнологии. Предложен способ получения дезинфицированного препарата клеток из ткани млекопитающего.

Группа изобретений относится к области биотехнологии. Способ выделения ганглиозида GM1 предусматривает получение тканей не бычьего и не свиного происхождения, содержащих клетки, продуцирующие GM1; выделение из указанных тканей клеток, продуцирующих ганглиозид GM1; экспансию указанных клеток, продуцирующих GM1, в культуре при подходящих условиях, способствующих экспансии указанных клеток; экспрессию ганглиозида GM1 в культуре при подходящих условиях; выделение указанного ганглиозида GM1 из указанной культуры, который может быть использован для лечения болезни Паркинсона и других неврологических заболеваний.
Наверх