Химерные вирусоподобные частицы, содержащие гемагглютинин, сходные с частицами вируса гриппа

Изобретение относится к области биотехнологии, генной инженерии и вирусологии. Предложен способ получения в растении или в его части химерных вирусоподобных частиц (VLP). Частицы сходны с частицами вируса гриппа. Способ включает экспрессию химерного НА вируса гриппа в растении или в части растения. Данное изобретение относится также к VLP, включающей химерный белок НА вируса гриппа и липиды растений. Изобретение относится также к нуклеиновой кислоте, кодирующей химерный НА вируса гриппа, и вектору. VLP могут быть использованы для приготовления вакцин против гриппа или для улучшения существующих вакцин. Предложенная группа изобретений может быть использована в медицине. 18 н. и 19 з.п. ф-лы, 60 ил., 5 табл., 5 пр.

 

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ДАННОЕ ИЗОБРЕТЕНИЕ

Данная заявка претендует на приоритет предварительной заявки США на патент №61/220161, поданной 24 июня 2009 г.

Данное изобретение относится к вирусоподобным частицам. Более конкретно, настоящее изобретение предусматривает вирусоподобные частицы, содержащие гемагглютинин химерного вируса гриппа, и способы получения химерных вирусоподобных частиц, сходных с частицами вируса гриппа.

УРОВЕНЬ ТЕХНИКИ

Грипп является основной причиной смерти людей, вызванной респираторным вирусом, подсчитано, что во время «сезона гриппа» во всем мире могут быть инфицированы 10-20% населения, при этом каждый год умирают 250000-500000 людей.

Применяемый в настоящее время способ борьбы с заболеванием гриппом у людей состоит в ежегодной вакцинации. Обычно вакцина представляет собой комбинацию нескольких штаммов, которые рассматриваются как доминирующие штаммы в предстоящем сезоне гриппа, однако, количество доз вакцин, производимых ежегодно, является недостаточным для вакцинации всего населения в мире. Например, в Канаде и Соединенных штатах Америки производится количество доз вакцин, достаточное для иммунизации примерно одной трети населения, а в Европе в настоящее время могут быть вакцинированы только 17% населения - перед лицом возможной мировой пандемии гриппа это количество доз вакцин является недостаточным. Даже, если необходимое на год производство вакцин в данном году будет достаточным, доминирующие штаммы меняются от года к году, поэтому накопление вакцины в период отсутствия заболеваний в данном году не является рациональным. С экономической точки зрения крупномасштабное производство эффективной вакцины против гриппа представляет значительный интерес для правительств, а также для частных производителей в различных странах.

Гемагглютинин вируса гриппа (НА), являющийся поверхностным гликопротеином, представляет собой мембранный слитый белок и связывает рецепторы. Он является тримером идентичных подъединиц, каждая из которых содержит два полипептида, НА1 и НА2, связанных дисульфидными связями, которые получаются в результате протеолитического расщепления предшественника, НА0, который включает сигнальную пептидную последовательность на своем N - конце и мембранную якорную последовательность на С - конце. Расщепление с образованием НА1 и НА2 приводит к получению N - конца у меньшего полипептида, НА2, который содержит мембранную якорную последовательность на своем С - конце. Расщепление требуется для обеспечения активности слияния с мембраной, но не для иммуногенности. N - концевая последовательность НА2 называется "слитым пептидом", так как расщепление подобных гидрофобных последовательностей также требуется для проявления активности других слитых вирусных белков и потому, что аналоги синтетических пептидов, содержащие 20 остатков, сливаются с мембранами in vitro.

Вообще поверхность глобулярной «головки» содержит несколько гибких петель с хорошо охарактеризованными и вариабельными антигенными участками, обозначаемыми как А, В, С, D и Е (см. обзор в Wiley et al., 1987. Annu. Rev. Biochem. 56: 365-394). Инсерция или замещение коротких пептидных последовательностей в некоторых сайтах (например, В и Е) для изучения механизма иммунитета уже были описаны (см. Garcia - Sastre et al. 1995. Biologicals 23: 171-178).

Эпидермальный фактор роста (EGF), одноцепочечное антитело (scFV) и Fc - домен IgG, меняющиеся по размеру от 53 to 246 аминокислот, были введены инсерцией на N - конце вируса гриппа подтипа Н7, и химеры были успешно экспрессированы (см. Hatziioannou et al., 1999, Human Gene Therapy, 10: 1533-1544). Позже с амино - концом вируса подтипа Н3 были слиты 90 и 140 доменов аминокислот защитного антигена Bacillus anthracis (Li et al., 2005, Journ. Virol. 79: 10003-1002). Copeland (Copeland et al., 2005. J. Virol. 79: 6459-6471) описывает экспрессию поверхностного гликопротеина gp120 Env H1V на "стебле" Н3, где домен gp120 заместил всю глобулярную головку НА.

В качестве рекомбинантных вакцин - кандидатов от гриппа были разработаны несколько рекомбинантных продуктов. Подходы к их созданию были сфокусированы на экспрессии, продуцировании и очистке белков вируса гриппа типов А НА и NA, включая экспрессию этих белков с применением клеток насекомых, инфицированных бакуловирусом (Crawford et al, 1999, Vaccine, 17: 2265-74; Johansson, 1999, Vaccine, 17: 2073-80), вирусных векторов и конструктов ДНК - вакцин (Olsen et al., 1997, Vaccine 15: 1149-56).

Одним из путей предотвращения недиагностируемой инфекции является получение штамма неинфекционного вируса гриппа для производства вакцины. Или же в качестве заместителей культивируемого вируса можно изучать вирусоподобные частицы (VLP). VLP имитируют структуру капсида вируса, но не содержат генома и вследствие этого не могут реплицироваться или создавать средство для вторичной инфекции. Современные технологии производства VLP, сходной с частицами вируса гриппа, основаны на совместной экспрессии множественных вирусных белков, эта зависимость представляет собой недостаток, так как в случае пандемической системы и ежегодных эпидемий гриппа время ответа при проведении вакцинации является критическим. Более простая система производства VLP, например, система, которая основывается на экспрессии только одного или нескольких вирусных белков без необходимости экспрессии неструктурных вирусных белков, является желательной для ускорения развития вакцин.

Вирусы в оболочке могут получать свою липидную оболочку при «отпочковывании» от инфицированной клетки и приобретать мембрану из плазменной мембраны или из мембраны внутренней органеллы. Например, в системах клеток млекопитающих или клеток бакуловирусов вирус гриппа отпочковывается от плазменной мембраны (Quan et al., 2007, J. Virol, 81: 3514-3524). Известно, что только немногие вирусы в оболочке инфицируют растения (например, члены семейств вирусов Tospo viruses и Rhabdo viruses). Из известных вирусов растений в оболочке они характеризуются отпочковыванием от внутренних мембран клетки-хозяина, а не от плазменной мембраны. Хотя в клетках-хозяевах было получено небольшое количество рекомбинантных VLP, из плазменной мембраны не было получено ни одной такой VLP, что ставит вопрос о том, могут ли быть получены из плазменной мембраны VLP, сходные с частицами вируса гриппа, в растениях.

Образование VLP в любой системе предъявляет значительные требования к структуре белков - изменение коротких отрезков последовательности, которая соответствует выбранной структуре петель глобулярной структуры, может не оказывать большого влияния на экспрессию самого полипептида, однако, не известны результаты изучения структуры, которые демонстрируют влияние таких изменений на образование VLP. Совместное действие различных участков и структур НА (например, мембранные якорные последовательности, "стебель" и "ствол" тримера, которые отделяют глобулярную головку от мембран) меняется вместе с вирусом и не может быть подвержено подобным изменениям без потери целостности тримера НА и образования VLP.

Получение VLP НА вируса гриппа было ранее описано в заявке WO 2009/009876.

РАСКРЫТИЕ ИЗОБРЕТЕНИЯ

Данное изобретение относится к вирусоподобным частицам. Более конкретно, настоящее изобретение направлено на вирусоподобные частицы, содержащие химерный гемагглютинин вируса гриппа и на способы получения химерных вирусоподобных частиц, сходных с частицами вируса гриппа.

Цель данного изобретения состоит в получении усовершенствованной химерной вирусоподобной частицы (VLP), сходной с частицей вируса гриппа.

Настоящее изобретение предусматривает полипептид, включающий химерный НА вируса гриппа, содержащий кластер "стволового" домена (SDC), кластер головного домена (HDC) и кластер трансмембранного домена (TDC), где SDC включает субдомен F'1, F'2 и F; HDC включает субдомен RB, Е1 и Е2; TDC включает субдомен TmD и Ctail; где по меньшей мере один субдомен представляет собой субдомен первого НА вируса гриппа и другие субдомены являются субдоменами одного или более вторых НА вируса гриппа НА. Первый и второй НА вируса гриппа могут быть независимо выбраны из группы, включающей НА H1, Н3, Н5 и В. Кроме того, полипептид может включать сигнальный пептид.

Настоящее изобретение предусматривает также нуклеиновую кислоту, кодирующую полипептид, включающий химерный НА вируса гриппа, содержащий кластер "стволового" домена (SDC), кластер головного домена (HDC) и кластер трансмембранного домена (TDC), где SDC включает субдомен F'1, F'2 и F; HDC включает субдомен RB, E1 и Е2; TDC включает субдомен TmD и Ctail; где по меньшей мере один субдомен представляет собой субдомен НА первого вируса гриппа и другие субдомены являются субдоменами НА одного или более второго вируса гриппа. Эта нуклеиновая кислота может также кодировать полипептид, который включает сигнальный пептид в добавление к доменам SDC, HDC и TDC, описанным выше.

Предусматривается также способ получения химерных вирусоподобных частиц (VLP), сходных с частицами вируса гриппа, в растении, который включает:

а) введение в растение или его часть нуклеиновой кислоты, кодирующей химерный НА вируса гриппа, включающий сигнальный пептид, кластер "стволового" домена (SDC), кластер головного домена (HDC) и кластер трансмембранного домена (TDC), где SDC включает субдомен F'1, F'2 и F; HDC включает субдомен RB, E1 и Е2; TDC включает субдомен TmD и Ctail; где по меньшей мере один субдомен представляет собой субдомен НА первого вируса гриппа и другие субдомены являются субдоменами одного или более второго НА вируса гриппа и

б) инкубирование растения или его части в условиях, которые позволяют осуществить экспрессию нуклеиновой кислоты, при этом получаются VLP.

Данное изобретение включает способ, описанный выше, где на стадии введения (на стадии а) нуклеиновая кислота вводится в растение транзиентно (временно). Или же на стадии введения (на стадии а) нуклеиновая кислота вводится в растение и стабильно интегрируется. Способ может также включать стадию с): сбора хозяина и очистки VLP.

Данное изобретение обеспечивает получение растения или его части, которые включают химерный НА вируса гриппа или нуклеотидную последовательность, кодирующую химерный НА вируса гриппа, химерный НА вируса гриппа, содержащий кластер "стволового" домена (SDC), кластер головного домена (HDC) и кластер трансмембранного домена (TDC), где SDC включает субдомен F'1, F'2 и F; HDC включает субдомен RB, E1 и Е2; TDC включает субдомен TmD и Ctail; где по меньшей мере один субдомен представляет собой субдомен НА первого вируса гриппа и другие субдомены являются субдоменами одного или более НА второго вируса гриппа.

Это растение или его часть могут также включать нуклеиновую кислоту, содержащую нуклеотидную последовательность, кодирующую один или более шапероновых белков, функционально связанных с регуляторной активной областью в растении. Один или более, чем один шапероновый белок может быть выбран из группы, включающей Hsp40 и Hsp70.

Настоящее изобретение относится к вирусоподобной частице (VLP), включающей химерный НА вируса гриппа, химерный НА вируса гриппа, содержащий кластер стволового домена (SDC), кластер головного домена (HDC) и кластер трансмембранного домена (TDC), где SDC включает субдомен F'1, F'2 и F; HDC включает субдомен RB, Е1 и Е2; TDC включает субдомен TmD и Ctail; где по меньшей мере один субдомен представляет собой субдомен НА первого вируса гриппа и другие субдомены являются субдоменами НА одного или более второго вируса гриппа. VLP может также включать специфические для растения N-гликаны или модифицированные N-гликаны.

Данным изобретением предусмотрена также композиция, содержащая эффективную дозу VLP, описанной выше, и фармацевтически приемлемый носитель.

В соответствии с альтернативным аспектом данного изобретения предусмотрен способ индуцирования иммунитета к инфекции вирусом гриппа у субъекта, включающий введение VLP субъекту. VLP могут вводиться субъекту перорально, интрадермально или интраназально, внутримышечно, интраперитонеально, внутривенно или подкожно.

Регуляторные области, которые могут быть функционально связаны с последовательностью, кодирующей химерный белок НА, включают области, которые функционируют в клетке растения, в клетке насекомого или в дрожжевой клетке. Такие регуляторные области могут включать регуляторную область пластоцианина, регуляторную область рибулозо-1,5-бифосфаткарбоксилазы/оксигеназы (RuBisCO), регуляторную область хлорофиллового а/b-связывающего белка (CAB) или регуляторную область ST - LSI. Другие регуляторные области включают 5'UTR, 3'UTR или терминаторные последовательности. Регуляторная область пластоцианина может представлять собой участок пластоцианина люцерны; 5'UTR, 3'UTR или терминаторные последовательности также могут быть последовательностями белка люцерны.

Данное изобретение предусматривает полипептид химерного НА вируса гриппа, выбранного из первичного вируса гриппа и вторичного вируса гриппа, при этом первичный вирус гриппа и вторичный вирус гриппа могут быть независимо выбраны из группы, включающей В, H1, Н2, Н3, Н4, Н5, H6, Н7, Н8, Н9, H10, H11, Н12, Н13, Н14, H15 и Н16; при условии, что первичный вирус гриппа и вторичный вирус гриппа не являются одними и теми же самыми типами, подтипами вирусов гриппа или не имеют одного и того же происхождения.

В соответствии с некоторыми аспектами данного изобретения полипептид химерного НА вируса гриппа включает сигнальную пептидную последовательность, сигнальная пептидная последовательность может быть выбрана из группы, включающей нативную сигнальную пептидную последовательность, PDI сигнальную последовательность люцерны, сигнальную последовательность вируса гриппа Н5 и сигнальную пептидную последовательность вируса гриппа H1.

Данное изобретение предусматривает способ получения VLP, содержащей химерный гемагглютинин (НА) вируса гриппа с хозяином, способным продуцировать VLP и включающим растение, насекомое или дрожжи, заключающийся во введении в клетку хозяина нуклеиновой кислоты, кодирующей химерный НА вируса гриппа, включающий кластер стволового домена (SDC), кластер головного домена (HDC) и кластер трансмембранного домена (TDC), где SDC включает субдомен F'1, F'2 и F; HDC включает субдомен RB, Е1 и Е2; TDC включает субдомен TmD и Ctail; где по меньшей мере один субдомен представляет собой субдомен НА первого вируса гриппа и другие субдомены являются субдоменами НА одного или более второго вируса гриппа, и в инкубировании хозяина в условиях, которые позволяют осуществиться экспрессии нуклеиновой кислоты, при этом образуются VLP.

Получение VLP в растениях имеет несколько преимуществ по сравнению с получением этих частиц в культуре клеток насекомого. Растительные липиды могут стимулировать специфические иммунные клетки и способствуют вызванному иммунному ответу. Растительные мембраны изготовлены из липидов фосфатидилхолина (PC) и фосфатидилэтаноламина (РЕ) и содержат также гликосфинголипиды, которые являются уникальными для растений и некоторых бактерий и простейших. Сфинголипиды необычны тем, что они не являются эфирами глицерина, такими как PC или РЕ, но скорее состоят из длинноцепочечного аминоспирта, который образует амидную связь с цепью жирной кислоты, содержащей более 18 атомов углерода. PC и РЕ, а также гликосфинголипиды могут связываться с молекулами CD1, экспрессированными иммунными клетками млекопитающего, такими как антиген - презентирующие клетки (АРС) типа дендритных клеток, и макрофаги и другие клетки, включающие В- и T-лимфоциты в вилочковой железе и печени. Кроме того, в дополнение к потенциальному адъювантному эффекту от наличия растительных липидов способность растительных N-гликанов увеличивать захват антигенов гликопротеина антиген - представляющими клетками может обеспечивать преимущество при получении химерных VLP в растениях. Не ограничиваясь какой-либо теорией, ожидают, что полученные в растениях химерные VLP вызовут более сильный иммунный ответ, чем химерные VLP, полученные в других системах, и что иммунная реакция, вызванная этими полученными в растениях химерными VLP, является более сильной, чем в случае иммунной реакции, вызванной живой или ослабленной цельно - вирионной вакциной.

В противоположность вакцинам, изготовленным из цельных вирусов, химерные VLP обеспечивают преимущество, состоящее в том, что они не являются инфекционными, поэтому ограничивающая их применение биологическая безопасность не является такой существенной, как в случае целого инфекционного вируса и она не требуется для производства вакцины. Полученные в растениях химерные VLP обеспечивают еще одно преимущество за счет выращивания системы экспрессии в теплице или в поле, что является значительно более экономичным и подходящим для масштабирования производства.

Кроме того, растения не включают ферменты, участвующие в синтезе и присоединении остатков сиаловой кислоты к белкам. VLP могут быть получены в отсутствие нейраминидазы (NA) и поэтому нет необходимости в совместной экспрессии NA или в обработке получающихся клеток или экстракции сиалидазой (нейраминидазой) для обеспечения получения VLP в растениях.

Изложенная сущность изобретения не описывает все признаки этого изобретения.

КРАТКОЕ ОПИСАНИЕ РИСУНКОВ

Эти и другие признаки изобретения станут более очевидными из следующего ниже описания, в котором даются ссылки на прилагаемые рисунки, которые представляют собой следующее:

Фигура 1A показывает схематическую диаграмму субдоменов НА вируса. СР: сигнальный пептид, F'1, F'2, и F: субдомены слияния; RB: рецептор-связывающий субдомен, Е1 и Е2: субдомены эстеразы, TMD/СТ: трансмембранный и цитоплазматический хвостовые субдомены. Фигура 1B схематически отображает кассеты экспрессии на основе пластоцианина (номера конструктов: 774, 540, 660, 690, 691, 696) для экспрессии гемагглютинина H1 A/Brisbane/59/2007 (H1/Bri), гемагглютинина H1 A/New Caledonia/20/99 (H1/NC) и гемагглютинина Н5 A/Indonesia/5/05 (Н5/Indo) в нативной и в химерной формах. Plasto pro: промотор пластоцианина люцерны, Plasto ter : терминатор пластоцианина люцерны, SP : сигнальный пептид, RB: рецептор-связывающий субдомен, Е1-RB-Е2: субдомен эстеразы и рецептор-связывающий субдомен, TMD/СТ : трансмембранный и цитоплазматический хвостовые субдомены, PDI : протеин - дисульфидизомераза люцерны. Фигура 1C показывает выравнивание последовательности аминокислот, наложенное на структурное выравнивание нескольких вирусов гриппа HAs (В/Florida/4/2006 (В Florida), SEQ ID NO: 94 (GenBank Accession No. ACA33493.1; В/Malaysia/2506/2004 (В - Malaysia), SEQ ID NO: 95 (GenBank Accession No. ABU99194.1; H1/Bri (A - Brisbane), SEQ ID NO: 96 (GenBank Accession No. ADE28750.1; H1 A/Solomon Islands/3/2006 (A - Sol.Isl), SEQ ID NO: 97 (GenBank Accession No. ABU99109.1); H1/NC (A - NewCal)., SEQ ID NO: 98 (GenBank Accession No. AAP34324.1; H2 A/Singapore/1/1957 (A - Singapore), SEQ ID NO: 99 (GenBank Accession No. AAA64366.1); H3 A/Brisbane/10/2007 (A - Brisbane), SEQ ID NO: 100 (GenBank Accession No. ACI26318.1); H3 A/Wisconsin/67/2005 (A - WCN), SEQ ID NO: 101 (GenBank Accession No. AB037599.1); Н5 A/Anhui 1/2005 (A - Anhui), SEQ ID NO: 102 (GenBank Accession No. ABD28180.1); Н5 A/Vietnam/1194/2004 (A - Vietnam), SEQ ID NO: 103 (GenBank Accession No. ACR48874.1); Н5 - Indo, SEQ ID NO: 104 (GenBank Accession No. ABW06108.1. Указаны границы между субдоменами F'1, эстеразы 1, рецептор-связывающим, эстеразы 2, F'2, белка слияния, TMD/СТ и дисульфидными мостиками.

На Фигуре 2 показана аминокислотная последовательность указанных субдоменов химерного НА вируса, экспрессированного при помощи конструктов 690, 734 (SEQ ID NO: 11), 696 (SEQ ID NO: 112), что показано на верхней панели, и 691 (SEQ ID NO: 113), что показано на нижней панели. Аминокислоты 1-92 в SEQ ID NO: 111 представляют собой F'1+E1 домен Н5/Indo; аминокислоты 93-263 представляют собой RB головной домен H1/Brisbane и аминокислоты 264-552 представляют собой домен E2+F'2 Н5/Indo. Аминокислоты 1-92 в SEQ ID NO: 112 представляют собой домен F'1+E1B Н5/NC; аминокислоты 93-301 представляют собой головной домен RB в Н5/Indo и аминокислоты 302-586 представляют собой домен E2+F'2 в H1/NC. Аминокислоты 1-42 в SEQ ID NO: 113 представляют собой домен F'1B Н5/Indo; аминокислоты 43-273 представляют собой головной домен Е1-RB-Е2 в H1/Brisbane и аминокислоты 274-552 представляют собой домен F'2 в Н5/Indo.

На Фигуре 3 приведена аминокислотная последовательность кодирующей области конструктов 690 и 734 (SEQ ID NO: 80), включающая субдомен RB H1/Bri, сигнальный пептид Н5/Indo и комплекс "стволового" домена (SDC), включающего субдомены Н5/Indo F'1, El, E2, F'2 и F.

На Фигуре 4 приведена аминокислотная последовательность кодирующей области конструкта 691 (SEQ ID NO: 81), включающего комплекс головного домена H1/Bri (HDC), включающего сигнальный пептид Е1, RB, E2, Н5/Indo, и комплекс "стволового" домена Н5/Indo (SDC), включающего субдомены Н5/Indo F'1, F'2 и F.

На Фигуре 5 приведена аминокислотная последовательность кодирующей области конструкта 696 (SEQ ID NO: 82), включающего субдомен RB в Н5/Indo, сигнальный пептид PDI и комплекс "стволового" домена (SDC) H1/NC, включающий F'1, El, E2 и F'2.

На Фигуре 6 показаны результаты определения методом иммуноблоттинга уровня экспрессии H1/Bri в нативной форме, конструкта 774 (включающего H1/Bri), конструкта 692 (включающего комплекс головного домена (HDC) в H1/Bri) и конструкта 690 (включающего субдомен RB в H1/Bri, слитый с комплексом "стволового" домена (SDC) Н5/Indo в растениях. Для каждого конструкта проводили анализ экстрактов белков, полученных из трех отдельных растений. Загружали 20 мг белка для каждого анализируемого растения. Вестерн-блот выявляли при помощи моноклональных антител к НА (анти - H1 - Brisbane; FII 10-150). Конструкт 774 экспрессирует H1/Bri при помощи нативного сигнального пептида H1/Bri; конструкты 690, 691 экспрессируют НА при помощи нативного сигнального пептида Н5/Indo.

На Фигуре 7 показаны результаты определения методом иммуноблоттинга уровня экспрессии Н5/Indo в нативной форме, конструкта 660 (включающего H5/Indo) или конструкта 696 (включающего субдомен H1/Indo RB, слитый с субдоменами H1/NC SDC, E1 и Е2). Для каждого конструкта проводили анализ экстрактов белков, полученных из трех отдельных растений. Загружали 20 мкг белка для каждого анализируемого растения. Вестерн-блот выявляли при помощи поликлональных антител к Н5 Indonesia (ITC IT-003-005V). Конструкт 660 экспрессирует Н5/Indo при помощи своего нативного сигнального пептида; конструкт 696 экспрессирует химерный НА при помощи сигнального пептида PDI.

На Фигуре 8 схематически показаны основанные на 35SCPMV/НТ кассеты экспрессии H1/Bri в нативной (конструкт 732) и химерной (конструкты 733 и 734) формах. Конструкт 733, включает сигнальный пептид PDI и HDC, SDC и комплекс трансмембранного домена (TDC) в H1/Bri и конструкт 734 включает сигнальный пептид Н5/Indo, F'1, El, Е2, F'2, F, и RB из H1/Bri. 35S pro: промотор CaMV 35S, NO ter: терминатор нопалин - синтазы, SP: сигнальный пептид, RB: рецептор-связывающий субдомен, E1-RB-E2: субдомен эстеразы и рецептор-связывающий субдомен, TMD/СТ: трансмембранный и цитоплазматический хвостовые субдомены, PDI: протеин - дисульфидизомераза люцерны; CPMV - НТ: 5' и 3' - элементы гипертранслируемой системы экспрессии вируса мозаики коровьего гороха Cowpea Mosaic Virus.

На Фигуре 9 приведены результаты определения методом иммуноблоттинга уровня экспрессии H1/Bri в нативной форме, конструкта 732 (включающего H1/Bri под контролем основанной на 35SCPMV/НТ кассеты экспрессии), конструкта 733 (включающего сигнальный пептид PDI, который слит с H1/Bri; под контролем основанной на 35SCPMV/НТ кассеты экспрессии) или конструкта 734, включающего субдомен H1/Bri RB, который слит с субдоменами Н5/Indo SDC, E1 и Е2; под контролем основанной на 35SCPMV/НТ кассеты экспрессии). Для каждого конструкта проводили анализ экстрактов белков, полученных из трех отдельных растений. Загружали 5 мкг белка для каждого анализируемого растения. Вестерн-блот проявляли при помощи моноклональных антител к НА (FII 10-150).

На Фигуре 10 схематически показаны основанные на 35SCPMV/НТ кассеты экспрессии гемагглютининов H3A/Brisbane/10/2007 НА (H3/Bri) и В/Florida/4/2006 НА (В/Flo). Конструкт 736 включает Н3/Bri, слитый с сигнальным пептидом PDI. Конструкт 737 включает Н3/Bri, который слит с сигнальным пептидом PDI и Н5/Indo TMD/СТ. Конструкт 739 включает В/Flo, который слит с сигнальным пептидом PDI. Конструкт 745Включает В/Flo, который слит с сигнальным пептидом PDI, и Н5/Indo TMD/СТ. 35S pro: промотор CaMV 35S, NO ter: терминатор нопалин - синтазы, SP: сигнальный пептид, RB: рецептор-связывающий субдомен, Е1-RB-Е2: субдомен эстеразы и рецептор-связывающий субдомен, TMD/СТ: трансмембранный и цитоплазматический хвостовые субдомены, PDI: протеин - дисульфидизомераза люцерны; CPMV - НТ: 5' и 3' - элементы гипертранслируемой системы экспрессии вируса мозаики коровьего гороха.

На Фигуре 11 показана граница слияния в конструктах номер 745 и номер 737. Происхождение последовательности НА указано стрелками, заканчивающимися жирными точками. Аминокислоты трансмембранного домена представляют собой QILSIYSTVA и им предшествуют аминокислоты, которые являются частью эктодомена.

На Фигуре 12 показана аминокислотная последовательность химерного гемагглютинина Н5/Н3 (SEQ ID NO: 83; конструкт 737), включающего сигнальный пептид PDI, эктодомен H3A/Brisbane/10/2007 и TMD/СТ в Н5 A/Indonesia/5/2005.

На Фигуре 13 показана аминокислотная последовательность химерного гемагглютинина Н5/В (SEQ ID NO: 84), включающего эктодомен В/Florida/4/2006 и TMD/СТ в Н5 А/Indonesia/5/2005, кодируемый открытой рамкой считывания в конструкте номер 745.

На фигуре 14 показаны результаты определения методом иммуноблоттинга уровня экспрессии В/Flo в нативной форме, конструкта 739 (включающего PDI-В/Flo) или с конструктом 745 (включающим В/Flo HDC и SDC, слитый с TDC H5/Indo). Для каждого конструкта проводили анализ экстрактов белков, полученных из трех отдельных растений. Загружали 20 мг белка для каждого анализируемого растения. Вестерн-блот выявляли при помощи поликлональных антител к НА В/Florida (NIBSC 07/356).

На фигуре 15 показаны результаты определения методом иммуноблоттинга уровня экспрессии Н3/Bri в нативной форме, конструкта 736 (включающего PDI sp-H3/Bri) или с конструктом 737 (H3/Bri HDC и SCD, слитый с H5/Indo TDC). Для каждого конструкта проводили анализ экстрактов белков, полученных из трех отдельных растений. Загружали 20 мг белка для каждого анализируемого растения. Вестерн-блот выявляли при помощи поликлональных антител к Н3 Brisbane (NIBSC 08/124).

На Фигуре 16 приведены результаты гель-хроматографии белковых экстрактов, полученных из листьев растений, инфильтрированных конструктом номер 745. Для каждой фракции показано относительное содержание белка во фракциях элюирования. Результаты иммунологического анализа (Вестерн-блоттинга) гемагглютинина с применением поликлональных антител к НА В/Florida (NIBSC 07/356) во фракциях 7-15 показаны под графиком. Пик элюирования Blue Dextran 2000 показан стрелкой (фракция 8).

На Фигуре 17 показана последовательность нуклеиновой кислоты (SEQ ID NO: 52) синтезированного фрагмента, включающего полный участок кодирования H5 (А/Indonesia/5/05 (H5N1)) (включающий сигнальный пептид и стоп - код он), фланкированный в положении 5' сайтом HindIII и в положении 3' - сайтом SacI.

На Фигуре 18 показана последовательность нуклеиновой кислоты (SEQ ID NO: 53) конструкта 660, кассета экспрессии НА, включающая промотор пластоцианина люцерны и 5'UTR, последовательность, кодирующую гемагглютинин формы H5 А/Indonesia/5/05 (H5N1), последовательность 3'UTR пластоцианина люцерны и терминаторная последовательность.

На Фигуре 19 показана последовательность нуклеиновой кислоты (SEQ ID NO: 54) H1 дикого типа (А/New Caledonia/20/99 (H1N1) (GenBank acc. no. AY 289929), кодирующая последовательность без TmD и Ctail.

На Фигуре 20 приведена последовательность нуклеиновой кислоты (SEQ ID NO: 55) синтезированного фрагмента, содержащая последовательность, кодирующую H1 (А/New Caledonia/20/99 (H1N1), в которой отсутствуют TmD и Ctail. В положении 5' последние нуклеотиды происходят от PDI SP и включают сайт рестрикции BglII и в положении 3', двойной сайт SacI/StuI расположен сразу же в направлении 5'-3' стоп - ко дона.

На Фигуре 21 приведена нуклеотидная последовательность (SEQ ID NO: 56) синтезированного фрагмента, содержащая последовательность, кодирующую С - ter H1 (А/New Caledonia/20/99 (H1N1)), включающую TmD и Ctail из сайта Kpnl к стоп - кодону (фланкированному в положении 3' двойным сайтом SacI/StuI).

На Фигуре 22 оказана нуклеотидная последовательность для Medicago sativa mRNA протеин - дисульфидизомеразы. GenBank Accession No. Z11499 (SEQ ID NO: 57). Нуклеотиды 32-103 кодируют сигнальный пептид PDI.

На Фигуре 23 показана нуклеотидная последовательность плазмиды PromPlasto - PDISP - Plasto 3'UTR. На Фигуре 23A показана нуклеотидная последовательность в PromPlasto - PDISP (SEQ ID NO: 58). На Фигуре 23B показана нуклеотидная последовательность в Plasto 3'UTR (SEQ ID NO: 85). Сигнальный пептид протеин-дисульфидизомеразы (PDI) подчеркнут. Сайты рестрикции BglII (AGATCT) и SacI (GAGCTC), использованные для клонирования, выделены жирным шрифтом.

На Фигуре 24 показана нуклеотидная последовательность (SEQ ID NO: 59; конструкт 540) кассеты экспрессии НА, включающей промотор пластоцианина люцерны и 5'UTR, последовательность, кодирующую сигнальный пептид из PDI и формы H1A/New Caledonia/20/99 (H1N1), 3'UTR и терминаторные последовательности пластоцианина люцерны. H1 из кодирующей последовательности А/New Caledonia/20/1999 подчеркнута.

На Фигуре 25 приведена нуклеотидная последовательность (SEQ ID NO: 60) синтезированного фрагмента, содержащая полную область, кодирующую H1 (А/Brisbane/59/07 (H1N1) (включая сигнальный пептид и стоп - кодон), фланкированный в положении 5' последовательностями гена пластоцианина люцерны, соответствующими первьм 84 нуклеотидам в обратном направлении от первоначального ATG, начиная с сайта DraIII, и фланкированного в положении 3'-сайтом SacI.

На Фигуре 26 показана нуклеотидная последовательность (SEQ ID NO: 61; конструкт 774) кассеты для экспрессии НА, включающей промотор и 5'UTR пластоцианина люцерны, последовательность, кодирующую гемагглютинин формы H1A/Brisbane/59/07 (H1N1), последовательность 3'UTR и терминаторную последовательность пластоцианина люцерны.

На Фигуре 27 показана нуклеотидная последовательность кассеты экспрессии номер 828 (SEQ ID NO: 62) от сайта PacI (против хода транскрипции относительно промотора) к сайту Asd (непосредственно по ходу транскрипции от NO - терминатора). Последовательность CPMV НТ 3'UTR подчеркнута и мутированный ATG выделен жирным шрифтом. Сайт рестрикции Apal подчеркнут и выделен курсивом.

На Фигуре 28 показана нуклеотидная последовательность (SEQ ID NO: 63; конструкт 690) кассеты экспрессии химерного Н5/H1, включающая промотор и 5'UTR пластоцианина люцерны, последовательность, кодирующую химерный гемагглютинин, 3'UTR и терминаторную последовательность пластоцианина люцерны. Последовательность, кодирующая химерный НА, подчеркнута.

На Фигуре 29 показана нуклеотидная последовательность (SEQ ID NO: 64; конструкт 691) кассеты для экспрессии химерного Н5/H1, включающая промотор и 5'UTR пластоцианина люцерны, последовательность, кодирующую химерный гемагглютинин, 3'UTR и терминаторную последовательность пластоцианина люцерны. Последовательность, кодирующая химерный НА, подчеркнута.

На Фигуре 30 показана нуклеотидная последовательность (SEQ ID NO: 65; конструкт 696) кассеты экспрессии химерного Н5/H1, включающая промотор пластоцианина люцерны и 5'UTR, последовательность, кодирующую химерный гемагглютинин, последовательность 3'UTR и терминаторную последовательность пластоцианина люцерны. Последовательность, кодирующая химерный НА, подчеркнута.

На Фигуре 31 показана нуклеотидная последовательность (SEQ ID NO: 66; конструкт 732) кассеты экспрессии НА, включающая промотор CaMV 35S, CPMV-НТ 5'UTR, кодирующую последовательность гемагглютинина формы H1 A/Brisbane/59/07 (H1N1), терминаторные последовательности CPMV - НТ 3'UTR и NO. Последовательность, кодирующая H1/Bri, подчеркнута.

На Фигуре 32 показана нуклеотидная последовательность (SEQ ID NO: 67) кодирующей последовательности от ATG до стоп - кодона промежуточного конструкта номер 787.

На Фигуре 33 показана нуклеотидная последовательность (SEQ ID NO: 68; конструкт номер 733) кассеты экспрессии SpPDI H1/Bri, включающей промотор CaMV 35S, CPMV-HT 5'UTR, последовательность, кодирующую сигнальный пептид из PDI, кодирующую последовательность гемагглютинина формы H1A/Brisbane/59/07 (H1N1), CPMV - НТ 3'UTR и последовательности NO - терминатора. Последовательность, кодирующая SpPDI H1/Bri, подчеркнута.

На Фигуре 34 показана нуклеотидная последовательность (SEQ ID NO: 69; конструкт номер 734) кассеты экспрессии химерного Н5/H1, включающая промотор CaMV 35S, CPMV - НТ 5'UTR, кодирующую последовательность химерного гемагглютинина, последовательность CPMV - НТ 3'UTR и последовательность NO - терминатора. Последовательность, кодирующая химерный НА, подчеркнута.

На Фигуре 35 показана нуклеотидная последовательность (SEQ ID NO: 70) синтезированного фрагмента, включающего полный кодирующий участок Н3 (А/Brisbane/10/07 (H3N2)) (включая сигнальный пептид и стоп - кодон), фланкированный в положении 5' нуклеотидными последовательностями генов пластоцианина люцерны, соответствующими первьм 84 нуклеотидам против хода транскрипции от исходного ATG, начиная с сайта DraIII, и в положении 3' - сайтом SacI.

На Фигуре 36 показана нуклеотидная последовательность (SEQ ID NO: 71; конструкт номер 736) кассеты экспрессии НА, включающей промотор CaMV 35S, CPMV-HT 5'UTR, кодирующую последовательность сигнального пептида из PDI, кодирующую последовательность гемагглютинина формы H3A/Brisbane/10/07 (H2N3), CPMV - HT 3'UTR и последовательности NO - терминатора. Последовательность, кодирующая SpPDI H1/Bris, подчеркнута.

На Фигуре 37 показана нуклеотидная последовательность (SEQ ID NO: 72; конструкт номер 737) кассеты экспрессии химерного Н5/H3, включающая промотор CaMV 35S, CPMV-HT 5'UTR, кодирующую последовательность сигнального пептида из PDI, кодирующую последовательность химерного гемагглютинина, последовательность CPMV-HT 3'UTR и последовательности NO - терминатора. Последовательность, кодирующая химерный НА, подчеркнута.

На Фигуре 38 показана нуклеотидная последовательность (SEQ ID NO: 73) синтезированного фрагмента, включающая полную область, кодирующую НА (В/Florida/4/06) (включая сигнальный пептид и стоп - кодон), фланкированный в положении 5' нуклеотидными последовательностями гена пластоцианина люцерны, соответствующими первым 84 нуклеотидам вверх по ходу транскрипции от исходной ATG, начиная с сайта DraIII, и фланкированного в положении 3' сайтом SacI.

На Фигуре 39 показана нуклеотидная последовательность (SEQ ID NO: 74; конструкт номер 739) кассеты экспрессии НА, включающая промотор CaMV35S, CPMV - HT 5'UTR, последовательность, кодирующую сигнальный пептид из PDI, кодирующую последовательность гемагглютинина НА формы В/Florida/4/06, CPMV - HT 3'UTR и последовательности NO - терминатора. Последовательность, кодирующая Sp PDI B/Flo, подчеркнута

На Фигуре 40 показана нуклеотидная последовательность (SEQ ID NO: 75; конструкт номер 745) кассеты экспрессии химерного Н5/В, включающая промотор CaMV 35S, CPMV-HT 5'UTR, кодирующую последовательность химерного гемагглютинина, последовательность CPMV-HT 3'UTR и последовательности NO - терминатора. Последовательность, кодирующая химерный НА, подчеркнута.

На Фигуре 41 показана нуклеотидная последовательность, кодирующая Msj1 (SEQ ID NO: 76).

На Фигуре 42 показана нуклеотидная последовательность (SEQ ID NO: 77) части конструкта номер R850 от сайта HindIII (в сайте множественного клонирования, против хода транскрипции от промотора) до сайта EcoRI (по ходу транскрипции от терминатора NO). Последовательность, кодирующая HSP40, подчеркнута.

На Фигуре 43 показана нуклеотидная последовательность (SEQ ID NO: 78) части конструкта номер R860 от сайта HindIII (в сайте множественного клонирования, против хода транскрипции от промотора) до сайта EcoRI (сразу же по ходу транскрипции от терминатора NO). Последовательность, кодирующая HSP70, подчеркнута.

На Фигуре 44 показана нуклеотидная последовательность (SEQ ID NO: 79) части конструкта номер R870 от сайта HindIII (в сайте множественного клонирования, против хода транскрипции от промотора) до сайта EcoRI (по ходу транскрипции по течению от терминатора NO). Последовательность, кодирующая HSP40, выделена курсивом и подчеркнута и последовательность, кодирующая HSP70, подчеркнута.

На Фигуре 45 представлено схематическое изображение конструкта номер R472.

На Фигуре 46 показан дисульфидный мостиковый "образ" вируса гриппа типа А. Нумерация в мостике: 1) Cys4HA1-Cysl37HA2, 2) Cys60HA1-Cys72HA1, 3) Cys94HA1-Cysl43HA1, 4) Cys292HA1-Cys318HA1 5) Cysl44HA2-Cysl48HA2 и 6) Cys52HA1-Cys277HA1. Дисульфидные мостики, которые являются разными у вирусов подтипов А и В (Фигура 47), указаны стрелками. Применена нумерация, начиная от зрелого белка Н3.

На Фигуре 47 показан дисульфидный мостиковый "образ" вируса гриппа типа В НА. Нумерация в мостике: 1) Cys4HA1-Cysl37HA2, 2) Cys60HA1-Cys72HA1, 3) Cys94HA1-Cysl43HA1, 4) Cys292HA1-Cys318HA1 5) Cysl44HA2-Cysl48HA2, 6) Cys52HA1-Cys277HA1, 7) Cys54HA1-Cys57HA1 и 8) Cysl78HA1-Cys272HA1. Дисульфидные мостики, которые являются разными у вирусов подтипов А и В (Фигура 46), указаны стрелками. Применена нумерация последовательности зрелого белка Н3.

На Фигуре 48 показана схематическая диаграмма, которая показывает переходы слияния в домене. На Фигуре 48A показано слияние субдомена RB от H1/Bri, Н3/Bri и В/Flo с Н5/Indo SDC's, и субдомена RB от Н5/Indo со "стволовым" доменом H1/NC. На Фигуре 48B показано слияние субдоменов Е1-RB-Е2 (HDC) от H1/Bri, Н3/Bri или В/Flo с Н5/Indo SDC и Н5/Indo HDC с SDC H1/NC.

На Фигуре 49A показана нуклеотидная последовательность (SEQ ID NO: 86) H1 A/California/04/09. Последовательность, кодирующая сигнальный пептид протеин - дисульфидизомеразы, подчеркнута и последовательность, кодирующая зрелый H1, выделена жирным шрифтом. На Фигуре 49 В показана аминокислотная последовательность (SEQ ID NO: 87) в H1 A/California/04/09. Сигнальный пептид протеин - дисульфидизомеразы люцерны подчеркнут.

На Фигуре 50 показаны результаты определения методом иммуноблоттинга уровня экспрессии химерного гемагглютинина Н5/В (конструкт номер 747; включающий В/Flo HDC и SDC, слитые с Н5/Indo TDC) после инфильтрации AGL1/747, неразбавленного, инфильтрированного совместно с AGL1/443 ("пустой" вектор) и инфильтрированного совместно с AGL1/R870 (HSP40/HSP70). Для каждого конструкта проводили анализ экстрактов белков, полученных из трех отдельных растений. Загружали 20 мкг белка для каждого анализируемого растения. Вестерн-блот проявляли при помощи поликлональных антител к В/Florida (NIBSC).

На Фигуре 51A показана нуклеотидная последовательность для промоторной последовательности 2X35S (SEQ ID NO: 88). На Фигуре 51B показана нуклеотидная последовательность для конструкта 747 (SEQ ID NO: 93) от сайта Pad (вверх по течению от промотора 35S) до сайта AscI (сразу же вниз по течению от терминатора NO). Последовательность кодирования химерного НА подчеркнута. Последовательность промотора 2X35S выделена курсивом.

ОСУЩЕСТВЛЕНИЕ ИЗОБРЕТЕНИЯ

Данное изобретение относится к вирусоподобным частицам. Более конкретно, настоящее изобретение направлено на создание вирусоподобных частиц, содержащие химерный гемагглютинин вируса гриппа, и на способы получения химерных вирусоподобных частиц вируса гриппа.

Ниже следует описание предпочтительного варианта.

Настоящее изобретение предусматривает нуклеиновую кислоту, содержащую нуклеотидную последовательность, кодирующую химерный гемагглютинин (НА) вируса гриппа, функционально связанный с регуляторным участком, который активен в растении.

Кроме того, данное изобретение предусматривает способ получения вирусоподобных частиц (VLP) в растении. Этот способ включает введение в растение или его часть нуклеиновой кислоты, кодирующей химерный белок НА вируса гриппа, функционально связанный с регуляторной областью, активной в растении, и инкубирование растения или части этого растения при условиях, которые позволяют осуществиться экспрессии нуклеиновой кислоты с получением при этом VLP.

Данное изобретение предусматривает также получение VLP, содержащей химерный белок НА вируса гриппа.

VLP может быть получена способом, который предусмотрен данным изобретением.

Под термином "химерный белок" или "химерный полипептид" подразумевают белок или полипептид, который содержит аминокислотные последовательности из двух или из более, чем двух источников, например, но без ограничения, двух или более типов или подтипов вируса гриппа или вируса гриппа другого происхождения, при этом аминокислотные последовательности слиты в один полипептид. Химерный белок или полипептид могут включать сигнальный полипептид, который является таким же, как остальная часть полипептида или белка или быть гетерологичным по отношению к ним.

Химерный белок или химерный полипептид могут быть получены в виде транскрипта из химерной нуклеотидной последовательности и после синтеза химерный белок или химерный полипептид отщепляются и, как это требуется, ассоциирует с образованием многомерного белка. Следовательно, химерный белок или химерный полипептид также включает белок или полипептид, содержащий подъединицы, которые связаны при помощи дисульфидных мостиков (то есть многомерный белок). Например, химерный полипептид, содержащий аминокислотные последовательности из двух или более источников, может быть превращен в подъединицы и эти подъединицы, связанные через дисульфидные мостики, могут образовать химерный белок или химерный полипептид (см. Фигуры 46 и 47). Такой полипептид может быть гемагглютинином (НА) и каждая из двух или более, чем двух аминокислотных последовательностей, которая образует полипептид, может быть получена из разных HAs с получением химерного НА или химерного НА вируса гриппа. Химерный НА может также включать аминокислотную последовательность, содержащую гетерологичный сигнальный пептид (химерный белок - предшественник), который расщепляется в процессе синтеза или после завершения синтеза белка. Предпочтительно, химерный полипептид или химерный НА вируса гриппа не являются белками природного происхождения. Нуклеиновая кислота, которая кодирует химерный полипептид, может быть описана как "химерная нуклеиновая кислота" или "химерная нуклеотидная последовательность". Вирусоподобная частица, содержащая химерный НА, может быть названа "химерной VLP". Химерный НА вируса гриппа в соответствии с различными вариантами данного изобретения может включать кластер "стволового" домена или "ствола" домена (SDC), кластер головного домена (HDC) и кластер трансмембранного домена (TDC), где один или более, чем один субдомен, или SDC, или HDC, или TDC, представляет собой субдомены НА первого типа, подтипа вируса гриппа или они могут быть одного происхождения, и один или более, чем один субдомен SDC, или HDC, или TDC относятся к субдоменам НА второго типа, подтипа вируса гриппа или имеют другое происхождение. Как описано выше, SDC включает субдомен F'1, F'2 и F; HDC включает субдомен RB, Е1 и Е2; TDC включает субдомен TmD и Ctail (TMD/СТ; см. Фигуры 1A, 46 и 47).

Термины "вирусоподобная частица" (VLP) или "вирусоподобные частицы" или "VLP" относятся к структурам, которые самообразуются и включают структурные белки, такие как белок НА вируса гриппа или химерный белок НА вируса гриппа. VLP и химерные VLP в общем морфологически и антигенно подобны вирионам, образующимся во время инфекции, но не содержат генетической информации, достаточной для осуществления репликации, и поэтому не являются инфекционными. VLP и химерные VLP могут быть получены в подходящих клетках хозяина, включая клетки растения-хозяина. После экстракции из клетки-хозяина и после выделения и последующей очистки в подходящих условиях VLP и химерные VLP могут быть получены в виде интактных структур.

Химерные VLP или VLP, полученные из белков вируса гриппа, в соответствии с данным изобретением не содержат белок М 1. Известно, что белок М 1Связывает РНК (Wakefield and Brownlee, 1989), которая загрязняет получаемую VLP. Наличие РНК является нежелательным при получении разрешения регулирующего органа на производство химерной VLP, следовательно, получение химерной VLP, не содержащей РНК, может быть предпочтительным.

Химерные VLP в соответствии с данным изобретением могут быть получены в клетке хозяине, которая характеризуется отсутствием способности сиалилировать белки, например, в клетке растения, в клетке насекомого, грибка или других организмов, включая губки, кишечнополостные, кольчатые черви, артроподы, моллюски, нематоды, трогельминты (trochelmintes), плоские черви (plathelmintes), щетинкочелюстные черви, щупальцевые животные, хламидии, спирохеты, грамм - положительные бактерии, цианобактерии, архебактерии и т.п. См., например, Gupta et al., 1999. Nucleic Acids Research 27: 370-372; Toukach et al., 2007. Nucleic Acids Research 35: D280-D286; Nakahara et al., 2008. Nucleic Acids Research 36: D368-D371. Химерные VLP, полученные, как описано в данной заявке, обычно не содержат нейраминидазу (NA). Однако, если желательно получить VLP, содержащие НА и NA, NA может быть экспрессирована вместе с НА.

Данное изобретение предусматривает также VLP, содержащие химерный НА, который приобрел липидную оболочку из плазменной мембраны клетки, в которой происходила экспрессия химерного НА. Например, если химерный НА экспрессирован в системе на основе растения, полученная VLP может получить оболочку из плазменной мембраны клетки растения.

В общем термин "липид" относится к жирорастворимым (липофильным) молекулам природного происхождения. Химерная VLP, полученная в растении, в соответствии с некоторыми аспектами данного изобретения может образовывать комплексы с липидами растений. Липиды, происходящие из растений, могут быть в виде двухслойного липида и дополнительно могут содержать оболочку, окружающую VLP. Липиды, происходящие из растений, могут включать липидные компоненты плазменной мембраны растения, где получаются VLP, включая фосфолипиды, три-, ди- и моноглицериды, а также жирорастворимый стерол или метаболиты, содержащие стерол. Примеры включают фосфатидилхолин (PC), фосфатидилэтаноламин (РЕ), фосфатидилинозитол, фосфатидилсерин, гликосфинголипиды, фитостеролы или их комбинацию. Липид, происходящий из растений, иначе может называться "растительным липидом". Примеры фитостеролов включают кампестерол, стигмастерол, эргостерол, брассикастерол, дельта-7-стигмастерол, дельта-7-авенастерол, дауностерол, ситостерол, 24-метилхолестерин, холестерин или бета-ситостерол - см., например, Mongrand et al., 2004. Как ясно специалисту в данной области, липидная композиция плазменной мембраны клетки может меняться в зависимости от культуры или условий роста клетки или организма или вида, из которого получена клетка. Обычно самым распространенным фитостеролом является бета - ситостерол.

Клеточные мембраны обычно содержат липидные бислои, а также белки, выполняющие различные функции. Локализованные концентрации конкретных липидов могут быть обнаружены в липидном бислое, они называются липидным "рафтом" (микродоменом липидного бислоя). Эти микродомены липидного рафта могут быть обогащены сфинголипидами и стеролами. Не намереваясь ограничиваться какой-либо одной теорией, предполают, что липидный рафт может играть значительную роль в эндо - и экзоцитозе, входе и выходе вирусов или других инфекционных агентов из клеток, в межклеточном сигнале, трансдукции, во взаимодействии с другими структурными компонентами клетки или организма, такими как внутриклеточные и внеклеточные матрицы.

Данное изобретение включает VLP, содержащие химерный НА, субдомены которого могут быть получены из любого типа, подтипа вируса гриппа, который может инфицировать людей, включая, например, типы и подтипы В, H1, Н2, Н3, Н4, Н5, H6, Н7, Н8, Н9, H10, H11, Н12, Н13, Н14, Н15 и Н16. Согласно некоторым примерам вирус гриппа может быть типа или подтипа H1, Н3, Н5 или В. Неограничивающие примеры типов или подтипов H1, Н3, Н5 или В включают А/New Caledonia/20/99, подтип (H1N1) ("H1/NC"; SEQ ID NO: 56), H1 A/California 04/09, подтип (H1N1) ("H1/Cal"; SEQ ID NO: 86), A/Indonesia /5/05, подтип (H5N1) ("Н5/Indo"), A/Brisbane/59/2007 ("H1/Bri") и В/Florida/4/2006 ("В/Flo") и H3A/Brisbane /10/2007 ("Н3/Bri"). Кроме того, химерный НА дополнительно может включать один или более субдоменов гемагглютинина, который выделен из одного или более вновь появляющихся или впервые идентифицированных вирусов гриппа.

Данное изобретение относится также к вирусам гриппа, которые инфицируют других млекопитающих или животных-хозяев, например, людей, приматов, лошадей, свиней, птиц, водоплавающую птицу, мигрирующих птиц, перепелов, уток, гусей, домашнюю птицу, цыплят, верблюда, собаку, кошек, тигра, леопарда, цивет, норку, куницу, хорьков, домашних любимцев, домашний скот, мышей, крыс, тюленей, китов и т.п. Некоторые вирусы гриппа могут инфицировать более одного животного-хозяина.

Имея в виду вирус гриппа, термин "гемагглютинин" или "НА", используемый в данной заявке, следует отнести к структурному гликопротеину частиц вируса гриппа. Структура гемагглютинина вируса гриппа хорошо изучена и демонстрирует высокую степень консерватизма во вторичной, третичной и четвертичной структуре. Этот консерватизм структуры наблюдается даже хотя аминокислотная последовательность может меняться (см., например, SkehE1 and Wiley, 2000, Ann. Rev. Biochem. 69: 531-69; Vaccaro et al., 2005; эти источники включены в качестве ссылок в данную заявку). Нуклеотидные последовательности, кодирующие НА, хорошо известны и доступны, см., например. The BioDefense and Public Health Database (например, URL: biohealthbase.org/GSearch/home.do?decorator=Influenza) или в базах данных, поддерживаемых National Center for Biotechnology Information (NCL2I; например, URL: nCl2i.nlm.nih.gov/sites/entrez?db=nuccore&cmd=search&term=influenza), при этом обе базы данных включены в данную заявку в качестве ссылок.

Мономер На может быть подразделен на три функциональных домена - "стволовой домен" или кластер домена "ствола" (SDC), глобулярный головной домен или кластер головного домена (HDC) и кластер трансмембранного домена (TDC). SDC содержит четыре субдомена, слитый пептид F, F'1 и F'2 (этот субдомен обычно можно назвать "каркасом"). TDC содержит два субдомена, трансмембранный (TmD) и С - концевой хвостовой субдомен (СТ). HDC содержит три субдомена, vestigial домены эстеразы ЕГ и Е2 и рецептор-связывающий домен RB. SDC и HDC могут вместе называться "эктодоменом".

Публикация На et al., 2002 (EMBO J. 21: 865-875; которая включена в данную заявку посредством отсылки) иллюстрирует относительную ориентацию различных субдоменов SDC и HDC в нескольких подтипах вируса гриппа на основе рентгенограмм кристаллических структур. Схематическая диаграмма субдоменов относительно N - конца и С - конца полипептидов НА1 и НА2 показана на Фигуре 1A. Аннотированное структурное выравнивание различных подтипов вируса гриппа показано на Фигуре 1С.

В гемагглютининах вирусов гриппа допускается вариация аминокислот. Эта вариация обеспечивает новые штаммы, которые постоянно идентифицируются. Инвазионная способность может отличаться от вируса к вирусу. Однако образование тримеров гемагглютинина, которые затем обеспечивают получение VLP, сохраняется. Следовательно, данное изобретение обеспечивает наличие аминокислотной последовательности гемагглютинина, включающей химерный НА или нуклеиновую кислоту, которая кодирует аминокислотную последовательность химерного гемагглютинина, которая образует VLP в растении и включает известные последовательности и вариантные последовательности НА, которые могут развиться. Данное изобретение также относится к применению полипептида химерного НА, содержащего домены TDC, SDC и HDC. Например, химерный белок НА может быть НА0 или отщепленный химерный НА, содержащий субдомены НА1 и НА2 из двух или более типов вируса гриппа. Химерный белок НА может быть применен для получения или образования VLP с использованием растения, клетки растения, системы экспрессии.

НА0 может экспрессироваться и свертываться с образованием тримера, который затем может собираться с образованием VLP. Расщепление НА0 приводит к образованию полипептидов НА1 и НА2, связанных дисульфидным мостиком (для иллюстрации вида дисульфидного мостика см. Фигуры 1С, 46 и 47). Для инфекционной вирусной частицы расщепление предшественника НА0 требует запуска конформационного изменения, которое высвобождает белок слияния (на N-конце полипептида НА2) и делает его доступным для слияния клетки и вирусных мембран. Однако VLP не являются инфекционными и расщепление НА на НА1 и НА2 не требуется, например, для производства вакцины. Нерасщепленный предшественник НА0 также собирается в тримеры и отпочковывается от плазменной мембраны с образованием наночастиц VLP.

Полипептид НА0 содержит несколько доменов. Субдомен RB в HDC включает несколько петель в антигенных областях, обозначенных как сайт А-Е. Антитела, которые могут нейтрализовать инфекционный вирус гриппа, часто нацелены на один или несколько таких сайтов. Рудиментарные субдомены эстеразы (Е1 и Е2) могут играть роль в слиянии и могут связывать Са++. Домены F, F'1 и F'2 взаимодействуют и кооперируются с образованием ствола, поднимая головку тримера НА над мембраной. TmD и СТ могут участвовать в фиксировании складчатого НА на мембране. TmD может играть роль в сродстве НА к липидным рафтам, в то время, как СТ может играть роль в секреции НА, а некоторые цистеиновые остатки, найденные в субдомене СТ, могут быть пальмитилированы. На N - конце полипептида НА0 может быть обнаружен сигнальный пептид (SP). Фигура 2 и Таблицы 4 и 5 иллюстрируют примеры аминокислотных последовательностей доменов SP, F'1, F'2, E1, RB, E2 и F некоторых субтипов вируса гриппа.

Процессинг последовательности N - концевого сигнального пептида (SP) во время экспрессии и/или секреции гемагглютининов вирусов гриппа может иметь значение в процессе фолдинга белка НА. Термин "сигнальный пептид" обычно относится к короткой последовательности аминокислот (около 5-30 аминокислот), обнаруживаемой обычно на N - конце полипептида гемагглютинина, который может направлять прямую транслокацию вновь транслированного полипептида к конкретной органелле или помогать в позиционировании специфических доменов цепи полипептида относительно других доменов. Сигнальный пептид гемагглютининов нацеливает транслокацию белка в эндоплазменный ретикулюм и был предложен в качестве средства, способствующего позиционированию N - концевого проксимального домена по отношению к мембранно-якорному домену растущего полипептида гемагглютинина для расщепления и фолдинга зрелого гемагглютинина.

Инсерция НА внутрь эндоплазменной ретикулярной (ER) мембраны клетки-хозяина, расщепление сигнального пептида и гликозилирование белков представляют собой элементы совместной трансляции белков. Корректный фолдинг НА требует гликозилирования белка и образования по меньшей мере 6 межцепных дисульфидных связей (см. Фигуры 46 и 47). На Фигуре 46 показано, что НА подтипа А имеет 6 консервативных дисульфидных мостиков мономере. Для сравнения мономер НА подтипа В (Фигура 47) имеет 7 дисульфидных мостиков и пять из этих дисульфидных мостиков имеют ответную часть в А (см. обзор SkehE1 and Wiley, 2000. Ann. Rev. Biochem. 69: 531-569; примеры структур, иллюстрирующих внемолекулярные и внутримолекулярные дисульфидные мостики и другие консервативные аминокислоты и их относительное положение описаны, например, в Gamblin et al., 2004, Science 303: 1838-1842; оба указанных источника включены в качестве ссылок в данную заявку). Как известно специалисту в данной области, при получении химерных HAs является важным обеспечить похожее расположение дисульфидных мостиков.

Сигнальный пептид может быть нативным по отношениюк гемагглютинину или сигнальный пептид может быть гетерологичным по отношению к первичной последовательности гемагглютинина, который экспрессируется. Химерный НА может включать сигнальный пептид из типа, подтипа или штамма первого вируса гриппа при наличии баланса НА от одного или более, чем одного другого типа, подтипа или штамма.

Например, нативный SP подтипов НА, таких как В H1, Н2, Н3 или Н5, Н7, Н9 или вируса типа В может быть применен для экспрессии НА в системе растения. В соответствии с некоторыми вариантами SP может быть пептидом вируса гриппа типов В, H1, Н3 или Н5; или подтипа H1/Bri, H1/NC, Н5/Indo, Н3/Bri или В/Flo.

SP также может быть не нативным, например, из структурного белка или гемагглютинина вируса, не являющегося вирусом гриппа, или из растения, животного или бактериального полипептида. Неограничивающим примером сигнального пептида, который может быть использован, является протеин - дисульфидизомераза люцерны (PDI SP; нуклеотиды 32-103, Accession No. Z11499; SEQ ID NO: 34; Фигура 17), имеющая аминокислотную последовательность:

MAKNVAIFGLLFSLLLLVPSQIFAEE (нуклеотиды 32-103; SEQ ID NO: 34)

Следовательно, данное изобретение предусматривает химерный гемагглютинин вируса гриппа, содержащий нативный или не нативный сигнальный пептид и нуклеиновые кислоты, кодирующие такие химерные гемагглютинины.

Корректный фолдинг гемагглютининов может быть важным для стабильности белка, образования мультимеров, образования VLP и функции НА (способности к гемагглютинации) наряду с другими характеристиками гемагглютининов вируса гриппа. На фолдинг белка могут влиять один или несколько факторов, включая, но без ограничения, последовательность белка, распространенность белка, степень внутриклеточного роста, доступность кофакторов, которые могут связывать или быть временно ассоциированы со свернутым, частично свернутым или неструктурированным белком, наличие одного или более шапероновых белков и т.п.

Белки теплового шока (Hsp) или стрессовые белки представляют собой примеры белков-шаперонов, которые могут принимать участие в различных клеточных процессах, включая синтез белков, внутриклеточную направленную миграцию, предотвращение мисфолдинга, предотвращение агрегации белков, сборку и отсутствие комплексов белков, фолдинг белков и дезагрегацию белков. Примеры таких белков-шаперонов включают, но без ограничения, Hsp60, Hsp65, Hsp 70, Hsp90, Hsp 100, Hsp20-30, Hsp10, Hsp100-200, Hsp100, Hsp90, Lon, TF55, FKBPs, циклофилины, CIpP, GrpE, убиквитин, калнексин и протеин - дисульфидизомеразы (см., например, Macario, A.J.L., Cold Spring Harbor Laboratory Res. 25: 59-70. 1995; Parsell, D.A.&Lindquist, S. Ann. Rev. Genet. 27:437-496 (1993); патент США №5232833). Как описано в данной заявке, шапероновые белки, например, но без ограничения, Hsp 40 и Hsp 70, могут быть применены для обеспечения фолдинга химерного НА.

Примеры Hsp70 включают Hsp 72 и Hsc 73 из человеческих клеток, DnaK из клеток бактерий, особенно микобактерий, таких как Mycobacterium leprae, Mycobacterium tuberculosis и Mycobacterium bovis (таких как Bacille - Calmette Guerin: обозначаемые здесь как Hsp 71), DnaK из клеток Escherichia coli, дрожжей и других прокариотных клеток и BiP и Grp 78 из эукариотных клеток, таких как A. tHA1iana (Lin et al. 2001 (Cell Stress and Chaperones 6: 201-208)). Конкретным примером Hsp 70 является Hsp 70 A. tHA1iana (кодированный, Genbank ref: AY120747.1). Hsp 70 способен к специфичному связыванию с АТР, а также с несвернутыми белками и пептидами, принимая при этом участие в фолдинге белков и развертывании белков, а также в сборке и исчезновении белковых комплексов.

Примеры Hsp40 включают DnaJ из прокариотных клеток, таких как Е. coli и микобактерий, и HSJ1, HDJ1 и Hsp40 из эукариотных клеток, таких как клетки люцерны (Frugis et al., 1999. Plant Molecular Biology 40: 397-408). Конкретный пример Hsp40 представляет собой М. sativa MsJl (AJ000995.1 или SEQ ID NO: 76). Hsp40 играет роль молекулярного шаперона в процессе фолдинга белков, терморезистентности и репликации ДНК наряду с прочими клеточными событиями. На Фигуре 41 показана нуклеотидная последовательность, кодирующая Msjl (SEQ ID NO: 76).

Среди Hsps именно Hsp 70 и его ко - шаперон, Hsp 40, участвуют в стабилизации трансляции и в стабилизации вновь синтезированных полипептидов до завершения синтеза. Не основываясь на какой-либо одной теории, полагают, что Hsp40 связывается с гидрофобными петчами несвернутых (растущих или вновь перенесенных) полипептидов, тем самым способствуя взаимодействию комплекса Hsp70 - АТР с полипептидом. Гидролиз АТР приводит к образованию стабильного комплекса между полипептидом, Hsp70 и ADP и высвобождению Hsp40. Ассоциация комплекса Hsp70 - ADP с гидрофобными петчами полипептида предотвращает их взаимодействие с другими гидрофобными петчами, препятствуя некорректному фолдингу и образованию агрегатов с другими белками (см., обзор в Harti, FU. 1996. Nature 381: 571-579).

Нативные белки-шапероны могут быть способны способствовать облегчению корректного фолдинга низких уровней рекомбинантного белка, но так как уровни экспрессии возрастают, количество нативных шаперонов становится лимитирующим фактором. Высокие уровни экспрессии гемагглютинина в агроинфильтрованных листьях могут приводить к аккумуляции полипептидов гемагглютинина в цитозоле, и совместная экспрессия одного или более, чем одного шаперонового белка, такого как Hsp 70, Hsp 40 или и Hsp 70, и Hsp 40, может снижать уровень неправильно свернутого или агрегированного гемагглютинина и увеличивать количество полипептидов, обладающих третичными и четвертичными структурными характеристиками, которые позволяют осуществиться гемагглютинации и/или образованию вирусоподобных частиц. SEQ ID NO: 77 представляет собой нуклеотидную последовательность области конструкта номер R850, от сайта HindIII (в сайте множественного клонирования, против хода транскрипции от промотора) до сайта EcoRI (сразу же по ходу транскрипции от NO - терминатора), кодирующую HSP40 (подчеркнута). SEQ ID NO: 78 представляет собой нуклеотидную последовательность области конструкта номер R860, от сайта HindIII (в сайте множественного клонирования, против хода транскрипции от промотора) до сайта EcoRI (сразу же по ходу транскрипции от NO - терминатора), кодирующую HSP70 (подчеркнута). SEQ ID NO: 79 представляет собой нуклеотидную последовательность области конструкта номер R870, от сайта HindIII (в сайте множественного клонирования, 5', против хода траскрипции от промотора) до сайта EcoRI (сразу же по ходу транскрипции от NO - терминатора), кодирующую HSP40 (подчеркнутый курсив) и HSP70 (подчеркнута).

Следовательно, данное изобретение предусматривает также способ получения химерных VPLs вируса гриппа в растении, при этом первая нуклеиновая кислота, кодирующая химерный НА вируса гриппа совместно экспрессируется со второй нуклеиновой кислотой, кодирующей шаперон. Первая и вторая нуклеиновые кислоты могут быть введены в растение на одной и той же стадии или могут быть введены в растение последовательно.

VPLs можно оценивать в отношении их структуры и размера при помощи, например, определения гемагглютинации, методом электронной микроскопии или гель-хроматографии.

В случае гель-хроматографии общее количество растворимых белков может быть экстрагировано из ткани растения путем гомогенизации (в гомогенизаторе фирмы Polytron) образца измельченного замороженного растительного материала в буфере для экстракции, и нерастворимый материал удаляют путем центрифугирования. Может быть благоприятным осаждение при помощи PEG. Растворимый белок определяют количественно и экстракт пропускают через колонку с гранулами Sephacryl™. В качестве калибровочного стандарта для калибровки колонки можно применять голубой декстран. Blue Dextran 2000. После хроматографии можно проанализировать фракции путем иммуноблоттинга для определения комплемента белка фракции.

Данное изобретение предусматривает также растение, включающее нуклеиновую кислоту, кодирующую один или более, чем один химерный гемагглютинин вируса гриппа, и нуклеиновую кислоту, кодирующую один шаперон или более одного шаперона.

Настоящее изобретение включает нуклеотидные последовательности:

SEQ ID NO: 63 (конструкт 690; кассета для экспрессии химерного Н5/Н1, содержащая промотор и 5'UTR пластоцианина люцерны, последовательность, кодирующую химерный гемагглютинин, последовательность 3'UTR и терминаторную последовательность пластоцианина люцерны) и подчеркнутую часть SEQ ID NO: 63, кодирующую SP, F'1, E1 of H5/Indo - RB в H1/Bri - E2, F'2, F, TMD/CT в Н5/Indo;

SEQ ID NO: 64 (конструкт 691; кассета экспрессии химерного Н5/Н1, содержащая промотор и 5'UTR пластоцианина люцерны, последовательность, кодирующую химерный гемагглютинин, последовательность 3'UTR и терминаторную последовательность пластоцианина люцерны) и неподчеркнутую часть SEQ ID NO: 64, кодирующую SP, F'1, в Н5/Indo - El, RB.E2 в H1/Bri - F'1, F, TMD/CT в Н5/Indo;

SEQ ID NO: 65 (конструкт 696; кассета экспрессии химерного Н5/Н1, содержащая промотор и 5'UTR пластоцианина люцерны, последовательность, кодирующую химерный гемагглютинин, последовательность 3'UTR и терминаторную последовательность пластоцианина люцерны) и подчеркнутую часть SEQ ID NO: 65, кодирующую PDI SP - F'1, E1B H1/NC - RB в Н5/Indo - E2, F'2, F, TMD/CT в H1/NC;

SEQ ID NO: 68 (конструкт 733; кассета экспрессии SpPDI H1/Bri, включающая промотор CaMV 35S, CPMV - HT 5'UTR, последовательность, кодирующая сигнальный пептид из PDI, последовательность, кодирующая гемагглютинин формы H1 A/Brisbane/59/07 (H1N1), последовательность CPMV - HT 3'UTR и последовательность NO - терминатора) и подчеркнутую область SEQ ID NO:68, кодирующую PDI SP - F'1, El, RB,E2, F'2, F, TMD/CT в H1/BRI;

SEQ ID NO: 69 (конструкт 734; кассета экспрессии Н5/Н1, включающая промотор CaMV 35S, CPMV - HT 5'UTR, последовательность, кодирующую химерный гемагглютинин, последовательность CPMV - HT 3'UTR и последовательность NO - терминатора). Последовательность, кодирующая химерный НА, подчеркнута, она кодирует тот же самый химерный НА, что и последовательность SEQ ID NO:63;

SEQ ID NO: 71 (конструкт 736; кассета экспрессии НА, включающая промотор CaMV 35S, CPMV-HT 5'UTR, последовательность, кодирующую сигнальный пептид из PDI, последовательность, кодирующая гемагглютинин формы H3A/Brisbane/10/07 (H2N3), последовательность CPMV - HT 3'UTR и последовательность NO - терминатора) и подчеркнутую область SEQ ID NO: 71, кодирующую PDI SP - F'1, E1, RB, E2, F'2, F, TMD/CT в Н3/BRI;

SEQ ID NO: 72 (конструкт 737; кассета экспрессии химерного Н5/H3, включающая промотор CaMV 35S, CPMV-HT 5'UTR, последовательность, кодирующую химерный гемагглютинин, последовательность CPMV - НТ 3'UTR и последовательность NO - терминатора), и подчеркнутую часть SEQ ID NO: 72, кодирующей PDI SP - F'1, E1, RB, E2, F'2, F, TMD/CT в Н5/Indo;

SEQ ID NO: 74 (конструкт 739; кассета экспрессии НА, включающая промотор CaMV 35S, CPMV-HT 5'UTR, последовательность, кодирующую сигнальный пептид из PDI, последовательность, кодирующую химерный гемагглютинин формы НА В/Florida/4/06, последовательность CPMV-HT 3'UTR и последовательность NO - терминатора), и подчеркнутую часть SEQ ID NO: 74, кодирующую PDI SP - F'1, El, RB.E2, F'2, F, TMD/CT в В/Flo;

SEQ ID NO: 75 (конструкт 734; кассета экспрессии химерного Н5/В, включающая промотор CaMV 35S, CPMV-HT 5'UTR, последовательность, кодирующую химерный гемагглютинин, последовательность CPMV-HT 3'UTR и последовательность NO - терминатора), и подчеркнутую часть SEQ ID NO: 75, кодирующей PDI SP - F'1, E1, RB, E2, F'2, F, TMD/CT в Н5/Indo.

Данное изобретение включает также нуклеотидную последовательность, которая гибридизуется в строгих условиях гибридизации с образованием подчеркнутых частей любой из SEQ ID NO: 63-65, 68, 69 и 71-75. Данное изобретение включает также нуклеотидную последовательность, которая гибридизуется в строгих условиях гибридизации с образованием комплемента подчеркнутых частей любой из последовательностей SEQ ID NO: 63-65, 68, 69, и 71-75. Эти нуклеотидные последовательности, которые гибридизуются до неподчеркнутых областей SEQ ID NO: 63-65, 68, 69 71-75 или комплемента неподчеркнутых частей SEQ ID NO: 63-65, 68, 69 и 71-75, кодируют химерный белок гемагглютинина, когда экспрессированные формы химерной VLP и химерная VLP индуцируют получение антитела при введении субъекту. Например, экспрессия нуклеотидной последовательности в клетке растения приводит к образованию химерной VLP, а химерная VLP может быть использована для получения антитела, которое способно связывать НА, включая зрелый НА, НА0, НА1 или НА2 одного или более типов или подтипов вируса гриппа. Химерная VLP при введении субъекту индуцирует иммунный ответ.

Гибридизация в строгих условиях гибридизации известна из уровня техники (см., например, Current Protocols in Molecular Biology, AusubE1 et al., eds. 1995 и приложения; Maniatis et al., in Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, 1982; Sambrook and Russell, in Molecular Cloning: A Laboratory Manual, 3rd edition 2001; каждый из этих источников включен в данную заявку посредством отсылки). Пример таких строгих условий гибридизации состоит в следующем: примерно 16-20 час гибридизации в 4 Х SSC при температуре 65°С, с последующей промывкой в 0,1 Х SSC при температуре 65°С в течение часа или две промывки в 0,1 Х SSC при температуре 65°С, каждая в течение 20 или 30 мин. Или же примером жестких условий гибридизации являются: ночь (16-20 час) в 50% формамиде, 4 Х SSC при температуре 42°С, с последующей промывкой в 0,1 Х SSC при температуре 65°С в течение часа или двумя промывками в 0,1 Х SSC при температуре 65°С, каждая в течение 20 или 30 мин, или ночь (16-20 час), или гибридизация в водном фосфатном буфере Черча (7% SDS; 0,5 М NaPO4, буфер рН 7,2; 10 мМ EDTA) при температуре 65°С, с двумя промывками или при температуре 50°С в 0,1 Х SSC, 0,1% SDS, течение 20 или 30 мин каждая, или двумя промывками при температуре 65°С в 2 Х SSC, 0,1% SDS, в течение 20 или 30 мин каждая.

Кроме того, данное изобретение включает нуклеотидные последовательности, которые характеризуются тем, что они имеют степень идентичности последовательности или подобия идентичности, равную примерно 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98, 99, 100% или любому числу между этими цифрами, с нуклеотидной последовательностью, кодирующей химерный НА, согласно неподчеркнутым частям любой из SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 75, при этом нуклеотидная последовательность кодирует белок гемагглютинин, который после экспрессии образует химерную VLP, а химерная VLP индуцирует образование антитела. Например, экспрессия нуклеотидной последовательности в клетке растения приводит к образованию химерной VLP, a химерная VLP может быть использована для получения антитела, которое способно связывать НА, включая зрелый НА, НА0, НА1 или НА2. VLP при введении субъекту индуцирует иммунный ответ.

"Иммунный ответ" обычно относится к ответу адаптивной иммунной системы. Адаптивная иммунная система обычно включает гуморальный ответ и ответ, опосредованный клеткой. Гуморальный ответ является аспектом иммунитета, который опосредован секретированными антителами, образовавшимися в клетках клеточной линии В - лимфоцитов (В - клеток). Секретированные антитела связываются с антигенами на поверхностях инвазивных микробов (таких как вирусы или бактерии), которые выделяют их для деструкции. Гуморальный иммунитет обычно используют для обозначения получения антитела и сопутствующих ему процессов, а также эффекторных функций антител, включая активацию клеток Th2 и продуцирование цитокинов, образование клеток памяти, опсониновое ускорение фагоцитоза, выделение патогенов и т.п.Термины "модулировать" или "модуляция" относятся к увеличению или уменьшению конкретного ответа (реакции) или параметра, определенного любым из нескольких методов анализа, известных или используемых в настоящее время, некоторые из которых описаны в примерах в данной заявке.

Ответ, опосредованный клеткой, представляет собой иммунный ответ, в котором не участвуют антитела, а скорее участвуют активация макрофагов, природные клетки - убийцы (NK), антиген - специфические цитотоксичные T-лимфоциты и высвобождение различных цитокинов в ответ на антиген. Иммунитет, опосредованный клеткой, используется обычно для обозначения активации некоторых Th - клеток, активации Tc - клеток и ответов, опосредованных T - клетками. Иммунитет, опосредованный клеткой, является особенно важным для реакции на вирусные инфекции.

Например, индукция антиген - специфических in - лимфоцитов, стимулирующих CD8 - положительные клетки, может быть определена с применением метода анализа ELISPOT; стимуляция in - лимфоцитов, CD4 антиген - положительных in - лимфоцитов может быть определена методом анализа пролиферации. Титры антител к вирусам гриппа могут быть количественно определены с применением метода анализа ELISA; изотипы антиген - специфических или кросс-реактивных антител могут быть также определены с применением антител к изотипам (например, к иммуноглобулинам IgG, IgA, IgE или IgM). Способы и методики проведения таких анализов хорошо известны из уровня техники.

Определение ингибирования гемагглютинации (HI или HAI) также можно применять для демонстрации эффективности антител, индуцированных вакциной или составом вакцины, содержащим химерный НА, или химерная VLP может ингибировать агглютинацию красных кровяных телец (RBC) при помощи рекомбинантного НА. Титры антител, ингибирующих гемагглютинацию, в образцах сыворотки можно определить по микротитру HAI (Aymard et al., 1973). Могут быть использованы эритроциты любого из нескольких видов - например, лошади, индейки, цыплят или т.п. Этот метод анализа дает косвенную информацию о сборке тримера НА на поверхности VLP, подтверждая надежное представление сайтов антигенов на HAs.

Титры кросс-реактивности HAI также могут быть использованы для демонстрации эффективности иммунного ответа на другие штаммы вирусов, относящихся к подтипам вакцины. Например, сыворотка, взятая у субъекта, иммунизованного композицией вакцины, содержащей химерный гемагглютинин, включающий HDC первого типа или подтипа вируса гриппа, может быть использована при проведении анализа HAI со вторым штаммом полного вируса или вирусными частицами и определения титра HAI.

Не основываясь на одной какой-либо теории, полагают, что способность НА связываться с RBC от различных животных, управляется сродством НА к сиаловым кислотам, связанным α2,3 и α2,6 - связями, и наличием этих сиаловых кислот на поверхности RBC. НА вирусов лошадиного и птичьего гриппа вызывает агглютинацию эритроцитов у некоторых видов, включая индеек, цыплят, уток, морских свинок, людей, овец, лошадей и коров; в то время, как HAs людей будет связываться с эритроцитами индеек, цыплят, уток, морских свинок, людей и овец (Ito Т. et al, 1997, Virology, 227: 493-499; Medeiros R. et al, 2001, Virology 289: 74-85).

Наличие и уровень цитокинов могут быть также определены количественно. Например, ответ на действие хелпера T-клеток (Th1/Th2) будет характеризоваться измерением количества клеток, которые секретируют IFN-γ и IL-4, с применением метода анализа ELISA (например, наборов BD Biosciences OptEIA). Можно вырастить мононуклеоторыне клетки периферической крови (РВМС) или спленоциты, полученные у субъекта, и проанализировать надосадочную жидкость. Количество T-лимфоцитов может быть также определено методом флуоресцентно-активированного клеточного сортинга (FACS) с использованием маркерных флуоресцентных меток, эти способы известны из уровня техники.

Для характеристики иммунного ответа у субъекта можно также проводить анализ методом микронейтрализации, см., например, методы Rowe et al., 1973. Титры нейтрализации вирусов могут быть определены несколькими путями, включая: 1) регистрацию лизисных бляшек (анализ бляшкообразования) с последующей фиксацией/окрашиванием клеток кристаллами фиолетового красителя; 2) микроскопическое наблюдение за лизисом клеток в культуре; 3) ELISA и спектромикроскопическое детектирование белка NP вируса (корреляция с вирусной инфекцией клеток-хозяев).

Идентичность последовательностей или подобие последовательностей могут быть определены с применением программы сравнения последовательностей, такой как предусмотренной в компьютерной программе DNASIS (например, используя, но без ограничения, следующие параметры: штраф за пропуск последовательности равный 5, # верхних диагоналей равный 5, фиксированный штраф за пропуск последовательности равный 10, k - кратность 2, наличие блуждающего гэпа 10 и размер окна равный 5). Однако из уровня техники хорошо известны и другие методы выравнивания последовательностей для сравнения, например, алгоритмы Smith & Waterman (1981, Adv. Appl. Math. 2: 482), Needleman & Wunsch (J. Mol. Biol. 48: 443, 1970), Pearson & Lipman (1988, Proc. Nat'1. Acad. Sci. USA 85: 2444), а также компьютерное воплощение этих алгоритмов (например, программы GAP, BESTFIT, FASTA и BLAST (Altschul et al., 1990. J. Mol Biol 215: 403-410), или выравнивание вручную и визуальный осмотр. Нуклеиновые или аминокислотные последовательности могут быть сравнены или выровнены и могут быть определены консенсусные последовательности с применением нескольких программ, известных из уровня техники, например, MULTALIN (Corpet F., 1988, Nucl. Acids Res., 16 (22), 10881-10890), BLAST, CLUSTAL или т.п.; или же последовательности могут быть выровнены вручную и затем определено сходство или различие между последовательностями.

Фрагмент или область белка, слитого белка или полипептида включает пептид или полипептид, содержащие подкласс аминокислотного комплемента конкретного белка или полипептида, при условии, что фрагмент может образовать химерную VLP после экспрессии. Этот фрагмент может, например, образовать антигенную область, область, индуцирующую стресс - ответ, или область, содержащую функциональный домен белка или полипептида. Такой фрагмент может также включать область или домен, общий для белков одного и того же семейства, или этот фрагмент может включать аминокислотную последовательность, достаточную для специфического идентифицирования белка полной длины, из которого он произошел.

Например, такой фрагмент или область могут включать от примерно 60% до примерно 100% от длины полной протяженности белка или любое количество между этими двумя цифрами, при условии, что этот фрагмент может образовать химерную VLP после экспрессии. Например, это количество может составлять от примерно 60% до примерно 100%, от примерно 70% до примерно 100%, от примерно 80% до примерно 100%, от примерно 90% до примерно 100%, от примерно 95% до примерно 100% от величины длины полной протяженности белка или любую величину между этими двумя цифрами. Или же, альтернативно, фрагмент или область может содержать от примерно 150 до примерно 500 аминокислот или любое количество между этими двумя величинами в зависимости от химерного НА и при условии, что такой фрагмент может образовать химерную VLP после экспрессии. Например, этот фрагмент может включать от примерно 150 до примерно 500 аминокислот или любое их количество в интервале между этими двумя цифрами, от примерно 200 до примерно 500 аминокислот или любое их количество в интервале между этими двумя цифрами, от примерно 250 до примерно 500 аминокислот или любое их количество в интервале между этими двумя цифрами, от примерно 300 до примерно 500 аминокислот или любое их количество в интервале между этими двумя цифрами, от примерно 350 до примерно 500 аминокислот или любое их количество в интервале между этими двумя цифрами, от примерно 400 до примерно 500 аминокислот или любое их количество в интервале между этими двумя цифрами, от примерно 450 до примерно 500 аминокислот или любое их количество в интервале между этими двумя цифрами, в зависимости от химерного НА и при условии, что такой фрагмент может образовать химерную VLP после экспрессии. Например, примерно 5, 10, 20, 30, 40 или 50 аминокислот или любое их количество в интервале между этими двумя цифрами может быть удалено с С - конца, N - конца или с обоих N - конца, и С - конца химерного белка НА при условии, что такой фрагмент может образовать химерную VLP после экспрессии.

Нумерация аминокислот в любой данной последовательности относится к конкретной последовательности, однако, специалист в данной области может легко определить "эквивалентность" конкретной аминокислоты в последовательности на основании структуры и/или последовательности. Например, если были удалены шесть N - концевых аминокислот, это приведет к изменению специфической нумерационной идентичности аминокислоты (например, относительно полной длины белка), но не изменит относительное положение аминокислоты в структуре.

Данное изобретение описывает, но без ограничения, экспрессию нуклеиновой кислоты, кодирующей химерный НА, в части растения или в клетке растения и продуцирование химерных VLP вируса гриппа в растении, подходящем для получения вакцины. Примеры таких нуклеиновых кислот включают, но без ограничения, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 75.

Кроме того, данное изобретение предусматривает экспрессию нуклеиновой кислоты, кодирующей химерный НА, например, но без ограничения, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 75В растении, части растения или в клетке растения и получение вакцин - кандидатов от гриппа или реагентов, состоящих из рекомбинантных структурных белков вируса гриппа, которые самоорганизуются в функциональные и иммуногенные гомотипные структуры макромолекулярных белков, включая субвирусные частицы вируса гриппа и химерные VLP вируса гриппа, в трансформированных клетках растения.

Следовательно, данное изобретение предусматривает химерные VLP и способ получения химерных VLP в экспрессионной системе растения в результате экспрессии единственного химерного белка в оболочке.

Нуклеиновая кислота, кодирующая химерный НА подтипов вируса гриппа, например, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 75, может быть синтезирована методом обратной транскрипции и полимеразной цепной реакции (ПЦР) с применением НА РНК. Как пример, РНК может быть выделена из вирусов H1/NC, H1/Bri, Н3/Bri, В/Flo или Н5/Indo или из клеток, инфицированных этими или другими типами или подтипами вируса гриппа. Для обратной транскрипции и ПЦР могут быть использованы олигонуклеотидные праймеры, специфичные для НА РНК. Кроме того, нуклеиновая кислота, кодирующая химерный НА, может быть синтезирована химическим методом, как известно специалистам в данной области.

Настоящее изобретение относится кроме того к конструкту гена, включающему нуклеиновую кислоту, кодирующую химерный НА, как описано выше, функционально связанную с регуляторным элементом, который функционирует в растении. Примеры регуляторных элементов, функционирующих в клетке растения, которые могут быть применены в соответствии с данным изобретением, включают, но без ограничения, регуляторную область пластоцианина (патент США №7125978; который включен в данную заявку посредством отсылки), или регуляторную область рибулозо - 1,5-бифосфат-карбоксилазы/оксигеназы (RuBisCO; патент США №4962028; который включен в данную заявку посредством отсылки), регуляторную область хлорофилл - а/b-связывающего белка (CAB; Leutwiler et al; 1986; этот источник также включен в данную заявку посредством отсылки), регуляторную область ST-LSI (ассоциированного с кислород - выделяющим комплексом фотосистемы II и описанного Stockhaus et al., 1987, 1989; этот источник также включен в данную заявку посредством отсылки).

Конструкт гена согласно данному изобретению может также включать конститутивный промотор, который направляет экспрессию гена, который функционально связан с промотором через различные части растения и непрерывно через развитие растения. Неограничивающий пример конститутивного промотора представляет собой промотор, который ассоциирован с конструктом CaMV 35S (см., например, Odell et al., 1985, Nature, 313: 810-812, этот источник также включен в данную заявку посредством отсылки).

Примером последовательности, включающей регуляторную область пластоцианина, является последовательность в положении 5' к подчеркнутой последовательности, кодирующей сигнальный пептид PDI в SEQ ID NO: 58. Регуляторный элемент или регуляторная область может способствовать трансляции нуклеотидной последовательности, с которой она функционально связана, при этом нуклеотидная последовательность может кодировать белок или полипептид. Другим примером регуляторной области является область, которая происходит из нетранслированных областей вируса мозаики коровьего гороха (CPMV), который может быть использован для предпочтительной трансляции нуклеотидной последовательности, с которой она функционально связана. Эта регуляторная область CPMV используется в гипертранслируемой области системы CMPV (CPMV-НТ; см., например, Sainsbury et al, 2008, Plant Physiology 148: 1212-1218; Sainsbury et al., 2008, Plant Biotechnology Journal, 6: 82-92; оба этих источников включены в данную заявку в качестве ссылок).

Следовательно, один из аспектов данного изобретения предусматривает нуклеиновую кислоту, включающую регуляторную область, функционально связанную с последовательностью, кодирующей химерный НА вируса гриппа. Регуляторная область может представлять собой регуляторный элемент пластоцианина и химерный НА вируса гриппа может включать субдомены из вирусов гриппа типов, подтипов или штаммов Н5/Indo, H1/Bri, Н3/Bri, H1/NC, В/Flo. Нуклеиновые последовательности, содержащие регуляторный элемент пластоцианина и химерный НА вируса гриппа, представляют собой, например, SEQ ID NO: 63 и 64. Примеры нуклеотидных последовательностей, содержащих регуляторный элемент 35S и химерный НА вируса гриппа, используемых в данной заявке, представляют собой SEQ ID NO: 68, 69 и 71-75.

Согласно другому аспекту данного изобретения оно предусматривает нуклеиновую кислоту, включающую регуляторную область CPMV и химерный НА вируса гриппа, содержащий субдомены из вирусов гриппа типов, подтипов или штаммов Н5/Indo, H1/Bri, Н3/Bri, H1/NC, В/Flo. Примеры нуклеотидных последовательностей, содержащих регуляторный элемент СРМР и химерный НА вируса гриппа, используемых в данной заявке, представляют собой SEQ ID NO: 66-69 и 71-75.

Полученные из растений химерные VLP вируса гриппа отпочковываются от плазменной мембраны и липидный состав химерных VLP отражает липидный состав растительной клетки или растительной ткани, из которых они получены. VLP, полученные в соответствии с данным изобретением, содержат химерный НА двух или более типов или подтипов вируса гриппа, образовавших комплекс с липидами, происходящими из растений. Растительные липиды могут стимулировать специфические иммунные клетки и могут способствовать индуцированному иммунному ответу.

Растительные липиды, такие как PC (фосфатидилхолин) и РЕ (фосфатидилэтаноламин), а также гликосфинголипиды могут связываться с молекулами CD1, экспрессированными иммунными клетками млекопитающего, такими как антиген - представляющие клетки (APCs), типа дендритных клеток и макрофагов и других клеток, включая В- и T-лимфоциты в вилочковой железе и в печени (см. обзор в Tsuji М,. 2006, Cell. Mol. Life Sci. 63: 1889-98). Молекулы CD1 являются структурно подобными главному комплексу гистосовместимости (МНС) молекул класса I и их роль состоит в представлении антигенов гликолипидов в клетки NKT (Natural Killer T - клетки). После активации клетки NKT активируют врожденные иммунные клетки, такие как клетки NK и дендритные клетки, а также активируют адаптивные иммунные клетки типа антитело-продуцирующих В - клеток и T - клеток.

Фитостеролы, присутствующие в VLP вируса гриппа, образовавшей комплекс с бислойным липидом, таким как оболочка, полученная от плазменной мембраны, могут обеспечить благоприятный состав вакцины. Не ограничиваясь одной какой-либо теорией, полагают, что VLP, полученные из растений, включая те, которые включают химерный НА, образовавший комплекс с бислойным липидом, таким как оболочка, полученная от плазменной мембраны, могут индуцировать более сильную иммунную реакцию, чем VLP, полученные в других системах экспрессии, и она может быть подобна иммунной реакции, индуцированной живыми или ослабленными вакцинами на основе полного вируса.

Следовательно, согласно некоторым вариантам данное изобретение предусматривает VLP, образовавшую комплекс с бислойным липидом растения. В соответствии с некоторыми вариантами бислойный липид, происходящий из растения, может содержать оболочку VLP.

VLP, полученная в растении, может включать химерный НА, содержащий специфические для этого растения N-гликаны. Следовательно, данное изобретения предусматривает также VLP, включающую химерный НА, содержащий специфические для этого растения N-гликаны.

Кроме того, известна модификация N-гликана в растениях (см., например, заявку WO 2008/151440; которая включена в данную заявку посредством отсылки) и поэтому может быть получен химерный НА, содержащий модифицированные N-гликаны. Может быть получен химерный НА, содержащий модифицированные гликозилированием N-гликаны, которые могут быть получены, например, с восстановленными фукозилированными, ксилозилированными или и с фукозилированными и ксилозилированными группами, или может быть получен химерный НА, характеризующийся модифицированным характером гликозилирования, когда белок не подвергнут фукозилированию, ксилозилированию или тому, и другому и характеризуется повышенной степенью галактозилирования. Кроме того, модулирование посттрансляционных модификаций, например, присоединение концевой галактозы, может привести к уменьшению степени фукозилирования и ксилозилирования экспрессированного химерного НА по сравнению с химерным НА дикого типа, экспрессированным в растении.

Например, можно отметить, но без ограничения, что синтез химерного НА, имеющего модифицированный характер гликозилирования, может быть осуществлен путем совместной экспрессии нужного белка вместе с нуклеотидной последовательностью, кодирующей бета-1,4-галактозил-трансферазу (GalT), например, но без ограничения, GalT млекопитающего или человеческую GalT, однако, может быть также использована GalT из других источников. Каталитический домен GalT может быть также слит с доменом CTS (то есть цитоплазматическим хвостом, трансмембранным доменом, стволовой областью) N-ацетилглюкозаминил-трансферазы (GNT1) с целью получения гибридного фермента GNT1-GalT, и гибридный фермент может быть совместно экспрессирован с НА. НА может быть также совместно экспрессирован вместе с нуклеотидной последовательностью, кодирующей N-ацетилглюкозаминил-трансферазу III (GnT-III), например, но без ограничения, GnT-III млекопитающего или GnT-III человека, может быть также использована GnT-III из других источников. Кроме того, может быть также использован гибридный фермент GNT1-GnT-III, включающий CTS от GNT1, слитой с GnT-III.

Следовательно, данное изобретение включает также VLP, содержащие химерный НА, включающий модифицированные N-гликаны.

Не основываясь на какой-либо одной теории, полагают, что наличие N-гликанов растений в химерном НА может стимулировать иммунный ответ путем промотирования связывания НА антиген - представляющими клетками. Стимуляция иммунного ответа при помощи N-гликанов растений была предложена Saint - Jore - Dupas et al. (Trends Biotechnol. 25: 317-23, 2007). Кроме того, конформация VLP может быть благоприятной для презентации антигена и усиления дополнительного эффекта VLP при образовании комплекса с липидным слоем растения.

Под "регуляторной областью", "регуляторным элементом" или "промотором" подразумевается часть нуклеиновой кислоты, которая обычно, не не всегда, расположена вверх от белка, кодирующего участок гена, который может состоять или из ДНК или РНК, или и из ДНК, и из РНК. Когда регуляторная область является активной, и находится в функциональной связи с целевым геном, это может привести к экспрессии этого целевого гена. Регуляторный элемент может опосредовать специфичность органа или контролировать развивающуюся или временную активацию гена. "Регуляторная область" включает элементы промотора, элементы ядра гена, проявляющие исходную активность промотора, элементы, которые индуцируются в ответ на внешний раздражитель, элементы, которые опосредуют активность промотора, такие как негативные регуляторные элементы или транскрипционные энхансеры. "Регуляторная область", в контексте данного изобретения, включает также элементы, которые являются активными после транскрипции, например, регуляторные элементы, которые модулируют экспрессию генов, такие как трансляционные и транскрипционные энхансеры, трансляционные и транскрипционные репрессоры, последовательности, активирующие вверх по течению, и детерминанты нестабильности мРНК. Некоторые из этих последних элементов могут быть расположены проксимально к кодирующей области.

В контексте данного описания термины "регуляторный элемент" или "регуляторная область" обычно относится к последовательности ДНК, обычно, но не всегда, в положении против хода транскрипции (5') к кодирующей последовательности структурного гена, который контролирует экспрессию кодирующей области, обеспечивая распознавание РНК - полимеразы и/или других факторов, требуемых для того, чтобы транскрипция началась в конкретном сайте. Однако следует понимать, что другие нуклеотидные последовательности, расположенные внутри интронов, или в положении 3' последовательности, также могут вносить свой вклад в регуляцию экспрессии кодирующей области, представляющей интерес. Примером регуляторного элемента, который обеспечивает распознавание РНК - полимеразы или других транскрипционных факторов для обеспечения инициирования в конкретном сайте, является элемент промотора. Большая часть, но не все, элементов эукариотных промоторов содержит ТАТА - бокс, консервативную нуклеотидную последовательность, состоящую из пар нуклеотидных оснований аденозина и тимидина, обычно расположенных в количестве примерно 25 пар оснований вверх по течению от сайта начала транскрипции. Элемент промотора включает базальный элемент промотора, который отвечает за инициирование транскрипции, а также другие регуляторные элементы (которые перечислены выше), которые модифицируют экспрессию генов.

Имеются некоторые типы регуляторных областей, включая Tc области, которые регулируются эволюционно, индуцибельно или конститутивно. Регуляторная область, которая регулируется эволюционно или контролирует дифференциальную экспрессию гена под контролем, активируется некоторыми органами или тканями органа в конкретное момент во время развития этого органа или этой ткани. Однако некоторые регуляторные области, которые регулируются эволюционно, могут предпочтительно быть активными в некоторых органах или тканях на специфических стадиях развития, они могут быть также активными эволюционным образом или также на базальном уровне в других органах или тканях в растении. Примеры ткань - специфических регуляторных областей, например, см., регуляторная область - включают напиновый промотор и круцифериновый промотор (Rask et al., 1998, J. Plant Physiol. 152: 595-599; Bilodeau et al., 1994, Plant Cell 14: 125-130). Примером промотора, активность которого проявляется в листьях, является промотор пластоцианина (см., например, SEQ ID NO: 58; патент США №7125978, который включен в данную заявку посредством отсылки).

Индуцибельная регуляторная область представляет собой такую область, которая способна непосредственно или косвенно активировать транскрипцию одной или более последовательностей или генов ДНК в ответ на действие индуктора. В отсутствие индуктора гены или последовательности ДНК не будут транскрибироваться. Обычно протеиновый фактор, который специфически связывается с индуцируемой регуляторной областью для активации транскрипции, может находиться в неактивной форме, которая затем, непосредственно или косвенно, превращается под действием индуктора в активную форму. Однако протеиновый фактор может также отсутствовать. Индуктор может представлять собой химический агент, такой как белок, метаболит, фактор роста, гербицид или фенольное соединение, или физиологический стресс, вызванный прямым воздействием тепла, холода, соли или токсичных элементов или косвенным действием патогена или агента, вызывающего заболевание, такого как вирус. Клетка растения, содержащая индуцибельную регуляторную область, может быть подвержена действию индуктора при внешнем нанесении индуктора на клетку или растение, например, путем распыления, смачивания водой, нагревания или подобными методами. Индуцибельные регуляторные элементы могут быть получены или из генов растений, или из генов нерастительных организмов (см., например, Gatz, С. and Lenk, I.R.P., 1998, Trends Plant Sci. 3, 352-358; этот источник включен в данную заявку посредством отсылки). Примеры потенциальных индуцибельных промоторов включают, но без ограничения, тетрациклин - индуцибельный промотор (Gatz, С., 1997, Ann. Rev. Plant Physiol. Plant Mol. Biol. 48, 89-108; этот источник включен в данную заявку посредством отсылки), стероид - индуцибельный промотор (Aoyama, Т. and Chua, N.H., 1997, Plant J. 2, 397-404; этот источник включен в данную заявку посредством отсылки) и этанол - индуцибельный промотор (Salter, M.G., et al, 1998, Plant Journal 16, 127-132; Caddick, M.X., et al, 1998, Nature Biotech. 16, 177-180, эти источники включены в данную заявку в качестве ссылок), цитокин - индуцибельные гены IB6 и CKI1 (Brandstatter, I. and Kieber, J.J., 1998, Plant Cell 10, 1009-1019; Kakimoto, Т., 1996, Science 274, 982-985; эти источники включены в данную заявку в качестве ссылок) и ауксин - индуцибельный элемент, DR5 (Ulmasov, Т., et al., 1997, Plant Cell, 9, 1963-1971; этот источник включен в данную заявку посредством отсылки).

Конститутивная регуляторная область осуществляет экспрессию гена через различные части растения непрерывно благодаря развитию растения. Примеры известных конститутивных регуляторных элементов включают промоторы, ассоциированные с транскриптом CaMV 35S. (Odell et al., 1985, Nature, 313: 810-812), актином 1 риса (Zhang et al, 1991, Plant Cell, 3: 1155-1165), актином 2 (An et al., 1996, Plant J., 10: 107-121) или tms 2 (патент США №5428147, этот источник включен в данную заявку посредством отсылки), и генами триозофосфат - изомеразы 1 (Xu et. al., 1994, Plant Physiol. 106: 459-467), геном убиквитина 1 маиса (Comejo et al, 1993, Plant Mol. BioL, 29: 637-646), генами убиквитина 1 и 6 е Arabidopsis (Holtorf et al, 1995, Plant Mol. BioL, 29: 637-646), и геном фактора 4А трансляционной инициации из табака (MandE1 et al, 1995, Plant Mol. Biol. 29: 995-1004). Термин "конститутивный", используемый в данной заявке, не необходимо указывает на то, что ген под контролем конститутивной регуляторной области экспрессируется с тем же самым уровнем в клетках всех типов, но что ген экспрессируется в большом количестве клеток, даже хотя часто наблюдается вариация его количества. Конститутивные регуляторные элементы могут сочетаться с другими последовательностями для дальнейшего ускорения транскрипции и/или трансляции нуклеотидной последовательности, с которой они связаны функционально. Например, система CPMV - НТ происходит из нетранслированных областей вируса мозаики коровьего гороха (CPMV) и демонстрирует ускоренную трансляцию ассоциированной кодирующей последовательности.

Термин "нативный" означает, что нуклеотидная или аминокислотная последовательность имеет природное происхождение или является последовательностью "дикого типа".

Термин "функционально связанная" означает, что конкретные последовательности, например, регуляторный элемент или целевая кодирующая область взаимодействуют непосредственно или косвенно с выполнением нужной функции, такой как опосредование или модуляция экспрессии гена. Взаимодействие функционально связанных последовательностей может, например, быть опосредовано белками, которые взаимодействуют с функционально связанными последовательностями.

Одна или более, чем одна нуклеотидная последовательность в соответствии с данным изобретением может быть экспрессирована в любом подходящем растении-хозяине, который трансформируется нуклеотидной последовательностью или конструктами, или векторами по изобретению. Примеры подходящих хозяев включают, но без ограничения, сельскохозяйственные полевые культуры, включая люцерну, канолу, Brassica spp., маис, Nicotiana spp., альфальфу, картофель, женьшень, горох, овес, рис, соевые бобы, пшеницу, ячмень, подсолнечник, хлопок и т.п.

Один или более химерных генетических конструктов в соответствии с данным изобретением могут также содержать 3' - нетранслируемая область. 3' -нетранслируемая область относится к той части гена, содержащего ДНК - сегмент, которая содержит сигнал полиаденилирования и любой другой регуляторный сигнал, способный к осуществлению процессинга мРНК или гена экспрессии. Сигнал полиаденилирования обычно характеризуется осуществлением присоединения следов полиадениловой кислоты на 3'-конце предшественника мРНК. Сигналы полиаденилирования обычно распознаются по наличию гомологии канонической формы 5'ААТААА-3, хотя вариации не являются необычными.

Неограничивающие примеры подходящих 3'-областей представляют собой транскрибированные 3'-нетранслированные области, содержащие сигнал полиаденилирования опухоли Agrobacterium, индуцирующий гены (Ti) плазмиды, такие как ген нопалин - синтазы (NO), гены растений, такие как гены белка хранившихся соевых бобов, малые субъединицы гена рибулозо-1,5-бифосфат-карбоксилазы (ssRUBISCO; патент США №4962028, который включен посредством отсылки в данную заявку), промотор, применяемый в регуляции экспрессии пластоцианина, описанный в патенте США №7125978 (который включен посредством отсылки в данную заявку).

Один или более химерных генетических конструктов в соответствии с данным изобретением могут также включать дополнительные энхансеры, или энхансеры трансляции, или энхансеры транскрипции, как это может потребоваться. Энхансеры могут быть расположены в положениях 5' или 3' по отношению к последовательности, которая транскрибируется. Области действия энхансеров хорошо известны специалистам в данной области и могут включать инициирующий кодон ATG, смежные последовательности или т.п. Инициирующий кодон, если он имеется, может быть в фазе с рамкой считывания ("в рамке") кодирующей последовательности для корректной трансляции транскрибированной последовательности.

Для облегчения идентификации трансформированных клеток растения на конструкты в соответствии с изобретением можно дополнительно влиять путем включения селектируемых маркеров растений. Подходящие селектируемые маркеры включают ферменты, которые придают стойкость к химическим агентам, таким как антибиотик, например, гентамицин, гигромицин, канамицин, или гербициды, такие как фосфинотрицин, глифосат, хлоросульфурон и т.п. Подобным образом могут быть использованы ферменты, обеспечивающие продуцирование соединения, идентифицируемого по изменению цвета, такие как GUS (бета-глюкуронидаза) или по люминесценции, такие как люцифераза или GFP.

Значительную часть данного изобретения составляют трансгенные растения, клетки растений или семена, содержащие конструкт химерного гена согласно данному изобретению. Из уровня техники известны также способы регенерации целых растений из клеток растений. В общем, трансформированные клетки растений культивируются в соответствующей среде, которая может содержать селективные агенты, такие как антибиотики, при этом селектируемые маркеры применяются для облегчения идентификации трансформированных клеток растений. Как только образуется каллюс, образование ростков может быть ускорено путем применения соответствующих растительных гормонов в соответствии с известными методами и ростки передаются в корневую среду для регенерации растений. Затем растения могут быть использованы для получения повторяющихся поколений, или из семян, или с применением методики вегетативного размножения. Трансгенные растения могут быть также получены без применения тканевых культур.

Существенную часть данного изобретения составляют также трансгенные растения, деревья, дрожжи, бактерии, грибки, насекомые и клетки животных, содержащие конструкт химерного гена, включающий рекомбинант, кодирующий нуклеиновую кислоту, химерный НА или НА0 для получения VLP в соответствии с данным изобретением.

Регуляторные элементы по изобретению могут также комбинироваться с целевой кодирующей областью, представляющей интерес для экспрессии среди ряда организмов-хозяев, которые восприимчивы к трансформации или временной экспрессии. Такие организмы включают, но без ограничения, растения, как однодольные, так и двудольные, например, но без ограничения, кукурузу, злаковые растения, пшеницу, ячмень, овес, Nicotiana spp, Brassica spp, соевые бобы, бобы, горох, люцерну, томаты, женьшень и Arabidopsis.

Способы стабильной трансформации и регенерации этих организмов уже разработаны и известны специалистам в данной области. Способ получения трансформированных и регенерированных растений не является критическим для настоящего изобретения.

Под "трансформацией" подразумевают межвидовой перенос генетической информации (нуклеотидной последовательности), который проявляется генотипически, фенотипически или и генотипически, и фенотипически. Межвидовой перенос генетической информации от химерного конструкта к хозяину может быть наследственным и перенос генетической информации стабильным или перенос может быть временным и перенос генетической информации не является наследственным.

Термин "растительный материал" означает любой материал, полученный из растения. Растительный материал может представлять собой целое растение, ткань, клетки или любую их часть. Кроме того, растительный материал может включать межклеточные компоненты растения, внеклеточные компоненты растения, жидкие или твердые растительные экстракты или их комбинацию. Кроме того, растительный материал может включать растения, клетки растений, ткань, жидкий экстракт или их комбинацию из листьев растений, стеблей, фруктов, корней или их комбинации. Растительный материал может включать растение или его часть, которые не были подвергнуты любым операциям процессинга. Часть растения может включать растительный материал. Однако данное изобретение предусматривает также, что растительный материал может быть подвергнут минимальному количеству стадий процессинга, как описано ниже, или более жесткому процессингу, включая частичную или существенную очистку белка с применением методов, широко известных в уровне техники, включая, но без ограничения, методы хроматографии, электрофореза и т.п.

Под термином "минимальный процессинг" подразумевают, что растительный материал, например, растение или его часть, содержащие целевой белок, подвергается частичной очистке с целью получения растительного экстракта, гомогената, фракции гомогената растения или т.п. (то есть подвергается минимальному процессингу). Частичная очистка может включать, но без ограничения, разрушение клеточных структур растения с получением при этом композиции, содержащей растворимые компоненты растения и нерастворимые компоненты растения, которые могут быть отделены, например, но без ограничения, путем центрифугирования, фильтрования или их комбинации. В этом случае белки, секретированные внутри внеклеточного пространства листа растения или других тканей растения, могут быть легко получены с применением вакуума или центробежной экстракции, или же ткани могут быть экстрагированы под давлением при пропускании через роллеры или при размалывании или т.п. для сдавливания или для высвобождения свободного белка из внеклеточного пространства. Минимальный процессинг может также включать получение сырых экстрактов растворимых белков, так как эти препараты будут содержать незначительное количество загрязнений из вторичных продуктов растений. Кроме того, минимальный процессинг может включать водную экстракцию растворимого белка из листьев с последующим осаждением при помощи любой подходящей соли. Другие методы могут включать крупномасштабную мацерацию и экстракцию сока с целью непосредственного применения экстракта.

Растительный материал в виде материала или ткани может быть введен субъекту перорально. Растительный материал может быть введен как часть диетической добавки вместе с пищевыми продуктами или в инкапсулированном виде. Растительный материал или ткань могут быть также сконцентрированы для улучшения или увеличения вкусовых качеств или могут поставляться с другими материалами, ингредиентами или фармацевтическими эксципиентами, когда это требуется.

Примеры субъекта или целевого организма, которым могут вводиться VLP согласно данному изобретению, включают, но без ограничения, людей, приматов, птиц, водоплавающих птиц, мигрирующих птиц, перепелов, уток, гусей, домашнюю птицу, цыплят, свиней, овец, лошадей, верблюдов, собак, кошек, тигров, леопардов, цивет, норок, каменных куниц, африканских хорьков, домашних питомцев, домашний скот, кроликов, мышей, крыс, морских свинок или других грызунов, тюленей, китов и т.п. Эти целевые организмы названы только в качестве примеров и применение и использование данного изобретения ими не ограничивается.

Данное изобретение предусматривает, что растение, содержащее химерный НА в соответствии с некоторыми вариантами данного изобретения, или растение, экспрессирующее VLP, включающую химерный НА в соответствии с некоторыми вариантами данного изобретения, может быть введено субъекту или в целевой организм различными методами в зависимости от необходимости и ситуации. Например, химерный НА, полученный из растения, может быть экстрагирован до его использования или в сыром, или в частично очищенном виде, или в очищенном виде. Если химерный НА должен быть по меньшей мере частично очищен, тогда он может быть получен или в съедобных, или в несъедобных растениях. Кроме того, если химерный НА вводится перорально, растительная ткань должна быть собрана и непосредственно введена как пища субъекту или собранная ткань может быть высушена до применения в качестве пищи, или животному разрешают щипать растение без предварительного его сбора. Объем данного изобретения также предусматривает получение собранных растительных тканей в качестве пищевых добавок в корм для животных. Если растительная ткань является пищей для животного после небольшой обработки или без такой обработки, предпочтительно, чтобы эта используемая растительная ткань была съедобной.

При ограничении экспрессии трансгенов в растениях может быть применен пост - трансляционный сайленсинг (PTGS), и для противодействия специфическому разложению трансгенных мРНК (Brigneti et al., 1998) может быть использована совместная экспрессия супрессорного гена сайленсинга из вируса Y (НсРго) картофеля. Альтернативные супрессоры сайленсинга хорошо известны из уровня техники и могут быть также применены, как описано в следующем источнике (Chiba et al., 2006, Virology, 346: 7-14; который включен в данную заявку посредством отсылки), например, но без ограничения, это могут быть ген TEV - pl/HC - Pro (Tobacco etch virus - pl/НС - Pro, вируса гравировки табака), BYV - р21, ген р19 вируса карликовой кустистости томата (TBSV р19), белок капсида вируса курчавости томата (TCV - СР), ген вируса 2b мозаики огурца (CMV - 2b), ген р25Вируса Х картофеля (PVX - р25), ген р14 вируса М картофеля (PVM - р11), ген р14 вируса S картофеля (PVS - р11), ген р16 вируса пятнистости черники (BScV - р16), р23 вируса тристеца цитрусовых культур (CTV - р23), ген р24 вируса - 2, связанного со скручиванием листьев винограда (GLRaV - 2 р24), ген р10 вируса А винограда (GVA - р10), ген р14 вируса В винограда (GVB - р14), ген р10 латентного вируса Heracleum (HLV - р10) или ген р16 латентного вируса чеснока (GCLV - р16). Следовательно, ген - супрессор сайленсинга, например, но без ограничения, НсРго, TEV - р1/НС - Pro, BYV - р21, TBSV р19, TCV - СР, CMV - 2b, PVX - р25, PVM - р11, PVS - р11, BScV - р16, CTV - р23, GLRaV - 2 р24, GBV - р14, HLV - р10, GCLV - р16 или GVA - р10, может быть экспрессирован совместно с нуклеотидной последовательностью, кодирующей целевой белок для обеспечения более высокого уровня продуцирования белков в растении.

Далее, VLP, полученные как описано в данной заявке, не содержат нейраминидазу (NA). Однако нейраминидаза может быть экспрессирована совместно с НА, если желательно, чтобы VLP содержали и НА, и NA.

Следовательно, данное изобретение предусматривает также подходящий вектор, включающий последовательность химерного НА, подходящую для применения или со стабильной, или с транзиентной системами экспрессии. Генетическая информация может быть также обеспечена внутри одного или более, чем одного конструкта. Например, нуклеотидная последовательность, которая кодирует целевой белок, может быть введена в один конструкт, а вторая нуклеотидная последовательность, которая кодирует белок, который модифицирует гликозилирование целевого белка, может быть введена с применением отдельного конструкта. Затем эти нуклеотидные последовательности могут быть совместно экспрессированы в растении. Однако может быть также использован конструкт, включающий нуклеотидную последовательность, кодирующую и целевой белок, и белок, который модифицирует профиль гликозилирования целевого белка. В этом случае нуклеотидная последовательность будет включать первую последовательность, содержащую первую нуклеотидную последовательность, кодирующую целевой белок, функционально связанный с промотором или регуляторной областью, и вторую последовательность, содержащую вторую нуклеотидную последовательность, кодирующую белок, который модифицирует профиль гликозилирования целевого белка, при этом вторая последовательность оперативно связана с промотором или регуляторной областью.

Термин "совместно экспрессированные" означает, что две или более, чем две нуклеотидные последовательности экспрессированы в растении и в одной и той же ткани растения примерно в одно и то же время. Однако нуклеотидные последовательности не обязательно должны экспрессироваться в одно и то же время. Скорее, две или более нуклеотидных последовательностей экспрессируются таким образом, что кодируемые продукты имели шанс взаимодействовать. Например, белок, который модифицирует процесс гликозилирования целевого белка, может быть экспрессирован или до, или во время периода, когда целевой белок экспрессируется таким образом, что имеет место модификация процесса гликозилирования целевого белка. Две или более, чем две нуклеотидные последовательности могут быть экспрессированы совместно с применением транзиентной системы экспрессии, когда две или более, чем две последовательности вводятся в растение примерно в одно и то же время в условиях, когда экспрессируются обе последовательности. Или же основа растения, включающая одну из нуклеотидных последовательностей, например, последовательность, кодирующую белок, который модифицирует профиль гликозилирования целевого белка, может быть трансформирована, или временно, или стабильно, дополнительной последовательностью, кодирующей целевой белок. В этом случае последовательность, кодирующая белок, который модифицирует профиль гликозилирования целевого белка, может быть экспрессирована в желательной ткани во время желательной стадии развития, или ее экспрессия может быть индуцирована с применением индуцибельного промотора, а дополнительная последовательность, кодирующая целевой белок, может быть экспрессирована в похожих условиях и в той же самой ткани для осуществления совместной экспрессии нуклеотидных последовательностей.

Конструкты по данному изобретению могут быть введены в клетки растения с применением Ti - плазмид, Ri - плазмид, вирусных векторов растений, прямой трансформации ДНК, микроинъекции, электропорации, инфильтрации и т.п. Обзоры по применению этих методов см., например, в Weissbach и Weissbach, Methods for Plant Molecular Biology, Academy Press, New York VIII, p.p.421-463 (1988); eierson and Corey, Plant Molecular Biology, 2d Ed. (1988); и Miki and lyer, Fundamentals of Gene Transfer in Plants. In Plant Metabolism, 2d Ed. DT. Dennis, DH Turpin, DD Lefebrve, DB Layzell (eds), Addison - Wesley, Langmans Ltd. London, p.p.561-579 (1997). Другие методы включают прямое поглощение ДНК, применение липосом, электропорацию, например, использование протопластов, микроинъекции, микрочастиц или нитевидных кристаллов и вакуумной инфильтрации. См., например, Bilang et al. (Gene 100: 247-250 (1991), Scheid et al. (Mol. Gen. Genet. 228: 104-112, 1991), Guerche et al. (Plant Science 52: 111-116, 1987), Neuhause et al. (Theor. Appi Genet. 75: 30-36, 1987), Klein et al., Nature 327: 70-73 (1987); Howell et al. (Science 208: 1265, 1980), Horsch et al. (Science 227: 1229-1231, 1985), DeBlock et al., (Plant Physiology 91: 694-701, 1989), Liu and LomoNOsoff (J. Virol Meth, 105: 343-348, 2002). патенты США №№4945050; 5036006; 5100792; 6403865; 5625136 (все эти источники включены в данную заявку в качестве ссылок).

Методы транзиторной экспрессии могут быть применены для экспрессии конструктов по изобретению (см. Liu and LomoNOsoff, 2002, Journal of Virological Methods, 105: 343-348; этот источник включен в данную заявку посредством отсылки). Или же может быть использован метод транзиторной экспрессии с применением вакуума, например, описанный Kapila et al. 1997, Plant Science, 122: 101-108 (этот источник также включен в данную заявку посредством отсылки). Эти методы могут включать, например, но без ограничения, метод агроинокуляции или агроинфильтрации, однако, как отмечено выше, могут быть применены и другие методы транзиторной экспрессии. При агроинокуляции или агроинфильтрации во внутриклеточное пространство ткани, например, листьев, в воздушную часть растения (включая стебель, листья и цветы), в другие части растения (корень, стебель, цветок) или во все растение поступает смесь Agrobacteria, содержащая желаемую нуклеиновую кислоту. После пересечения эпидермиса Agrobacterium инфицирует и переносит копии T - ДНК в клетки. T - ДНК транскрибируется эписомально, а м - РНК транслируется, что приводит к образованию целевого белка в инфицированных клетках, однако, локализация in - ДНК в ядре клетки является транзиторной.

VLP, содержащие химерный На, полученные в соответствии с данным изобретением, могут быть применены в сочетании с существующими вакцинами от гриппа, в качестве добавки к вакцине, что делает ее более эффективной, или для уменьшения необходимой вводимой дозы. Как хорошо известно специалистам в данной области, вакцина может быть направлена против одного или более, чем одного вируса гриппа. Примеры подходящих вакцин включают, но без ограничения, вакцины, которые являются коммерчески доступными в фирмах Sanofi - Pasteur, ID Biomedical, Merial, Sinovac, Chiron, Roche, Medlmmune, GlaxoSmithKline, Novartis, Sanofi - Aventis, Serono, Shire Pharmaceuticals и т.п.

Если это желательно, VLP по данному изобретению могут быть смешаны с подходящим адъювантом, что хорошо известно специалисту в данной области. Далее, VLP может быть применена в составе вакцины, содержащей эффективную дозу VLP для лечения целевого организма, как указано выше. Кроме того, VLP, полученная согласно изобретению, может быть соединена с VLP, полученными с использованием различных белков вируса гриппа, например, нейраминидазы (NA).

Следовательно, настоящее изобретение предусматривает способ индукции иммунитета к инфекции вирусом гриппа у животного или в целевом организме, включающий ведение эффективной дозы вакцины, содержащей одну или более, чем одну VLP. Вакцина может быть введена перорально, интрадермально, интраназально, внутримышечно, интраперитонеально, внутривенно или подкожно.

Согласно различным вариантам данного изобретения композиции могут включать VLP двух или более штаммов или подтипов вируса гриппа. Выражение "два или более" относится к двум, трем, четырем, пяти, шести, семи, восьми, девяти, 10 или более штаммам или подтипам вируса. Эти штаммы или подтипы могут быть одного подтипа (например, H1N1 или H5N1) или могут быть комбинацией подтипов. Примеры подтипов или штаммов включают Н5/Indo, H1/Bri, H1/NC, H3/Bri, В/Flo. Выбор комбинации штаммов и подтипов может зависеть от географической области проживания субъектов, которые могут подвергаться инфекции вирусом гриппа, от близости видов животных к расположению популяции людей, которым должна быть проведена вакцинация (например, видов плавающих птиц, сельскохозяйственных животных, таких как свиньи и т.д.) и штаммов, которые они несут, действию которых подвергаются или, возможно, должны подвергнуться, от предсказаний антигенного дрейфа в подтипах или штаммах или от комбинации этих факторов. Примеры комбинаций, использованных в прошлые годы, доступны в базах данных, которые поддерживает Всемирная организация здравоохранения (ВОЗ) (см. URL: who.int/csr/dieease/influenza/vaccme recommendationsl/en).

Две или более VLP могут быть экспрессированы по отдельности, затем очищенные или полуочищенные VLP соединяются. Или же VLP могут быть совместно экспрессированы в организме одного и того же хозяина, например, растения, части растения или в растительной клетке. VLP могут быть соединены или получены в желаемом отношении, например, в примерно эквивалентном отношении, или могут быть соединены таким образом, что один подтип или штамм содержит большинство VLP в композиции.

Следовательно, данное изобретение предусматривает композиции, включающие VLP двух или более штаммов или подтипов.

Предусмотрено также изделие, содержащее упаковочный материал и композицию, включающую VLP, содержащую химерный НА. Такая композиция включает физиологически или фармацевтически приемлемый эксципиент, а упаковочный материал может иметь этикетку, на которой указаны активные ингредиенты композиции (например, VLP).

Настоящее изобретение предусматривает также набор, содержащий композицию, включающую нуклеиновую кислоту, кодирующую химерный НА, описанный в данном заявке, вместе с инструкцией по использованию нуклеиновой кислоты для получения химерного НА или в набор включены также VLP, содержащие химерный НА. Такой набор может быть пригодным для получения VLP, включающих химерный НА, и инструкции могут включать, например, информацию об экспрессии нуклеиновой кислоты в растении или в растительной клетке, инструкции по сбору и получению VLP из растения или растительной ткани.

Согласно другому варианту предусмотрен набор для приготовления лекарственного препарата, включающего VLP, содержащую химерный НА, вместе с инструкциями по его применению. Инструкции могут включать описание ряда стадий получения лекарственного препарата, при этом этот препарат пригоден для индукции терапевтического или профилактического иммунного ответа у субъекта, которому он был введен. Набор может также содержать инструкции, касающиеся величины доз, интервалов между введением доз, предпочтительных методов введения и т.п.

Данное изобретение будет проиллюстрировано ниже следующими примерами. Однако следует иметь в виду, что эти примеры приведены только для иллюстрации изобретения и никоим образом не ограничивают объем данного изобретения.

Ниже указаны последовательности, описанные в данной заявке.

Методы и материалы

1. Сборка кассет экспрессии НА

A - pCAMBIAPlasto

Все манипуляции производились с применением протоколов общей молекулярной биологии Sambrook and Russell (2001; этот источник включен в данную заявку посредством отсылки). В Таблице 1 представлены олигонуклеотидные праймеры, используемые для сборки кассет экспрессии. Первая стадия клонирования состояла в сборке плазмиды экспрессии рецептора, содержащей вверху и внизу по течению регуляторные элементы гена пластоцианина люцерны. Последовательности промотора пластоцианина и 5'UTR были амплифицированы с помощью геномной ДНК люцерны с применением олигонуклеотидных праймеров Xmal - pPlas.c (SEQ ID NO: 1) и SacI - ATG - pPlas.r (SEQ ID NO: 2). Полученный продукт амплификации расщепляли с помощью Xmal и SacI и дотировался в pCAMBIA2300 (Gambia, Canberra, Australia), которая была предварительно расщеплена теми же самыми ферментами с образованием вектора pCAMBIApromoPlasto. Подобным образом амплифицировали последовательности 3'UTR и терминатор гена пластоцианина амплифицировали при помощи геномной ДНК люцерны с использованием следующих праймеров: SacI - PlasTer.c (SEQ ID NO: 3) и EcoRI - PlasTer.r (SEQ ID NO: 4), и продукт расщепляли SacI и EcoRI перед инсерцией в Tc же самые сайты pCAMBIApromoPlasto с целью получения вектора pCAMBIAPlasto.

В - Plasto - нативный SP - Н5 А/Indonesia/5/05 (конструкт номер 660)

Фрагмент, кодирующий гемагглютинин вируса штамма гриппа А/Indonesia/5/05 (H5N1; Асе. No. LANL ISDN125873) был синтезирован в Epoch Biolabs (Sugar Land, TX, USA). Полученный фрагмент, содержащий полную область, кодирующую Н5, включающий нативный сигнальный пептид, фланкированный сайтом HindIII сразу же против хода транскрипции от исходного ATG и сайтом SacI сразу же по ходу транскрипции от стоп - кодона (ТАА), представлен в (SEQ ID NO: 52; на Фигуре 17). Область, кодирующая Н5, была клонирована в кассету экспрессии на основе белка пластоцианина методом лигирования с применением ПЦР, описанного Darveau et al. (1995). Вкратце, ПЦР амплификация была осуществлена с применением праймеров Plasto - 443 с (SEQ ID NO: 5;) и SpHA (Ind) - Plasto.r (SEQ ID NO: 6) и матрицы pCAMBIApromoPlasto. Параллельно, проводили вторую амплификацию при помощи праймеров Plasto - SpHA (SEQ ID NO: 7) и НА(Ind) - Sac.r (SEQ ID NO: 8) с фрагментом, кодирующими Н5 (SEQ ID NO: 52; см. Фигуру 17) в качестве матрицы. Продукты амплификации, полученные в результате обеих реакций, смешивали вместе и полученная смесь служила как матрица для третьей реакции (реакции сборки) с применением Plasto - 443 с (SEQ ID NO: 5) и НА(Ind) - Sac.r (SEQ ID NO:8) качестве праймеров. Полученный фрагмент расщепляли BamH1 (в промоторе пластоцианина) и SacI (на конце 3'фрагмента) и клонировали в pCAMBIAPlasto, предварительно расщепленный теми же самыми ферментами. Полученная плазмида под обозначением 660 представлена на Фигуре 18 (SEQ ID NO: 53).

С - Plasto - PDI SP - H1 A/New Caledonia/20/99 (конструкт номер 540)

Открытая рамка считывания гена вируса гриппа H1 штамма А/New Caledonia/20/99 (H1N1) была синтезирована в виде двух фрагментах (Plant Biotechnology Institute, National Research Council, Saskatoon, CaNaCla). Первый синтезированный фрагмент соответствует последовательности, кодирующей белок дикого типа H1 (GenBank асе. No. AY289929; SEQ ID NO: 54; Фигура 19), не содержащей последовательность, кодирующую сигнальный пептид на 5'-конце, и последовательность, кодирующую трансмембранный домен на 3'-конце. 5'-конец этого фрагмента состоит из последних нуклеотидов, кодирующих PDISP (включая сайт рестрикции BglII), и двойной сайт SacI/StuI был добавлен сразу же вниз по течению от стоп - кодона на 3'-конце этого фрагмента для получения SEQ ID NO: 55 (Фигура 20). Второй фрагмент, кодирующий С - конец белка H1 (включающий трансмембранный домен и цитоплазматический хвост) из сайта Kpnl к стоп - кодону, и фланкированный в 3'-конце рестрикционными сайтами SacI и StuI, был также синтезирован (SEQ ID NO: 56; Фигура 21).

Первый фрагмент H1 расщепляли сайтами BglII и SacI и клонировали в Tc же самые сайты бинарного вектора (pCAMBIAPlasto), который содержит промотор и 5'UTR пластоцианина, слитые с сигнальным пептидом гена протеин дисульфилизомеразы (PDI) люцерны (нуклеотиды 32-103; Accession No. Z11499; SEQ ID NO: 57; Фигура 22), что привело к получению химерного гена PDI - H1 вниз по течению от регуляторных элементов пластоцианина. Последовательность в кассете на основе пластоцианина, содержащая промотор и сигнальный пептид PDI вверх к сайту рестрикции BglII и терминатор пластоцианина ниже сайта Sad, представлена в SEQ ID NO: 58 (Фигура 23). Добавление С - концевой области, кодирующей H1 (кодирующей трансмембранный домен и цитоплазматический хвост), осуществляли путем инсерции синтезированного фрагмента (SEQ ID NO: 56; Фигура 21), предварительно расщепленного сайтами Kpnl и SacI в плазмиде экспрессии H1. Полученный конструкт под номером 540 представлен в последовательности SEQ ID NO: 59 (Фигура 24).

D - Plasto - нативный SP - H1 A/Brisbane/59/07 (конструкт номер 774)

Кассета экспрессии номер 774, управляющая экспрессией H1 штамма А/Brisbane/59/07, собиралась следующим образом. Был синтезирован синтетический фрагмент, включающий полную последовательность, кодирующую гемагглютинин (от ATG до стоп - кодона), фланкированную в положении 3' последовательностями гена пластоцианина люцерны, соответствующими первым 84 нуклеотидам вверх по течению от ATG пластоцианина, начиная от сайта рестрикции DraIII. Синтетические фрагменты содержали также сайт SacI сразу же вниз по течению от стоп - кодона.

Синтетический фрагмент был синтезирован компанией Top Gene Technologies (Montreal, QC, CaNaCla). Синтезированный фрагмент находится в SEQ ID NO: 60 (Фигура 25). Для сборки полной кассеты экспрессии синтетический фрагмент расщеплялся сайтами DraIII и SacI и его клонировали в вектор pCAMBIAPlasto, который был предварительно расщеплен теми же самыми ферментами с получением конструкта номер 774 (SEQ ID NO: 61; Фигура 26).

Е - CPMV HT - LC C51 (конструкт номер 828)

Кассеты экспрессии вируса CPMV-HT используют промотор 35S для контроля экспрессии мРНК, включающей целевую кодирующую последовательность, фланкированную в положении 5' нуклеотидами 1-512 вируса мозаики коровьего гороха (CPMV) RNA2 с мутированным ATG в положениях 115 and 161, и в положении 3' нуклеотидами 3330-3481 вируса CPMV RNA2 (соответствующими 3'UTR) с последующим NO - терминатором. Плазмида pBD-С5-1LC, (Sainsbury et al. 2008; Plant Biotechnology Journal 6: 82-92 и международная заявка WO 2007/135480), была использована для сборки кассет экспрессии гемагглютинина, основанных на использовании вируса CPMV - HT. Мутацию ATGs в положениях 115 и 161 вируса CPMV RNA2 проводили с применением метода дотирования, основанного на ПЦР, описанного Darveau et al. (Methods in Neuroscience 26: 77-85 (1995)). Осуществляли две отдельные ПЦРз с применением pBD-С5-1LC в качестве матрицы. Праймерами для первой амплификации служили pBinPlus.2613c (SEQ ID NO: 9) и Mut - ATG115.r (SEQ ID NO: 10). В качестве праймеров для проведения второй амплификации использовали Mut - ATG161.C (SEQ ID NO: 11) и LC-С5-1.110r (SEQ ID NO: 12). Два полученных фрагмента смешивали и применяли в качестве матрицы для проведения третьей амплификации с применением pBinPlus.2613c (SEQ ID NO: 9) и LC-С5-1.110r (SEQ ID NO: 12) в качестве праймеров. Полученный фрагмент расщепляли рестриктазами PacI и Apal и клонировали в pBD-C5-lLC, который был расщеплен теми же самыми ферментами. Полученный конструкт номер 828 показан на Фигуре 27 (SEQ ID NO: 62).

Рецептор-связывающий домен (RB) F - H1 A/Brisbane/59/07 в остове полипептида в Н5 A/Indonesia/5/05 (конструкт номер 690)

Химерный НА был получен путем замещения RB домена в Н5 А/Indonesia/5/05 доменом H1A/Brisbane/59/07 с применением метода лигирования с использованием ПЦР, описанного Darveau et al. (Methods in Neuroscience 26: 77-85 (1995)). В первом раунде ПЦР сегмент промотора пластоцианина, слитого в природным сигнальным пептидом, доменами F'1 и E1 Н5 А/Indonesia/5/05, был амплифицирован с применением праймеров Plasto - 443 с (SEQ ID NO:5)и E1 H1B-E1 H5I.r (SEQ ID NO: 13) и конструкта номер 660 (SEQ ID NO: 53, Фигура 18) в качестве матрицы. Второй фрагмент, включающий последовательность, кодирующую RB домен H1A/Brisbane/59/07, был амплифицирован с применением праймеров Е1 H5N - E1 H1B.c (SEQ ID NO: 14) и Е2 H5I - RB H1B.r (SEQ ID NO: 15) и конструкта номер 774 (SEQ ID NO: 61; Фигура 26) в качестве матрицы. Третий фрагмент, включающий Е2, F'2, F, трансмембранный и цитоплазматический домены Н5 А/Indonesia/5/05 был амплифицирован с применением праймеров RB H1B - Е2 H5I.c (SEQ ID NO: 16) и НА(Ind) - Sacl.r (SEQ ID NO: 8) и конструкта номер 660 (SEQ ID NO: 53; Фигура 18) в качестве матрицы. Продукты амплификации затем смешивали и использовали в качестве матрицы для второго раунда амплификации (реакция сборки) с праймерами Plasto-443c (SEQ ID NO: 5) и НА(Ind) - Sacl.r (SEQ ID NO: 8). Полученный фрагмент расщепляли рекстриктазами BamH1 (в промоторе пластоцианина) и SacI (после стоп - кодона) и клонировали в конструкт номер 660 (SEQ ID NO: 53; Фигура 18), который был предварительно расщеплен теми же самыми рекстриктазами с получением конструкта номер 690 (SEQ ID NO: 63). Этот конструкт показан на Фигуре 28.

Домен эстеразы вируса G - H1 A/Brisbane/59/07 и рецептор-связывающий домен (E1-RB-E2) в остове вируса Н5 A/Indonesia/5/05 (конструкт номер 691)

Химерный НА был собран путем замещения доменов Е1-RB-Е2 в Н5 А/Indonesia/5/05 доменами H1A/Brisbane/59/07 при помощи метода лигирования с применением ПЦР, описанного Darveau et al. (Methods in Neuroscience 26: 77-85, (1995)). В первом раунде ПЦР сегмент промотора пластоцианина, слитый с природным сигнальным пептидом и доменом F' 1 вируса Н5 А/Indonesia/5/05 был амплифицирован при помощи праймеров Plasto - 443 с (SEQ ID NO: 5) и E1 H1B - F'1 H5I.r (SEQ ID NO: 17) и конструкта номер 660 (SEQ ID NO: 53; Фигура 18) в качестве матрицы. Параллельно проводили амплификацию двух других фрагментов. Второй фрагмент, содержащий последовательность, кодирующую домены Е1 - RB-E2 в H1A/Brisbane/59/07, был амплифицирован с помощью праймеров F'1 H5N - E1 H1B.c (SEQ ID NO: 18) и F'2 H5I - E2 H1B.r (SEQ ID NO: 19) и конструкта номер 774 (SEQ ID NO: 61; Фигура 26) в качестве матрицы. Для третьего фрагмента, F'2, F, были амплифицированы трансмембранный и цитоплазматический домены Н5 А/Indonesia/5/05 с помощью праймеров E2 H1B - F'2 H5I.C (SEQ ID NO: 20) и НА (Ind) - Sacl.r (SEQ ID NO: 8) и конструкта номер 660 (SEQ ID NO: 53; Фигура 18) в качестве матрицы. Продукты амплификации затем соединяли и применяли в качестве матрицы для проведения второго раунда амплификации (реакция сборки) с помощью праймеров Plasto - 443 с (SEQ ID NO: 5) и НА(Ind) - Sacl.r (SEQ ID NO: 8). Полученный фрагмент расщепляли при помощи BamH1 (в промоторе пластоцианина) и SacI (после стоп - кодона) и клонировали в конструкт номер 660 (SEQ ID NO: 53; Фигура 18), предварительно расщепленный теми же самыми рестрикционными ферментами с образованием конструкта номер 691 (SEQ ID NO: 64). Этот конструкт представлен на Фигуре 29.

Рецептор-связывающий домен (RB) вируса Н - Н5 А/Indonesia/5/05В остове вируса H1A/New Caledonia/20/99 (конструкт номер 696)

Химерный НА был получен путем замещения домена RB вируса H1 A/New Caledonia/20/99 доменом RB Н5 A/Indonesia/5/05 при помощи метода лигирования с применением ПЦР, описанного Darveau et al. (Methods in Neuroscience 26: 77- 85(1995)). В первом раунде ПЦР сегмент промотора пластоцианина, слитый с сигнальным пептидом протеин - дисульфидизомеразы люцерны (PDISP; Accession No. Z11499; нуклеотиды 32-103 в SEQ ID NO: 57; Фигура 22), домены F'1 и E1B H1 A/New Caledonia/20/99 были амплифицированы с помощью праймеров Plasto - 443 с (SEQ ID NO: 5) и E1 H51-E1 H1NC.r (SEQ ID NO: 21) и конструкта номер 540 (SEQ ID NO: 59; Фигура 24) в качестве матрицы. Второй фрагмент, содержащий последовательность, кодирующую домен RB в Н5 А/Indonesia 5/05, был амплифицирован с помощью праймеров E1 H1NC - Е1 H5I.C (SEQ ID NO: 22) и E2 H1NC - RB H5I.r (SEQ ID NO: 23) и конструкта номер 660 (SEQ ID NO: 53; Фигура 18) в качестве матрицы. Третий фрагмент, содержащий E2, F'2, F, трансмембранный и цитоплазматический домены вируса H1A/New Caledonia/20/99, был амплифицирован при помощи праймеров RB H5I - E2 H1NC.с (SEQ ID NO: 24) и НА - Sacl.r (SEQ ID NO: 25) и конструкта номер 540 (SEQ ID NO: 59; Фигура 24) в качестве матрицы. Продукты амплификации затем соединяли и применяли в качестве матрицы для проведения второго раунда амплификации (реакция сборки) с помощью праймеров Plasto - 443 с (SEQ ID NO: 5) и НА - Sacl.r (SEQ ID NO: 25). Полученный фрагмент расщепляли при помощи BglII и SacI и клонировали в конструкт номер 540 (SEQ ID NO: 59; Фигура 24), предварительно расщепленный теми же самыми рестрикционными ферментами с образованием конструкта номер 696 (SEQ ID NO: 65). Полученный конструкт представлен на Фигуре 30.

I - сборка вируса H1A/Brisbane/59/2007 в кассете экспрессии CPMV - НТ (конструкт номер 732).

Последовательность, кодирующая НА вируса H1A/Brisbane/59/2007 была клонирована в CPMV - НТ следующим образом. Сайты рестрикции Apal (непосредственно вверх от ATG) и StuI (непосредственно вниз от стоп - кодона) были добавлены к последовательности, кодирующей гемагглютинин путем амплификации с помощью ПЦР с использованием праймеров Apal - H1B.c (SEQ ID NO: 26) и StuI - H1B.r (SEQ ID NO: 27) и конструкта номер 774 (SEQ ID NO: 61; Фигура 26) в качестве матрицы. Полученный фрагмент расщепляли при помощи рестрикционных ферментов Apal и StuI и клонировали в конструкт номер 828 (SEQ ID NO: 62; Фигура 27), расщепленный теми же самыми ферментами. Полученная кассета получила название конструкт номер 732 (SEQ ID NO: 66; Фигура 31).

J - сборка SpPDI-H1 A/Brisbane/59/2007 в кассете экспрессии CPMV - НТ (конструкт номер 733).

Последовательность, кодирующая сигнальный пептид протеин дисульфидизомеразы люцерны (PDISP; нуклеотиды 32-103 в SEQ ID NO: 57, Фигура 22; Accession No. Z11499), была слита с последовательностью, кодирующей НА0 формы H1 вируса А/Brisbane/59/2007 и полученный фрагмент клонировали в CPMV - НТ следующим образом. Последовательность, кодирующая H1, была амплифицирована с помощью праймеров SpPDI - H1B.c (SEQ ID NO: 28) и SacI - H1B.r (SEQ ID NO: 29) и конструкта номер 774 (SEQ ID NO: 61; Фигура 26) в качестве матрицы. Полученный фрагмент состоял из последовательности, кодирующей H1, фланкированной, в положении 5', последними нуклеотидами, кодирующими PDISP (включая сайт рестрикции BglII), и, в положении 3', сайтом рестрикции SacI. Этот фрагмент расщеплялся сайтами рестрикции BglII и SacI и клонировался в конструкт номер 540 (SEQ ID NO: 59; Фигура 24), предварительно расщепленный теми же самыми ферментами. Кодирующая последовательность промежуточной кассеты, названная конструктом номер 787 (SEQ ID NO: 67), представлена на Фигуре 32. Сайты рестрикции Apal (непосредственно вверх от ATG) и StuI (непосредственно вниз от стоп - кодона) были добавлены к последовательности, кодирующей гемагглютинин методом ПЦР - амплификации с помощью праймеров Apal - SpPDI.c (SEQ ID NO: 30) и StuI - H1B.r (SEQ ID NO: 27) и конструкта номер 787 (SEQ ID NO: 67; Фигура 32) в качестве матрицы. Полученный фрагмент расщеплялся рестриктазами Apal и StuI и клонировался в конструкт номер 828 (SEQ ID NO: 62; Фигура 27), расщепленный теми же самыми ферментами. Полученная кассета получила название конструкт номер 733 (SEQ ID NO: 66; Фигура 33).

К - сборка рецептор-связывающего домена (RB) H1 A/Brisbane/59/07 в остове вируса Н5 А/Indonesia/5/05 при помощи кассеты для экспрессии CPMV - НТ (конструкт номер 734).

Последовательность, кодирующая химерный НА, содержащийся в RB - домене H1A/Brisbane/59/07 в остове вируса Н5 А/Indonesia/5/05, была клонирована в CPMV - НТ следующим образом. Сайты рестрикции Apal (непосредственно против хода транскрипции от ATG) и StuI (непосредственно по ходу транскрипции от стоп - кодона) были добавлены к последовательности, кодирующей гемагглютинин путем амплификации с помощью ПЦР с использованием праймеров Apal - Н5 (А - Indo).1c (SEQ ID NO: 31) и Н5 (А - Indo) - StuI.1707r (SEQ ID NO: 32) и конструкта номер 690 (SEQ ID NO: 63; Фигура 28) в качестве матрицы. Полученный фрагмент расщепляли рестриктазами Apal и StuI и клонировали в конструкт номер 828 (SEQ ID NO: 62; Фигура 27), расщепленный теми же самыми ферментами. Полученная кассета получила название конструкт номер 734 (SEQ ID NO: 69; Фигура 34).

L - сборка SpPDI - Н3 A/Brisbane/10/2007 в кассете экспрессии CPMV - НТ (конструкт номер 736).

Последовательность, кодирующая сигнальный пептид альфальфа - PDI, слитый с НА0 в H3A/Brisbane/10/2007, была клонирована в CPMV - НТ следующим образом. Сначала был получен синтетический фрагмент, включающий полную последовательность, кодирующую гемагглютинин (от ATG до стоп - кодона), фланкированную в положении 3' последовательностью гена пластоцианина люцерны (люцерны), соответствующей первым 84 нуклеотидам (начиная с сайта рестрикции DraIII) вверх по течению от ATG пластоцианина. Синтетический фрагмент содержал также сайт SacI непосредственно после стоп - кодона. Синтетический фрагмент был синтезирован в Top Gene Technologies (Montreal, QC, CaNaCla). Этот синтезированный фрагмент представлен в SEQ ID NO: 70 (Фигура 35) и он был применен в качестве матрицы для последующего ПЦР - лигирования.

Затем сигнальный пептид альфальфа - протеин - дисульфидизомеразы (PDISP) (нуклеотиды 32 - 103; Accession No Z11499; SEQ ID NO: 57; Фигура 22) был линкован с последовательностью, кодирующей НА0 формы 3 A/Brisbane/10/2007 вместе с сайтом рестрикции ApaI непосредственно вверх по течению от ATG и сайтом рестрикции StuI вниз по течению от стоп - кодона следующим образом. PDISP был присоединен к последовательности, кодирующей Н3, методом ПЦР - лигирования, описанным Darveau et al. (Methods in Neuroscience, 26: 77-85(1995)). В первом раунде ПЦР сигнальный пептид PDISP был амплифицирован с помощью праймеров Apal - SpPDI.c (SEQ ID NO: 30) и Н3В - SpPDI.r (SEQ ID NO: 33) и конструкта номер 540 (SEQ ID NO: 59; Фигура 24) в качестве матрицы. Параллельно был амплифицирован другой фрагмент, содержащий часть последовательности, кодирующей Н3 A/Brisbane/10/2007 (от кодона 17 к стоп - кодону) с помощью праймеров SpPDI - Н3В.с (SEQ ID NO: 34) и StuI - Н3В.r (SEQ ID NO: 35) с использованием ранее синтезированного фрагмента (SEQ ID NO: 70; Фигура 35) в качестве матрицы. Продукты амплификации затем смешивали и использовали в качестве матрицы для второго раунда амплификации (реакция сборки) с праймерами Apal - SpPDI.c (SEQ ID NO: 30) и StuI - Н3В.r (SEQ ID NO: 35). Полученный фрагмент расщеплялся рестриктазами Apal и StuI и клонировался в конструкт номер 828 (SEQ ID NO: 62; Фигура 27), расщепленный теми же самыми ферментами. Полученная кассета получила название конструкт номер 736 (SEQ ID NO: 71; Фигура 36).

М - сборка химерного SpPDI - H3A/Brisbane/10/2007 (эктодомен) +Н5 А/Indonesia/5/2005 (TmD+Cyto - хвост) в кассете экспрессии CPMV - НТ (конструкт номер 737).

Последовательность, кодирующая сигнальный пептид альфальфа - PDI, слитый с эктодоменом Н3 A/Brisbane/10/2007 и с трансмембранным и цитоплазматическим доменами Н5 А/Indonesia/5/2005, была клонирована в CPMV - НТ следующим образом. Последовательность, кодирующая PDISP - Н3 была слита с трансмембранным доменом Н5 методом ПЦР - лигирования, описанным Darveau et al. (Methods in Neuroscience 26: 77-85(1995)). В первом раунде ПЦР фрагмент, содержащий сигнальный пептид PDISP и эктодомен из Н3 Brisbane был получен путем амплификации (с помощью сайта рестрикции Apal вверх по течению от исходной ATG PDISP) с применением праймеров Apal - SpPDI.c (SEQ ID NO: 30) и TmD H5I - H3B.r (SEQ ID NO: 36) и конструкта номер 736 (SEQ ID NO: 71; Фигура 36) в качестве матрицы. Параллельно был амплифицирован другой фрагмент, содержащий трансмембранный и цитоплазматический домены Н5 Indonesia, при помощи праймеров Н3В - TmD H5I.C (SEQ ID NO: 37) Н5 (A-Indo)-StuI.1707r (SEQ ID NO: 32) и конструкта номер 660 (SEQ ID NO: 53; Фигура 18) в качестве матрицы. Продукты амплификации затем смешивали и использовали в качестве матрицы для второго раунда амплификации (реакция сборки) с праймерами Apal - SpPDI.c (SEQ ID NO: 30) и Н5 (А - Indo) - StuI.1707r (SEQ ID NO: 32). Полученный фрагмент расщеплялся рестриктазами Apal и StuI и клонировался в конструкт номер 828 (SEQ ID NO: 62; Фигура 27), расщепленный теми же самыми ферментами. Полученная кассета получила название конструкт номер 737 (SEQ ID NO: 72; Фигура 37).

N - сборка SpPDI - НА В/Florida/4/2006 в кассете экспрессии CPMV - НТ (конструкт номер 739).

Последовательность, кодирующая сигнальный пептид PDI люцерны, слитый с НА0 в НА В/Florida/4/2006, клонировали в CPMV - НТ следующим образом. Сначала синтезировали синтетический фрагмент, включающий полную последовательность, кодирующую гемагглютинин (от ATG до стоп - кодона), фланкированную в положении 3' последовательностью гена пластоцианина люцерны, соответствующей первым 84 нуклеотидам (начиная от сайта рестрикции DraIII) вверх по течению от ATG пластоцианина. Синтетический фрагмент содержал также сайт рестрикции SacI непосредственно после стоп - кодона. Синтетический фрагмент был получен в Epoch Biolabs (Sugar Land, Texas, USA). Синтезированный фрагмент представлен и в SEQ ID NO: 73 (Фигура 38) и затем был применен в качестве матрицы для проведения лигирования с использованием ПЦР.

Затем сигнальный пептид протеин - дисульфидизомеразы (PDISP) люцерны (нуклеотиды 32 - 103; SEQ ID NO: 57; Фигура 22; Accession No Z11499) был присоединен к последовательности, кодирующей НА0 формы В Florida/4/2006 вместе с сайтом рестрикции Apal непосредственно против хода транскрипции от ATG и сайтом рестрикции StuI вниз по ходу транскрипции от стоп - кодона следующим образом. PDISP был линкован с последовательностью, кодирующей НА, методом ПЦР - лигирования, описанным Darveau et al. (Methods in Neuroscience, 26: 77-85(1995)). В первом раунде ПЦР сигнальный пептид PDISP был амплифицирован с помощью праймеров Apal - SpPDI.c (SEQ ID NO: 30) и конструкта номер 540 (SEQ ID NO: 59; Фигура 24) в качестве матрицы. Параллельно был амплифицирован другой фрагмент, содержащий часть последовательности, кодирующей НА В Florida/4/2006 (от кодона 16 к стоп - кодону) с помощью праймеров SpPDI - HBF.c (SEQ ID NO: 39) и StuI - HBF.r (SEQ ID NO: 40) с использованием ранее синтезированного фрагмента (SEQ ID NO: 73; Фигура 38) в качестве матрицы. Продукты амплификации затем смешивали и использовали в качестве матрицы для второго раунда амплификации (реакция сборки) с праймерами Apal - SpPDI.c (SEQ ID NO: 30) и StuI - HBF.r (SEQ ID NO: 40). Полученный фрагмент расщеплялся рестриктазами Apal и StuI и клонировался в конструкт номер 828 (SEQ ID NO: 62; Фигура 27), расщепленный теми же самыми ферментами. Полученная кассета получила название конструкт номер 739 (SEQ ID NO: 74; Фигура 39).

О - сборка химерного SpPDI - НА В/Florida/4/2006 (эктодомен) +Н5 A/Indonesia/5/2005 (TmD+Cyto - хвост) в кассете экспрессии CPMV - НТ (конструкт номер 745).

Последовательность, кодирующая сигнальный пептид PDI люцерны, слитый с эктодоменом НА В/Florida/4/2006А и с трансмембранным и цитоплазматическим доменами Н5 А/Indonesia 151 2005, клонировали в CPMV - НТ следующим образом. Последовательность, кодирующая эктодомен PDISP - В/ Florida/4/ 2006 была слита с трансмембранным и цитоплазматическим доменами Н5 путем лигирования с применением ПЦР, как описано Darveau et al. (Methods in Neuroscience 26: 77-85(1995)). В первом раунде ПЦР фрагмент, содержащий сигнальный пептид PDISP, слитый с эктодоменом в НА В/Florida/4/2006, был получен путем амплификации при помощи праймеров Apal - SpPDI.c (SEQ ID NO: 30) и TmD H5I - В Flo.r (SEQ ID NO: 41) и конструкта номер 739 (SEQ ID NO: 74; Figure 39) в качестве матрицы. Параллельно был амплифицирован другой фрагмент, содержащий трансмембранный и цитоплазматический домены Н5 Indonesia при помощи праймеров В Flo - TmD H5I.C (SEQ ID NO: 42) и Н5 (A-Indo) - StuI.1707r (SEQ ID NO: 32) и конструкта номер 660 (SEQ ID NO: 53; Фигура 18) в качестве матрицы. Продукты амплификации затем смешивали и использовали в качестве матрицы для второго раунда амплификации (реакция сборки) с праймерами Apal - SpPDI.c (SEQ ID NO: 30) и Н5 (A-Indo)-StuI.1707r (SEQ ID NO: 32). Полученный фрагмент расщеплялся рестриктазами Apal и StuI и клонировался в конструкт номер 828 (SEQ ID NO: 62; Фигура 27), расщепленный теми же самыми ферментами. Полученная кассета получила название конструкт номер 745 (SEQ ID NO: 75; Фигура 40).

Р - сборка химерного SpPDI - НА В/Florida/4/2006+Н5 A/Indonesia/5/2005 (TmD+Cyto - хвост) в кассете экспрессии 2X35S - CPMV - НТ (конструкт номер 747).

Последовательность, кодирующая сигнальный пептид PDI люцерны, слитый с НА0 в НА В/Florida/4/2006 и с трансмембранным и цитоплазматическим доменами Н5 А/Indonesia/5/2005, клонировали в 2X35S - CPMV - НТ следующим образом. Переключение промоторов проводили методом лигирования с применением ПЦР, как описано Darveau et al. (Methods in Neuroscience 26: 77-85 (1995)). Первый фрагмент, содержащий промотор 2X35S (SEQ ID NO: 88; Фигура 50А) амплифицировали ПЦР с помощью праймеров PacI - MCS - 2X35S.C (SEQ ID NO: 89) CPMV 5'UTR - 2X35S.r (SEQ ID NO: 90):

Pad - MCS-2X35S.C (SEQ ID NO: 89)

AATTGTTAATTAAGTCGACAAGCTTGCATGCCTGCAGGTCAAC

CPMV 5'UTR - 2X35S.r (SEQ ID NO: 90)

TCAAAACCTATTAAGATTTTAATACCTCTCCAAATGAAATGAACTTCC.

используя плазмиду, содержащую промотор 2X35S в качестве матрицы. Параллельно проводили вторую реакцию ПЦР, применяя праймеры 2X35S - CPMV 5'UTR.c (SEQ ID NO: 91) и Apal - M prot.r (SEQ ID NO: 92):

2X35S- CPMV 5'UTR.c (SEQ ID NO: 91)

TTGGAGAGGTATTAAAATCTTAATAGGTTTTGATAAAAGCGAACGTGGG

Apal - M prot.r (SEQ ID NO: 92)

TCTCCATGGGCCCGACAAATTTGGGCAGAATATACAGAAGCTTA.

используя конструкт номер 745 (SEQ ID NO: 75; Фигура 40) в качестве матрицы. Два полученных фрагмента затем смешивали и применяли в качестве матрицы для второго раунда ПЦР (реакция сборки) с помощью PacI - MCS-2X35S.C (SEQ ID NO:89) Apal - M prot.r (SEQ ID NO: 92) в качестве праймеров. Полученный фрагмент расщепляли рестриктазами Apal и StuI и клонировался в конструкт номер 745 (SEQ ID NO: 75; Фигура 40), который был расщеплен теми же самыми ферментами. Последовательность кассеты экспрессии, получившей название конструкт 747 (SEQ ID NO: 93), представлена на Фигуре 50В.

2. Сборка кассет для экспрессии шаперонов

Проводили сборку двух кассет для экспрессии белков теплового шокап (Hsp). В первой кассете экспрессия цитозольного HSP70 (Athsp70 - 1 in Lin et al. (2001), Cell Stress and Chaperones 6: 201-208) Arabidopsis tHA1iana (экотип Columbia) контролировалась химерным промотором, объединяющим элементы нитрит - редуктазы (Nir) люцерны и промоторы пластоцианина (Nir/Plasto) люцерны. Собирали также вторую кассету, содержащую кодирующую область цитозольного HSP40 (MsJl; Frugis et al. (1999) Plant Molecular Biology 40: 397-408) люцерны под контролем химерного промотора Nir/Plasto.

Сначала собирали плазмиду акцептора, содержащего промотор нитрит - редуктазы (Nir) люцерны, репортер - ген GUS и NO - терминатор в бинарном векторе растения. Плазмида pNir3K51 (описанная ранее в патенте США №6,420,548) расщеплялась indIII и EcoRI. Полученный фрагмент клонировали в рСАМВ1А2300 (Gambia, Canberra, Australia), который был расщеплен теми же самыми рекстриктазами с образованием pCAMBIA - Nir3K51.

Последовательности, кодирующие Hsp70 и Hsp40, клонировали отдельно в плазмиду акцептора pCAMBIANir3K51 методом лигирования с применением ПЦР, как описано Darveau et al. (Methods in Neuroscience 26: 77-85 (1995)).

Для Hsp40 последовательность, кодирующая Msjl (SEQ ID NO: 76; Фигура 41) была амплифицирована путем RT - ПЦР из полной РНК листьев люцерны (экотип Rangelander) с применением праймеров Hsp40Luz.1c (SEQ ID NO: 43) и Hsp40Luz-SacI.1272r (SEQ ID NO: 44). Вторую амплификацию проводили с помощью праймеров Plasto - 443 с (SEQ ID NO: 5) и Hsp40Luz - Plasto.r (SEQ ID NO: 45) с конструктом номер 660 (SEQ ID NO: 53; Фигура 18) в качестве матрицы. Затем продукты ПЦР смешивали и применяли в качестве матрицы для проведения третьей амплификации (реакции сборки) с помощью праймеров Plasto -443 с (SEQ ID NO: 5) и Hsp40Luz - SacI.1272r (SEQ ID NO: 44). Затем продукты ПЦР смешивали и применяли в качестве матрицы для pCAMBIANir3K51, который был предварительно расщеплен Нра! (в промоторе Nir) и Sad, и заполнялся Т4 ДНК - полимеразой для получения "тупых" концов. Проводили скрининг полученных клонов для правильной ориентации и секвенировали для получения полной последовательности. Полученная плазмида, обозначенная R850, представлена на фигуре 42 (SEQ ID NO: 77). Область, кодирующая Athsp70 - 1 была амплифицирована методом ОТ - ПЦР из РНК листьев Arabidopsis при помощи праймеров Hsp70Ara.1c (SEQ ID NO: 46) и Hsp70Ara - SacI.1956r (SEQ ID NO: 47). Вторую амплификацию проводили с помощью праймеров Plato - 443 с (SEQ ID NO: 5) и Hsp70Ara - Plasto.r (SEQ ID NO: 48) с конструктом номер 660 (SEQ ID NO: 53; Фигура 18) в качестве матрицы. Затем продукты ПЦР смешивали и применяли в качестве матрицы для третьей амплификации (реакции сборки) с помощью праймеров Plasto - 443 с (SEQ ID NO: 5) и Hsp70ARA - SacI.1956r (SEQ ID NO: 47). Полученный фрагмент расщепляли Hpal (в промоторе пластоцианина) и клонировали в pCAMBIANir3K51, который был расщеплен Hpal (в промоторе Nir) и SacI и заполнен Т4 ДНК - полимеразой для получения "тупых" концов. Проводили скрининг полученных клонов для правильной ориентации и секвенировали для получения полной последовательности. Полученная плазмида, обозначенная R860, представлена на фигуре 43 (SEQ ID NO: 78). Бифункциональная плазмида для экспрессии Hsp была собрана следующим образом. R860 (SEQ ID NO: 78; Фигура 43) расщепляли сайтом BsrBI (по ходу транскрипции от NOS - терминатора), обрабатывали Т4 ДНК - полимеразой для образования "тупого" конца и расщепляли сайтом Sbfl (против хода транскрипции от химерного промотора NIR/Plasto). Полученный фрагмент (химерный Nir/Plasto промотор - последовательность, кодирующая HSP70, NO - терминатор) была клонирована в R850 (SEQ ID NO: 77; Фигура 42), расщепленную предварительно Sbfl и Smal (которые оба расположены в множественном сайте клонирования против хода транскрипции от химерного Nir/Plasto - промотора). Полученная плазмида под названием R870 представлена на Фигуре 44 (SEQ ID NO: 79).

3. Сборка других кассет экспрессии Кассета экспрессии HcPro

Конструкт HcPro (35НсРго) был получен, как описано Hamilton et al. (2002). Все клоны секвенировали для подтверждения целостности конструктов. Эти плазмиды были использованы для трансформации Agrobacteium tumefaciens (AGL1; АТСС, Manassas, VA 20108, USA) методом электропорации (Mattanovich et al., 1989). Целостность всех штаммов A. tumefaciens была подтверждена методом рестрикционного картирования.

Кассета экспрессии белка р19

Последовательность, кодирующая белок р19 вируса кустистой карликовости томата (TBSV), была линкована в кассете экспрессии пластоцианина люцерны методом лигирования с применением ПЦР, описанного Darveau et al. (Methods in Neuroscience 26: 77-85(1995)). В первом раунде ПЦР сегмент промотора пластоцианина был амплифицирован с помощью промотора пластоцианина и праймеров Plasto - 443 с (SEQ ID NO: 5) и supP19 - plasto.r (SEQ ID NO: 49) и конструкта 660 (SEQ ID NO: 53) в качестве матрицы. Параллельно был амплифицирован другой фрагмент, содержащий последовательность, кодирующую р19 при помощи праймеров supP19 - 1С (SEQ ID NO: 50) и SupP19 - SacI.r (SEQ ID NO: 51) с использованием в качестве матрицы конструкта 35S:p19, описанного Voinnet et al. (The Plant Journal 33: 949-956 (2003)). Затем продукты амплификации смешивали и применяли в качестве матрицы для второго раунда амплификации (реакции сборки) с помощью праймеров Plasto - 443 с (SEQ ID NO: 5) и SupP19 - Sacl.r (SEQ ID NO: 51). Полученный фрагмент расщеплялся BamH1 (в промоторе пластоцианина) и SacI (на конце последовательности, кодирующей р19) и клонировался в конструкт номер 660 (SEQ ID NO: 53; Фигура 18), ранее расщепленный теми же самыми рестриктазами с образованием конструкта номер R472. Плазмида R472 показана на Фигуре 45.

Конструкт номер 443.

Конструкт номер 443 соответствует рСАМВ1А2300 (пустой вектор).

Таблица 1
Олигонуклеотидные праймеры, использованные для сборки кассет экспрессии
SEQ ID Название Олигонуклеотидная последовательность (5'-3')
1 XmaI-pPlas.c AGTTCCCCGGGCTGGTATATTTATATGTTGTC
2 SacI-ATG-pPlas.r AATAGAGCTCCATTTTCTCTCAAGATGATTAATTAATTAATTAGTC
3 SacI-PlasTer.c AATAGAGCTCGTTAAAATGCTTCTTCGTCTCCTATTTATAATATGG
4 EcoRI-PlasTer.r TTACGAATTCTCCTTCCTAATTGGTGTACTATCATTTATCAAAGGGGA
5 Plasto-443c GTATTAGTAATTAGAATTTGGTGTC
6 SpHA(Ind)-Plasto.r GCAAGAAGAAGCACTATTTTCTCCATTTTCTCTCAAGATGATTA
7 Plasto-SpHA.c TTAATCATCTTGAGAGAAAATGGAGAAAATAGTGCTTCTTCTTGC
8 HA(Ind)-Sac.r ACTTTGAGCTCTTAAATGCAAATTCTGCATTGTAACGA
9 PbinPlus.2613c AGGAAGGGAAGAAAGCGAAAGGAG
10 Mut-ATG115.r GTGCCGAAGCACGATCTGACAACGTTGAAGATCGCTCACGCAAGAAAGACAAGAGA
11 Mut-ATG161.c GTTGTCAGATCGTGCTTCGGCACCAGTACAACGTTTTCTTTCACTGAAGCGA
SEQ ID Название Олигонуклеотидная последовательность (5'-3')
12 LC.C5-1.110r TCTCCTGGAGTCACAGACAGGGTGG
13 E1 H1B-E1 H5I.r TCATAGTCAGCGAAATGCCCTGGGTAACAGAGGTCATTGGTTGGATTGGCCT
14 E1 H5N-E1 H1B.c ATGACCTCTGTTACCCAGGGCATTTCGCTGACTATGAGGAACTGAGGG
15 E2 H5I-RB H1B.r CCAATTCACTTTTCATAATTCCTGATCCAAAGCCTCTACTCAGTGCGA
16 RB H1B-E2 H5I.C GGCTTTGGATCAGGAATTATGAAAAGTGAATTGGAATATGGTAACTGCAAC
17 E1 H1B-F'1 H5I.r GGCTATTCCTTTTAATAGGCAGAGCTTCCCGTTGTGTGTCTTTTCCAG
18 F'1 H5N-E1 H1B.c AACGGGAAGCTCTGCCTATTAAAAGGAATAGCCCCACTACAATTGGGT
19 F'2 H5I-E2 H1B.r GGAGTTTGACACTTGGTGTTGCATTTATCCATTGGTGCATTTGAGTTG
20 E2 H1B-F'2 H5I.C AATGCACCAATGGATAAATGCAACACCAAGTGTCAAACTCCAATGGGG
21 E1 H5I-E1 H1NC.r TCTTCATAGTCGTTGAAACTCCCTGGGTAACATGTTCCATTCTCAGGA
22 E1 H1NC-E1 H5I.C CTGAGAATGGAACATGTTACCCAGGGAGTTTCAACGACTATGAAGAAC
23 E2 H1NC-RB H5I.r ATTTGAGGTGATGATTGCTGAGTCCCCTTTCTTGACAATTTTGTATGCATA
24 RB H5I-E2 HINC.c GTCAAGAAAGGGGACTCAGCAATCATCACCTCAAATGCACCAATGGAT
25 HA-SacI.r TTAACTTAGAGCTCTTAGATGCATATTCTACACTGCAAAGACC
26 ApaI-HlB.c TGTCGGGCCCATGAAAGTAAAACTACTGGTCCTGTTATGCACATT
27 StuI-HlB.r AAATAGGCCTTTAGATGCATATTCTACACTGTAAAGACCCATTGGA
28 SpPDI-HlB.c TTCTCAGATCTTCGCTGACACAATATGTATAGGCTACCATGCTAACAAC
29 SacI-HlB.r CTTAGAGCTCTTAGATGCATATTCTACACTGTAAAGACCCATTGGAA
30 ApaI-SpPDI.c TTGTCGGGCCCATGGCGAAAAACGTTGCGATTTTCGGCTTATTGT
SEQ ID Название Олигонуклеотидная последовательность (5'-3')
31 ApaI-H5(A-Indo).1c TGTCGGGCCCATGGAGAAAATAGTGCTTCTTCTTGCAAT
32 H5 (A-Indo)-StuI.1707r AAATAGGCCTTTAAATGCAAATTCTGCATTGTAACGA
33 H3B-SpPDI.r TGTCATTTCCGGGAAGTTTTTGAGCGAAGATCTGAGAAGGAACCA
34 SpPDI-H3B.с TCTCAGATCTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACG
35 StuI-H3B.r AAAATAGGCCTTCAAATGCAAATGTTGCACCTAATGTTGCCTTT
36 TmD Н51-H3B.r ATTTGGTAAGTTCCTATTGACTTCAGCTCAACGCCCTTGATCTGG
37 H3B-TmD H5I.c TGAGCTGAAGTCAATAGGAACTTACCAAATACTGTCAATTTATTCAAC
38 HBF-SpPDI.r GTTATTCCAGTGCAGATTCGATCAGCGAAGATCTGAGAAGGAACCAACAC
39 SpPDI-HBF.c CAGATCTTCGCTGATCGAATCTGCACTGGAATAACATCTTCAAACTCACC
40 StuI-HBF.r AAAATAGGCCTTTATAGACAGATGGAGCATGAAACGTTGTCTCTGG
41 TmD H5I-B Flo.r TGACAGTATTTGGTAGTTATCCAATCCATCATCATTTAAAGATGC
42 В Flo-TmD H5I.c GGATTGGATAACTACCAAATACTGTCAATTTATTCAACAGTGGCGAGTTC
43 Hsp-40Luz.1c ATGTTTGGGCGCGGACCAAC
44 Hsp40Luz SacI.1272r AGCTGAGCTCCTACTGTTGAGCGCATTGCAC
45 Hsp40Luz-Plasto.r GTTGGTCCGCGCCCAAACATTTTCTCTCAAGATGAT
46 Hsp70Ara.1c ATGTCGGGTAAAGGAGAAGGA
47 Hsp70Ara SacI.1956r AGCTGAGCTCTTAGTCGACCTCCTCGATCTTAG
48 Hsp70Ara-Plasto.r TCCTTCTCCTTTACCCGACATTTTCTCTCAAGATGAT
49 supP19-plasto.r CCTTGTATAGCTCGTTCCATTTTCTCTCAAGATG
50 supP19-1c ATGGAACGAGCTATACAAGG
SEQ ID Название Олигонуклеотидная последовательность (5'-3')
51 SupP19-Sacl.r AGTCGAGCTCTTACTCGCTTTCTTTTTCGAAG
89 Pad - MCS - 2X35S.C AATTGTTAATTAAGTCGACAAGCTTGCATGCCTGCAGGTCAAC
90 CPMV 5'UTR - 2X35S.r TCAAAACCTATTAAGATTTTAATACCTCTCCAAATGAAATGAACTTCC
91 2X35S - CPMV 5'UTR.c TTGGAGAGGTATTAAAATCTTAATAGGTTTTGATAAAAGCGAACGTGGG
92 ApaL - M prot.r TCTCCATGGGCCCGACAAATTTGGGCAGAATATACAGAAGCTTA
Таблица 2
Штаммы Agrobacterium, использованные для экспрессии гемагглютининов вируса гриппа нативным пептидом или сигнальным пептидом PDI
Биоштамм Экспрессированный НА Сигн. пептид Кассета экспрессии
AGL1/540 H1(A/New Caledonia/20/99) PDI Пластоцианин.
AGL1/774 H1(A/Brisbane/59/2007) нативный Пластоцианин.
AGL1/787 H1(A/Brisbane/59/2007) PDI Пластоцианин.
AGL1/732 H1(A/Brisbane/59/2007) нативный 35S/CPMV - НТ
AGL1/736 H3(A/Brisbane/I 0/2007) PDI 35S/CPMV - НТ
AGL1/660 H5(A/Indonesia/5/2005) нативный Пластоцианин.
AGL1/739 В(B/Florida/4/2006) PDI 35S/CPMV - НТ
AGL1/828 CPMVHT-LCC51 C51LC 35S/CPMV - НТ
AGL1/690 H1/Bris RB+H5/Indo SDC нативный Plasto
AGL1/691 H1/Bri E1-RB-E2+H5 SDC нативный Plasto
AGL1/696 H5/Indo RB+H1/NC SDC PDI Plasto
AGL1/733 H1/Bri PDI 35S/CPMV - НТ
AGL1/734 H1/Bri RB+H5/Indo SDC нативный 35S/CPMV - НТ
AGL1/737 H3/Bri эктодомен +Н5/Indo TDC PDI 35S/CPMV - НТ
AGL1/745 B/Flo эктодомен H5/Indo TDC PDI 35S/CPMV - НТ
AGL1/747 B/Flo эктодомен Н5/Indo TDC PDI 2X35S/CPMV - НТ

4. Получение растительной биомассы, инокулюма, агроинфильтрация и сбор

Растения Nicotiana benthamiana выращивали из семян в плашках для клеточных культур с плоским дном на подстилке из промышленного болотного мха. Растения выращивал в теплице в течение фотопериода 16/8 при температуре равной 25°С днем/20°С ночью. Через 3 нед после посева отдельные ростки собирали, пересаживали в горшки и оставляли в теплице еще на 3 нед в тех же условиях окружающей среды. До трансформации удаляли апикальные мерисистемы почек и зачаточные части почек в разные моменты времени, как указано ниже, или отщипывая почки от растения, или путем химической обработки растения. Agrobacteria, трансфицированные при помощи каждого конструкта, выращивали в среде YEB, дополненной 10 мМ 2-[N-морфолино] этансульфокислоты (MES), 20 мкМ ацетосирингона, 50 мкг мл канамицина и 25 мкг/мл карбенициллина при рН 5,6, пока они не достигали OD600 в пределах между 0,6 и 1,6. Суспензии Agrobacterium центрифугировали перед применением и вновь суспендировали в среде для инфильтрации (10 мм MgCl2 и 10 мм MES, рН 5.6). Инфильтрацию шприцом проводили, как описано Liu and LomoNOsoff (2002, Journal of Virological methods, 105: 343-348). В случае инфильтрации под вакуумом суспензии A. Tumefaciens центрифугировали, вновь суспендировали в среде для инфильтрации и хранили в течение ночи при 4°С. В день инфильтрации партии культур разбавляли в 2,5 раза и давали нагреться перед применением. Целые растения N. benthamiana или N. tabacum помещали на 2 мин вверх корнями в бактериальную среду в воздухонепроницаемый приемник из нержавеющей стали в условиях вакуума 20-40 торр. После инфильтрации шприцом или под вакуумом растения возвращали в теплицу на инкубирование в течение 4-5 дн до их сбора. Если иное не оговаривается, все инфильтрации проводили как совместные с AGL1/35S-HcPro в отношении 1:1, за исключением штаммов, несущих кассеты CPMV - НТ, которые были инфильтрованы совместно со штаммом AGL1/R472 в отношении 1:1.

5. Отбор образцов листьев и экстракция всех белков

После инкубирования собирали воздушную часть растений, замораживали при температуре - 80°С, измельчали на части. Все растворимые белки экстрагировали путем гомогенизации (в гомогенизаторе Polytron) каждого образца измельченного замороженного растительного материала в 3 объемах холодной среды из 50 мМ Tris, pH 8, 0,15 М NaCl, 0,04% метабисульфита натрия и 1 мМ фенилметансульфонилфторида. После гомогенизации суспензии центрифугировали при 20000 г в течение 20 мин при температуре 4°С и хранили эти прозрачные сырые экстракты (надосадочную жидкость) для проведения последующего анализа. Общее содержание белков в прозрачных сырых экстрактах определяли методом Брэдфорд (Bio - Rad, Hercules, CA) с применением бычьего сывороточного альбумина в качестве стандарта.

6. Количественное определение белков и иммуноблоттинг

Концентрации белков определяли методом анализа с применением бычьего сывороточного альбумина (ВСА) (Pierce Biochemicals, Rockport IL). Белки были отделены методом электрофореза в полиакриламидном геле в присутствии додецилсульфат натрия, SDS-PAGE, в восстановительных условиях с окрашиванием при помощи Coomassie Blue. Окрашенные гели сканировали и проводили денситометрический анализ, используя программу ImageJ Software (NIH).

Белки из фракции, полученной элюированием при помощи SEC, осаждали ацетоном (Bollag et al., 1996), снова суспендировали в 1/5 объема в буфере равновесия/элюирования и разделяли методом SDS - PAGE в восстанавливающих условиях и переносили методом электропереноса на поливинилидендифторидные (PVDF) мембраны (Roche DiagNOtics Corporation, Indianapolis, IN) для иммунодетектирования. Перед проведением иммуноблоттинга мембраны были блокированы 5% снятым молоком и 0,1% Tween - 20 в физиологическом растворе, содержащем Tris - буфер (TBS - Т) в течение 16-18 ч при температуре 4°С.

Иммуноблоттинг проводили путем инкубирования с подходящим антителом (Таблица 6) в TBS-Tween 20, 0,1%, (2 мкг/мл 2% снятого молока). Вторичные антитела, использованные для хемилюминесценного детектирования, были разбавлены TBS - Tween 20 0,1%, содержащим 2% снятого молока, как указано в Таблице 4. Иммунореактивные комплексы детектировали методом хемилюминесценции с применением люминола в качестве субстрата (Roche DiagNOtics Corporation). Конъюгат пероксидазы хрена с антителом против человеческого иммуноглобулина, IgG, получали с использованием набора EZ - Link Plus® Activated Peroxidase conjugation kit (Pierce, Rockford, IL). Полный неактивированный вирус (WIV), использованный в качестве контроля детектирования подтипов H1, H3 и В, приобретали в National Institute for Biological Standards and Control (NIBSC)

Таблица 3
Условия электрофореза, антитела и разбавления для проведения иммуноблоттинга экспрессированных белков
Подтип НА Штамм вируса гриппа Условие электрофореза Первичное антитело Разбавление Вторичное антитело Разбавление
H1 A/Brisbane/59/2 007(H1N1) Восстанавливающая FII 10-150 4 мкг/мл Антитело козы против мышиного иммуноглобулина (JIR 115-035-146) 1:10000
H1 A/New Caledonia /20/99(H1N1) Восстанавливающая FII 10-150 4 мкг/мл Антитело козы против мышиного иммуноглобулина (JIR 115-035-146) 1:10000
H3 A/Brisbane/10/2007 (H3N2) Невосстанавливающая NIBSC 08/124 1:4000 Кроличье антитело против иммуноглобулина овцы (JIR 313-035-045) 1:10000
Н5 A/Indonesia/5/2005 (H5N1) Восстанавливающая ITC IT - 003 - 005V 1:4000 Антитело козы против кролич. иммуноглобулина (JIR 111-035-144) 1:10000
В B/Florida/4/2006 Невосстанавливающая NIBSC 07/356 1:2000 Кроличье антитело против иммуноглобулина овцы (JIR 313-035-045) 1:10000
FII: Fitzgerald Industries International, Concord, MA, USA;
NIBSC: National Institute for Biological Standards and Control;
JIR: Jackson ImmunoResearch, West Grove, PA, USA;
ITC: Immune Technology Corporation, Woodside, NY, USA

7. Очистка и концентрация перед проведением гель-хромотографии

Для увеличения разрешения и сигнала в элюированных фракциях сырые экстракты, которые нужно было загрузить в колонку для гель-хроматографии, были очищены и сконцентрированы следующим методом. Экстракты центрифугировали при 70000 г при температуре 4°С в течение 20 мин и осадок после центрифугирования дважды промывали вновь полученной суспензией в 1 объеме (в сравнении с исходным объемом экстракта) буфера для экстракции (50 мМ Iris, рН 8, 0,15 М NaCl) и центрифугировали при 70000 г при температуре 4°С в течение 20 мин. Полученный осадок снова суспендировали в 1/3 объема (в сравнении с исходным объемом экстракта) и осаждали белки (включая VLP) путем добавления 20% (вес/об) PEG 3350 с последующим инкубированием на льду в течение 1 ч. Осажденные белки выделяли путем центрифугирования при 10000 г, 4°С, 20 мин и снова суспендировали в 1/15 объема (в сравнении с исходным объемом экстракта) буфера для экстракции. После получения конечной суспензии белков проводили окончательное центрифугирование при 20000 г, 4°С, 5 мин, для получения осадка нерастворимых веществ, а прозрачную надосадочную жидкость выделяли.

8. Гель-хроматография белкового экстракта

В колонки для гель-хроматографии (SEC) загружали 32 мл гранул для высокого разрешения Sephacryl™ S-500 (S - 500 HR: GE Healthcare, Uppsala, Sweden, Cat. No. 17-0613-10) и уравновешивали буфером для уравновешивания/элюирования (50 мМ Tris, рН 8, 150 мМ NaCl). 1,5 мл сырого белкового экстракта загружали в колонку с проведением последующей стадии элюирования с использованием 45 мл буфера для уравновешивания/элюирования. Собирали фракции элюата объемом 1,5 мл и проводили мониторинг относительного содержания белков путем смешения 10 мкл фракции с 200 мкл разбавленного реагента для окрашивания белков Bio - Rad (Bio - Rad, Hercules, CA). Колонку промывали 2 объемами (в расчете на объем колонки) 0,2N NaOH и затем 10 объемами 50 мМ Tris с рН 8, 150 мМ NaCl, 20% этанола. Каждая операция выделения сопровождалась калибровкой колонки с помощью голубого декстрана. Blue Dextran 2000 (GE Healthcare Bio - Science Corp., Piscataway, NJ, USA). Сравнивали профили элюирования Blue Dextran 2000 и растворимых белков хозяина между каждой стадией выделения с целью обеспечения однородности профилей элюирования для всех использованных колонок.

Пример 1: Стратегия обмена доменами в случае домена RB и/или домена эстеразы в вирусе гриппа разных подтипов.

Субдомен RB вируса Н5/Indo может быть заменен субдоменом RB НА вируса подтипов H1, Н3 или В. Полученный химерный НА обеспечивает получение VLP SDC H5/Indo и включает субдомен RB, содержащий иммуногенные сайты H1, Н3 или В. Субдомен RB в Н5/ Indo может быть инсерцирован в линию H1 (H1/NC). На Фигурах 15А и 15В показаны аминокислотные последовательности в местах слияния указанных субдоменов и аминокислотные последовательности соответствующих субдоменов показаны на Фигуре 2 (конструкты 690, 734, 696 и 691) и в Таблице 4 (конструкты 900 и 745) и в Таблице 5 (конструкты 910, 920 и 930). Аминокислотные последовательности, показанные на Фигуре 2 и в Таблицах 4 и 5, не включают последовательностей сигнальных пептидов.

Таблица 4
Субдомены и химерный НА вируса гриппа. Химерный НА вируса гриппа, включающий гетерологичный субдомен RB.
Констр. № N-концевой "ствол": F'1+El Головка RB С - концевой "ствол": E2+F'2-Stop
900 (SEQ ID NO:105) Н5 Indo H3/Brisbane Н5/Indo
745 (SEQ ID NO:106) H5/Indo В/Florida H5/Indo

Аминокислоты 1-92 в SEQ ID NO: 105 находятся в домене F'1+E1 Н5/Indo; аминокислоты 93-259 находятся в головном RB - домене в Н3/Brisbane; аминокислоты 260-548 - в домене E2+F'2 H5/Indo.

Аминокислоты 1-92 в SEQ ID NO: 106 расположены в домене F'1+E1 H5/Indo; аминокислоты 93-276 находятся в головном RB - домене в В/Florida; аминокислоты 277-565 - в домене E2+F'2 Н5 "ствол"/Indo.

Таблица 5
Субдомены и химерный НА вируса гриппа. Химерный НА вируса гриппа, включающий гетерологичный субдомен RB
Конструкт No. N - концевой "ствол": F'1 Головка E1-RB-E2 С - концевой "ствол": F'2 - Stop
910 (SEQ ID NO:107) H5/Indo H3/Brisban H5/Indo
920 (SEQ ID NO: 108) HS/Indo В/Florida 115/Indo
930 (SEQ ID NO: 109) Hl/NC H5/Indo Hl/NC

Аминокислоты 1-42 SEQ ID NO: 107 представляют собой N - концевой домен F'1 Н5/Indo; аминокислоты 43-228 представляют собой головной домен E1-RB-Е2 Н3/Brisbane; аминокислоты 229-507 представляют собой домен F'2 H5/Indo.

Аминокислоты 1-42 SEQ ID NO: 108 представляют собой N - концевой домен F'1 H5/Indo; аминокислоты 43-281 представляют собой головной домен E1-RB-Е2 В/Florida; аминокислоты 282-556 представляют собой домен F'2 H5/ Indo.

Аминокислоты 1-42 SEQ ID NO: 109 представляют собой N - концевой домен F'1 H1/NC; аминокислоты 43-273 представляют собой головной домен E1-RB-Е2 H5/Indo; аминокислоты 274-548 представляют собой домен F'2 H1/NC.

Места слияния для различных химер выбирали так, чтобы они были как можно ближе к N- и С-концам различных субдоменов (но необязательно непосредственно в них) - не основываясь на какой-либо теории, полагают, что эти места слияния выбираются таким образом, чтобы обеспечить максимальную стабильность химерного НА. Например, сохранение структуры и последовательностей наблюдается на N - конце субдомена RB (На et al. 2002, EMBO J. 21:865-875; этот источник включен посредством отсылки в данную заявку). Менее вариабельная область в первичной последовательности находится в триаде С-F/Y-Р, расположенной примерно на 15 аминокислотных остатков ранее, в субдомене Е1. Этот цистеиновый остаток входит в состав дисульфидного мостика #3, который сохранен среди HAs (см. Фигуры 46 и 47). Место соединения у этого Cys может привести к приемлемой или превосходной стабильности химерного НА относительно нативной последовательности. С - конец RB обеспечивает сохранение признаков: например, сохранение остатка Ser в положении - 1 и субдомен Е2 начинается со складчатого бета - слоя, наблюдаемого во всех НА в выравнивании (На et al. 2002, EMBO J. 21: 865-875; этот источник включен посредством отсылки в данную заявку). Следовательно, С - конец этого RB может быть слит с инициирующей аминокислотой этой складчатой структуры бета - слоя субдомена Е2. Далее, структура дисульфидного мостика не меняется или не меняется существенно в случае химер, включающих субдомены RB H1/NC, H1Bri, Н3/Bri или В/Flo в SDC H5/Indo и в субдомене RB H5/Indo в SDC H1 (всего 6), но дисульфидный мостик (мостик #8) будет добавлен к гибридному НА в В RB на "стволе" H5. Это добавление дисульфидного мостика не помешает укладке НА (так как он расположен в RB - домене и остатки Cys являются смежными в последовательности), и может быть получен даже более стабильный гибридный НА.

Суб домены Е1-RB-Е2 вируса гриппа первого типа были замещены субдоменами E1-RB-E2 вируса гриппа второго типа. Такое расположение может охватывать большее количество аминокислот второго типа на поверхности H5-VLP. В этом примере HDC H1, Н3 или В был помещен в SDC H5/Indo и в HDC H5/Indo в SDC H1/NC (Таблица 5).

Место соединения HDC определяли при помощи сохраненного остатка цистеина (включающего дисульфидный мостик #6 в НА типа А #7 в НА типа В). Место соединения HDC на С - конце субдомена Е2 определяли при помощи другого сохраненного остатка цистеина, включающего дисульфидный мостике #6 (вторая аминокислота субдомена F'2) вируса гриппа типа H1 или H3B SDC H5/Indo или в SDC H1 вируса гриппа типа H5. В случае химеры вируса гриппа типа В место соединения было определено при помощи первого остатка цистеина, включающего дисульфидный мостик #4 (расположенный через 4 аминокислоты в субдомене F'2 и сохраненного в Has). Полученные химеры не проявляют никакого изменения в структурах дисульфидных мостиков - гибридные HAs H1/H3/H5 будут содержать 6 дисульфидных мостиков и гибрид типа В будет иметь 7 таких мостиков.

Пример 2; Замена рецептор-связывающего субдомена (RB) или замена рецептор-связывающего субдомена и субдомена эстеразы (Е1-RB-Е2) в H5 А/Indonesia/5/05 этими же субдоменами в H1 A/Brisbane/59/2007: Сравнение экспрессии химерной и нативной форм.

Для объединения высокого уровня накопления VLP из Н5 A/Indonesia/5/05 с характеристиками антигенности H1 A/Brisbane/59/2007 были получены химерные гемагглютинины, включающие домены H1 A/Brisbane/59/2007, слитые с кластером стволового домена Н5 А/Indonesia/5/05. Кассеты для экспрессии слияний гемагглютинина Н5/H1 представлены на Фигуре 1, а аминокислотные последовательности зрелых белков слияния показаны на Фигуре 2.

Для сравнения уровней накопления химерных гемагглютининов Н5/H1C этим показателем в их нативных формах проводили инфильтрацию растений Nicotiana bentbamiana генами AGL1/774, AGL1/691 и AGL1/690, собирали листья через 6 дн (инкубационный период). Для определения уровня накопления каждой формы НА в агроинфильтрованных листьях экстрагировали белки из ткани инфильтрованного листа и анализировали эти экстракты методом Вестерн-блоттинга с применением моноклональных антител к НА. В экстрактах из листьев, инфильтрованных AGL1/690, но не AGL1/774 или AGL1/691, была обнаружена одна полоса, соответствующая примерно 75 кДа (Фигура 3), коррелирующаяся по размеру с формой нерасщепленного НА0 гемагглютинина вируса гриппа, что свидетельствует о более высоком уровне накопления химерного гемагглютинина, включающего рецептор-связывающую область H1 A/Brisbane/59/2007, слитую с остовом Н5 A/Indonesia/5/05, по сравнению как с нативной формой H1 A/Brisbane/59/2007 (AGL1/774), так и с химерным гемагглютинином, объединяющим эстеразу и рецептор-связывающую область H1 A/Brisbane/59/2007 с остовом Н5 A Indonesia/5/05. Целый инактивированный вирус (WIV) (HI A/Brisbane/59/2007), применявшийся в качестве положительного контроля, был обнаружен в виде многочисленных полос с основной полосой, соответствующей примерно 80 кДа, коррелирующейся с молекулярным весом предшественника НА0 в H1A /Brisbane 59/2007. Эти результаты показали, что замена рецептор-связывающей области Н5 А/Indonesia/5/05 такой же областью H1A /Brisbane/59/2007 привела к получению химерного гемагглютинина, который представлял собой антигенную область H1 и который аккумулировался в растениях на более высоком уровне, чем нативная форма H1 A/Brisbane/59/2007. Однако химерный гемагглютинин, в котором эстераза и рецептор-связывающая область Н5 A/Indonesia/5/05 были заменены этими же областями H1 A/Brisbane/59/ 2007, не аккумулировался в растениях в определяемом количестве.

Процесс слияния рецептор-связывающей области из H1 A/Brisbane/59/2007 с остовом Н5 A/Indonesia/5/05, как метод увеличения накопления антиген - представляющих VLP H1, повторно оценивали под контролем кассеты экспрессии с сильными регуляторными элементами на основе вируса CPMV-HT. Эта стратегия слияния сравнивалась также с методом замены сигнального пептида как средством увеличения уровня накопления. Кассеты экспрессии участков слияния гемагглютинина Н5/H1C применением CPMV - НТ представлены на Фигуре 8, а аминокислотные последовательности зрелых белков слияния показаны на Фигуре 2.

Растения Nicotiana benthamiana были инфильтрованы генами AGL1/732, AGL1/733 и AGL1/734, затем через 6 дн (инкубационный период) собирали листья. Для определения уровня накопления каждой формы НА в агроинфильтрованных листьях сначала экстрагировали белки из ткани инфильтрованного листа и анализировали эти экстракты методом Вестерн-блоттинга с применением поликлональных антител к H1 (Brisbane). В экстрактах из листьев, инфильтрованных AGL1/732, AGL1/733 и AGL1/734, была обнаружена одна полоса, соответствующая примерно 75 кДа (Фигура 5), коррелирующаяся по размеру с формой нерасщепленного НА0 гемагглютинина вируса гриппа. Однако, хотя гемагглютинин был обнаружен во всех экстрактах, подвергшихся анализу, можно было заметить значительные отличия. В то время, как экспрессия H1 A/Brisbane/59/2007 была едва заметна при этих условиях при использовании природного сигнального пептида (732), замена сигнального пептида сигнальным пептидом PDI привела к более высокому уровню накопления зрелого H1 A/Brisbane/59/2007 (733) и химерный гемагглютинин Н5/H1 (734) аккумулировался до самого высокого уровня. Взятые вместе, эти результаты показывают, что слияние рецептор-связывающего домена H1B остове Н5 приводит к высокому уровню аккумулирования антиген - представлющего гемагглютинина H1 и что уровень аккумулирования, достигнутый в растениях при таком слиянии, выше, чем этот показатель, полученный с применением нативной формы с замещением сигнального пептида или без такого замещения.

Пример 3: Замена рецептор-связывающего субдомена (RB) H1 A/New Caledonia/20/99 таким же субдоменом Н5 А/Indonesia/5/05. Сравнение экспрессии химерной и нативной форм.

Оценивалось также применение остова H1 (А/New Caledonia/20/99) для презентации антигенной области Н5. Кассеты экспрессии для экспрессии участка слияния гемагглютинина H1/Н5 представлены на Фигуре 1, а аминокислотные последовательности зрелых белков слияния показаны на Фигуре 2.

Для сравнения уровней накопления химерных гемагглютининов H1/Н5 с этим показателем в их нативных формах проводили инфильтрацию растений Nicotiana benthamiana геном AGL1/660 и AGL1/696, собирали листья через 6 дн (инкубационный период). Для определения уровня накопления каждой формы НА в агроинфильтрованных листьях экстрагировали белки из ткани инфильтрованного листа и анализировали эти экстракты методом Вестерн-блоттинга с применением поликлональных антител к Н5. В экстрактах из листьев, инфильтрованных AGL1 660 и AGL1/696, была обнаружена одна полоса, соответствующая примерно 75 кДа (Фигура 5), коррелирующаяся по размеру с формой нерасщепленного НА0 гемагглютинина вируса гриппа, показывающая, что обе нативные формы химерного гемагглютинина Н5 А/Indonesia/5/05 и H1/Н5 аккумулируются в растениях на высоком уровне.

Пример 4: Замена эктодомена Н5 А/Indonesia/5/05 эктодоменом Н3 или В. Сравнение экспрессии химерной и нативной форм.

Оценивали слияние эктодомена Н3 A /Brisbane /10 /2007 или В Florida/4/2006 с трансмембранным и цитоплазматическими субдоменами Н5 А/Indonesia/5/05 как стратегию для презентации антигенных областей гемагглютинина штаммов вируса типа Н3 и В при увеличении уровня их аккумулирования в растениях. Кассеты экспрессии участков слияния гемагглютининов вирусов типа Н5/Н3 и Н5/В представлены на Фигуре 10 и аминокислоты на границе слияний показаны на Фигуре 11.

Уровень аккумулирования химерного гемагглютинина Н5/В (745) сравнивали с уровнем аккумулирования нативной формы НА В (739) в растениях Nicotiana benthamiana. Проводили инфильтрацию растений Nicotiana benthamiana генами AGL1/739 и AGL1/745, собирали листья через 6 дн (инкубационный период). Для определения уровня накопления каждой формы НА в агроинфильтрованных листьях вначале экстрагировали белки из ткани инфильтрованного листа и анализировали эти экстракты методом Вестерн-блоттинга с применением поликлональных антител к В (Florida). В экстрактах из листьев, инфильтрованных AGL1/739, была обнаружена одна полоса, соответствующая примерно 75 кДа (Фигура 14), коррелирующаяся по размеру с формой нерасщепленного НА0 гемагглютинина вируса гриппа, в то время, как для 3 растений, инфильтрованных геном AGL1/745, наблюдался положительный сигнал, соответствующий гемагглютинину, что свидетельствует о том, что химерная форма гемагглютинина Н5/В аккумулировалась на высоком уровне более регулярно, чем нативная форма гемагглютинина В.

Точно так же уровень аккумулирования химерного гемагглютинина Н5/Н3 (737) сравнивали с уровнем накопления его нативной формы (736) в растениях Nicotiana benthamiana. Проводили инфильтрацию растений Nicotiana benthamiana генами AGL1/736 и AGL1/737, собирали листья через 6 дн (инкубационный период). Для определения уровня накопления каждой формы НА в агроинфильтрованных листьях вначале экстрагировали белки из ткани инфильтрованного листа и анализировали эти экстракты методом Вестерн-блоттинга с применением поликлональных антител к Н3 (Brisbane). В экстрактах из листьев, инфильтрованных AGL1/736 и AGL1/737, была обнаружена одна полоса, соответствующая примерно 75 кДа (Фигура 15), коррелирующаяся по размеру с формой нерасщепленного НА0 гемагглютинина вируса гриппа. Этот результат показывает, что слияние трансмембранного и цитоплазматического субдоменов Н5 А/ Indonesia/5/05 с эктодоменом A/ Brisbane/10/2007 создает химерный гемагглютинин, который аккумулируется с тем же уровнем, что и нативная форма H3A/ Brisbane/10/2007.

Оценивали также получение VLP в результате экспрессии химерного гемагглютинина Н5/В (конструкт номер 745) с применением гель-хроматографии. Концентрированные экстракты, полученные из растений, инфильтрованных AGL1/745, (1,5 мл) фракционировали, применяя гель-хроматографию (SEC) на колонках Sephacryl™ S - 500 HR (GE Healthcare Bio-Science Corp., Piscataway, NJ, USA). Как показано на Фигуре 16, фракция 8 характеризовалась пиком, свойственным элюированному "голубому декстрану", Blue Dextran (2 MDa), с небольшим временем удерживания. Когда белки из 200 мкл каждой фракции элюирования SEC концентрировались (в 5 раз) путем осаждения ацетоном и анализировались методом Вестерн-блоттинга с помощью поликлональных антител к В (Florida) (Фигура 16), химерный гемагглютинин сначала был обнаружен во фракции 7, что свидетельствует о введении НА в структуры с высоким молекулярным весом. Не основываясь на одной какой-либо теории, полагают, что химерный белок НА или собирается в большие суперструктуры, или присоединяется к структуре с высоким молекулярным весом. Полученные результаты показывают, что химерный НА, состоящий из эктодомена НА В/Florida/4/2006, слитого с трансмембранным и цитозольным субдоменами Н5 А/Indonesia/5/05, собирается в высокомолекулярные частицы и что профиль элюирования этих высокомолекулярных частиц не отличается от профиля элюирования VLP гриппа.

Пример 5: Совместная экспрессия химерного гемагглютинина Н5/В (конструкт номер 747, включающий HDC и SDC В/Flo и слитый с TDC Н5/Indo) вместе с Hsp70 и Hsp 40 в комбинации с модификацией сигнального пептида.

Экспрессия Hsp40 и Hsp70 в растениях и совместная экспрессия с гемагглютининами вируса гриппа описаны в сопутствующей заявке РСТ/СА2009/000032. Цитозольные Hsp70 и Hsp40 (конструкт номер R870) растительного происхождения могут быть также экспрессированы совместно с химерными гемагглютининами с целью повышения уровня их аккумулирования в растениях. Совместная экспрессия может быть проведена путем агроинфильтрации растений N. benthamiana бактериальной суспензией, содержащей смесь (в отношении 1:1:1) AGL1, несущего кассету для экспрессии желательного химерного НА, с AGL1/R870 и AGL1 / 35SHcPro.

Уровень аккумулирования химерного гемагглютинина Н5/В (В/Flo HDC и SDC, слитые с TDC Н5/Indo) оценивали при совместной экспрессии с HSP40 и HSP70 in растениях Nicotiana benthamiana. Проводили инфильтрацию растений AGL1/747, AGL1/747+AGL1/443 (пустой вектор) или AGL1/747+AGL1/R870 (HSP40/HSP70), через 6 дн (инкубационный период) собирали листья. Для определения уровня аккумулирования химерного НА Н5/В в агроинфильтрованных листьях сначала экстрагировали белки из ткани инфильтрованных листьев и анализировали их методом Вестерн-блоттинга с помощью поликлональных антител к В (Florida). В экстрактах из листьев трех растений, инфильтрованных AGL1/747+AGL1/R870 (HSP 40/HSP 70), была обнаружена одна полоса, оответствующая примерно 75 кДа (Фигура 50), коррелирующаяся по размеру с формой нерасщепленного НА0 гемагглютинина вируса гриппа, в то время как у трех растений, инфильтрованных AGL 1/747+ контрольный вектор (443), сигнала не наблюдалось (при выбранных условиях), что свидетельствовало о высоком уровне аккумулирования химерной формы гемагглютинина Н5/В при совместной экспрессии с шаперонами HSP 40 и HSP 70.

Все источники, указанные в данном описании, включены в заявку посредством отсылок так, как если бы каждая отдельная публикация была включена посредством отсылки конкретно и индивидуально и была полностью изложена. Цитирование ссылок в данной заявке не должно рассматриваться как допущение, что такие ссылки являются прототипом данного изобретения.

В данном описании ряд терминов использован расширительно и приведены определения для облегчения понимания различных аспектов настоящего изобретения. Примеры в описании, включая примеры терминов, использованы только с целью иллюстрации и никоим образом не должны рассматриваться как ограничение объема и смысла приведенных вариантов данного изобретения. Интервалы указанных чисел включают величины, определяющие данный интервал. Слово "включающий" использовано в данном описании как ничем не, ограниченный термин, практически эквивалентный фразе "включающий, но без ограничения" и слово "включает" имеет соответствующее значение.

Один из предпочтительных в настоящее время вариантов изобретения или более описаны только как примеры. Настоящее изобретение включает все варианты, модификации и вариации, как будто практически описанные в данной заявке со ссылками на примеры и фигуры. Специалистам в данной области является очевидным, что ряд вариаций и модификаций может был сделан, не выходя за рамки объема данного изобретения, который определяется формулой изобретения. Примеры таких модификаций включают замену признаков известными эквивалентами в случае любого аспекта настоящего изобретения с целью достижения того же результата практически тем же самым путем.

1. Нуклеиновая кислота для экспрессирования гемагглютинина химерного вируса гриппа (НА) в клетке-хозяине, включающая одну или более регуляторных функциональных областей, которые распознаются РНК полимеразой 2 и которые функционально связаны с последовательностью, кодирующей химерный полипептид гемагглютинин (НА) вируса гриппа, включающий кластер стволового домена (SDC), кластер головного домена (HDC) и кластер трансмембранного домена (TDC), причем одна или более регуляторных областей дополнительно включает последовательности 5′UTR, 3′UTR или 5′UTR и 3′UTR, при этом
а) SDC содержит субдомены F′1, F′2 и F;
б) HDC содержит субдомены RB, Е1 и Е2;
в) TDC содержит субдомены TmD и Ctail; и
по меньшей мере один RB-субдомен является субдоменом НА первого вируса гриппа, а SDC, TDC или они оба происходят из НА одного или более вторых вирусов гриппа, и где субдомены El, Е2 или оба субдомена и субдомены F′l, F′2 или оба субдомена происходят из того же одного или более вторых вирусов гриппа.

2. Нуклеиновая кислота по п. 1, отличающаяся тем, что последовательность, кодирующая химерный полипептид НА вируса гриппа, дополнительно включает последовательность сигнального пептида, выбранную из группы: последовательность нативного сигнального пептида НА, последовательность сигнального пептида PDI люцерны, последовательность сигнального пептида вируса гриппа типа Н5 и последовательность сигнального пептида НА вируса гриппа типа H1.

3. Нуклеиновая кислота по п. 1, отличающаяся тем, что последовательности 5′UTR, 3′UTR или 5′UTR и 3′UTR получены из UTR пластоцианина или UTR CPMV.

4. Нуклеиновая кислота по п. 1, отличающаяся тем, что указанная регуляторная область получена из регуляторной области пластоцианина, регуляторной области рибулозо-1,5-дифосфаткарбоксилазы/оксигеназы (RuBisCo), регуляторной области хлорофилл-а/b-связывающего белка (CAB), регуляторной области CaMV 35S, регуляторной области актина, регуляторной области убиквитина, регуляторной области триозофосфатизомеразы-1, регуляторной области 4А-фактора инициации трансляции и регуляторной области ST-LS1.

5. Нуклеиновая кислота по п. 1, отличающаяся тем, что НА первого и второго вируса гриппа независимо выбраны из группы, включающей НА вирусов типов H1, Н3, Н5 и В.

6. Нуклеиновая кислота по п. 1, отличающаяся тем, что одна или более регуляторных областей активна в клетке растения, насекомого или дрожжей.

7. Нуклеиновая кислота по п. 1, отличающаяся тем, что 5′UTR, 3′UTR или 5′UTR и 3′UTR активны в клетке растения, насекомого или дрожжей.

8. Нуклеиновая кислота по п. 1, отличающаяся тем, что одна или более регуляторных областей дополнительно включают 5′UTR, 3′UTR или обе 5′UTR и 3′UTR, которые гетерологичны в отношении TDC.

9. Клетка растения, трансформированная нуклеиновой кислотой по п. 1, включающая полипептид, кодируемый нуклеиновой кислотой по п. 1, для индукции иммунитета к инфицированию вирусом гриппа у субъекта.

10. Нуклеиновая кислота по п. 1, отличающаяся тем, что RB-субдомен является субдоменом НА первого вируса гриппа, а субдомены Е1, Е2, SDC, TDC или их комбинация происходит из НА второго вируса гриппа.

11. Полипептид, кодируемый нуклеиновой кислотой по п. 1, для индукции иммунитета к инфицированию вирусом гриппа у субъекта.

12. Вирусоподобная частица (VLP), включающая полипептид по п. 11, для индукции иммунитета к инфицированию вирусом гриппа у субъекта.

13. VLP по п. 12, отличающаяся тем, что она дополнительно включает N-гликаны, являющиеся специфическими для растения, или модифицированные N-гликаны.

14. Композиция, содержащая VLP по п. 13 и фармацевтически приемлемый носитель, для индукции иммунитета к инфицированию вирусом гриппа у субъекта.

15. Применение вирусоподобных частиц по п. 12 для индукции иммунитета к инфицированию вирусом гриппа у субъекта.

16. Применение вирусоподобных частиц по п. 12 для изготовления лекарственного средства для индукции иммунитета к инфицированию вирусом гриппа у субъекта.

17. Вирусоподобная частица (VLP) по п. 12 для применения для индукции иммунитета к инфицированию вирусом гриппа у субъекта.

18. Применение по п. 15 или 16, при котором вирусоподобные частицы являются пригодными для перорального, интрадермального, интраназального, внутримышечного, интраперитонеального, внутривенного или подкожного введения субъекту.

19. Вирусоподобная частица по п. 17, где вирусоподобная частица является пригодной для перорального, интрадермального, интраназального, внутримышечного, интраперитонеального, внутривенного или подкожного введения субъекту.

20. Полипептид, кодируемый нуклеиновой кислотой по п. 10, для индукции иммунитета к инфицированию вирусом гриппа у субъекта.

21. Вирусоподобная частица (VLP), включающая полипептид по п. 20, для индукции иммунитета к инфицированию вирусом гриппа у субъекта.

22. Нуклеиновая кислота по п. 1, отличающаяся тем, что SDC и HDC из НА первого вируса гриппа и TDC из НА второго вируса гриппа.

23. Полипептид, кодируемый нуклеиновой кислотой по п. 22, для индукции иммунитета к инфицированию вирусом гриппа у субъекта.

24. Вирусоподобная частица (VLP), включающая полипептид по п. 23, для индукции иммунитета к инфицированию вирусом гриппа у субъекта.

25. Способ получения химерных вирусоподобных частиц (VLP), сходных с частицами вируса гриппа, в растениях, включающий:
а) введение нуклеиновой кислоты по п. 1 в растение или его часть и
б) инкубирование растения или его части в условиях, которые обеспечивают экспрессию нуклеиновой кислоты с получением при этом VLP.

26. Способ по п. 25, отличающийся тем, что на стадии введения (стадии а) нуклеиновую кислоту вводят в растение транзиторным образом.

27. Способ по п. 25, отличающийся тем, что на стадии введения (стадии а) нуклеиновую кислоту вводят в растение так, что она стабильно интегрируется в геном.

28. Способ по п. 25, отличающийся тем, что он дополнительно включает стадию в) сбора растения-хозяина и очистки VLP.

29. Способ получения химерных вирусоподобных частиц (VLP), сходных с частицами вируса гриппа, в растении, включающий:
а) введение нуклеиновой кислоты по п. 10 в растение или его часть, и
б) инкубирование растения или его части при условиях, которые обеспечивают экспрессию нуклеиновой кислоты с получением при этом VLP.

30. Способ получения химерных вирусоподобных частиц (VLP), сходных с частицами вируса гриппа, в растении, включающий:
а) введение нуклеиновой кислоты по п. 22 в растение или его часть, и
б) инкубирование растения или его части при условиях, которые обеспечивают экспрессию нуклеиновой кислоты с получением при этом VLP.

31. Нуклеиновая кислота для экспрессирования гемагглютинина химерного вируса гриппа (НА) в клетке-хозяине, включающая одну или более регуляторных областей, которые распознаются РНК полимеразой 2, функционально связанных с последовательностью, кодирующей химерный полипептид НА вируса гриппа, включающий кластер стволового домена (SDC), кластер головного домена (HDC) и кластер трансмембранного домена (TDC), при этом
а) SDC содержит субдомены F′1, F′2 и F;
б) HDC содержит субдомены RB, Е1 и Е2;
в) TDC содержит субдомены TmD и Ctail; и
RB-субдомен является субдоменом НА первого вируса гриппа, а субдомены E1, Е2, SDC, TDC или их комбинация из НА одного или более вторых вирусов гриппа.

32. Нуклеиновая кислота по п. 31, отличающаяся тем, что субдомены El, Е2 или оба этих субдомена и субдомены F′l, F′2 или оба этих субдомена представляют собой субдомены одного и того же НА вируса гриппа.

33. Нуклеиновая кислота по п. 31, где одна или более регуляторных областей активна в клетке растения, насекомого или дрожжей.

34. Нуклеиновая кислота по п. 31, где одна или более регуляторных областей дополнительно включают 5′UTR, 3′UTR или обе 5′UTR и 3′UTR, которые гетерологичны в отношении TDC.

35. Полипептид, кодируемый нуклеиновой кислотой по п. 31, для индукции иммунитета к инфицированию вирусом гриппа у субъекта.

36. Вирусоподобная частица (VLP), включающая полипептид по п. 35, для индукции иммунитета к инфицированию вирусом гриппа у субъекта.

37. Способ получения химерных вирусоподобных частиц (VLP), сходных с частицами вируса гриппа, в растениях, включающий:
а) введение нуклеиновой кислоты по п. 31 в растение или его часть, и
б) инкубирование растения или его части при условиях, которые обеспечивают экспрессию нуклеиновой кислоты с получением при этом VLP.



 

Похожие патенты:

Настоящее изобретение относится к фармацевтической промышленности. Предложены способ получения вирусного антигена из оболочечного вируса и применение этого способа в производстве вакцинного препарата, содержащего указанный вирусный антиген.

Изобретение относится к микробиологии и касается штамма бактериофага Staphylococcus aureus. Предложенный штамм обеспечивает разрушение биопленок, образуемых бактериями рода Staphylococcus, и содержит ген, кодирующий альфа-субъединицу рибонуклеотидредуктазы 1b.

Изобретение относится к биотехнологии, а именно к способу оценки активности лечебно-профилактических препаратов против вируса натуральной оспы. Способ включает введение в организм инбредных разнополых 18-21-суточных мышей иммунодефицитной линии SCID массой 12-14 г контрольной и испытуемой группы по заданной схеме суспензии исследуемого противовирусного препарата.

Предложен штамм энтеровируса человека А71 типа субгенотипа С4. Штамм депонирован в Коллекции микроорганизмов ФБУН ГНЦ ВБ «Вектор» Роспотребнадзора под регистрационным номером V-670.

Изобретение относится к микробиологии и касается штамма бактериофага Citrobacter freundii, способного лизировать патогенные штаммы Citrobacter freundii и содержащего ген, кодирующий рибонуклеотидредуктазу III.

Изобретение относится к области биотехнологии и вирусологии. Предложен новый штамм парвовируса, представляющий собой парвовирус-2.
Изобретения касаются антирабической вакцины для пероральной иммунизации против бешенства диких плотоядных животных и способа ее получения. Предложенная вакцина включает иммунизирующий антиген бешенства с инфекционной активностью 6,0-8,5 lg МЛД50/мл, цеолит природный или синтетический и аттрактант.

Изобретение относится к области ветеринарной вирусологии и биотехнологии и касается нового штамма вируса ящура Aphtae epizooticae типа О сем. Picornaviridae, рода Aphtovirus, депонированного в коллекции ФГБУ «ВНИИЗЖ» под регистрационным номером вирус ящура штамм О №2102/Забайкальский/2010.
Изобретение относится к биотехнологии, а именно к штамму вируса гриппа А/17/Техас/2012/30 (H3N2). Данный штамм вируса гриппа депонирован в Государственную коллекцию вирусов ФГБУ «Научно-исследовательский институт вирусологии им.
Изобретение относится к области микробиологии. Вакцинный штамм вируса гриппа, Ortomyxoviridae, род Influenza, А/17/Ануи/2013/61 (H7N9) депонирован в Государственной коллекции вирусов Института вирусологии им.

Изобретение относится к области генной инженерии и биотехнологии. Изобретение представляет собой способ получения клеточной суспензионной культуры трансгенного табака N.
Изобретение относится к биотехнологии и может быть использовано в процессе клонального микроразмножения яблони и груши на этапе собственно микроразмножения. .

Изобретение относится к области биотехнологии, клеточной технологии, медицине и трансплантологии. .

Изобретение относится к области биотехнологии, в частности к культивированию клеточных культур лекарственных растений. .
Изобретение относится к лесному хозяйству, а именно к созданию сортового плантационного лесовыращивания на основе современных инновационных биотехнологий. .
Изобретение относится к биотехнологии, в частности к штамму продуценту стефарина. .

Изобретение относится к области биотехнологии растений и может быть использовано для мультипликации культур, трудно размножаемых вегетативным способом. .
Изобретение относится к биотехнологии. .

Изобретение относится к области биотехнологии и вирусологии. Предложен новый рекомбинантный полипептид вируса гриппа, представляющий собой гемагглютинин.

Изобретение относится к области биотехнологии, генной инженерии и вирусологии. Предложен способ получения в растении или в его части химерных вирусоподобных частиц. Частицы сходны с частицами вируса гриппа. Способ включает экспрессию химерного НА вируса гриппа в растении или в части растения. Данное изобретение относится также к VLP, включающей химерный белок НА вируса гриппа и липиды растений. Изобретение относится также к нуклеиновой кислоте, кодирующей химерный НА вируса гриппа, и вектору. VLP могут быть использованы для приготовления вакцин против гриппа или для улучшения существующих вакцин. Предложенная группа изобретений может быть использована в медицине. 18 н. и 19 з.п. ф-лы, 60 ил., 5 табл., 5 пр.

Наверх