Пробиотическая бифидобактерия bifidobacterium longum

Представленная группа изобретений касается штаммов Bifidobacterium longum и их применений в качестве пробиотиков в виде различных составов и композиций. Изолированные штаммы Bifidobacterium longum BL1207 (PTA-9608), AH121A (NCIMB 41675), AH1714 (NCIMB 41676) экспрессируют экзополисахарид и индуцируют соотношение [IL10]:[IL12], равное, по меньшей мере, 10, по результатам анализа ко-инкубированием с мононуклеарными клетками периферической крови (РМВС), при концентрации бактерий 1×107 КОЕ/мл. Представленные изобретения могут быть использованы в медицине в качестве пробиотических составов и композиций. 6 н. и 5 з.п. ф-лы, 13 ил., 9 табл., 9 пр.


Область техники

Изобретение относится к геному штамма пробиотических бифидобактерий и генам, кодируемым геномом. Бифидобактерии являются одними из нескольких основных бактериальных культур, присутствующих в микрофлоре толстой кишки человека.

Известный уровень техники

Бифидобактерии считаются пробиотиками, поскольку они представляют собой живые организмы, которые проявляют полезные для здоровья эффекты, помимо основного питательного, при приеме внутрь в достаточном количестве. Высокие уровни принятых внутрь бифидобактерий должны достичь своего места приложения действия для проявления пробиотического эффекта. Был предложен минимальный уровень содержания, равный приблизительно 106-107 жизнеспособных бифидобактерий на грамм содержимого кишечника (Bouhnik, Y., Lait 1993). В литературе имеются сообщения о том, что проведенные in vivo исследования на взрослых и детях показывают, что некоторые штаммы бифидобактерий способны выживать при прохождении по желудочно-кишечному тракту. Наблюдались значительные различия в способности разных штаммов бифидобактерий переносить воздействие кислоты и желчных солей, указывающие на то, что выживание является важным критерием выбора потенциально пробиотических штаммов.

Прием внутрь бифидобактерий может улучшать желудочно-кишечный транзит и может создавать препятствия или помогать лечению болезней, которые могут быть вызваны дефицитом или поражениями микрофлоры, такими как инфекции желудочно-кишечного тракта (GIT), запор, синдром раздраженного кишечника (IBS), воспалительное заболевание кишечника (IBD) - болезнь Крона и неспецифический язвенный колит, пищевые аллергии, индуцированная антибиотиками диарея, сердечно-сосудистая болезнь и определенные виды рака (например, колоректальный рак).

Благодаря своей ощутимой активности, способствующей улучшению состояния здоровья, бифидобактерии в последние годы привлекали все возрастающее внимание со стороны ученых, включая полное секвенирование генома ряда штаммов (описано в обзоре Liu et al., 2005). Такие геномные последовательности обеспечат генетические платформы, создающие возможность исследования молекулярных механизмов, по которым эти микроорганизмы взаимодействуют со своим человеком-хозяином и проявляют пробиотическую функцию.


Изобретение предусматривает изолированный и очищенный штамм Bifidobacterium longum, за исключением штамма 35624 Bifidobacterium longum (NCIMB 41003), где штамм:

a) экспрессирует экзополисахарид; и

b) содержит по меньшей мере две последовательности нуклеиновой кислоты, выбранные из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними.

Штамм Bifidobacterium longum в соответствии с изобретением может содержать любые 2 или больше, такие как BI00778, BI00793; BI00778, BI00794; BI00778, BI00795, или любые три или больше, такие как BI00793, BI00794, BI00798; BI00794, BI00795, BI00796; BI00796, BI00797, BI00798, или любые четыре или больше, такие как BI00778, BI00779, BI00780, BI00794; BI00778, BI00779, BI00785, BI00786; BI00790, BI00791, BI00794, BI00798, или любые пять или больше, такие как

BI00783, BI00786, BI00790, BI00794, BI00798; BI00780, BI00782, BI00785, BI00786, BI00790; BI00778, BI00779, BI00787, BI00789, BI00798, или любые шесть или больше, такие как

BI00778, BI00779, BI00780, BI00781, BI00782, BI00794;

BI00782, BI00784, BI00785, BI00788, BI00792, BI00797;

BI00781, BI00782, BI00783, BI00791, BI00796, BI00797, или любые семь или больше, такие как

BI00779, BI00783, BI00784, BI00787, BI00791, BI00792, BI00797;

BI00780, BI00789, BI00790, BI00793, BI00794, BI00797, BI00798;

BI00783, BI00784, BI00786, BI00788, BI00789, BI00793, BI00796, или любые восемь или больше, такие как

BI00779, BI00782, BI00783, BI00784, BI00785, BI00794, BI00797, BI00798;

BI00780, BI00787, BI00788, BI00789, BI00790, BI00793, BI00794, BI00795;

BI00783, BI00784, BI00785, BI00786, BI00787, BI00793, BI00795, BI00798, или любые девять или больше, такие как

BI00778, BI00780, BI00782, BI00784, BI00785, BI00787, BI00793, BI00795, BI00796;

BI00779, BI00781, BI00782, BI00784, BI00786, BI00787, BI00793, BI00795, BI00797;

BI00782, BI00783, BI00785, BI00786, BI00787, BI00789, BI00792, BI00796, BI00797, или любые десять или больше, такие как

BI00778, BI00781, BI00784, BI00785, BI00786, BI00789, BI00790, BI00792, BI00793, BI00798;

BI00779, BI00781, BI00784, BI00786, BI00787, BI00788, BI00791, BI00794, BI00795, BI00796;

BI00782, BI00784, BI00785, BI00786, BI00790, BI00792, BI00794, BI00796, BI00797, BI00798, или любые одиннадцать или больше, такие как

BI00778, BI00781, BI00785, BI00787, BI00788, BI00790, BI00791, BI00792, BI00794, BI00795, BI00798;

BI00779, BI00782, BI00785, BI00786, BI00789, BI00790, BI00793, BI00794, BI00795, BI00796, BI00797;

BI00781, BI00783, BI00785, BI00787, BI00788, BI00789, BI00790, BI00793, BI00794, BI00795, BI00796, или любые двенадцать или больше, такие как

BI00778, BI00781, BI00782, BI00783, BI00784, BI00785, В-00790, BI00791, BI00792, BI00795, BI00796, BI00797;

BI00779, BI00785, BI00787, BI00788, BI00789, BI00790, BI00791, BI00792, BI00794, BI00796, BI00797, BI00798;

BI00786, BI00787, BI00788, BI00789, BI00790, BI00791, BI00792, BI00793, BI00795, BI00796, BI00797, BI00798, или любые тринадцать или больше, такие как

BI00778, BI00779, BI00780, BI00782, BI00784, BI00789, BI00790, BI00791, BI00792, BI00793, BI00794, BI00795, BI00798;

BI00778, BI00781, BI00782, BI00783, BI00786, BI00787, BI00789, BI00790, BI00791, BI00792, BI00795, BI00796, BI00798;

BI00780, BI00781, BI00782, BI00783, BI00785, BI00786, BI00788, BI00790, BI00791, BI00792, BI00793, BI00797, BI00798, или любые четырнадцать или больше, такие как

BI00778, BI00779, BI00780, BI00782, BI00783, BI00784, BI00785, BI00787, BI00789, BI00791, BI00793, BI00794, BI00795, BI00797;

BI00778, BI00780, BI00781, BI00782, BI00784, BI00785, BI00786, BI00788, BI00789, BI00792, BI00793, BI00794, BI00796, BI00797;

BI00779, BI00780, BI00781, BI00782, BI00783, BI00784, BI00785, BI00787, BI00790, BI00791, BI00794, BI00796, BI00797, BI00798, или любые пятнадцать или больше, такие как

BI00778, BI00779, BI00780, BI00781, BI00782, BI00783, BI00784, BI00785, BI00786, BI00787, BI00788, BI00789, BI00790, BI00792, BI00798;

BI00778, BI00780, BI00781, BI00782, BI00785, BI00787, BI00788, BI00789, BI00790, BI00791, BI00793, BI00794, BI00795, BK)0796, BI00798;

BI00780, BI00782, BI00783, BI00784, BI00785, BI00786, BI00787, BI00789, BI00790, BI00791, BI00793, BI00795, BI00796, BI00797, BI00798, или любые шестнадцать или больше, такие как

BI00778, BI00779, BI00780, BI00781, BI00782, BI00784, BI00785, BI00787, BI00789, BI00790, BI00791, BI00792, BI00793, BI00795, BI00797, BI00798;

BI00778, BI00779, BI00781, BI00783, BI00784, BI00785, BI00787, BI00788, BI00789, BI00790, BI00791, BI00792, BI00794, BI00795, BI00797, BI00798;

BI00780, BI00781, BI00782, BI00783, BI00784, BI00785, BI00787, BI00788, BI00789, BI00790, BI00792, BI00793, BI00795, BI00796, BI00797, BI00798, или любые семнадцать или больше, такие как

BI00778, BI00779, BI00780, BI00781, BI00782, BI00784, BI00785, BI00787, BI00788, BI00789, BI00790, BI00793, BI00794, BI00795, BI00796, BI00797, BI00798;

BI00778, BI00780, BI00781, BI00782, BI00783, BI00785, BI00786, BI00787, BI00789, BI00790, BI00791, BI00792, BI00793, BI00794, BI00795, BW0796, BI00797;

BI00779, BI00780, BI00782, BI00783, BI00784, BI00785, BI00787, BI00788, BI00789, BI00790, BI00791, BI00792, BI00793, BI00794, BI00795, BI00797, BI00798, или любые восемнадцать или больше, такие как

BI00778, BI00779, BI00780, BI00781, BI00782, BI00783, BI00784, BI00785, BI00787, BI00788, BI00789, BI00791, BI00792, BI00793, BI00794, BI00795, BI00796, BI00798;

BI00778, BI00779, BI00781, BI00782, BI00783, BI00784, BI00785, BI00786, BI00787, BI00788, BI00789, BI00790, BI00792, BI00794, BI00795, BI00796, BI00797, BI00798;

BI00779, BI00781, BI00782, BI00783, BI00784, BI00785, BI00786, BI00787, BI00788, BI00789, BI00790, BI00791, BI00792, BI00793, BI00794, BI00795, BI00796, BI00797 или любые девятнадцать или больше, такие как

BI00778, BI00779, BI00780, BI00781, BI00782, BI00783, BI00784, BI00785, BI00786, BI00787, BI00788, BI00789, BI00790, BI00791, BI00792, BI00794, BI00795, BI00796, BI00797;

BI00778, BI00779, BI00780, BI00782, BI00783, BI00784, BI00785, BI00786, BI00787, BI00788, BI00789, BI00790, BI00791, BI00792, BI00793, BI00794, BI00795, BI00796, BI00797;

BI00779, BI00780, BI00781, BI00782, BI00784, BI00785, BI00786, BI00787, BI00788, BI00789, BI00790, BI00791, BI00792, BI00793, BI00794, BI00795, BI00796, BI00797, BI00798, или любые двадцать или больше, такие как

BI00778, BI00779, BI00780, BI00781, BI00782, BI00783, BI00784, BI00785, BI00786, BI00787, BI00788, BI00789, BI00790, BI00791, BI00792, BI00793, BI00794, BI00795, BI00797, BI00798;

BI00778, BI00779, BI00780, BI00781, BI00782, BI00783, BI00784, BI00785, BI00786, BI00787, BI00789, BI00790, BI00791, BI00792, BI00793, BI00794, BI00795, BI00796, BI00797, BI00798;

BI00778, BI00779, BI00780, BI00782, BI00783, BI00784, BI00785, BI00786, BI00787, BI00788, BI00789, BI00790, BI00791, BI00792, BI00793, BI00794, BI00795, BI00796, BI00797, BI00798, или все двадцать одну, последовательности нуклеиновой кислоты, выбранные из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей, гомологичных с ними.

Штамм может содержать по меньшей мере три последовательности нуклеиновой кислоты, выбранные из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере четыре последовательности нуклеиновой кислоты, выбранные из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере пять последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере шесть последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере семь последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере восемь последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере девять последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере десять последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере одиннадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере двенадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере тринадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере четырнадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере пятнадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере шестнадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере семнадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере восемнадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере девятнадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере двадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать все двадцать одну последовательность нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними.

Штамм может не содержать последовательности нуклеиновой кислоты SEQ ID NO. 112.

Штамм может содержать по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними.

Штамм может содержать по меньшей мере две последовательности нуклеиновой кислоты, выбранные из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере три последовательности нуклеиновой кислоты, выбранные из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере четыре последовательности нуклеиновой кислоты, выбранные из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере пять последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере шесть последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере семь последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере восемь последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере девять последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере десять последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере одиннадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере двенадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере тринадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере четырнадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере пятнадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере шестнадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере семнадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать по меньшей мере восемнадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать все девятнадцать последовательностей нуклеиновой кислоты, выбранных из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними

Штамм может содержать одну последовательность нуклеиновой кислоты, выбранную из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, по меньшей мере гомологичных этим последовательностям. Штамм может содержать последовательность нуклеиновой кислоты SEQ ID NO. 132, или последовательность нуклеиновой кислоты, по меньшей мере гомологичную этой последовательности.

Штамм может содержать две последовательности нуклеиновой кислоты, выбранные из группы, включающей SEQ ID NO. 114 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними. Штамм может содержать последовательности нуклеиновой кислоты SEQ ID NO. 131 и SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними.

Изобретение также предусматривает изолированный и очищенный штамм Bifidobacterium longum, где штамм:

a) экспрессирует экзополисахарид; и

b) содержит по меньшей мере две последовательности нуклеиновой кислоты, выбранные из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними; и

c) содержит последовательность нуклеиновой кислоты SEQ ID NO. 132 или последовательность нуклеиновой кислоты, имеющую по меньшей мере 85% гомологии последовательности с ней; и/или

d) содержит последовательность нуклеиновой кислоты SEQ ID NO. 131 или последовательность нуклеиновой кислоты, имеющую по меньшей мере 85% гомологии последовательности с ней.

В одном варианте исполнения, 1×107 КОЕ/мл штамма может индуцировать соотношение [IL10]: [IL12], равное по меньшей мере 10, по результатам анализа ко-инкубации с мононуклеарными клетками периферической крови (РМВС). Штамм может иметь форму бактериального бульона. Штамм может иметь форму лиофилизированного порошка.

Изобретение далее предусматривает изолированный и очищенный штамм Bifidobacterium longum, где штамм:

a) экспрессирует экзополисахарид; и

b) содержит по меньшей мере две последовательности нуклеиновой кислоты, выбранные из группы, включающей SEQ ID NO. 93 - SEQ ID NO. 113, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними; и

c) содержит последовательность нуклеиновой кислоты SEQ ID NO. 132 или последовательность нуклеиновой кислоты, имеющую по меньшей мере 85% гомологии последовательности с ней; и/или последовательность нуклеиновой кислоты SEQ ID NO. 131 или последовательность нуклеиновой кислоты, имеющую по меньшей мере 85% гомологии последовательности с ней; и

d) индуцирует соотношение [IL10]:[IL12], равное по меньшей мере 10 по результатам анализа ко-инкубации с мононуклеарными клетками периферической крови (РМВС) при концентрации бактерий 1×107 КОЕ/мл.

Изобретение также предусматривает изолированный штамм Bifidobacterium longum BL1207 (РТА-9608).

Изобретение далее предусматривает изолированный штамм Bifidobacterium longum AH121A (NCIMB 41675).

Изобретение также предусматривает изолированный штамм Bifidobacterium longum AH1714(NCIMB41676).

Изолированный штамм может иметь форму жизнеспособных клеток. Изолированный штамм может иметь форму нежизнеспособных клеток.

Изобретение также предусматривает состав, содержащий изолированный штамм Bifidobacterium longum, описанный тут. Состав может содержать пригодный для приема внутрь носитель. Пригодный для приема внутрь носитель может быть фармацевтически приемлемым носителем, таким как капсула, таблетка или порошок. Пригодный для приема внутрь носитель может быть пищевым продуктом, таким как сквашенное молоко, йогурт, замороженный йогурт, сухое молоко, молочный концентрат, пастообразные сырные продукты, соусы или напитки. Состав может содержать штамм, присутствующий в количестве более 106 КОЕ на грамм пригодного для приема внутрь носителя.

Изобретение далее предусматривает композицию, содержащую изолированный штамм Bifidobacterium longum, как описано тут, и фармацевтически приемлемый носитель.

Изобретение также предусматривает использование штамма Bifidobacterium longum, как описано тут, в качестве пробиотического штамма.

Изобретение также предусматривает способ идентификации экспрессирующего экзополисахарид штамма Bifidobacterium longum, включающий стадии:

a) получения образца, содержащего бактерии;

b) экстрагирования нуклеиновой кислоты из образца;

c) амплификации экстрагированной нуклеиновой кислоты в присутствии по меньшей мере двух праймеров, полученных из последовательности нуклеиновой кислоты, выбранной из группы, содержащей: SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 10 - SEQ ID NO. 12, SEQ ID NO. 93 - SEQ ID NO. 132, или последовательностей нуклеиновой кислоты, имеющих по меньшей мере 85% гомологии последовательности с ними;

d) идентификации бактериального штамма, экспрессирующего экзополисахарид.

Праймер может содержать по меньшей мере 10 последовательно расположенных оснований из последовательности нуклеиновой кислоты, выбранной из группы, содержащей: SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 10 - SEQ ID NO. 12, и SEQ ID NO. 93 - SEQ ID NO. 132.

Праймер может содержать последовательность нуклеиновой кислоты, выбранную из группы, содержащей: SEQ ID NO. 10 - SEQ ID NO. 12, SEQ ID NO. 13 - SEQ ID NO. 92, или последовательность нуклеиновой кислоты, имеющую по меньшей мере 85% гомологии последовательности с ними.

Стадия идентификации бактериального штамма, экспрессирующего экзополисахарид, может включать выращивание бактериального штамма на агаровой пластинке с конго красным.

Образец представляет собой образец, взятый у млекопитающего. Образец может быть образцом, взятым у человека. Образец может быть образцом фекалий.

Изобретение также предусматривает штамм Bifidobacterium longum, идентифицируемый по приведенному тут описанию. Штамм Bifidobacterium longum может иметь форму жизнеспособных клеток. Штамм Bifidobacterium longum может иметь форму нежизнеспособных клеток.

Изобретение далее предусматривает состав, содержащий штамм Bifidobacterium longum, описанный тут. Состав может содержать пригодный для приема внутрь носитель. Пригодный для приема внутрь носитель может быть фармацевтически приемлемым носителем, таким как капсула, таблетка или порошок. Пригодный для приема внутрь носитель может быть пищевым продуктом, таким как сквашенное молоко, йогурт, замороженный йогурт, сухое молоко, молочный концентрат, пастообразные сырные продукты, соусы или напитки. Штамм может присутствовать в составе в количестве более 106 КОЕ на грамм пригодного для приема внутрь носителя.

Изобретение также предусматривает композицию, содержащую штамм Bifidobacterium longum, описанный тут, и фармацевтически приемлемый носитель.

В одном варианте исполнения изобретения предлагается способ идентификации бактериальных штаммов, секретирующих экзополисахарид, включающий стадии:

- получения образца, содержащего бактерии;

- экстрагирования ДНК из образца;

- амплификации экстрагированной ДНК в присутствии по меньшей мере одного праймера ДНК, полученного из последовательности ДНК SEQ ID NO. 2 и/или SEQ ID NO. 3; и

- идентификации бактериального штамма, экспрессирующего экзополисахарид.

Экстрагированная ДНК может быть амплифицирована методом ПЦР в реальном масштабе времени. ДНК может быть амплифицирована в присутствии по меньшей мере одного праймера последовательности нуклеиновой кислоты SEQ ID NO. 10, SEQ ID NO. 11 или SEQ ID NO. 12.

Образец может быть образцом, полученным от человека, таким как образец фекалий.

В другом варианте исполнения, изобретение также предусматривает бактериальный штамм, идентифицированный описанным тут способом.

В другом варианте исполнения, изобретение дополнительно предусматривает использование бактериального штамма, идентифицированного описанным тут способом, в качестве пробиотических бактерий.

В еще одном варианте исполнения, изобретение также предусматривает состав, содержащий бактериальный штамм, идентифицированный описанным тут способом.

В другом варианте исполнения, изобретение дополнительно предусматривает композицию, содержащую бактериальный штамм, идентифицированный описанным тут способом, и фармацевтически приемлемый носитель.

В другом варианте исполнения, изобретение также предусматривает изолированный штамм Bifidobacterium longum BLM07 (PTA-9608).

В еще одном варианте исполнения, изобретение дополнительно предусматривает состав, содержащий изолированный штамм Bifidobacterium longum BL1207 (PTA-9608).

В другом варианте исполнения, изобретение также предусматривает композицию, содержащую изолированный штамм Bifidobacterium longum BL1207 (PTA-9608) и фармацевтически приемлемый носитель.

В другом варианте исполнения, изобретение дополнительно предусматривает матрицу/чип ДНК, содержащую по меньшей мере один полинуклеотид, полученный из последовательности нуклеиновой кислоты SEQ ID NO. 1, SEQ ID NO. 2, или SEQ ID NO. 3.

В одном варианте исполнения, изобретение также предусматривает машинно-читаемый носитель, содержащий последовательность нуклеиновой кислоты SEQ ID NO. 1, SEQ ID NO. 2 или SEQ ID NO. 3 или ее частей.

Штамм Bifidobacterium longum в соответствии с вариантом исполнения изобретения может экспрессировать или продуцировать EPS (экзополисахарид) с выходом от примерно 10 мг/л до примерно 1000 мг/л бактериальной культуры.

Существует ряд штаммов бифидобактерий, уже депонированных в соответствии с Будапештским договором. Они включают штамм, депонированный в NCIMB под номером 41003, геном которого представлен тут. Поскольку этот штамм является известным, он конкретно исключается из объема защиты по формуле изобретения штаммов per se. В той степени, в которой следующие штаммы могут входить в объем формул изобретения на соответствующую дату (даты), исключаются также следующие притязания: АТСС BAA-999, CNCM 1-1227, CNCM 1-1228, CNCM 1-2168, CNCM 1-2170, CNCM 1-2618, CNCM 1-3446, CNCM 1-3853, CNCM 1-3854, CNCM 1-3855, NCIMB 41290, NCIMB 41291, NCIMB 41382, NCIMB41387, NTCC2705.

Краткое описание чертежей

Изобретение будет лучше понятно из представленного далее описания, которое приводится только в качестве примера со ссылками на сопровождающие чертежи, на которых:

Фиг.1 представляет собой атлас генома Bifidobacterium longum, биотип infantis UCC 35624. Числа на геноме (1, 1000001, 200001) относятся к положению пар оснований. 1 относится к нуклеотиду аденина старт-кодона ATG гена, кодирующего предсказанный реплицируемый белок. Внешняя окружность (две нити, черная и белая) относится к генной плотности в хромосоме. Вторая окружность (средняя окружность - черная) относится к содержанию GC (гуанина-цитозина), и внутренняя окружность относится к асимметрии GC;

Фиг.2 представляет собой гистограмму, показывающую профиль индукции IL-1бета в РВМС штаммом Bifidobacterium longum infantis UCC35624 (В624), штаммом Bifidobacterium longum 1207 (BL1207), штаммом Bifidobacterium longum 15707 (BLI5707), Bifidobacterium lactis (BL-07) и штаммом Bifidobacterium breve 8807 [UCC2003] (breve);

Фиг.3 представляет собой гистограмму, изображающую профиль индукции IL-12p70 в РВМС штаммом Bifidobacterium longum infantis UCC35624 (В624), штаммом Bifidobacterium longum 1207 (BL1207), штаммом Bifidobacterium longum 15707 (BL15707), Bifidobacterium lactis (BL-07) и штаммом Bifidobacterium breve 8807 [UCC2003] (breve);

Фиг.4 представляет собой гистограмму, изображающую профиль индукции IL-10 в РВМС штаммом Bifidobacterium longum infantis UCC35624 (В624), штаммом Bifidobacterium longum 1207 (BL1207), штаммом Bifidobacterium longum 15707 (BLI5707), Bifidobacterium lactis (BL-07) и штаммом Bifidobacterium breve 8807 [UCC2003] (breve);

Фиг.5 представляет собой гистограмму, изображающую профиль индукции TNF-альфа в РВМС штаммом Bifidobacterium longum infantis UCC35624 (В624), штаммом Bifidobacterium longum 1207 (BL 1207), штаммом Bifidobacterium longum 15707 (BLI5707), Bifidobacterium lactis (BL-07) и штаммом Bifidobacterium breve 8807 [UCC2003] (breve).

Фиг.6 представляет собой фотографию В.longum 35624, выращиваемых на агаровой пластинке с конго красным;

Фиг.7 представляет собой фотографию В.longum AH121A, выращиваемых на агаровой пластинке с конго красным;

Фиг.8 представляет собой фотографию В.longum АН1714, выращиваемых на агаровой пластинке с конго красным;

Фиг.9 представляет собой фотографию В.longum AH0119, выращиваемых на агаровой пластинке с конго красным;

Фиг.10 представляет собой фотографию В.breve UCC2003, выращиваемых на агаровой пластинке с конго красным;

Фиг.11 представляет собой фотографию L.rhamnosus AH308, выращиваемых на агаровой пластинке с конго красным;

Фиг.12 представляет собой фотографию L.salivarius UCC1, выращиваемых на агаровой пластинке с конго красным; и

Фиг.13 представляет собой гистограмму, иллюстрирующую соотношение IL-10:IL-12p70 для РВМС, стимулированных штаммом Bifidobacterium longum infantis 35624 (Bifidobacterium 35624), штаммом Bifidobacterium longum 1714 (Bifidobacterium 1714), штаммом Bifidobacterium longum 1207 (Bifidobacterium 1207), штаммом Bifidobacterium longum 121A (Bifidobacterium 121A), штаммом Bifidobacterium longum 0119 (Bifidobacterium 0119), штаммом Bifidobacterium longum 15707 (Bifidobacterium 15707), штаммом Bifidobacterium breve 8807 (Bifidobacterium UCC2003), Lactobacillus rhamnosus и штаммом Lactobacillus salivarius UCC1.


Настоящее изобретение раскрывает изолированный полинуклеотид SEQ ID NO. 1. Полинуклеотид SEQ ID NO. 1 кодирует штамм Bifidobacterium. Bifidobacterium, кодируемые изолированной полинуклеотидной последовательностью, содержат ряд уникальных генов. Уникальные гены, кодируемые полинуклеотидом, имеют уникальный порядок в последовательности SEQ ID NO. 1. В используемом тут значении, термин "уникальные гены" означает гены, не выявленные в доступных на данный момент последовательностях Bifodobacterium. В используемом тут значении, термин "уникальный порядок" означает, что положение/последовательность генов в полинуклеотиде не были выявлены в доступных на данный момент последовательностях Bifodobacterium. Уникальные гены, присутствующие в изолированном полинуклеотиде, могут перемежаться остатками нуклеиновых кислот, кодирующими другие (известные) гены, или участками некодирующей последовательности, но общий порядок/последовательность уникальных генов в изолированном полинуклеотиде сами по себе являются уникальными по сравнению с порядком генов, определенном для доступных на данный момент последовательностей Bifodobacterium.

Полинуклеотид был выделен из штамма бактерий вида Bifidobacterium longum биотип infantis, имеющего обозначение штамма UCC 35624. Депонирование штамма UCC 35624 Bifidobacterium longum биотип infantis было осуществлено в Национальных коллекциях промышленных и морских бактерий (National Collections of Industrial and Marine Bacteria Limited, NCIMB), Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, Scotland, UK, 13 января 1999 г., с присвоением номера доступа NCIMB 41003.

Депонирование штамма BL1207 Bifidobacterium infantis было осуществлено в Американской коллекции типовых культур (American Type Culture Collection, ATTC) 10801 University Boulevard, Manassas, Virginia 20110-2209, USA, 14 ноября 2008 г., с присвоением номера доступа РТА-9608.

Депонирование штамма Bifidobacterium longum AH121A было осуществлено в Национальных коллекциях промышленных и морских бактерий (National Collections of Industrial and Marine Bacteria Limited, NCIMB), Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, Scotland, UK, 5 ноября 2009 г., с присвоением номера доступа NCIMB 41675.

Депонирование штамма Bifidobacterium longum AH1714 было осуществлено в Национальных коллекциях промышленных и морских бактерий (National Collections of Industrial and Marine Bacteria Limited, NCIMB), Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, Scotland, UK, 5 ноября 2009 г., с присвоением номера доступа NCIMB 41676.

С учетом размера изолированного полинуклеотида, можно ожидать присутствия в последовательности точечных мутаций или какой-либо другой формы мутаций. В этом смысле, наше описание охватывает варианты SEQ ID NO. 1. В используемом тут значении, термин "варианты" означает штаммы бифидобактерий, имеющие идентичность последовательности с SEQ ID NO. 1, равную по меньшей мере 99,5% или больше.

SEQ ID NO. 1 содержит большое число открытых рамок считывания, которые представляют собой предсказанные гены. Мы идентифицировали в данном полинуклеотиде 1836 кодирующих областей белков или генов. По существу, наше описание охватывает фрагменты полинуклеотида SEQ ID NO. 1. Фрагменты могут соответствовать участкам полинуклеотидной последовательности, кодирующим один или несколько белков. Альтернативно, фрагменты могут соответствовать участкам полинуклеотидной последовательности, определяющим часть гена или гены, например, фрагмент может соответствовать участку полинуклеотидной последовательности, охватывающему часть двух или больше генов.

Последовательность SEQ ID NO. 1 представляет собой полинуклеотидную последовательность ДНК, наше описание охватывает последовательности, являющиеся комплементарными к последовательности ДНК, например, комплементарные ДНК (кДНК) или РНК последовательности, включая матричную РНК (мРНК) и транспортную РНК (тРНК), или белковые последовательности, такие как аминокислотные последовательности, кодируемые полинуклеотидной последовательностью.

Полинуклеотид SEQ ID NO. 1 и его комплементарные последовательности могут иметь большое число форм, например, изолированной полинуклеотидной последовательности; изолированной белковой последовательности; биологически чистой культуры штамма бифидобактерий, содержащего нуклеиновую кислоту SEQ ID NO. 1; плазмиды, содержащей полинуклеотид SEQ ID NO. 1; и т.п. Данное описание охватывает все такие формы последовательности SEQ ID NO. 1.

В используемом тут значении, термин "экспрессирует экзополисахарид" может быть интерпретирован как обозначающий, что бактериальный штамм содержит последовательность ДНК, кодирующую экзополисахарид, например, последовательность ДНК, которая кодирует по меньшей мере один ген из SEQ ID NO. 2 и/или по меньшей мере один ген из SEQ ID NO. 3 или его функциональный фрагмент или вариант.

В используемом тут значении, термин "гомология последовательности" охватывает гомологию последовательности на уровне нуклеиновой кислоты и/или аминокислотном (белковом) уровне. Гомология последовательности указывается как общий процент идентичности по всей последовательности нуклеиновой кислоты и/или аминокислотной последовательности. Гомология последовательности может быть определена с использованием стандартных методик, известных квалифицированным специалистам в данной области техники. Например, гомология последовательности может быть определена с помощью работающей в интерактивном режиме (on-line) программы "BLAST", основанной на алгоритме определения гомологии, публично доступной по адресу http://www.ncbi.nlm.nih.gov/BLAST/. Последовательность может иметь по меньшей мере 85%, или по меньшей мере 86%, или по меньшей мере 87%, или по меньшей мере 88%, или по меньшей мере 89%, или по меньшей мере 90%, или по меньшей мере 91%, или по меньшей мере 92%, или по меньшей мере 93%, или по меньшей мере 94%, или по меньшей мере 95%, или по меньшей мере 96%, или по меньшей мере 97%, или по меньшей мере 98%, или по меньшей мере 99% гомологии последовательности с последовательностями нуклеиновой кислоты, описанными тут, или кодируемыми ими аминокислотными (белковыми) последовательностями.

Настоящее изобретение основано на полной геномной последовательности Bifidobacterium longum биотип infantis UCC 35624. Геномная последовательность приведена как SEQ ID NO. 1 приложенного перечня последовательностей и содержит 2264374 пар оснований. Анализ геномной последовательности идентифицировал 1836 гена, имеющих открытые рамки считывания, приведенные в Таблице 1 ниже.

Таблица 1
Открытые рамки считывания генома UCC 35624
Ген Начало Конец Нить Описание
BI00001 1667321 1667608 - CRISPR-ассоциированный белок Cas2
BI00002 1667697 1668593 - CRISPR-ассоциированный белок Cas1
BI0002a 1668725 1669423 - CRISPR-ассоциированный белок Cas4
BI00003 1669465 1670313 - CRISPR-ассоциированный белок, семейство ТМ1801
BI00005 1670320 1672275 - CRISPR-ассоциированный белок, семейство СТ1133
BI00006 1672281 1672982 - CRISPR-ассоциированный белок, семейство СТ1134
BI00007 1672992 1675427 - гипотетическая CRISPR-ассоциированная геликаза Cas3
BI00008 1676109 1676426 - COG3464: Транспозаза и инактивированные производные
BI00009 1677053 1680283 - изолейцил-тРНК синтетаза
BI00010 1680955 1682163 + аминотрансфераза, класс I, предположительно
BI00011 1682280 1683785 - галактозидный симпортер
BI00012 1684111 1687299 + бета-галактозидаза, предположительно
BI00013 1687365 1688372 - сахарсвязывающий регулятор транскрипции, семейство Lad, предположительно
BI00014 1688522 1689889 - Предположительно, белок резистентности к антибиотику (мембранный белок)
BI00015 1690007 1690906 - гипотетическая карбогидрат-киназа семейства pfkB
BI00016 1690909 1692111 - алкогольдегидрогеназа, железосодержащая
BI00017 1692111 1692794 - гипотетическая дегалогеназа галоидных кислот-подобная гидролаза
BI00018 1692921 1693901 - инозин-уридин-предпочитающая нуклеозидгидролаза
BI00019 1693960 1694913 - гипотетическая карбогидрат-киназа семейства pfkB
BI00020 1694909 1695553 - гипотетическая N-(5'-фосфорибозил)-антранилатизомераза
BI00021 1695603 1696415 - Переносчик ABC, АТФ-связывающий белок
BI00022 1696415 1697242 - консервативный гипотетический белок
BI00023 1697246 1698055 гипотетический транспортный белок кобальта
BI00024 1698062 1698712 - консервативный гипотетический белок
BI00025 1698969 1700846 + регулятор транскрипции, семейство Lad / карбогидрат-киназа, белок семейства PfkB
BI00026 1700977 1702989 - переносчик ABC, АТФ-связывающий белок/пермеаза
BI00027 1702989 1704944 - переносчик ABC, АТФ-связывающий белок
BI00028 1704944 1705402 - регулятор транскрипции, семейство MarR, предположительно
BI00029 1705699 1706610 - COG 1472: Бета-глюкозидаза-родственные гликозидазы
BI00030 1706029 1706937 + COG 1309: Регулятор транскрипции
BI00031 1707015 1708373 - безымянный белковый продукт
BI00032 1708509 1710902 ксилозидаза/арабинозидаза [импортированный]
BI00033 1710937 1711287 - гипотетический белок
BI00034 1711383 1712762 - глутамат-цистеинлигаза, предположительно
BI00035 1712905 1718037 + белок консервативного домена
BI00036 1718044 1718883 + гипотетический белок
BI00037 1719052 1724187 - BadF/BadG/BcrA/BcrD семейства АТФазы
BI00038 1724418 1725143 - активирующий белок анаэробной рибонуклеозид-трифосфатредуктазы
BI00039 1725294 1727699 - анаэробная рибонуклеозид-трифосфатредуктаза
BI00040 1728167 1729534 + экзодезоксирибонуклеаза VII, большая субъединица
BI00041 1729587 1729886 + экзодезоксирибонуклеаза VII, малая субъединица
BI00042 1730013 1730534 + NADP(H) оксидоредуктаза СС0205 [импортированная]
BI00043 1730676 1732529 - длинноцепочечная жирная кислота-СоА лигаза, предположительно
BI00044 1732662 1732787 - COG 1970: Механочувствительный канал высокой проводимости
BI00045 1732765 1733166 - гипотетический Механочувствительный канал высокой проводимости, MscL
BI00046 1733337 1733762 - неизвестный белок, предположительно
BI00047 1733887 1734102 - COG0454: Гистонацетилтрансфераза НРА2 и родственные ацетилтрансферазы
BI00048 1734587 1735696 + гипотетический трансмембранный белок с
неизвестной функцией
BI00049 1735718 1736683 - экзополифосфатаза, предположительно
BI00050 1736864 1737967 - аминотрансфераза, класс I
BI00051 1738178 1739230 + оксидоредуктаза, семейство Gfo/Idh/MocA, предположительно
BI00052 1739267 1739779 - белок репарации очажков [импортированный]
BI00053 1739931 1740377 + ацетилтрансфераза, семейство GNAT
BI00054 1740356 1740841 - консервативный гипотетический белок
BI00055 1741026 1745207 - геликаза, семейство Snf2
BI00056 1745285 1746367 + консервативный гипотетический белок
BI00057 1746358 1746504 - гипотетический белок
BI00058 1746604 1747620 + тетрагидродипиколинат-N-сукцинилтрансфераза (dapD)
BI00059 1747840 1749129 - цитратсинтаза I
BI00060 1749406 1750242 - метионинаминопептидаза, тип I
BI00061 1750378 1751355 - мембранный белок, предположительно
BI00062 1751532 1753703 + принадлежит к семейству пептидаз М13
BI00063 1753792 1754526 подсемейство одноцепочечного ДНК-связывающего белка (ssb)
BI00064 1754805 1756616 - пролил-тРНК синтетаза
BI00065 1757008 1757361 + гипотетический белок
BI00066 1757392 1758561 - pflA
BI00067 1758551 1760338 - Семейство белков с неизвестной функцией
BI00068 1760391 1761806 - белок TPR-домена
BI00069 1761858 1762505 - олигорибонуклеаза
BI00070 1762676 1764259 - инозин-5'-монофосфатдегидрогеназа
BI00071 1764282 1765562 - ундекапренил-фосфат альфа-N-ацетилглюкозаминилтрансфераза
BI00072 1765562 1766233 - белок семейства Sua5/YciO/YrdC/YwlC
BI00073 1766408 1767082 + мальтоза-O-ацетилтрансфераза
BI00074 1767220 1767921 - переносчик аминокислоты с разветвленной цепью ABC, АТФ-связывающий белок
BI00075 1767924 1768781 - переносчик аминокислоты с разветвленной цепью ABC, АТФ-связывающий белок
BI00076 1768781 1769854 - переносчик аминокислоты с разветвленной цепью ABC, белок пермеазы
BI00077 1769874 1770797 - переносчик аминокислоты с разветвленной цепью ABC, белок пермеазы
BI00078 1771042 1772226 - переносчик аминокислоты с разветвленной цепью ABC, аминокислота-связывающий белок, предположительно
BI00079 1772502 1773407 - N-метилаза РарМ
BI00080 1773473 1774492 - фактор 1 высвобождения пептидной цепи
BI00003g 1774715 1774924 - рибосомальный белок L31
BI00081 1775256 1776482 регулятор транскрипции ROK семейство VC2007 [импортированный], предположительно
BI00082 1776702 1778219 + ксилулолкиназа
BI00083 1778416 1778760 + липопротеин, предположительно
BI00084 1778773 1779114 + гипотетический белок
BI00085 1779393 1779737 - возможно, пермеаза сахара
BI00086 1779656 1780930 - транспозаза, семейство Mutator
BI00087 1781199 1782545 - ксилозоизомераза
BI00088 1782842 1783072 + переносчик резистентности к лекарственным препаратам, подсемейство EmrB/QacA
BI00089 1783095 1783409 + переносчик резистентности к лекарственным препаратам, подсемейство EmrB/QacA
BI00090 1783425 1784222 - консервативный гипотетический белок
BI00091 1785149 1785661 - полипептид деформилаза
BI00092 1785576 1786421 - оксидоредуктаза, семейство альдо/кето редуктазы суперсемейство
BI00093 1786497 1786673 - COG0477: Пермеазы суперсемейства главного посредника
BI00094 1786761 1787264 - гипотетические COG0477: Пермеазы суперсемейства главного посредника
BI00095 1787291 1787791 - возможнй регулятор транскрипции MarR-типа
BI00011g 1787998 1788333 - гипотетический белок Blon021361
BI00096 1788358 1789572 - переносчик сахара ABC, белок пермеазы
BI00097 1789575 1791125 - переносчик сахара ABC, АТФ-связывающий белок
BI00098 1791229 1792383 - переносчик сахара ABC, периплазматический сахарсвязывающий белок
BI00099 1792462 1792608 - гипотетический белок
BI00100 1792854 1793801 + возможно, репрессорный белок семейства (NagC/XylR)
BI00101 1793842 1794705 + переносчик сахара ABC, АТФ-связывающий белок, предположительно
BI00102 1794736 1795683 - глюкокиназа, предположительно
BI00103 1796537 1798192 + АТФ-связывающий белок переносчика ABC
BI00104 1798507 1799409 + ацил-СоА тиоэстераза II
BI00105 1799511 1800035 - гипотетический мембранный белок с неизвестной функцией
BI00106 1800213 1801622 - дигидронеоптерин альдолаза
BI00107 1801736 1802608 - дигидроптероат синтаза
BI00108 1802699 1803295 - ГТФ циклогидролаза I
BI00109 1803391 1805478 - белок клеточного деления FtsH
BI00110 1805478 1806038 - гипоксантин фосфорибозилтрансфераза
BI00111 1806028 1807191 - COG0037: предсказанная АТФаза вовлеченного суперсемейства РР-петли
BI00112 1807285 1808772 - D-аланил-D-аланин карбоксипептидаза/D-аланил-D-аланин-эндопептидаза
BI00113 1808798 1810468 - гипотетический трансмембранный белок с неизвестной функцией
BI00114 1810468 1811421 - система АТФ-связывающего белка
переносчика ABC
BI00115 1811519 1812739 - белок домена гликозилтрансферазы, предположительно
BI00116 1812742 1814496 - гипотетический интегральный мембранный белок в upfoll8
BI00117 1814587 1815252 + возможно, гликозилтрансфераза
BI00118 1815481 1816629 - алкогольдегидрогеназа, железосодержащая
BI00119 1817069 1818370 + циклопропан-ацил жирной кислоты-фосфолипидсинтаза
BI00120 1818383 1819687 + гипотетические COG0477: Пермеазы суперсемейства главного посредника
BI00121 1820205 1821215 - UDP-глюкоза 4-эпимераза
BI00122 1821585 1822400 + метилтрансфераза, предположительно
BI00123 1822698 1823195 - гипотетический белок
BI00124 1823244 1823708 - Orf2
BI00125 1823795 1824079 + гипотетическая спираль-поворот-спираль
BI00126 1824492 1824788 - гипотетический белок
BI00127 1825086 1826453 - gp22
BI00128 1827148 1827699 - гипотетический белок
BI00170t 1827699 1828901 - гипотетическое семейство фаговой интергазы
BI00129 1829429 1830229 + белок azIC, предположительно
BI00130 1830229 1830558 + пермеаза аминокислоты с разветвленной цепью
BI00131 1830743 1831258 - фосфотирозинпротеинфосфатаза, предположительно
BI00132 1831385 1832044 - дигидрофол атредуктаза
BI00133 1832157 1832936 - тимидилатсинтаза
BI00134 1833154 1833564 + консервативный гипотетический белок
BI00135 1833629 1834663 - demannu, предположительно
BI00136 1834835 1835572 - Р60 внеклеточный белок, инвазия-ассоциированный белок lap
BI00137 1835733 1836476 - белок домена семейства NLP/P60
BI00138 1836692 1837645 - белок домена N-ацетилмурамоил-L-аланинамидазы
BI00139 1838255 1839178 + фосфосеринаминотрансфераза, предположительно
BI00140 1839305 1839562 + консервативный гипотетический белок
BI00141 1839693 1840874 - сенсорная гистидинкиназа, предположительно
BI00142 1841128 1841745 + регуляторный белок системы транспорта фосфата PhoU, предположительно
BI00143 1842110 1842847 - фосфогл ицератмутаза
BI00144 1842910 1843872 - 1,4-дигидрокси-2-нафтоатоктапренил-трансфераза
BI00145 1843937 1845412 - лизил-тРНК синтетаза
BI00146 1846534 1847304 + AraJ-подобный белок, возможно, вовлеченный в транспорт арабинозных полимеров
BI00147 1847394 1849754 + белок TPR домена
BI00148 1849833 1850462 + консервативный гипотетический белок
BI00149 1850618 1852216 - гипотетическый мембранный белок, возможно, вовлеченный в транспорт
BI00150 1852325 1853029 - консервативный гипотетический белок
BI00151 1853062 1854903 - консервативный гипотетический белок
BI00152 1854930 1856174 + возможный гистидинкиназный сенсор двухкомпонентной системы
BI00153 1856174 1856866 + регулятор транскрипции, семейство LuxR NMB1250 [импортированный]
BI00154 1856920 1857939 - УДФ-глюкоза 4-эпимераза
BI00155 1858012 1859556 - галактоза-1-фосфатуридилилтрансфераза
BI00156 1859606 1860682 - предположительно, десульфатаза, возможно, для муцина
BI00157 1860713 1862965 - консервативный гипотетический белок
BI00158 1863426 1864382 - переносчик сахара ABC, белок пермеазы
BI00159 1864382 1865278 - переносчик сахара ABC, белок пермеазы,
BI00160 1865546 1866859 - белок, связывающий растворенные вещества, переносчика ABC для Сахаров
BI00161 1867217 1867369 - гипотетический белок
BI00162 1867867 1868856 - серил-тРНК синтетаза
BI00163 1869384 1870562 + белок каталитического домена диацилглицеринкиназы (предполагаемый)
BI00164 1870573 1871409 - антитерминатор транскрипции, семейство BgIG, предположительно
BI00165 1871430 1873829 - компонент системы PTS, предположительно
BI00166 1874293 1875843 + переносчик СС0814 [импортированный] семейства главного посредника, предположительно
BI00167 1875934 1877607 + фосфоглюкомутаза, альфа-D-глюкоза фосфат-специфическая
BI00222t 1878343 1879437 - консервативный гипотетический белок
BI00168 1879668 1880087 + консервативный гипотетический белок
BI00169 1880224 1881837 + оксидоредуктаза, пиридиннуклеотид-дисульфид, класс I
BI00170 1882002 1882151 - гипотетический белок
BI00171 1882305 1883360 + РНКаза Н
BI00172 1883494 1884189 + рибоза-5-фосфатизомераза
BI00173 1884629 1885258 - консервативный гипотетический белок
BI00174 1885386 1886921 + белок репарации ДНК RadA
BI00175 1886942 1888063 - белок биосинтеза рибофлавина RibF
BI00176 1888164 1889324 - тРНК псевдоуридинсинтаза В
BI00177 1889329 1889799 - рибосомасвязывающий фактор А
BI00178 1889953 1892799 - фактор инициации трансляции IF-2
BI00179 1893150 1894214 - белок А вещества утилизации N
BI00180 1894422 1895147 + липопротеин, предположительно
BI00181 1895194 1896234 - регулятор транскрипции, семейство Lacl, предположительно
BI00182 1896528 1896629 - гипотетический белок
BI00183 1896770 1897798 - гипотетический
BI00184 1897936 1898568 - альфа-L-арабинозидаза
BI00185 1899147 1899917 - белок домена трансглутаминаза-подобного суперсемейства
BI00186 1900154 1902331 - домен семейства с неизвестной функцией (DUF404)
BI00187 1902473 1902586 - гипотетический белок
BI00188 1902727 1903515 + тРНК псевдоуридинсинтаза А
BI00189 1903603 1904142 - рибосомальный белок L17
BI00190 1904245 1905237 - РНК полимеразы L / субъединица 13-16 кДа
BI00191 1905321 1905716 - рибосомальный белок S11
BI00192 1905807 1906181 - рибосомальный белок S13p/S18e
BI00193 1906333 1906443 - рибосомальный белок L36
BI00194 1906470 1906685 - фактор инициации трансляции IF-1
BI00195 1906865 1907422 - аденилаткиназа
BI00196 1907595 1908722 - препротеин-транслоказа, субъединица SecY
BI00197 1909207 1909656 - рибосомальный белок L15
BI00198 1909662 1909844 - рибосомальный белок L30
BI00199 1909853 1910581 - рибосомальный белок S5
BI00200 1910581 1910991 - рибосомальный белок L18
BI00201 1910954 1911490 - рибосомальный белок L6
BI00202 1911511 1911906 - рибосомальный белок S8
BI00203 1911999 1912181 - рибосомальный белок S14p/S29e
BI00204 1912186 1912755 - рибосомальный белок L5 VC2584 [импортированный]
BI00205 1912755 1913087 - рибосомальный белок L24
BI00206 1913092 1913457 - рибосомальный белок L14
BI00207 1913555 1913812 - рибосомальный белок S17
BI00208 1913818 1914066 - рибосомальный белок L29
BI00209 1914069 1914485 - рибосомальный белок L16
BI00210 1914495 1915295 - рибосомальный белок S3
BI00211 1915301 1915657 - рибосомальный белок L22
BI00212 1915677 1915952 - рибосомальный белок S19
BI00213 1915971 1916798 - рибосомальный белок L2
BI00214 1916838 1917131 - рибосомальный белок L23
BI00215 1917140 1917793 - рибосомальный белок семейства L4/L1
BI00216 1917803 1918441 - рибосомальный белок L3
BI00217 1918461 1918766 - рибосомальный белок 810
BI00218 1919023 1920027 + мембранный белок, предположительно
BI00219 1920366 1923092 - неизвестно
BI00220 1923607 1924797 + возможный репрессор семейства Rok (NagC/XylR)
BI00221 1924797 1927334 + белок оперона гликогена GlgX
BI00222 1927431 1927919 - рибосомальный белок S9
BI00223 1927945 1928391 - рибосомальный белок L13
BI00224 1928792 1930954 - 4-альфа-глюканотрансфераза
BI00225 1931125 1931931 - гипотетический вариант лейцин-богатого повтора
BI00226 1931876 1932514 - консервативный гипотетический белок TIGR00257
BI00227 1932579 1933592 - возможно, 2-оксикислотадегидрогеназа
BI00228 1933669 1935009 - белок сарА, предположительно
BI00229 1935547 1936608 - COG0697:Пермеазы суперсемейства переносчика лекарственного средства/метаболита (DMT)
BI00230 1936648 1937991 + белок Р, индуцируемый повреждением ДНК
BI00231 1938024 1939256 - аминотрансфераза, предположительно
BI00232 1939374 1939691 - fdxC
BI00233 1939755 1941278 - возможный переносчик катионных аминокислот
BI00234 1941433 1942398 - УДФ-N-ацетиленолпирувоилглюкозамин-редуктаза
BI00235 1942930 1943094 - рибосомальный белок L33
BI00236 1943529 1944245 + возможно, цистатионин гамма-лиаза
BI00237 1944924 1945214 - шаперонин, 10 кДа
BI00238 1945390 1946604 - консервативный гипотетический белок
BI00239 1946895 1947557 - rimJ
BI00240 1947644 1948360 + 5-формилтетрагидрофолатциклолигаза-родственный белок
BI00241 1948527 1948709 + консервативный гипотетический белок
BI00242 1948950 1949516 + консервативный гипотетический белок
BI00243 1949617 1949814 - гипотетический белок Blon021580
BI00244 1949820 1953440 - консервативный гипотетический белок
BI00245 1953452 1954999 - консервативный гипотетический белок
BI00246 1955200 1955577 - рибосомальный белок L7/L12
BI00247 1955689 1956207 - рибосомальный белок L10
BI00248 1956479 1957222 - консервативный гипотетический белок
BI00249 1957561 1958952 + неизвестно
BI00250 1959385 1962123 - полирибонуклеотид нуклеотидилтрансфераза
BI00251 1962444 1962710 - рибосомальный белок S15
BI00252 1962882 1963562 - консервативный гипотетический белок
BI00253 1963721 1963951 - гипотетический белок
BI00254 1964091 1966964 - возможно, внеклеточная экзоксиланаза
BI00255 1967190 1969712 - эндо-1,4-бета-ксиланаза D
BI00256 1970329 1971432 + семейство 1S30, транспозаза [импортированный]
BI00257 1971591 1972274 - консервативный гипотетический белок
BI00334t 1972174 1972389 + консервативный гипотетический белок
BI00258 1972411 1973094 - гипотетический белок Blon021028
BI00259 1973553 1974914 - возможный белок клеточной поверхности
BI00260 1974994 1977351 - белок домена фактора фон Виллебранда тип А
BI00261 1978150 1978326 - гипотетический белок Blon021305
BI00262 1978353 1978820 - фосфопантетиен протеинтрансфераза
BI00263 1979459 1988974 - белок МаоС-подобного домена
BI00264 1989016 1990635 - пропионил-СоА карбоксилаза, бета-цепь
BI00265 1990631 1992514 - ассА3
BI00266 1993105 1993701 + белок bioY
BI00267 1993739 1994710 - биотин-ацетил-СоА-карбоксилаза лигаза
BI00268 1994853 1996895 + мембранный белок, предположительно
BI00269 1996904 1997731 + консервативный гипотетический белок
BI00270 1997829 1998524 - регулятор транскрипции, предположительно
BI00350t 1998629 1999459 - гипотетический регулятор транскрипции, семейство IcIR
BI00271 2011598 2011726 - гипотетический белок
BI00272 2011797 2012486 - рибосомальный белок L1
BI00273 2012505 2012933 - рибосомальный белок L11
BI00274 2013199 2014089 - фактор NusG терминации/антитерминации транскрипции
BI00275 2014122 2014346 - субъединица SecE препротеин-транслоказы
BI00276 2014593 2015795 - аспартатаминотрансфераза [импортированный]
BI00277 2015889 2016986 - глутамат-5-киназа
BI00278 2017023 2018711 - ГТФ-связывающий белок
BI00279 2018783 2019028 - рибосомальный белок L27
BI00280 2019054 2019359 - рибосомальный белок L21
BI00281 2019502 2022534 - гипотетическая рибонуклеаза, семейство Rne/Rng
BI00282 2022850 2024121 - сукцинил-диаминопимелатдесукцинилаза
BI00283 2024159 2025100 + переносчик, предположительно
BI00284 2025282 2026727 - пермеаза, белок предположительного домена
BI00285 2026727 2027818 - переносчик ABC, АТФ-связывающий белок
BI00286 2027996 2029441 - Maf-подобный белок
BI00287 2029581 2030690 - гомосеринкиназа
BI00288 2030800 2032113 - гомосериндегидрогеназа
BI00289 2032276 2033865 - диаминопимелатдекарбоксилаза
BI00290 2033871 2035541 - аргинил-тРНК синтетаза
BI00291 2035944 2036606 + возможный регулятор транскрипции TetR-типа
BI00292 2036606 2037880 + пермеаза, предположительно
BI00293 2037742 2038899 + регулятор транскрипции LysR семейства VC1588 [импортированный], предположительно
BI00294 2038996 2040246 + возможно, аминотрансфераза
BI00295 2040298 2041521 - УДФ-N-ацетилглюкозамин 1-карбоксивинилтрансфераза
BI00296 2041869 2043212 + NADH оксидаза
BI00297 2043424 2044548 - семейство белков дигидрооротат-дегидрогеназы, предположительно
BI00298 2044591 2046468 - семейство белков СААХ семейства аминоконцевой протеазы
BI00299 2046594 2047283 - 3-изопропилмалатдегидратаза, малая субъединица
BI00300 2047369 2048769 - 3-изопропилмалатдегидратаза, большая субъединица
BI00301 2049087 2049860 + регулятор транскрипции, семейство IcIR
BI00302 2050021 2051391 - семейство Ser/Thr протеинфосфатазы
BI00303 2051896 2054130 + полифосфаткиназа
BI00304 2054291 2055487 + mutTI
BI00305 2055480 2056298 + гипотетический белок Blon021115
BI00306 2056564 2057871 - консервативный гипотетический белок
BI00307 2057963 2058121 - гипотетический белок
BI00308 2058175 2058813 + урацилфосфорибозилтрансфераза
BI00309 2058864 2059340 + консервативный гипотетический белок TIGR00246
BI00310 2059542 2060648 - возможно, фосфодиэстераза
BI00311 2060677 2061747 - белок домена глутамил-тРНК синтетазы
BI00312 2061933 2064599 - АТФ-зависимая CIp протеаза, АТФ-связывающая субъединица CIpB
BI00313 2064821 2066371 - гистидин аммиак-лиаза
BI00314 2066617 2067489 + регулятор транскрипции, семейство IcIR, предположительно
BI00315 2067489 2067662 + консервативный гипотетический белок
BI00316 2067741 2068559 возможно, 2-гидроксигепта-2,4-диен-1,7-диоатизомераза семейства фумарилацетоацетатгидролазы
BI00317 2068665 2069873 - гипотетический мембранный белок с неизвестной функцией
BI00318 2070097 2071272 - УДФ-галактопираноза мутаза
BI00319 2071426 2072670 + dTDP-глюкоза 4,6-дегидратаза
BI00320 2072827 2074311 + консервативный гипотетический белок
BI00321 2074367 2075068 + консервативный гипотетический белок
BI00423t 2075382 2075687 + предположительно, транспозаза
BI00322 2075763 2076530 - IS1533, OrfB
BI00323 2076530 2077987 - транспозаза (25) ВН3998 [импортированный], предположительно
BI00324 2078280 2078996 - гликозилтрансфераза, предположительно
BI00325 2079313 2079666 - сиаловая кислота-специфическая 9-O-ацетилэстераза
BI00326 2080049 2081173 + гипотетическое семейство ацилтрансферазы
BI00327 2081181 2082893 - гипотетический мембранный белок с неизвестной функцией
BI00328 2082902 2085811 - гипотетическая гликозилтрансфераза семейство 8
BI00329 2085935 2087170 - белок гипотетического семейства гликозилтрансферазы, группа 2
BI00330 2087259 2088509 - полисахарид переносчик ABC, АТФ-связывающий белок
BI00331 2088515 2089351 - полисахарид переносчик ABC, белок пермеазы, предположительно
BI00332 2089580 2091367 + гипотетическая гликозилтрансфераза семейство 8
BI00333 2091457 2092698 - УДФ-глюкоза 6-дегидрогеназа
BI00334 2092974 2093636 + гипотетическое семейство NAD-зависимой эпимеразы/дегидратазы
BI00335 2093654 2094844 - мембранный белок, предположительно
BI00336 2094847 2097099 - консервативный гипотетический белок
BI00337 2097441 2098844 + гипотетический мембранный белок с неизвестной функцией
BI00338 2098844 2099962 + возможно, АТФ-связывающий белок переносчика ABC
BI00339 2100089 2100790 + белок домена HDIG
BI00340 2100871 2101728 - консервативный гипотетический белок
BI00341 2101825 2104335 - белок системы поглощения калия Kup [импортированный]
BI00342 2104481 2105188 - гидролаза, семейство TatD
BI00343 2105717 2106784 + белок семейства Fic
BI00344 2106816 2108621 - переносчик ABC, АТФ-связывающий/белок пермеазы
BI00345 2108635 2110542 - переносчик ABC, АТФ-связывающий/белок пермеазы
BI00346 2110935 2111099 - гипотетический белок
BI00347 2111297 2112703 - возможно, альфа-галактозидаза
BI00348 2113077 2114231 + регулятор транскрипции, семейство Lacl, предположительно
BI00349 2114409 2115356 - возможно, регулятор транскрипции AraC/XylS-типа
BI00350 2115401 2117626 - консервативный гипотетический белок
BI00351 2117851 2119374 + аминопептидаза С
BI00352 2119555 2120628 + консервативный гипотетический белок
BI00353 2121673 2123403 - метионил-тРНК синтетаза
BI00354 2123873 2124496 + консервативный гипотетический белок
BI00466t 2124496 2124864 + консервативный гипотетический белок
BI00355 2124897 2125922 - консервативный гипотетический белок TIGR00096
BI00356 2126487 2127902 - возможно, симпортер
BI00357 2127864 2129027 + консервативный гипотетический белок
BI00358 2129186 2131012 - переносчик ABC, АТФ-связывающий белок/
белок пермеазы
BI00359 2131231 2133099 - переносчик ABC, АТФ-связывающий белок/ белок пермеазы
BI00360 2133289 2133684 - регулятор транскрипции, семейство MarR, предположительно
BI00475t 2134267 2134506 + индуцируемый повреждением ДНК белок Escherichia coli
BI00361 2135008 2138841 - LPXTG-мотив белка якорного домена клеточной оболочки
BI00362 2139056 2139151 - гипотетический белок
BI00363 2139209 2143594 - секретируемый белок
BI00364 2143901 2145394 - АТФ-зависимая ДНК геликаза recG
BI00365 2145737 2147257 - пермеаза аминокислот
BI00366 2147448 2151185 - пермеаза, предположительно
BI00367 2151199 2151897 - переносчик ABC, АТФ-связывающий белок
BI00368 2152041 2152607 + возможно, TetR-подобный регулятор транскрипции
BI00369 2152832 2154310 + транспортный белок AroP ароматических аминокислот
BI00370 2154575 2155774 + предположительно, инвертаза/транспозаза
BI00371 2155961 2160952 - гипотетические гликозилгидролазы семейство 43
BI00372 2161359 2164649 - гипотетический
BI00373 2164997 2168173 - возможно, арабинозидаза
BI00374 2168529 2169131 - консервативный гипотетический белок
BI00375 2169340 2170179 - переносчик сахара ABC, белок пермеазы, предположительно
BI00376 2170182 2171033 - переносчик сахара ABC, белок пермеазы, предположительно
BI00377 2171416 2172429 + регулятор транскрипции, семейство Lad [импортированный], предположительно
BI00378 2172690 2174015 - возможный белок, связывающий растворенные вещества, переносчика ABC
BI00379 2174424 2175134 - белок семейства фосфоглицератмутазы
BI00380 2175226 2175600 + гипотетические COG0531: переносчики аминокислот
BI00381 2175612 2176550 + гипотетический белок семейства нитроредуктазы
BI00382 2176846 2179572 + фаговая инфекция, предположительно
BI00383 2179572 2181908 + белок фаговой инфекции, предположительно
BI00384 2188511 2189263 + регуляторный белок, семейство SIR2
BI00385 2189415 2190791 - треониндегидратаза
BI00386 2190928 2192745 - глюкан 1,6-альфа-глюкозидаза
BI00387 2192872 2194731 - гипотетическая раффинозасинтаза или белок набухания семян Sip1
BI00388 2194766 2196433 - белок семейства альфа-амилазы
BI00389 2196537 2197358 - гипотетический переносчик ABC белок пермеазы yurm. {bacillus
BI00390 2197364 2198383 - гипотетический компонент внутренней мембраны связывающий белок-зависимой транспортной системы
BI00391 2198408 2199730 - гипотетический бактериальный внеклеточный белок, связывающий растворенные вещества
BI00392 2199980 2201095 - гипотетический белок Efae022644
BI00393 2201159 2202484 - гипотетический бактериальный внеклеточный белок, связывающий растворенные вещества
BI00394 2202692 2203717 + регулятор транскрипции, семейство Lad [импортированный], предположительно
BI00395 2203838 2204854 + регулятор транскрипции, семейство Lad [импортированный], предположительно
BI00396 2204919 2205782 - переносчик сахара ABC, белок пермеазы
BI00397 2205804 2206730 - переносчик сахара ABC, белок пермеазы
BI00398 2206755 2208041 - переносчик сахара ABC, сахарсвязывающий
белок, предположительно
BI00399 2208215 2209420 + регулятор транскрипции ROK семейства VC2007 [импортированный], предположительно
BI00400 2209591 2211894 - альфа-галактозидаза
BI00401 2212017 2212445 - гипотетическая цитидин- и дезоксицитидилатдеаминаза цинксвязывающий участок
BI00402 2212589 2214658 + антипортер Na+/H+
BI00403 2214858 2215613 - серинэстераза, предположительно
BI00404 2215613 2215714 - гипотетический белок
BI00405 2215735 2216592 - консервативный гипотетический белок
BI00406 2216949 2217527 + дезоксицитидинтрифосфатдеаминаза
BI00407 2217593 2219320 + белок якорного семейства поверхности клеточной оболочки, предположительно
BI00408 2219543 2222527 - АТФаза кальция Е1-Е2-типа
BI00409 2222713 2223447 - белок, возможно, вовлеченный в деградацию ксилана, возможно, ксиланэстераза
BI00410 2223622 2225049 - гипотетический белок суперсемейства главного посредника
BI00411 2225005 2225994 + РНК метилтрансфераза, семейство TrmH, группа 3
BI00412 2226107 2227516 - консервативный гипотетический белок
BI00413 2227740 2228864 - АТФ-связывающий белок переносчика ABC для сахаров
BI00414 2229226 2230419 - белок домена гликозилтрансферазы
BI00415 2230486 2231475 - рибонуклеотидредуктаза, бета-субъединица
BI00416 2231704 2233896 - рибонуклеозид-дифосфатредуктаза, альфа-субъединица
BI00417 2234015 2234470 - белок nrdl
BI00418 2234470 2234733 - COG0695: Глутаредоксин и родственные
BI00419 2235324 2235767 - гипотетическая спираль-поворот-спираль
BI00420 2235958 2236635 - консервативный гипотетический белок
BI00421 2236828 2237592 + переносчик ионов
BI00422 2237788 2238891 + консервативный гипотетический белок
BI00423 2239035 2239349 - бета-глюкозидаза-родственная гликозидаза
BI00424 2239828 2241951 + высококонсервативный белок с доменом эукариотической протеинкиназы
BI00425 2242132 2243106 + консервативный гипотетический белок
BI00426 2243627 2245111 + консервативный гипотетический белок
BI00427 2245147 2246067 + диметиладенозинтрансфераза
BI00428 2246067 2247014 + киназа, семейство GHMP, группа 2
BI00429 2246860 2247690 + гипотетический белок BL0655
BI00430 2247781 2249193 - pcnA
BI00431 2249280 2250569 + белок домена NUDIX
BI00432 2250569 2252836 + белок якорного семейства поверхности клеточной оболочки, предположительно
BI00433 2252836 2254560 + консервативный гипотетический мембранный белок семейства MviN
BI00434 2254646 2256706 + консервативный гипотетический белок
BI00435 2256829 2257845 + тиоредоксинредуктаза
BI00436 2258158 2259516 - белок распределения хромосом ParB
BI00437 2259519 2260487 - белок семейства Soj
BI00438 2260741 2261403 - метилтрансфераза GidB
BI00439 2261558 2262088 - белок домена R3H
BI00440 2262215 2263219 - внутренний мембранный белок, 60 кДа VC0004 [импортированный]
BI00143g 2263219 2263533 - консервативный гипотетический белок TIGR00278
BI00576t 2263533 2264063 - компонент белка рибонуклеазы Р
BI00441 2263925 2264056 - рибосомальный белок L34
BI00442 1 1500 + белок хромосомального инициатора репликации DnaA
BI00443 2239 3360 + ДНК-полимераза III, бета-субъединица
BI00444 3442 4626 + белок recF
BI00445 4626 5093 + консервативный гипотетический белок
BI00446 5229 7364 + DNA гираза, субъединица В
BI00447 7534 10083 + DNA гираза, субъединица А
BI00448 10156 10719 + консервативный гипотетический белок
BI00449 11406 12116 + гипотетический белок
BI00450 12179 13699 + гипотетическая пектинэстераза
BI00451 14103 15446 - NADP-специфическая глутаматдегидрогеназа
BI00452 15768 16199 - регулятор транскрипции AsnC-типа
BI00453 16405 17736 + аспартатаминотрансфераза
BI00454 17757 18746 - гипотетический белок Blon021073
BI00455 19007 19600 + гипотетический белок BL0627
BI00456 19770 20462 + гипотетический белок Blon021075
BI00457 20579 20821 + Предположительно, регуляторный белок acrab оперона репрессора транскрипции
BI00599t 21403 21735 - IS1557, транспозаза, предположительно
BI00146g 21834 22397 - консервативный гипотетический белок
BI00458 22130 23497 - гипотетический COGI 167: Регуляторы транскрипции, содержащие ДНК-связывающий НТН домен и аминотрансферазный домен (семейство MocR) и их эукариотические ортологи
BI00459 24132 25454 + суперсемейство аминотрансферазы, класс III
BI00460 25495 26397 + Цинк-металлопротеаза
BI00461 26414 26509 - гипотетический белок
BI00462 26487 26849 + COG3265: Глюконаткиназа
BI00463 27114 28424 - консервативный гипотетический белок
BI00464 28662 29138 - белок семейства Dps, предположительно
BI00465 29238 30608 - белок домена CBS, предположительно
BI00466 30841 31521 - карбоангидразы прокариотического типа
BI00467 31727 32287 + алкил-гидрогенперксид редуктаза
BI00468 32458 34371 + тиоредоксинредуктаза
BI00469 34494 35963 - антипортер оксалагформиат
BI00470 35948 36094 + гипотетический белок
BI00471 36333 37328 + регулятор транскрипции Lacl-типа
BI00472 37558 40308 - фосфоенолпируват карбоксилаза
BI00473 40594 42471 + мембранный белок, предположительно
BI00474 42737 44344 + возможно, симпортер натрия/пролина
BI00475 44680 45663 - узкоконсервативный гипотетический белок
BI00476 45917 47533 + консервативный гипотетический белок
BI00477 47717 48805 - триптофанил-тРНК синтетаза
BI00478 49056 49325 + гипотетический белок
BI00479 49437 49967 - консервативный гипотетический белок
BI00480 49986 52505 + гликогенфосфорилаза
BI00481 52725 52940 - гипотетический белок BL0595
BI00482 53195 53887 + белок семейства Rhomboid
BI00483 54562 55029 - консервативный гипотетический белок
BI00484 55119 55907 + консервативный гипотетический белок
BI00485 55907 57142 + гипотетический трансмембранный белок с неизвестной функцией
BI00486 57196 57837 + pabA
BI00487 58067 60136 - серин/треонин-протеинкиназа
BI00488 60136 60942 - серин/треонин-протеинкиназа
BI00489 61083 62546 - pbpA
BI00490 62546 64204 - неизвестный, предположительно
BI00491 64204 65895 - возможно, фосфопротеинфосфатаза
BI00492 65903 66430 - белки, содержащие FHA-домен
BI00493 66463 67161 - белок домена FHA
BI00494 67349 69790 - дипептидилпептидаза IV, предположительно
BI00495 69951 70997 + лизофосфолипаза L2, предположительно
BI00496 71080 72228 + белок фактора фон Виллебранда домена типа А
BI00497 72231 72947 + консервативный гипотетический белок
BI00498 72947 73348 + гипотетический белок Blon021556
BI00654t 73348 73497 + гипотетический белок Blon021556
BI00499 73873 74724 + белок резистентности к теллуриту
BI00500 75108 75608 + белок теплового шока, семейство Hsp20
BI00501 75938 76891 + возможно, трансмембранный белок
BI00502 77065 77520 - консервативный гипотетический белок
BI00503 77753 79132 + COG0627: Предсказанная эстераза
BI00504 79132 81702 + COG2898: Неохарактеризованный BCR
BI00505 82241 83212 + пептидметионинсульфоксидредуктаза
BI00506 83218 83304 + гипотетический белок BL0567
BI00668t 83341 83496 + COG0463: Гликозилтрансферазы, вовлеченные в биогенез клеточной оболочки
BI00507 83506 86709 - геликаза-родственный белок
BI00509 86785 87195 - белок мутатора MutT, предположительно
BI00510 87337 88587 + гипотетический домен с неизвестной функцией
BI00511 88678 89139 + ацетилтрансфераза, семейство GNAT
BI00512 89226 90080 - гипотетический
BI00513 90187 90420 - гипотетический белок
BI00514 90480 90842 + консервативный гипотетический белок
BI00515 91329 92639 - квеуин тРНК-рибозилтрансфераза
BI00516 93056 95065 + белок теплового шока HtrA
BI00517 95480 97636 + катион-транспортирующая АТФаза, семейство Е1-Е2
BI00684t 97816 98862 + регулятор транскрипции, семейство Lad
BI00518 98874 99131 - гипотетическое семейство mttA/Hcfl06
BI00519 99136 100215 - Sec-независимая протеинтранслоказа TatC
BI00687t 100215 100730 - гипотетический белок диаргининовой транслокации, семейство TatA/E
BI00520 101182 103581 + гипотетическая сигнальная последовательность пути Tat
(диаргининовой транслокации)
BI00521 103674 106151 + гипотетический
BI00522 106547 107707 - консервативный гипотетический белок
BI00523 107911 109359 + ферредоксин/ферредоксин-NADP редуктаза, предположительно
BI00524 109452 110450 + белок теплового шока HtpX
BI00525 110667 111731 - фруктоза-бисфосфатальдолаза, класс II
BI00526 111947 113230 + аденилосукцинат синтетаза
BI00527 113524 114837 + хлоридный канал
BI00528 115027 116094 + семейство CrcB-подобного белка
BI00700t 116097 116489 + белок, сходный с СгсВ
BI00529 116581 116691 + гипотетический белок
BI00530 116767 117849 + сахарсвязывающий регулятор транскрипции, семейство Lad, предположительно
BI00531 118274 119842 + белок системы поглощения калия Kup [импортированный]
BI00532 120262 121806 + альфа-L-арабинофуранозидаза
BI00533 121981 123012 + регулятор транскрипции, семейство Lad [импортированный], предположительно
BI00534 123104 124012 - гликозилгидролаза, семейство 31
BI00535 124149 124370 - IS861, транспозаза OrfB
BI00711t 124604 125803 + возможно, интеграза/рекомбиназа
BI00712t 125878 126765 + возможно, интеграза/рекомбиназа
BI00536 126765 127817 + интеграза/рекомбиназа XerC, возможно, [импортированный], предположительно
BI00537 127910 128956 - транспозаза семейства IS3
BI00538 129291 130814 + сахароза фосфорилаза
BI00539 131035 132669 + гипотетический трансмембранный белок с неизвестной функцией
BI00540 132736 133776 + сахарсвязывающий регулятор транскрипции, семейство Lad, предположительно
BI00541 134407 135771 + переносчик семейства главного посредника
BI00542 135971 137020 + кетол-кислота редуктоизомераза
BI00543 137452 138501 + кетол-кислота редуктоизомераза
BI00544 138689 140500 - белок семейства альфа-амилазы
BI00545 140663 141694 - регулятор транскрипции, семейство Lacl [импортированный], предположительно
BI00546 142008 144242 - 4-альфа-глюканотранссрераза
BI00547 144506 144784 - гипотетический белок Blon021648
BI00548 144856 145482 + консервативный гипотетический белок
BI00549 145500 146507 - регулятор транскрипции, семейство Lacl [импортированный], предположительно
BI00550 146777 147490 + переносчик сахара ABC, белок пермеазы
BI00551 147605 150139 + гликозилгидролаза, семейство 31
BI00552 151125 153002 + белок dnaK
BI00553 153005 153658 + ко-шаперон GrpE
BI00554 153753 154769 + белок DnaJ [импортированный]
BI00555 154787 155371 + hspR
BI00556 155647 156996 + ксантинпермеаза, предположительно
BI00557 157036 158154 + возможно, ацилпротеинсинтаза/ацил-СоА редуктаза-подобный белок
BI00558 158144 159640 + возможно, ацил-СоА редуктаза
BI00559 159715 160497 + 3-оксоацил-ацил белок-носитель редуктаза
BI00560 160553 161281 + бета-фосфоглюкомутаза, предположительно
BI00561 161435 162157 + белок DedA
BI00749t 162383 163330 + консервативный гипотетический белок
BI00562 163340 164404 + trbB
BI00751t 164410 165060 + консервативный гипотетический белок
BI00752t 165060 165659 + гипотетический мембранный белок с неизвестной функцией
BI00563 165947 166231 + гипотетический белок BL0505
BI00754t 166240 166614 + консервативный гипотетический белок
BI00564 166715 167041 + консервативный гипотетический белок
BI00565 167093 168220 + белок BmrU, предположительно
BI00566 168424 169020 - возможно, регулятор транскрипции TetR-типа
BI00567 169297 172125 + ДНК-полимераза III, тау/гамма субъединица
BI00568 172154 172753 + рекомбинантный белок RecR
BI00569 172756 173886 - белок семейства сортазы
BI00570 174774 176054 + консервативный гипотетический белок
BI00571 176649 177179 + гипотетическое семейство аминокислота-киназа
BI00572 177262 177801 + аспартокиназа, альфа и бета-субъединицы
BI00573 177889 178980 - аспартат-семиальдегиддегидрогеназа
BI00574 179055 179765 + консервативный гипотетический белок
BI00575 179774 181351 - семейство Ser/Thr протеинфосфатазы
BI00576 182040 183953 + 2-изопропилмалатсинтаза
BI00577 184031 186493 - пенициллинсвязывающий белок, предположительно
BI00578 186772 187959 + возможно, пре-пилин-пептидаза
BI00579 188086 191169 + ДНК-топоизомераза I
BI00580 191549 192067 + тимидилаткиназа
BI00581 192067 193215 + ДНК-полимераза III, дельта-субъединица
BI00582 193337 193888 + консервативный гипотетический белок TIGR00481
BI00583 194034 195632 + неизвестный
BI00584 195767 197281 + формиат-тетрагидрофолат лигаза
BI00585 197684 198028 - консервативный гипотетический белок
BI00586 198149 198763 + узко консервативный гипотетический мембранный белок
BI00587 198817 200226 - гипотетический мембранный белок с неизвестной функцией
BI00588 200521 201177 + белок семейства фосфоглицератмутазы
BI00589 201278 202228 + консервативный гипотетический белок
BI00590 202352 203224 + трансгликолаза, эпимераза
BI00591 203348 204496 - прекурсор экстенсина (гидроксипролин-
богатый гликопротеин клеточной оболочки)
BI00790t 204684 204866 + гипотетический белок BL0470
BI00592 205053 206570 + глутамил-тРНК синтетаза
BI00593 207503 207988 + гипотетический белок Blon021299
BI00594 207946 208221 - гипотетический белок BL0466
BI00595 208388 214285 + семейство якорных белков поверхности клеточной оболочки, аутентичный сдвиг рамки
BI00596 214390 215208 - гипотетический
BI00597 216652 218460 + консервативный гипотетический интегральный мембранный белок
BI00598 218637 219317 + мембранный антиген, предположительно
BI00599 219470 220744 + интегральный мембранный белок
BI00600 220769 222070 + возможно, белок пермеазы системы переносчика ABC
BI00601 222107 223327 + возможно, белок пермеазы системы переносчика ABC
BI00602 223346 224140 + переносчик ABC, АТФ-связывающий белок
BI00603 224259 224819 + липопротеин, предположительно
BI00604 224831 225427 - регулятор транскрипции, семейство TetR, предположительно
BI00605 225545 227704 - белок фаговой инфекции, предположительно
BI00606 227704 230250 - белок фаговой инфекции, предположительно
BI00607 230686 231969 + мембранный белок, предположительно
BI00608 232037 233602 + 6-фосфоглюконатдегидрогеназа, декарбоксилирующая
BI00609 233756 234595 - 6-фосфоглюконолактоназа
BI00610 234825 235847 - белок oxppcycle OpcA
BI00611 235847 237499 - глюкоза-6-фосфат 1-дегидрогеназа
BI00612 237652 239337 + неизвестный
BI00613 239417 240448 - гликозилтрансфераза, вовлеченная в
биогенез клеточной оболочки
BI00614 240475 241311 - регулятор транскрипции, семейство TetR
BI00615 241407 242675 + частица распознавания сигнала-докинг-белок FtsY
BI00616 243046 244338 + переносчик аммиака
BI00617 244343 244678 + регуляторный белок азота P-II
BI00618 244832 246613 + белок-pII, уридилилтрансфераза,
BI00619 246653 248095 - индуцируемый повреждением ДНК белок F, предположительно
BI00620 248301 249827 + репликационная ДНК геликаза
BI00621 249830 251299 + УДФ-N-ацетилмурамилтрипептидсинтаза
BI00622 251405 252154 + синтаза кобировой кислоты
BI00623 252306 252590 + консервативный гипотетический белок
BI00624 252590 254407 + семейство ABCI
BI00625 254428 255447 - регулятор транскрипции, семейство Lad
BI00626 255933 257255 + белок, связывающий растворенные вещества, системы переносчика ABC
BI00627 257546 258469 + переносчик сахара ABC, белок пермеазы, предположительно
BI00628 258493 259308 + переносчик ABC, белок пермеазы, MaIFG семейство
BI00629 259473 261446 + консервативный гипотетический белок
BI00630 262147 267966 + гипотетический
BI00631 268074 271778 + семейство якорных белков поверхности клеточной оболочки, предположительно
BI00632 271911 272741 + консервативный гипотетический белок TIGR00044
BI00633 272825 273835 - prsA
BI00634 273960 274439 - гипотетические COG3210: Крупные экзобелки, вовлеченные в утилизацию гема или адгезию
BI00635 274604 274891 + рибосомальный белок S6
BI00636 274951 275604 + гипотетический одноцепочечный связующий белок
BI00637 275668 275913 + рибосомальный белок S18
BI00638 275936 276379 + рибосомальный белок L9
BI00639 276769 277026 + ptsH
BI00640 277029 278705 + фосфоенолпируват-белок фосфотрансфераза
BI00641 278942 279673 + белок-посредник поглощения глицерина
BI00642 279763 282468 - медь-транслоцирующая АТФаза Р-типа
BI00643 282580 282858 + белок семейства COG 1937
BI00644 283012 284325 + Неохарактеризованный BCR, семейство YigN, COG 1322 семейство
BI00645 284325 284951 + консервативный гипотетический белок
BI00646 285048 285893 + COG0566: рРНК метилазы
BI00647 285787 286359 + глутамил-тРНК(Gln) амидотрансфераза, субъединица С
BI00648 286366 287904 + глутамил-тРНК(Gln) амидотрансфераза, субъединица А
BI00649 287933 289429 + глутамил-тРНК(Gln) амидотрансфераза, субъединица В
BI00650 289728 290789 + возможно, ацетилтрансфераза
BI00651 290803 291114 + консервативный гипотетический белок
BI00652 291501 293141 + консервативный гипотетический белок
BI00653 293363 294973 + BarJ
BI00654 295245 297248 + фактор терминации транскрипции Rho
BI00655 297358 297501 + гипотетический белок
BI00656 297559 297945 + хоризматмутаза
BI00657 298070 300151 + семейство якорных белков поверхности клеточной оболочки, предположительно
BI00658 300383 303220 - валил-тРНК синтетаза, предположительно
BI00659 303262 304686 - переносчик ABC, периплазматический субстратсвязывающий белок, предположительно
BI00660 304850 305533 - эндонуклеаза III
BI00661 305595 306374 - регулятор транскрипции
BI00662 306556 307212 - мембранный белок, предположительно
BI00663 307369 307950 - интегральный мембранный белок в upf0059
BI00664 308187 308678 - неорганическая пирофосфатаза
BI00665 308908 311145 - белок семейства альфа-амилазы
BI00666 311386 313377 + консервативный гипотетический белок
BI00667 313988 315019 + гомосерин O-сукцинилтрансфераза
BI00668 315484 316293 + АТР синтаза FO, субъединица А
BI00669 316400 316624 + АТР синтаза FO, субъединица С
BI00670 316684 317199 + АТР синтаза FO, субъединица В
BI00671 317237 318070 + АТР синтаза FI, дельта-субъединица
BI00672 318149 319777 + АТР синтаза FI, альфа-субъединица
BI00673 319784 320704 + АТР синтаза FI, гамма-субъединица
BI00674 320716 322185 + АТР синтаза FI, бета-субъединица
BI00675 322188 322478 + АТР синтаза FI, эпсилон-субъединица, предположительно
BI00676 322539 323336 + предсказанная нуклеаза семейства RecB
BI00677 323388 324374 - возможно, секретируемый белок пептидил-пролил цис-транс изомеразы
BI00678 324455 325531 + консервативный гипотетический белок
BI00679 325534 326538 + консервативный гипотетический белок
BI00680 326790 327761 + тиоредоксин [импортированный], предположительно
BI00681 327850 328473 - аденилат циклаза
BI00682 329012 329398 + эндорибонуклеаза L-PSP, предположительно
BI00683 329536 330498 + белок домена ацилтрансферазы
BI00684 330595 331593 + глицерин-3-фосфат дегидрогеназа, NAD-зависимая
BI00685 331783 332967 + D-ala D-ala лигаза
BI00686 333223 334386 + переносчик ABC, периплазматический субстратсвязывающий белок
BI00687 334206 335348 + спермидин/путресцин переносчик ABC,
белок пермеазы, предположительно
BI00688 335348 336199 + спермидин/путресцин переносчик ABC, белок пермеазы, предположительно
BI00689 336207 337481 + спермидин/путресцин переносчик ABC, АТФ-связывающий белок
BI00690 337788 338828 + семейство белков семейства СААХ аминотерминальной протеазы
BI00691 338873 339667 - семейство механочувствительных ионных каналов
BI00692 339751 341181 - аспартат аммиак-лиаза
BI00693 341302 342030 - регулятор транскрипции, белок домена семейства TetR
BI00694 342124 343527 - консервативный гипотетический белок
BI00695 343852 344400 - метилированная-ДНК-протеин-цистеин метилтрансфераза
BI00696 345228 346055 + гипотетический белок с мотивом спираль-поворот-спираль
BI00697 345928 347202 - белок семейства MFS переносчиков, предположительно
BI00698 347393 348406 - рибокиназа [импортированный]
BI00939t 348735 349001 + рибосомальный белок L28
BI00699 349116 351944 + АТФ-зависимая ДНК геликаза RecG
BI00700 352204 352782 + метилтрансфераза, предположительно
BI00701 352812 353624 - тРНК (гуанин-N1)-метилтрансфераза
BI00702 353623 355341 + неизвестный
BI00703 355422 356399 + консервативный гипотетический белок
BI00704 356482 357354 + 4-дифосфоцитидил-2С-метил-D-эритрит синтаза, предположительно
BI00705 357367 358041 + пирролидон-карбоксилатпептидаза, предположительно
BI00706 358303 359766 + lgA-специфическая серин-эндопептидаза, предположительно
BI00707 359884 361224 + аминопептидаза С
BI00708 361519 362649 + фосфо-2-дегидро-3-дезоксигептонат альдолаза
BI00709 362781 364010 + фосфо-2-дегидро-3-дезоксигептонат альдолаза
BI00710 364141 364845 + MTA/SAH нуклеозидаза
BI00711 365444 366427 + гипотетическая АТФаза, гистидин киназа-, ДНК-гираза В- и белок HSP90-подобного домена
BI00712 366563 367330 + ДНК-связывающий регулятор ответа RegX3
BI00713 367583 368713 + АВС-переносчик фосфата, фосфатсвязывающий белок
BI00714 368927 369877 + pstC2
BI00715 369997 370875 + АВС-переносчик фосфата, белок пермеазы
BI00716 370931 371707 + phoT
BI00717 372005 372580 + белок lemA
BI00718 372647 374902 + консервативный гипотетический белок
BI00719 374971 375831 + оксидоредуктаза, семейство альдо/кето редуктаз
BI00720 375932 376981 + инозин-уридин-предпочитающая нуклеозидгидролаза
BI00721 377109 377729 - 16S рРНК процессирующий белок RimM
BI00722 377755 377985 - белок домена KH
BI00723 378009 378467 - рибосомальный белок S16
BI00724 378703 379809 - семейство эндонуклеазы/экзонуклеазы/ фосфатазы
BI00725 379889 381634 - белок частицы распознавания сигнала
BI00726 381843 382748 + суперсемейство белков семейства оттока катионов
BI00727 382773 384488 - цистеинил-тРНК синтетаза
BI00728 384518 385363 + возможно, амидотрансфераза
BI00729 385627 387687 + переносчик ABC, АТФ-связывающий белок
BI00730 387746 388162 - белок стабильности плазмиды StbB
BI00731 388175 388450 - гипотетический белок
BI00732 388609 389160 - ацетолактатсинтаза, малая субъединица
BI00733 389180 391144 - ацетолактатсинтаза, большая субъединица, биосинтетического типа
BI00734 391308 392033 - рибонуклеаза III
BI00735 392189 392380 - рибосомальный белок L32
BI00736 392472 393098 - Неохарактеризованный ACR, COG 1399
BI00737 393191 394078 - консервативный гипотетический белок
BI00738 394089 394586 - пантетеин-фосфатаденилилтрансфераза
BI00739 394860 395150 + консервативный гипотетический белок
BI00740 395198 396205 - K+ канал, бета-субъединица
BI00741 396379 396804 + регулятор транскрипции, семейство MerR NMB1303 [импортированный], предположительно
BI00742 396910 397533 - гипотетический трансмембранный белок с неизвестной функцией
BI00743 397764 399083 + никотинатфосфорибозилтрансфераза, предположительно
BI00744 399381 400142 + рибонуклеаза РН
BI00745 400189 400944 + семейство HamI
BI00746 401106 402659 + гипотетическое семейство FemAB
BI00747 402736 404043 + белок семейства FemAB, предположительно
BI00748 404096 405373 + фактор резистентности к бета-лактаму, предположительно
BI00749 405462 406460 - мембранный белок, предположительно
BI00750 407182 408879 + глюкоза-6-фосфат изомераза
BI00751 409515 409877 + рибосомальный белок L19
BI00752 410047 410901 + lepB
BI00753 411024 411860 + рибонуклеаза HII
BI00754 411990 413102 + регулятор транскрипции, семейство Lad [импортированный]
BI00755 413261 414904 + возможно, сахаркиназа
BI00756 414992 415681 + сахаризомераза
BI00757 416114 417430 + L-арабиноза изомераза
BI00758 417620 418240 - глутаминамидотрансфераза/дипептидаза trp-G типа
BI00759 418178 420178 + мембранный белок, предположительно
BI00760 420330 421694 + пермеаза, предположительно
BI00761 421694 422914 + трансмембранный белок Vexpl, предположительно
BI00762 422930 423562 + Vexp2
BI00763 423886 425706 - длинноцепочечная жирная кислота-СоА лигаза, предположительно
BI00764 425820 426098 + фрагмент арабиноза-пермеазы
BI00765 426765 429890 + гипотетический переносчик ABC
BI00766 430170 430436 - переносчик СС0814 семейства главного посредника [импортированный], предположительно
BI00767 431272 432618 + белок, связывающий растворенные вещества, системы переносчика ABC
BI00768 432750 433799 + переносчик сахара ABC, белок пермеазы, предположительно
BI00769 433820 434809 + неизвестный
BI00770 435125 437128 + бета-D-галактозидаза, предположительно
BI00771 437175 438227 + регулятор транскрипции, семейство Lad [импортированный], предположительно
BI00772 438426 441116 + арабиногалактан эндо-1,4-бета-галактозидаза, предположительно
BI00773 441755 442621 + оксид оредуктаза, семейство альдо/кето редуктаз
BI00774 442628 443368 + консервативный гипотетический белок
BI00775 443378 444745 - консервативный гипотетический белок
BI00776 445003 446367 + транспортный белок, семейство NRAMP
BI00777 446472 448073 - переносчик резистентности к лекарственным препаратам, подсемейство EmrB/QacA
BI00778 448424 450007 + гликозилтрансфераза CpsE
BI00779 450302 452029 + COG0840: Метил-акцептирующий белок хемотаксиса
BI00780 452064 453566 + возможно, Etk-подобная тирозинкиназа, вовлеченная в биосинтез Eps
BI00781 453760 454725 + белок семейства гипотетической гликозилтрансферазы, группа 1
BI00782 454725 456065 + предположительно, белок гликозилтрансферазы
BI00783 456065 457126 + белок семейства NAD зависимой эпимеразы/дегидратазы
BI00784 457201 458448 + УДФ-глюкоза 6-дегидрогеназа
BI00785 458489 459550 + гипотетический белок семейства гликозилтрансферазы, группа 1
BI00786 459581 460408 + гипотетический EpsI II
BI00787 460446 460952 + гипотетический гексапептид бактериальной трансферазы (три повтора)
BI00788 460985 461998 + гипотетический белок синтеза капсульного полисахарида
BI00789 462020 463360 + гипотетический белок
BI00790 463363 464292 + Eps9K
BI00791 464362 465753 + гипотетический белок биосинтеза полисахарида
BI00792 465789 466280 + гипотетический гексапептид бактериальной трансферазы (три повтора)
BI00793 466366 467514 - белок семейства NAD-зависимой эпимеразы/дегидратазы, предположительно
BI00794 467785 468363 - транспозаза, вырожденная
BI00795 468615 468770 - гипотетические COG2963: Транспозаза и инактивированные производные
BI00796 469189 470208 + dTDP-глюкоза 4,6-дегидратаза
BI00797 470347 471303 + dTDP-4-дегидрорамноза 3,5-эпимераза
BI00798 471349 472245 + глюкоза-1-фосфат тимидилилтрансфераза
BI00799 472858 473046 - гипотетический белок
BI00800 473371 473802 - консервативный гипотетический белок
BI00801 474083 474640 - гипотетическая низкомолекулярная фосфотирозин протеинфосфатаза
BI00802 474825 475331 - гипотетический белок
BI00803 475655 475867 - гипотетическая спираль-поворот-спираль
BI00804 475860 476042 - гипотетический белок
BI00805 475971 476312 + гипотетический белок
BI00806 476415 477422 - консервативный гипотетический белок
BI00807 477471 478751 + узко консервативный гипотетический белок
BI00808 477495 477866 - тиоредоксин
BI00809 478880 479734 + 3-оксоадипат енол-лактоназа, предположительно
BI00810 479747 481036 + белок семейства MutT/nudix
BI00811 481065 481475 + белок Н системы отщепления глицина
BI00812 481547 482875 + консервативный гипотетический белок
BI00813 482973 485453 + протеаза II
BI00814 485521 486549 + 3-изопропилмалатдегидрогеназа
BI00815 486610 487692 + липоат-протеинлигаза
BI00817 487934 488650 + возможно, регулятор транскрипции с циклическим нуклеотидсвязывающим доменом
BI00818 488757 491069 + ponA, предположительно
BI00819 491264 492634 + NADH-зависимая флавиноксидоредуктаза, предположительно
BI00820 492807 493955 - дигидрооротат-дегидрогеназа, предположительно
BI00821 494409 495122 + глицерин-3-фосфат регулон репрессор
BI00822 495118 496365 + галактоза-1-фосфат уридилилтрансфераза
BI00823 496241 497632 + галактокиназа
BI00824 497718 497987 + белок домена ACT
BI00825 498201 499487 + схожий с неизвестными белками
BI00826 499800 500516 - spoU
BI00827 500612 501463 + mutY
BI00828 501531 502250 + консервативный гипотетический белок
BI00829 502633 505968 + ДНК-направленная РНК полимераза, бета-субъединица
BI00830 506139 510173 + ДНК-направленная РНК полимераза, бета-prime субъединица
BI00831 510338 510967 - белок домена FHA
BI00832 510986 511498 - гипотетический белок Blon020438
BI00833 511528 512457 - возможно, фосфопротеинфосфатаза
BI00834 512457 514967 - мембранный белок, предположительно
BI00835 514967 516187 - белок семейства с неизвестной функцией
BI00836 516215 517585 - moxR2
BI00837 517599 523580 - семейство якорных белков поверхности клеточной оболочки, предположительно
BI00838 523750 525168 - серин/треонин протеинкиназа, предположительно
BI00839 525300 529592 + гипотетические COG0210: Суперсемейство I ДНК и РНК геликаз
BI00840 529427 533620 + белок домена геликазы UvrD/REP
BI00841 533962 535152 + возможно, транспортный белок
BI00842 535527 536243 + дигидродипиколинат редуктаза
BI00843 536388 537311 + дигидродипиколинат синтаза
BI00844 537585 539246 + белок суперсемейства металло-бета-лактамазы
BI00845 539291 541897 + белок домена семейства пептидазы М1
BI00846 542078 542971 + гипотетический трансмембранный белок с неизвестной функцией
BI00847 543164 543502 + консервативный гипотетический белок
BI00848 543954 545336 + фосфоглюкозамин мутаза
BI00849 545362 546012 + полипептид деформилаза
BI00850 546072 547472 + консервативный гипотетический белок
BI00851 547492 547620 + гипотетический белок
BI00852 547858 548979 + фактор 2 высвобождения пептидной цепи
BI00853 548991 550121 + ftsE
BI00854 550135 551055 + переносчик ABC клеточного деления, белок пермеазы FtsX, предположительно
BI00855 551161 552519 + аутолизин, предположительно
BI00856 552673 553146 + SsrA-связывающий белок
BI00857 553192 554265 + переносчик аминокислот ABC, белок пермеазы
BI00858 554479 555420 + переносчик аминокислот ABC, белок пермеазы
BI00859 555554 556546 + переносчик аминокислот ABC, белок пермеазы
BI00860 556566 557393 + переносчик глутамина ABC, АТФ-связывающий белок
BI00861 557604 559493 + глюкозамин-фруктоза-6-фосфат аминотрансфераза, изомеризующая
BI00862 559699 560271 + COG0564: Псевдоуридилатсинтазы, 23S РНК-специфические
BI00863 560313 560525 - гипотетический белок Blon020898
BI00864 560565 561548 - регулятор транскрипции, семейство Lad, предположительно
BI00865 561794 562717 + переносчик сахара ABC, белок пермеазы, предположительно
BI00866 562776 563780 + неизвестный
BI00867 563975 566047 + бета-D-галактозидаза
BI00868 566259 567185 + регулятор транскрипции, семейство Lad, предположительно
BI00869 567311 569008 - альфа-L-арабинофуранозидаза
BI00870 569168 570517 + белок, связывающий растворенные вещества, системы переносчика ABC
BI00871 570852 572192 + возможно, белок, связывающий растворенные вещества, системы переносчика ABC для сахаров
BI00872 572449 573729 + сахарсвязывающий белок Sbp
BI00873 573795 574562 - активатор транскрипции, возможно, семейство Baf [импортированный]
BI00874 574688 576304 + переносчик ABC, периплазматический субстратсвязывающий белок, предположительно
BI00875 576372 577346 + мембранный белок, предположительно
BI00876 577346 578245 + переносчик пептидов ABC, белок пермеазы, предположительно
BI00877 578245 579033 + переносчик ABC, нуклеотидсвязывающий/АТФазы белок
BI00878 579029 579811 + переносчик ABC, АТФ-связывающий белок
BI00879 580296 581360 + цистатионин бета-синтаза
BI00880 581455 582636 + цистатионин бета-лиаза
BI00881 582780 584501 - семейство ErfK/YbiS/YcfS/YnhG
BI00882 584781 586613 + АТФ-зависимая ДНК геликаза RecQ
BI00883 586729 587220 + белок продуцирования аутоиндуктора-2 LuxS
BI00884 587453 587917 + ацетилтрансфераза, семейство GNAT, предположительно
BI00885 588181 589638 - гипотетический белок Blon020876
BI00886 589890 591347 - аминокислота-пермеаза
BI00887 591542 592891 + аланин рацемаза
BI00888 593087 594370 + дезоксигуанозинтрифосфат трифосфогидролаза, предположительно
BI00889 594546 596642 + ДНК-примаза, предположительно
BI00890 596961 597710 + белок биосинтеза пиридоксина
BI00891 597799 598434 + суперсемейство семейство SNO глутамин амидотрансферазы
BI00892 598495 600156 + аминотрансфераза, класс I, предположительно
BI00893 600514 601443 + белок семейства аспарагиназы
BI00894 601476 601607 + гипотетический белок Blon020867
BI00895 601574 601897 - гипотетический белок
BI00896 601995 603179 + возможно, транспортный белок
BI00897 603210 603467 - гипотетический белок Blon020865
BI00898 603634 603723 + гипотетический белок
BI00899 603651 605795 - схожий с альфа-L-арабинофуранозидазой А
BI00900 605923 606921 + EF0065, предположительно
BI00901 607014 608087 - консервативный гипотетический белок
BI00902 608687 609373 + переносчик ABC, АТФ-связывающий белок
BI00903 609373 610545 + консервативный гипотетический белок
BI00904 610560 612116 + переносчик ABC, АТФ-связывающий белок
BI00905 612106 614304 - 1 -дезоксиксилулоза-5-фосфат синтаза
BI00906 614478 615467 + оксидоредуктаза, цинксвязывающая, предположительно
BI00907 615572 616069 + фосфорибозиламиноимидазол карбоксилаза, каталитическая субъединица
BI00908 616095 617231 + фосфорибозиламиноимидазол карбоксилаза, субъединица АТФазы
BI00909 617243 617668 + furB
BI00910 617709 617954 - консервативный гипотетический белок
BI00911 618183 619103 + возможно, белок, связывающий растворенные вещества, системы переносчика ABC
BI00912 619367 621439 + мембранный белок, предположительно
BI00913 621563 623197 + альдегид дегидрогеназа
BI00914 623577 624842 - фосфорибозиламин-глицин лигаза
BI00915 624872 625702 - фосфорибозилформилглицинамидин цикло-лигаза
BI00916 626029 627537 - амидофосфорибозилтрансфераза
BI00917 627944 628726 - переносчик глутамина ABC, АТФ-связывающий белок
BI00918 628726 629610 - переносчик аминокислот ABC, белок пермеазы
BI00919 629723 630583 - переносчик аминокислот ABC, периплазматический
аминокислотасвязывающий белок
BI00920 630788 631255 - консервативный гипотетический белок
BI00921 631328 632698 - белок семейства Atz/Trz, предположительно
BI00922 632741 634240 - 8-аденозил-L-гомоцистеин гидролаза, NAD связывающий домен
BI00923 634405 635991 + структурный ген резистентности к ультрафиолету
BI00924 635991 636206 + гипотетический белок Blon020836
BI00925 636246 637220 - K+ канал, бета-субъединица
BI00926 637331 638293 - регулятор транскрипции, семейство НТН 1, предположительно
BI00927 638512 640023 + антипортер Na+/H+, предположительно
BI00928 640043 640699 - мембранный белок, предположительно
BI00929 640699 642066 - консервативный гипотетический белок
BI00930 642042 643337 - возможно, карбоксилэстераза или липаза
BI00931 643478 647209 - фосфорибозилформилглицинамидин синтаза
BI00932 647275 648024 - фосфорибозиламиноимидазол-сукцинокарбоксамид синтаза
BI00933 648113 648232 - гипотетический белок
BI00934 648420 649754 - фосфорибозилглицинамид формилтрансфераза 2 VC1228 [импортированный]
BI00935 649928 651085 + белок J биосинтеза капсульного полисахарида типа 1 (capJ)
BI00936 651238 652260 - консервативный гипотетический белок
BI00937 652822 653880 + переносчик
BI00938 654695 654967 + рибосомальный белок S12
BI00939 654976 655443 + рибосомальный белок S7
BI00940 655478 657598 + фактор элонгации трансляции G
BI00941 657774 658970 + фактор элонгации трансляции Tu
BI00942 659184 659909 + консервативный гипотетический белок
BI00943 660169 660864 + регулятор транскрипции, семейство LysR, предположительно
BI00944 661085 662098 + мембранный белок, предположительно
BI00945 662161 662637 - COG2246: Предсказанный мембранный белок
BI00946 662721 663083 - белок CrcB
BI00947 663086 663619 - белок, сходный с CrcB
BI00948 663706 663987 + гипотетический белок
BI00949 664023 665063 + алкогольдегидрогеназа, цинк-содержащая
BI00950 665437 665625 + гипотетический белок
BI00951 665652 667028 - консервативный гипотетический белок
BI00952 667295 667462 - возможно, регулятор транскрипции MarR-типа
BI00953 667902 670487 + эксинуклеаза ABC, субъединица А
BI00954 670548 671903 + белок семейства оттока MATE, предположительно
BI00955 671914 672603 + эндонуклеаза III, предположительно
BI00956 672783 673076 - гипотетический белок Blon020400
BI00957 673098 673766 + Неизвестный
BI00958 673782 674042 - ацетилтрансфераза, содержащая гексапептидный повтор
BI00959 674207 675292 + возможно, интегральный мембранный белок пермеазы
BI00960 675273 675902 + гипотетические гликозилгидролазы семейство 2, TIM бочкообразный домен
BI00961 676090 677316 - глутаминсинтетаза, тип I
BI00962 677846 678625 - узко консервативный гипотетический трансмембранный белок
BI00963 678712 680199 - дигидролипоамид дегидрогеназа
BI00964 680351 680971 - консервативный гипотетический белок
BI00965 681063 682427 + широко консервативный белок в семействе пептидазы или деацетилазы
BI00966 682730 683326 + консервативный гипотетический белок
BI00967 683329 684801 + переносчик ABC, АТФ-связывающий белок, предположительно
BI00968 684801 685625 + возможно, белок пермеазы переносчика ABC для кобальта
BI00969 685824 686699 + белок семейства spoU pPHK метилазы [импортированный]
BI00970 686891 687820 + фенилаланил-тРНК синтетаза, альфа-субъединица
BI00971 687831 690437 + фенилаланил-тРНК синтетаза, бета-субъединица
BI00972 690471 691154 + консервативный гипотетический белок
BI00973 691385 692347 + N-ацетил-гамма-глутамил-фосфат редуктаза
BI00974 692434 693519 + бифункциональный белок биосинтеза аргинина ArgJ
BI00013g 693503 693979 - гипотетический белок Magn025872
BI00975 693809 694612 + ацетилглутамат киназа
BI00976 694605 695897 + ацетилорнитин аминотрансфераза
BI00977 695944 696906 + орнитин карбамоилтрансфераза
BI00978 696906 697415 + репрессор аргинина
BI00979 697501 698736 + аргининосукцинат синтаза
BI00980 699184 700653 + аргининосукцинат лиаза
BI01326t 701005 701196 + белок биосинтеза тиамина ThiS
BI00981 701211 702077 + белок thiG
BI00982 702157 702963 + moeB
BI00983 703023 703376 + белок роданеза-подобного домена
BI00984 703541 704071 + белок домена HD
BI00985 703978 704835 + гипотетический
BI00986 704964 706283 + тирозил-тРНК синтетаза
BI00987 706314 708086 + гипотетический белок BL1050
BI00988 708098 709135 + предсказанные сахар фосфатазы суперсемейства HAD
BI00989 709395 710165 + гемолизин А
BI00990 710153 710719 - консервативный гипотетический белок
BI00991 710729 710881 + гипотетический белок
BI00992 710965 711624 - схожий с бактериальной системой поглощения K(+)
BI00993 711678 713141 - белок домена белка катионного транспорта
BI00994 713388 714407 + поли(Р)/АТР-NAD киназа
BI00995 714410 716233 + белок репарации ДНК RecN
BI00996 716266 716910 + гидролаза, дегалогеназа галоидных кислот-подобное семейство, предположительно
BI00997 717154 717525 + регулятор транскрипции, семейство GntR
BI00998 717550 718467 + переносчик ABC, АТФ-связывающий белок
BI01351t 718477 719091 + мембранный белок, предположительно
BI00999 719985 722768 - кальций-транслоцирующая Р-типа АТФаза, РМСА-типа
BI01000 722966 723238 + гипотетический белок BL1037
BI01001 723291 724778 - треонин-синтаза
BI01356t 725001 725699 + серин-гидроксиметилтрансфераза
BI01002 726028 727116 + гамма-глутамил фосфатредуктаза
BI01003 727134 727694 + консервативный гипотетический белок
BI01004 727694 728476 + никотинат (никотинамид) нуклеотид-аденилилтрансфераза
BI01005 728580 729857 - гликозил-гидролаза, семейство 3, предположительно
BI01006 729952 733203 + неохарактеризованный ACR
BI01007 733340 733834 + фосфинотрицин-ацетилтрансфераза
BI01008 734033 734629 + пептидил-тРНК гидролаза
BI01009 734622 738203 + фактор сопряжения транскрипции-репарации
BI01010 738346 739290 + оксидоредуктаза, предположительно
BI01011 739444 740739 + енолаза
BI01012 740809 741423 + гипотетический инициатор формирования перегородки
BI01013 741423 741986 + консервативный гипотетический белок
BI01014 742052 743050 + возможно, экзополифосфатаза-подобный
BI01015 743578 744711 + семейство IS30, транспозаза [импортированный]
BI01016 744846 747062 + L-серин дегидратаза 1
BI01018 747207 747611 + пептидил-пролил цис-транс изомераза, FKBP-типа
BI01019 747713 748189 + фактор удлинения транскрипции GreA
BI01020 748250 749191 - гемолизин, предположительно
BI01021 749361 750086 + консервативный гипотетический белок
BI01022 750474 751736 + гистидинкиназа-подобный белок
BI01023 751815 752090 - гипотетический фактор транскрипции WhiB
BI01024 752207 753922 - диарейный токсин
BI01025 754203 755633 - регулятор транскрипции
BI01389t 755884 756180 + whiB1
BI01026 756350 759319 + мембранный белок, предположительно
BI01027 759319 760857 + LPXTG-мотив белка якорного домена клеточной оболочки, предположительно
BI01028 760966 761391 - консервативный гипотетический белок
BI01029 761660 762283 + консервативный гипотетический белок
BI01030 762332 763015 + белок домена фосфорибозилтрансферазы
BI00019g 762937 763509 - гипотетическая семейства пептидаза S24
BI01031 763391 764464 - сенсорный бокс гистидинкиназы, предположительно
BI01032 764464 765183 - ДНК-связывающий регулятор ответа MtrA
BI01033 765222 767432 - 1,4-альфа-глюкан ветвящий фермент
BI01034 767649 768239 + возможно, регулятор транскрипции
BI01035 768351 768872 + 2С-метил-D-эритрит2,4-циклодифосфат синтаза
BI01036 768930 769760 - переносчик цинкаАВС, белок пермеазы, предположительно
BI01037 769830 770834 - переносчик ABC, АТФ-связывающий белок
BI01038 770893 772419 - возможно, белок, связывающий растворенные вещества, системы
переносчика ABC
BI01039 772190 773062 + метилентетрагидрофолатдегидрогеназа/ метенилтетрагидрофолат циклогидролаза
BI01040 773185 774657 + рибосомальный белок S1 [импортированный]
BI01041 774834 775448 + дефосфо-СоА киназа
BI01042 775463 777571 + эксинуклеаза ABC, субъединица В
BI01043 777887 778726 + белок семейства TerC [импортированный]
BI01044 778897 780336 + пируваткиназа
BI01045 780490 781086 - возможно, NTP пирофосфатаза семейства MutT
BI01046 781432 782214 + регулятор ответа
BI01047 782278 785127 + ДНК-полимераза I
BI01048 785291 786217 + консервативный гипотетический белок TIGR00486
BI01049 786266 786937 + белок семейства MutT/nudix, предположительно
BI01050 787135 789132 + белок гликогенового оперона GlgX
BI01424t 789186 789413 + гипотетический белок с мотивом спираль-поворот-спираль
BI01051 789420 790067 + консервативный гипотетический белок
BI01052 790243 790794 - DNA-3-метиладенин гликозилаза I
BI01053 791884 792942 - гипотетический белок
BI01054 793226 793780 + гипотетический белок
BI01055 793761 794246 - гипотетический белок
BI00021g 794049 794498 + транспозаза В
BI00020g 794300 794749 + IS1601-D
BI01056 794665 794844 + транспозаза субъединица В
BI01057 794937 795989 - интеграза/рекомбиназа XerC, возможно, [импортированный], предположительно
BI01434t 795989 796876 - возможно, интеграза/рекомбиназа
BI01058 796951 798150 - возможно, интеграза/рекомбиназа
BI01059 798284 799564 - IS3-Spnl, транспозаза
BI01060 799635 800477 - предположительно, субъединица транспозазы
BI01061 800762 802579 - гипотетический белок с неизвестной функцией DUF262
BI01062 802742 803464 - гипотетический белок
BI01063 803748 804065 - консервативный гипотетический белок
BI01064 804058 804405 - гипотетический белок
BI01065 804667 808221 + ДНК-полимераза III, альфа-цепь VC2245 [импортированный]
BI01066 808312 808743 + консервативный гипотетический белок
BI01067 808952 810826 + антиген, 67 кДа
BI01068 810916 811413 + NH2-ацетилтрансфераза
BI01069 817553 818377 - оксидоредуктаза, семейство альдо/кето редуктаз
BI01070 818538 819956 + сахаркиназа, семейство FGGY, предположительно
BI01451t 819972 820262 + Ацилфосфатаза
BI01071 820382 821761 + гистидинол дегидрогеназа
BI01072 821761 822918 + гистидинол-фосфатаминотрансфераза
BI01073 823007 823603 + имидазолглицерин-фосфатдегидратаза
BI01074 823606 824397 + гипотетический белок Blon020586
BI01075 824435 825079 + имидазол глицеринфосфат синтаза, субъединица глутамин амидотрансферазы
BI01076 825152 825874 + бифункциональный белок HisA/TrpF
BI01077 825984 826103 - узко консервативный гипотетический белок
BI01463t 826039 827637 - консервативный гипотетический белок
BI01078 827738 828898 + Глутаминсинтетаза, каталитический домен
BI01079 829137 829604 + переносчик, предположительно
BI01080 829657 830625 - консервативный гипотетический белок
BI01081 830625 834758 - АТФ-зависимая геликаза HrpA
BI01082 834751 835404 - консервативный гипотетический белок
BI01083 835647 837065 + ГТФ-связывающий белок
BI01084 837405 838208 + L-лактатдегидрогеназа
BI01085 838356 839291 - белок системы оттока катионов
BI01086 839460 840182 - pen рессор LexA
BI01087 840333 840680 + белок домена LysM
BI01088 840736 841173 + консервативный гипотетический белок TIGR00244
BI01089 841314 842510 - D-3-фосфоглицератдегидрогеназа
BI01090 842524 844800 - COG3973:Суперсемейство I ДНК и РНК геликаз
BI01091 845133 845651 + консервативный гипотетический белок TIGR00242
BI01092 845654 846730 + S-аденозил-метилтрансфераза MraW
BI01093 846740 847186 + гипотетический белок Blon020568
BI01094 847186 848985 + пенициллинсвязывающий белок, предположительно
BI01095 849015 849884 + консервативный гипотетический белок
BI01096 849936 851384 + УДФ-N-ацетилмурамоилаланил-D-глутамил-2,6-диаминопимелат-D-аланил-D-аланил лигаза
BI01097 851453 852535 + фосфо-N-ацетилмурамоил-пентапептид-трансфераза
BI01098 852593 854035 + УДФ-N-ацетилмурамоилаланин-D-глутамат лигаза
BI01099 854025 855239 + белок клеточного деления, семейство FtsW/RodA/SpoVE, предположительно
BI01100 855258 856436 + УДФ-N-ацетилглюкозамин-N-ацетил-мурамил(пентапептид) пирофосфорил-ундекапренол N-ацетилглюкозамин трансфераза
BI01101 856651 858075 + УДФ-N-ацетилмурамат-аланин лигаза
BI01102 858078 859139 + гипотетический белок клеточного деления FtsQ
BI01103 859565 860983 + гипотетическое семейство процессингового фермента Appr-1-p
BI01104 861241 861813 + неизвестный
BI01105 861640 861885 - гипотетический белок
BI01106 861906 862391 + D-тирозил-тРНК(Tyr) деацилаза
BI01107 862494 863735 - переносчик глюкозы/галактозы, предположительно
BI01108 863844 864230 - гипотетический белок семейства глиоксалазы
BI01109 864308 865201 - фруктокиназа, предположительно
BI01110 865277 866488 - регулятор транскрипции ROK семейства VC2007 [импортированный], предположительно
BI01111 866715 867626 + глюкокиназа, предположительно
BI01112 867792 868913 - регулятор транскрипции NagC/XylR-типа
BI01113 869251 870060 + глюкозамин-6-фосфат изомераза
BI01114 870119 871393 + N-ацетилглюкозамин-6-фосфат деацетилаза
BI01115 871646 873307 + переносчик дипептидов ABC, дипептидсвязывающий белок
BI01116 873480 874568 + переносчик олигопептидов ABC, белок пермеазы
BI01117 874714 875739 + переносчик дипептидов ABC, белок пермеазы
BI01118 875746 877452 + АТФ-связывающий белок переносчика ABC
BI01119 877508 878026 - белок семейства MutT/nudix
BI01120 878078 879670 - Хаа-Pro аминопептидаза I
BI01121 879977 880954 - консервативный гипотетический белок
BI01122 882044 883672 + folC
BI01123 883736 887410 + семейство SMC, семейство С-терминального домена
BI01124 887535 888527 - консервативный гипотетический белок
BI01125 888652 890202 - УДФ-N-ацетилмурамоилаланил-D-глутамат-2,6-диаминопимелат лигаза
BI01126 890377 891126 + фактор сигма-70 РНК полимеразы,
подсемейство ECF
BI01127 891129 891446 + консервативный гипотетический белок
BI01128 891719 892660 - суперсемейство альдоза 1-эпимеразы
BI01129 892788 893741 - суперсемейство альдоза 1-эпимеразы
BI01130 894032 895021 + гидроксиметилбутенил пирофосфат редуктаза
BI01131 895067 895573 - регулятор транскрипции, предположительно
BI01132 895670 896725 - глицеральдегид-3-фосфатдегидрогеназа, тип I
BI01133 896968 897690 - Тиамин пирофосфокиназа, семейство каталитического домена
BI01134 897586 898923 + гипотетическая спермин/спермидин синтаза
BI01135 899364 899930 + фактор инициации трансляции IF-3, С-терминальный домен
BI00041g 899764 900105 + рибосомальный белок L35
BI01136 900161 900541 + рибосомальный белок L20
BI01137 900605 901537 + Интеграза
BI01138 901668 904511 + переносчик ABC, АТФ-связывающий белок
BI01139 904656 905612 + белок семейства Soj
BI01140 905634 906545 + Неохарактеризованный ACR, COG 1354
BI01141 906675 907274 + консервативный гипотетический белок TIGR00281
BI01142 907409 908233 + белок семейства MutT/nudix
BI01143 908296 909573 + комплекс хинолинатсинтетазы, А субъединица
BI01144 909668 911296 + L-аспартатоксидаза
BI01145 911303 912193 + никотинат-нуклеотид пирофосфорилаза
BI01146 912292 913443 + возможно, пиридоксаль-фосфат-зависимая аминотрансфераза
BI01147 913478 914824 + переносчик семейства главного посредника
BI01148 915142 917070 + ГТФ-связывающий белок ТурА
BI01149 917197 917616 + консервативный гипотетический белок
BI01150 917699 918673 + префенат дегидратаза, предположительно
BI01151 918670 919734 + префенат дегидрогеназа
BI01152 919947 920201 + консервативный гипотетический белок
BI01153 920239 921303 + белок семейства фаговой интегразы
BI01154 921559 923196 + белок, связывающий растворенные вещества, системы переносчика ABC возможно, для пептидов
BI01155 923500 924423 + dppB
BI01156 924445 925446 + dppC
BI01157 925505 927478 + переносчик ABC-типа, дуплицированный компонент АТФазы
BI01158 927793 928650 - экзодезоксирибонуклеаза III
BI01159 928775 929626 + консервативный гипотетический белок
BI01160 929645 930400 + узко консервативный гипотетический трансмембранный белок
BI01161 930393 931658 + RNA метилтрансфераза, семейство TrmA
BI01162 931673 932365 + липопротеин, предположительно
BI01163 932483 935032 + катион-транспортирующая АТФаза, семейство Е1-Е2
BI01164 935156 937852 + аконитат гидратаза 1
BI01165 938001 938360 + белок лента-спираль-спираль, белок домена семейства copG
BI01166 938363 938851 + домен PIN, предположительно
BI01167 938917 941019 - Белок с неизвестной функцией семейства DUF262
BI01168 941112 941777 - ацетилтрансфераза, семейство GNAT семейство
BI01169 941793 942608 - ДНК-связывающий регулятор ответа, предположительно
BI01170 942553 943935 - атипичный сенсор гистидинкиназы двухкомпонентной системы
BI01171 944117 944959 + консервативный гипотетический белок
BI01172 945143 946039 + мембранный белок, предположительно
BI01173 946326 947195 + мембранный белок, предположительно
BI01174 947234 948073 - ГТФ пирофосфокиназа [импортированный]
BI01175 948115 949554 + TPHK-i(6)A37 тиотрансфераза фермент MiaB
BI01176 949568 950551 + тРНК дельта(2)-изопентенилпирофосфат трансфераза
BI01177 950591 951517 - семейство белков Fic
BI01178 951663 954437 + белок клеточного деления FtsK
BI01179 954635 955267 + CDP-диацилглицерин-глицерин-3-фосфат 3-фосфатидилтрансфераза
BI01180 955282 955812 + компетентность/повреждение-индуцируемый белок, белок домена CinA
BI01181 955881 956387 + возможно, ДНК-связывающий белок
BI01182 956502 956732 + консервативный гипотетический белок
BI01183 957036 958226 + белок recA
BI01184 958232 958822 + регуляторный белок RecX
BI01185 959702 960361 + белок семейства S30AE
BI01186 960556 963417 + препротеин-транслоказа, субъединица SecA
BI00044g 963734 963970 - COG3464: Транспозаза и инактивированные производные
BI01187 963974 964096 - COG3464: Транспозаза и инактивированные производные
BI00045g 964219 964602 + гипотетический белок BL0497
BI01188 964674 965717 + антранилатфосфорибозилтрансфераза
BI01189 965964 966686 - гипотетический трансмембранный белок с неизвестной функцией
BI01190 966447 967418 + гипотетическая ацилтрансфераза
BI01191 967476 969722 - серин/треонин протеинкиназа, предположительно
BI01192 969893 970858 - idsA2
BI01193 971179 971838 + консервативный гипотетический белок
BI01194 972002 973465 + РНК полимераза главный сигма-фактор, сигма 70
BI01195 973526 975799 + ДНК-гираза, субъединица В
BI01196 975969 977192 + мембранный белок, предположительно
BI01197 977269 978228 + рибокиназа
BI01198 978247 982977 + белок домена DEAD/DEAH бокса геликазы
BI01199 982994 983779 - ДНК-связывающий регулятор ответа TcrA, предположительно
BI01200 983927 986953 - ДНК-гираза субъединица А
BI01201 986925 988169 + консервативный гипотетический белок
BI01202 988185 989189 - консервативный гипотетический белок
BI01203 989432 989722 + консервативный гипотетический белок
BI01204 989725 990198 + дезоксиуридин-5-трифосфат нуклеотидогидролаза
BI01205 990335 992656 + ГТФ пирофосфокиназа
BI01206 992780 993058 - orfB
BI01207 993226 994425 + возможно, интеграза/рекомбиназа
BI01640t 994500 995387 + возможно, интеграза/рекомбиназа
BI01208 995387 996439 + интеграза/рекомбиназа XerC, возможно, [импортированный], предположительно
BI01209 996532 997095 - COG2801: Транспозаза и инактивированные производные
BI00053g 997107 997619 - ASOPSNART-11OSRSI
BI01210 997719 998264 - возможно, пептидил-пролил цис-транс изомераза
BI01211 998331 999296 - COG3391: Неохарактеризованный консервативный белок
BI01212 999519 999623 - гипотетический белок
BI01213 999683 1000615 - мембранный белок, предположительно
BI01214 1000747 1001295 + гипотетическ цитозольный белок
BI01215 1001329 1002621 - консервативный гипотетический белок
BI01216 1002648 1003532 + возможно, фосфоглицерат мутаза
BI01217 1003650 1004597 + переносчик магния, семейство CorA
BI01218 1004615 1005538 + glnH, предположительно
BI01219 1005776 1008544 + лейцил-тРНК синтетаза
BI01220 1008708 1009484 + белок компетентности ComEA белок домена
спираль-шпилька-спираль участок повтора
BI01221 1009553 1011235 + консервативный гипотетический трансмембранный белок, родственный с ComA
BI01222 1011378 1012721 + возможно, пролидаза (Х-Pro дипептидаза) или хлоргидролаза
BI01223 1012791 1013759 + консервативный гипотетический белок
BI01224 1013783 1014346 + консервативный гипотетический белок TIGR00150
BI01225 1014411 1015289 + консервативный гипотетический белок
BI01226 1015308 1015859 + рибосомальный-белок-аланин ацетилтрансфераза
BI01227 1015859 1016899 + O-сиалогликопротеин эндопептидаза
BI01228 1017438 1017539 - гипотетический белок
BI01229 1017569 1018501 + возможно, интеграза/рекомбиназа
BI01230 1018564 1018887 - консервативный гипотетический белок
BI01231 1018909 1019787 - консервативный гипотетический белок
BI01232 1019849 1020361 - консервативный гипотетический белок
BI01233 1020474 1021376 - семейство белков Fic
BI01234 1021357 1021929 - гипотетический белок BL1463
BI01235 1021949 1023763 - консервативный гипотетический белок
BI01236 1023782 1024864 - консервативный гипотетический белок
BI01237 1024893 1025600 - консервативный гипотетический белок
BI01238 1025761 1026843 - возможно, TraG-родственный белок
BI01239 1026843 1027799 - гипотетический белок Blon020262
BI01240 1027799 1028164 - гипотетический белок Blon020261
BI01242 1028379 1028669 + гипотетический белок Blon020260
BI01241 1028588 1030942 + ДНК-топоизомераза III
BI01243 1030771 1031448 + гипотетический белок Blon020258
BI01244 1031753 1032193 + COG 1758: ДНК-направленная РНК полимераза, субъединица K/омега
BI01245 1032161 1032553 - гипотетический белок Blon020256
BI01246 1032621 1033400 - семейство белков Fic
BI01247 1033518 1034822 + MC38, предположительно
BI01248 1034848 1036128 - предположительно, белок регулятора транскрипции HIPA
BI01249 1036128 1036439 - гипотетический белок Blon020251
BI01250 1036545 1037675 - консервативный гипотетический белок
BI01251 1038618 1040387 - МС40
BI01252 1040507 1041145 - консервативный гипотетический белок
BI01253 1041250 1042281 - консервативный гипотетический белок
BI01254 1042389 1042865 - консервативный гипотетический белок
BI01255 1043244 1044842 - АТФ-связывающий белок-подобный белок
BI01256 1044857 1046341 - консервативный гипотетический белок
BI01257 1046369 1048195 - липопротеин, предположительно
BI01258 1048370 1048669 - консервативный гипотетический белок
BI01259 1048710 1049189 - МС47, предположительно
BI01713t 1049183 1050538 + гипотетический белок BL1487
BI01260 1049206 1050405 - гипотетический белок
BI01261 1050435 1051070 - гипотетический белок Blon020236
BI01262 1051396 1056213 - гипотетическая COG2217: АТФаза катионного транспорта
BI01263 1056508 1057458 - гипотетический белок Blon020231
BI01264 1057844 1058440 - гипотетические COG1192: АТФазы, вовлеченные в распределение хромосом
BI01265 1059167 1059430 - COGI 192: АТФазы, вовлеченные в распределение хромосом
BI01266 1059569 1060042 - возможно, WhiB-подобный фактор транскрипции
BI01267 1060036 1061400 - консервативный гипотетический белок
BI01727t 1061400 1061597 - гипотетический белок Blon020220
BI01268 1061748 1061894 - гипотетический белок
BI01730t 1061882 1062055 - гипотетический белок Blon020217
BI01269 1062779 1062997 - консервативный гипотетический белок
BI01270 1063127 1063546 + белок домена спираль-поворот-спираль
BI01733t 1064092 1064778 + консервативный гипотетический белок
BI01271 1064862 1066490 - липопротеин, предположительно
BI01272 1066742 1067959 - изоцитрат дегидрогеназа, NADP-зависимая
BI01273 1068051 1069208 + белок семейства IMP дегидрогеназ
BI01274 1069373 1069861 + гипотетический белок Blon020211
BI01275 1069955 1072039 + длинноцепочечная жирная кислота-СоА лигаза, предположительно
BI01276 1072049 1072534 + полипептид деформилаза
BI01277 1072876 1073736 + рибосомальный белок S2
BI01278 1073818 1074666 + фактор элонгации трансляции Ts
BI01279 1074978 1075580 + уридилат киназа
BI01280 1075660 1076208 + фактор рециркуляции рибосом
BI01281 1076309 1077217 + фосфатидат цитидилилтрансфераза
BI01282 1077557 1078597 + фермент радикала SAM, семейство Cfr
BI01283 1078604 1079149 - протеаза I
BI01284 1079324 1080091 + имидазолглицеринфосфат синтаза, субъединица циклазы
BI01285 1080228 1080620 + фосфорибозил-АМР циклогидролаза
BI01286 1080704 1082257 + антранилатсинтаза компонент I
BI01287 1082328 1082564 - консервативный гипотетический белок
BI01288 1082576 1084174 + АТФ-связывающий белок переносчика ABC
BI01289 1084221 1084925 + оксидоредуктаза, семейство коротко-цепочечной дегидрогеназы/ редуктазы, предположительно
BI01290 1084999 1085364 + узко консервативный белок с неизвестной функцией
BI01291 1085423 1086091 - консервативный гипотетический белок
BI01292 1086091 1087701 - переносчик ABC, АТФ-связывающий белок
BI01293 1087704 1088600 - возможный переносчик ABC пермеаза для кобальта
BI01294 1088405 1089049 - узко консервативный белок с неизвестной функцией
BI01295 1089261 1090877 + консервативный гипотетический белок
BI01296 1090916 1091548 + консервативный гипотетический белок
BI01297 1091551 1095093 + гипотетический миозин-подобный белок с неизвестной функцией
BI01298 1095170 1096351 + консервативный гипотетический белок
BI01299 1096680 1097084 + гипотетический белок BL0701
BI01300 1097367 1100384 + эксинуклеаза ABC, субъединица А
BI01301 1100532 1102895 + эксинуклеаза ABC, субъединица С
BI01302 1103007 1103975 + aroE
BI01303 1103978 1104961 + Предсказанная киназа, содержащая Р-петлю
BI01304 1105247 1106110 + Неохарактеризованный BCR, COG 1481
BI01305 1106282 1107484 + фосфоглицерат киназа
BI01306 1107546 1108346 + триосефосфат изомераза
BI01307 1108365 1108658 + препротеин-транслоказа, субъединица SecG
BI01308 1108763 1109710 + L-лактат дегидрогеназа
BI01309 1109710 1110558 + белок семейства Cof
BI01310 1110672 1112225 + аминотрансфераза, класс I
BI01311 1112360 1113466 - мембранный белок, предположительно
BI01312 1113642 1114943 - аминокислота с разветвленной цепью белок-носитель транспортной системы II
BI01313 1115108 1116208 - трансальдолаза
BI01314 1116332 1118392 - транскетолаза
BI01315 1118812 1119927 + индуцируемый теплом репрессор транскрипции HrcA
BI01316 1119986 1121128 + белок dnaJ
BI01317 1121180 1121968 - COG3001: Неохарактеризованный BCR
BI01318 1122113 1122994 + ундекапренол киназа, предположительно
BI01319 1123157 1124146 - консервативный гипотетический белок
BI01320 1124807 1126837 + треонил-тРНК синтетаза
BI01321 1127061 1127561 + белок семейства HIT
BI01322 1127703 1128455 + консервативный гипотетический белок TIGR01033
BI01323 1128464 1129045 + эндодезоксирибонуклеаза соединения с
перекрещивающимися цепями RuvC
BI01324 1129106 1129729 + структура Холл идея ДНК-геликаза RuvA
BI01325 1129732 1130793 + структура Холлидея ДНК-геликаза RuvB
BI01326 1130876 1131292 + препротеин-транслоказа, субъединица YajC
BI01327 1131359 1131937 + аденин фосфорибозилтрансфераза
BI01328 1132037 1133236 + сукцинил-СоА синтетаза, бета-субъединица
BI01329 1133239 1134147 + сукцинил-СоА синтаза, альфа-субъединица
BI01330 1133954 1135546 + мембранный белок, предположительно
BI01331 1135497 1137131 + фосфорибозиламиноимидазолкарбоксамид формилтрансфераза/IMP циклогидролаза
BI01332 1137280 1137579 + гипотетический белок
BI01333 1137484 1138449 - аквапорин Z, предположительно
BI01334 1138645 1139412 + рибосомальная большая субъединица псевдоуридин синтазы В
BI01335 1139514 1141538 + возможно, ГТФ-связывающий белок
BI01336 1141896 1143422 + УДФ-глюкоза пирофосфорилаза
BI01337 1143565 1145475 + консервативный гипотетический белок
BI01338 1145489 1145803 + гипотетический белок Blon020144
BI01339 1145819 1148407 + helY
BI01340 1148524 1148868 + консервативный гипотетический белок
BI01341 1149001 1149717 + гидролаза, дегалогеназа галоидных кислот-подобное семейство
BI01833t 1149744 1149995 + консервативный гипотетический белок
BI01342 1150135 1150497 - гипотетический белок Blon020140
BI01343 1150673 1151302 - COG0789: Предсказанные регуляторы транскрипции
BI01344 1151406 1151846 - возможно, сигнальный белок трансдукции
BI01345 1151856 1152596 - консервативный гипотетический белок
BI01346 1152693 1153022 - малый основной белок
BI01347 1153025 1153999 - консервативный гипотетический белок
BI01348 1153992 1154684 - CDP-диацилглицерин-глицерин-3-фосфат 3-фосфатидилтрансфераза, предположительно
BI01349 1154623 1155471 - АТР фосфорибозилтрансфераза
BI01350 1155486 1155746 - фосфорибозил-АТР пирофосфогидролаза
BI01351 1155812 1156477 - рибулоза-фосфат 3-эпимераза
BI01352 1156556 1157500 - пролипопротеин диацилглицерил трансфераза
BI01353 1157614 1158480 - триптофан синтаза, альфа-субъединица
BI01354 1158507 1160591 - триптофан синтаза, бета-субъединица
BI01355 1161120 1161968 - эндонуклеаза IV
BI00066g 1161414 1162400 + пермеаза аминокислоты
BI01356 1162340 1162834 + пермеаза аминокислоты
BI01357 1162503 1162667 + пермеаза аминокислоты
BI01358 1163206 1164216 - гипотетический мембранный белок с неизвестной функцией
BI01359 1164333 1164536 - гипотетический белок
BI01360 1164570 1164860 - белок абортивной инфекции AbiGI, предположительно
BI01361 1164981 1165262 + гипотетический белок
BI01362 1165260 1165715 - lin2984
BI01363 1165903 1166406 + ацетилтрансфераза, семейство GNAT, предположительно
BI01364 1166567 1166746 + lin0863
BI01365 1166793 1167323 - ацетилтрансфераза, семейство GNAT
BI01366 1167392 1167961 - ацетилтрансфераза, семейство GNAT
BI01367 1168315 1168992 - гипотетический белок
BI01368 1169017 1169823 - гипотетический белок
BI01369 1169832 1170527 - переносчик ABC, АТФ-связывающий белок
BI01370 1170352 1171263 + гипотетический приемный домен регулятора ответа
BI01371 1171317 1172225 + гипотетический белок
BI01372 1172194 1172631 - гипотетический интегральный мембранный белок
BI01373 1172956 1173576 - гипотетический белок
BI01374 1173576 1174301 - гипотетический белок
BI01873t 1174309 1174962 - переносчик бактериоцина ABC, АТФ-связывающий белок, предположительно
BI01375 1175274 1176518 + семейство IS30, транспозаза [импортированный]
BI01376 1176714 1177379 - ДНК-связывающий регулятор ответа
BI01377 1177379 1179001 - гипотетическая АТФаза, белок гистидинкиназы-, ДНК-гиразы В- и HSP90-подобного домена
BI01378 1179039 1179881 - гипотетическая пермеаза, предположительно
BI01379 1180057 1180956 - переносчик ABC, АТФ-связывающий белок
BI01380 1181077 1181259 + гипотетический белок
BI01381 1181154 1181684 - гипотетический белок
BI01382 1182016 1182315 + BIsA
BI01383 1182321 1182662 + гипотетический белок
BI01384 1182847 1183050 - гипотетический белок
BI01385 1183324 1183446 + гипотетический белок BL0771
BI01386 1183489 1183932 + гипотетический белок Blon020116
BI01387 1183955 1184314 - COG0388: Предсказанная амидогидролаза
BI01388 1184376 1184531 - гипотетический белок
BI01389 1184840 1185853 - внутренний мембранный белок, 60 кДа VC0004 [импортированный]
BI01390 1186097 1186555 - гипотетический белок
BI01391 1186942 1187067 + гипотетический белок
BI01392 1187122 1188783 + пермеаза аминокислоты
BI01393 1188993 1189640 - сигнальная пептидаза I
BI00067g 1189800 1190303 + консервативный гипотетический белок
BI01394 1189721 1190146 - гипотетический белок Blon020104
BI01395 1190467 1191420 + Hn0466
BI01396 1191479 1191799 + узко консервативный гипотетический белок
BI01397 1191887 1192165 + узко консервативный гипотетический белок
BI01398 1192540 1193727 + Неизвестный, предположительно
BI01399 1193770 1195530 + белок семейства YjeF, предположительно
BI01400 1195635 1196261 + возможно, альфа бета-гидролаза
BI01401 1196417 1197286 + регулятор транскрипции, семейство LysR
BI01402 1197447 1198565 - консервативный гипотетический белок
BI01403 1198783 1198932 - гипотетический белок
BI01404 1199044 1199736 - оротат фосфорибозилтрансфераза
BI01405 1199748 1200716 - дигидрооротат дегидрогеназа
BI01406 1200722 1201543 - дигидрооротат дегидрогеназа, субъединица переноса электрона
BI01407 1201682 1202632 - оротидин 5-фосфат декарбоксилаза
BI01408 1202653 1203939 - дигидрооротаза
BI01921t 1204146 1204562 - Аспартат карбамоилтрансфераза регуляторная цепь, аллостерический домен
BI01409 1204565 1205524 - аспартат карбамоилтрансфераза
BI01410 1205669 1208896 - семейство глутамат-аммиаклигазы аденилилтрансфераз
BI01411 1208955 1209905 - EF0040
BI01412 1210042 1210893 - 5,10-метилентетрагидрофолат редуктаза
BI01413 1210955 1213255 - 5-метилтетрагидроптероилтриглутамат-гомоцистеин S-метилтрансфераза
BI01414 1213369 1213923 - фосфогистидин фосфатаза SixA, предположительно
BI01415 1214024 1215091 - консервативный гипотетический белок
BI01416 1215168 1215803 + серин эстераза, предположительно
BI01417 1215850 1216806 - оксидоредуктаза, семейство альдо/кето редуктаз 2
BI01418 1217063 1217995 + lipC, предположительно
BI01419 1218234 1219178 + гипотетическая оксидоредуктаза, семейство цинксвязывающей дегидрогеназы
BI01420 1219340 1219642 - возможно, АТФ-связывающий белок переносчика ABC
BI01421 1220459 1221484 + транспозаза (25) ВН3998 [импортированный], предположительно
BI00069g 1221277 1221948 + гипотетический белок
BI01422 1221948 1222706 + Tpase2
BI01423 1222896 1223972 + гипотетический белок
BI01424 1224236 1224811 + гипотетический белок
BI01425 1224888 1225190 - регулятор транскрипции, семейство НТН 3
BI01426 1225221 1226144 - гипотетический белок
BI01427 1226238 1227140 - гипотетический белок
BI01428 1227158 1228765 - гипотетический белок
BI01429 1229279 1230097 - гипотетическая ADP-рибозилглико-гидролаза
BI01430 1231271 1231726 - гипотетический белок
BI01431 1232085 1232906 + консервативный гипотетический белок
BI01432 1233000 1233539 - bcp
BI01433 1233681 1234511 - возможно, амидаза [импортированный]
BI01434 1234511 1235365 - гидролаза, дегалогеназа галоидных кислот-подобное семейство, предположительно
BI01435 1235520 1236365 - транспортный белок аминокислоты
BI01436 1236462 1237709 - возможно, гликозилтрансфераза
BI01437 1237841 1238302 - консервативный гипотетический белок
BI01438 1238382 1239917 - gltD
BI01439 1239922 1244265 - Консервативный участок в семействе глутамат синтазы
BI01440 1244835 1245116 + регулятор транскрипции, семейство Lacl [импортированный]
BI01441 1245175 1246197 - консервативный гипотетический белок
BI01442 1246656 1246979 + консервативный гипотетический белок
BI01443 1247042 1247227 - гипотетический белок
BI01444 1247493 1248536 - регулятор транскрипции, семейство Lacl, предположительно
BI01445 1249246 1250073 + консервативный гипотетический белок
BI01446 1250275 1250571 - гипотетический белок
BI00071g 1250541 1250888 - консервативный гипотетический белок
BI01447 1250658 1250807 + гипотетический белок
BI01448 1251252 1252538 + белок семейства оттока MATE,
BI01449 1252678 1252794 - гипотетический белок
BI01450 1253083 1254216 + IS30 семейство, транспозаза [импортированный]
BI01451 1254323 1255327 - глицерат киназа
BI01452 1255679 1256734 + регулятор транскрипции, семейство Lacl, предположительно
BI01453 1256820 1258094 - кислород-независимая копропорфириноген III оксидаза, предположительно
BI01454 1258229 1259890 - ГТФ-связывающий белок LepA
BI01455 1260253 1260510 + рибосомальный белок S20
BI01456 1260768 1261556 - консервативный гипотетический трансмембранный белок с неизвестной функцией
BI01457 1261807 1262703 - регулятор транскрипции, семейство MazG
BI01458 1262903 1264027 - аминотрансфераза аминокислоты с разветвленной цепью
BI01459 1264254 1264871 - связующий белок Е-петли рибосомальной 5S рРНК Ctc/L25nL5
BI01460 1265298 1266332 + консервативный гипотетический белок
BI01461 1266474 1267895 - NAD(P) трансгидрогеназа, бета-субъединица [импортированный]
BI01462 1267898 1268200 - NAD(P) трансгидрогеназа, альфа-субъединица
BI01463 1268219 1269379 - NAD(P) трансгидрогеназа, альфа-субъединица [импортированный]
BI01464 1269798 1271828 + длинноцепочечная жирная кислота-СоА лигаза
BI01465 1271887 1272948 - ГТФ-связывающий белок Era
BI01466 1272953 1274383 - белок домена CBS
BI01467 1274462 1275052 - консервативный гипотетический белок TIGR00043
BI01468 1275000 1276172 - белок семейства PhoH
BI01469 1276194 1276529 - белок семейства Hit
BI01470 1276581 1277375 - консервативный гипотетический белок TIGR00046
BI01471 1277619 1278494 + белок семейства spoU pPHK метилазы
BI01472 1278758 1279939 + глюкоза-1-фосфат аденилилтрансфераза
BI01473 1280035 1280532 - гомолог белка mrp
BI01474 1280635 1281171 - белок сборки SUF системы FeS, семейство NifU
BI01475 1281201 1282472 - аминотрансфераза, класс-V
BI01476 1282614 1283390 - FeS АТФаза сборки SufC
BI01477 1283419 1284651 - FeS белок сборки SufD
BI01478 1284660 1286156 - FeS белок сборки SufB
BI01479 1286383 1287849 - консервативный гипотетический белок
BI01480 1288225 1289883 - СТР синтаза
BI01481 1290032 1291585 - дипептидаза, предположительно
BI01482 1291684 1292127 - 3-дегидрохинат дегидратаза, тип II
BI01483 1292294 1293835 - 3-дегидрохинат синтаза
BI01484 1293999 1295132 - хоризмат синтаза
BI01485 1295247 1295717 + COG0477: Пермеазы суперсемейства главного посредника
BI01486 1295891 1297003 - неохарактеризованный BCR, YceG семейство COGI559
BI01487 1297083 1297535 - консервативный гипотетический белок TIGR00250
BI01488 1297550 1300228 - аланил-тРНК синтетаза
BI01489 1300359 1300592 - гипотетический белок Blon020010
BI01490 1300595 1300990 - консервативный гипотетический белок
BI01491 1301196 1301921 - фосфоглицерат мутаза
BI01492 1302158 1304008 + белок домена семейства ацилтрансферазы
BI01493 1304105 1304728 - рибосомальный белок S4
BI01494 1304930 1305895 - переносчик ABC, АТФ-связывающий белок
BI01495 1305900 1307114 - гипотетический трансмембранный белок с неизвестной функцией
BI01496 1307208 1307603 - консервативный гипотетический белок
BI01497 1307751 1310450 - гипотетическая UvrD/REP геликаза
BI01498 1310567 1311145 + ксантин фосфорибозилтрансфераза
BI01499 1311199 1312560 + белок семейства ксантин/урацил пермеазы
BI01500 1312696 1312902 - регулятор транскрипции, семейство Cro/CI [импортированный]-родственный белок
BI01501 1312912 1313169 - гипотетический белок
BI01502 1313326 1314144 - гидролаза, семейство альфа/бета-складки, предположительно
BI01503 1314432 1315367 + консервативный гипотетический белок
BI01504 1315462 1315860 - белок семейства глиоксалазы
BI01505 1316019 1316630 + изохоризматаза
BI01506 1316885 1318360 + консервативный гипотетический белок
BI01507 1318371 1319780 - мембранный белок, предположительно
BI01508 1319770 1321005 - мембранный белок, предположительно
BI01509 1321109 1322089 - резистентность к даунорубицину АТФ-связывающий белок
BI01510 1322192 1322296 - гипотетический белок
BI01511 1322475 1323824 + гистидинкиназный сенсор двухкомпонентной системы
BI01512 1323917 1324477 + ДНК-связывающий регулятор ответа
BI01513 1324667 1325287 - подсемейство белка с неизвестной функцией
BI01514 1325308 1326324 - белок семейства переносчика фосфата
BI01515 1326480 1326674 - консервативный гипотетический белок
BI01516 1326735 1329005 - белок углеродного голодания А
BI01517 1329406 1330668 + гликозилгидролаза, семейство 13, предположительно
BI01518 1330703 1331404 - регулятор транскрипции, семейство TetR, предположительно
BI01519 1331486 1333669 - возможно, АТФ-зависимая РНК геликаза
BI01520 1334052 1335338 - урацил-ксантин пермеаза
BI01521 1335446 1336273 - белок домена семейства фосфоглицерат
BI01522 1336327 1336905 - консервативный гипотетический белок
BI01523 1337061 1337612 + консервативный гипотетический белок
BI01524 1337738 1338898 - консервативный гипотетический белок
BI01525 1339275 1340816 - консервативный гипотетический белок
BI01526 1341250 1341687 + гипотетическая COG0653: Препротеин-транслоказа субъединица SecA (АТФаза, РНК-геликаза)
BI01527 1341752 1343449 + белок домена протеинкиназы
BI01528 1343493 1344980 - пермеаза, предположительно
BI01529 1345295 1347565 - переносчик резистентности к лекарственным препаратам, подсемейство EmrB/QacA
BI01530 1347576 1347776 - гипотетический белок
BI01531 1347947 1348309 + гипотетический домен с неизвестной функцией (DUF307)
BI01532 1348405 1349910 - гипотетический белок
BI01533 1349906 1351072 - гипотетический белок
BI01534 1351166 1351474 - гипотетический белок
BI02085t 1351280 1351477 + гипотетический белок Blon021394
BI01535 1351807 1352478 + COG4186: Предсказанная фосфоэстераза или фосфогидролаза
BI01536 1352565 1354004 + консервативный гипотетический белок
BI01537 1354044 1354253 + гипотетический белок BL0925
BI01538 1354253 1354612 + гипотетический белок BL0925
BI01539 1354729 1355193 + гипотетический белок
BI01540 1355496 1356380 - гипотетический белок
BI01541 1356380 1357450 - гипотетическое семейство фаговой интегразы
BI01542 1357650 1358675 + транспозаза (25) ВН3998 [импортированный], предположительно
BI00076g 1358468 1359139 + гипотетический белок
BI01543 1359139 1359897 + Tpase2
BI01544 1360305 1361546 - ГТФ-связывающий белок YchF
BI01545 1361533 1362351 - пирролин-5-карбоксилат редуктаза
BI01546 1362416 1363891 - пролин иминопептидаза
BI01547 1363977 1366433 + гистидинкиназный сенсор двухкомпонентной системы
BI01548 1366551 1367345 + ДНК-связывающий регулятор ответа
BI01549 1367384 1370233 - возможно, транспортный белок
BI01550 1370265 1371176 - переносчик ABC, АТФ-связывающий белок
BI01551 1371528 1372841 - O-ацетилгомосерин сульфгидрилаза
BI01552 1373315 1374184 + пиридоксалькиназа, предположительно
BI01553 1374424 1374924 + консервативный гипотетический белок TIGR00252
BI01554 1374983 1376515 + Mg хелатаза-родственный белок
BI01555 1376515 1378212 + ДНК-процессирующий белок DprA, предположительно
BI01556 1378272 1380134 + sdhA
BI01557 1380233 1381195 + sdhB
BI01558 1381277 1381954 + возможно, метилтрансфераза
BI01559 1382006 1382944 - консервативный гипотетический белок TIGR00730
BI01560 1383180 1384595 - Na+/H+ антипортер [импортированный]
BI01561 1385070 1386485 - АТФ-зависимая CIp протеаза, АТФ-связывающая субъединица CIpX
BI01562 1386610 1387308 - АТФ-зависимая CIp протеаза, протеолитическая субъединица CIpP
BI01563 1387317 1387907 - АТФ-зависимая CIp протеаза, протеолитическая субъединица CIpP
BI01564 1388046 1388423 - гипотетический белок Blon021418
BI01565 1388538 1390001 - белок семейства управляемых потенциалом хлоридных каналов, предположительно
BI01566 1390189 1391565 - инициирующий фактор
BI01567 1391623 1392921 - белок домена 3-5 экзонуклеазы
BI01568 1392921 1393730 - COG0477: Пермеазы суперсемейства
главного посредника
BI01569 1393622 1394500 - пируватформиат-лиаза 1 активирующий фермент
BI01570 1394613 1396985 - формиат ацетилтрансфераза
BI01571 1397254 1397475 - консервативный гипотетический белок
BI01572 1397531 1399093 - NH(3)-зависимая NAD+ синтетаза
BI01573 1399577 1400725 - пептидаза, семейство М20/М25/М40
BI01574 1400817 1401500 - белок пермеазы системы переносчика ABC
BI01575 1401500 1402702 - переносчик ABC, АТФ-связывающий белок
BI01576 1402839 1403816 - липопротеин, семейство YaeC
BI01577 1404020 1404847 + гидролаза, дегалогеназа галоидных кислот-подобное семейство
BI01578 1404975 1407449 - D-ксилулоза 5-фосфат/D-фруктоза 6-фосфат фосфокетолаза
BI01579 1407895 1409454 + GMP синтаза
BI01580 1409723 1410304 + COG0798: Насос оттока арсенита ACR3 и родственные пермеазы
BI01581 1410343 1410720 + белок резистентности к мышьяку/арсенат редуктаза
BI01582 1411265 1411771 + гипотетическое семейство транспозазы IS66
BI00078g 1411579 1412214 + гипотетический белок Blon021471
BI01583 1412111 1413136 + транспозаза (25) ВН3998 [импортированный], предположительно
BI00079g 1412929 1413600 + гипотетический белок
BI01584 1413600 1414358 + Tpase2
BI01585 1414423 1414911 + гипотетические COG3436: Транспозаза и инактивированные производные
BI02159t 1415037 1416323 - COG0477: Пермеазы суперсемейства главного посредника
BI01586 1416510 1417160 + предположительно, АТФ-связывающий белок
BI01587 1417164 1418444 + Неохарактеризованный консервативный белок
BI01588 1418440 1418820 + гипотетический белок Blon021466
BI01589 1418965 1420548 + консервативный гипотетический белок
BI01590 1420796 1422598 + ацилтрансфераза, предположительно
BI01591 1422687 1423706 + prsA
BI01592 1423991 1425370 + УДФ-N-ацетилглюкозамин пирофосфорилаза
BI01593 1425377 1425787 + iojap-родственный белок
BI01594 1425942 1426637 + фосфоглицерат мутаза, предположительно
BI01595 1427363 1428961 + фосфат ацетилтрансфераза
BI01596 1429099 1429695 + ацетат киназа
BI01597 1429811 1430326 + гипотетическая COG0282: Ацетат киназа
BI01598 1430503 1431867 - 3-фосфошикимат 1-карбоксивинил-трансфераза
BI01599 1431867 1433036 - мембранный белок, предположительно
BI01600 1433757 1434125 - гипотетическая COG2217: АТФаза катионного транспорта
BI01601 1434688 1436172 - симпортер галактозида
BI01602 1436515 1439583 + бета-галактозидаза, предположительно
BI01603 1440389 1441246 + гипотетический белок
BI01604 1441301 1441966 - гипотетический белок Blon020709
BI01605 1442167 1442559 - гипотетический белок
BI01606 1442574 1442990 - гипотетический белок
BI01607 1442990 1444792 - гипотетический белок
BI01608 1444688 1445566 + COG3757: Лизозим М1 (1,4-бета-N-ацетилмурамидаза)
BI01609 1445667 1445948 + гипотетический белок
BI01610 1446119 1446796 + гипотетический белок
BI01611 1447212 1448801 + гипотетическая С-5 цитозин-специфическая ДНК-метилаза
BI01612 1448804 1449997 - гипотетический белок Psyc022392
BI01613 1450130 1450393 + гипотетический белок
BI01614 1450514 1450891 - гипотетический белок
BI01615 1451253 1452203 - гипотетический белок
BI01616 1452503 1452802 - TnpB
BI01617 1452909 1453127 + IS861, транспозаза OrfB
BI01618 1453248 1453586 + предположительно, субъединица транспозазы
BI01619 1455179 1455604 - белок клеточного деления FtsZ
BI01620 1455752 1459864 - гипотетическая UvrD/REP геликаза
BI01621 1459861 1463163 - COG3857: АТФ-зависимая нуклеаза, субъединица В
BI01622 1463295 1465877 - гипотетическая ДНК-полимераза III, альфа-субъединица
BI01623 1466012 1467055 + консервативный гипотетический белок
BI01624 1467089 1467886 - узко консервативный гипотетический мембранный белок
BI01625 1468160 1468507 - гипотетический белок BL0124
BI01626 1468949 1469908 - Псевдоуридилат синтазы, 23S РНК-специфические
BI01627 1469911 1470456 - сигнальная пептидаза липопротеина
BI01628 1470481 1471857 - консервативный гипотетический белок
BI01629 1472000 1472299 - COG0762: Предсказанный интегральный мембранный белок
BI01630 1472424 1472900 - консервативный гипотетический белок
BI01631 1472916 1473830 - гипотетическое семейство тубулин/FtsZ, С-терминальный домен
BI01632 1474239 1475480 - TIM-баррель-белок, семейство NifR3
BI01633 1475628 1476938 - глицил-тРНК синтетаза
BI01634 1477533 1478474 + гидроксиэтилтиазол киназа
BI01635 1478743 1481310 + белок биосинтеза тиамина ThiC
BI01636 1481353 1481679 - гипотетический белок
BI01637 1481820 1482626 + фосфометилпиримидин киназа
BI01638 1482680 1483054 + COG0011. Неохарактеризованный ACR
BI01639 1483563 1484939 + пермеаза, предположительно
BI02235t 1485571 1485978 + консервативный гипотетический белок
BI01640 1486039 1487433 + суперсемейство серпина (ингибитор
сериновой протеазы)
BI01641 1487717 1488517 + регулятор транскрипции, семейство Lad, предположительно
BI01642 1488728 1490068 + транспортный белок сахарозы
BI01643 1490082 1491635 + сахароза-6-фосфат гидролаза, предположительно
BI01644 1491833 1492612 + переносчик ABC, белок пермеазы, семейство cysTW, предположительно
BI01645 1492927 1493943 + фермент биосинтеза прекурсора пиримидина, предположительно
BI02246t 1494070 1495254 + инозин-уридин-предпочитающая нуклеозид гидролаза
BI01646 1495416 1496207 - ундекапренил дифосфат синтаза
BI01647 1496207 1496923 - белок репарации ДНК RecO
BI01648 1496975 1498684 - консервативный гипотетический белок
BI01649 1498808 1500028 - 1-гидрокси-2-метил-2-(Е)-бутенил 4-дифосфат синтаза
BI01650 1500028 1501215 - 1-дезокси-D-ксилулоза 5-фосфат редуктоизомераза
BI01651 1501215 1502915 - консервативный гипотетический белок
BI01652 1503387 1503809 - консервативный гипотетический белок
BI01653 1503919 1504797 - белок семейства домена PDZ
BI01654 1505129 1506760 + консервативный гипотетический белок
BI01655 1506836 1508407 - АТФ-зависимая ДНК-геликаза PcrA
BI01656 1508553 1510205 + консервативный гипотетический белок
BI01657 1510357 1510578 + предположительно, АТФ-связывающий белок
BI01658 1510645 1511535 - семейство РНР домена N-терминального участка
BI01659 1511673 1512407 + узко консервативный гипотетический трансмембранный белок
BI01660 1512419 1513309 - диаминопимелат эпимераза
BI01661 1513417 1514208 + глутамат рацемаза
BI01662 1514340 1515182 + семейство пататина
BI01663 1515255 1516151 - неизвестный
BI01664 1516314 1516580 - фермент транс-сульфурирования
BI00087g 1516749 1517024 - переносчик ABC, АТФ-связывающий белок, предположительно
BI00086g 1517139 1517573 + консервативный гипотетический белок в upfD074
BI01665 1517692 1517940 - консервативный гипотетический белок
BI01666 1518187 1519422 - цистатионин бета-лиаза
BI01667 1519661 1520560 - переносчик глутамина ABC, периплазматический глутаминсвязывающий белок (glnH)
BI01668 1520629 1521417 - переносчик аминокислот ABC, АТФ-связывающий белок
BI01669 1521413 1521952 - переносчик аминокислот ABC, белок пермеазы SP0710 [импортированный]
BI01670 1522074 1522730 - переносчик аминокислот ABC, белок пермеазы
BI01671 1522793 1523605 + гипотетическая фосфолипаза/ карбоксилэстераза
BI01672 1523620 1525872 - Tn916, белок резистентности к тетрациклину, предположительно
BI01673 1526091 1526723 + ДНК-полимераза III, эпсилон-субъединица
BI01674 1526731 1527318 - гуанилат киназа
BI01675 1527501 1528418 - оротидин 5'-фосфат декарбоксилаза, предположительно
BI01676 1528421 1531801 - карбамоил-фосфат синтаза, большая субъединица
BI01677 1531806 1533176 - карбамоил-фосфат синтаза, малая субъединица
BI01678 1533219 1533788 - фактор антитерминации транскрипции NusB
BI01679 1533846 1534154 - фактор элонгации Р (EF-P)
BI01680 1534514 1535248 + неизвестный, предположительно
BI01681 1535248 1536033 + консервативный гипотетический белок TIGR00245
BI01682 1536066 1536770 - неизвестный
BI01683 1536878 1539436 - гипотетический EAL-домен
BI01684 1539444 1540751 - возможно, трансмембранный белок гидролазы
BI01685 1541332 1543257 + гликозилтрансфераза
BI01686 1543387 1543551 - гипотетический белок
BI01687 1543710 1544600 - 3-гидроксиацил-СоА дегидрогеназа
BI01688 1544959 1546782 - альфа-ксилозидаза
BI01689 1546897 1547199 - гипотетический COG1653: система транспорта сахара ABC-типа, периплазматический компонент
BI01690 1547359 1549491 - возможно, бета-гексозаминидаза А
BI01691 1549605 1550417 - переносчик ABC, белок пермеазы, семейство MalFG
BI01692 1551035 1551862 + консервативный гипотетический белок
BI01693 1552142 1553254 - mrp
BI01694 1553434 1556193 - ДНК-лигаза, NAD-зависимая
BI01695 1556261 1559881 - консервативный гипотетический белок
BI01696 1560102 1562237 + мембранный белок, предположительно
BI01697 1562555 1564141 + гипотетический белок Blon021196
BI01698 1564204 1564977 - переносчик ABC, АТФ-связывающий белок, предположительно
BI01699 1565037 1566299 - аминотрансфераза, класс I, предположительно
BI01700 1566573 1567337 - белок семейства ROK
BI01701 1567583 1568365 + белок семейства нитроредуктазы
BI01702 1568413 1569423 - возможно, гликозилтрансфераза
BI01703 1569675 1570325 + консервативный гипотетический белок
BI01704 1570459 1572888 + переносчик ABC, АТФ-связывающий белок, предположительно
BI01705 1572963 1573265 + предсказанныый РНК-связывающий белок,
содержащий KH-домен
BI01706 1573370 1573732 - консервативный гипотетический белок
BI01707 1573842 1574456 + гипотетический ТМ2-домен
BI01708 1574885 1575301 + гипотетический белок Blon021592
BI01709 1575432 1576415 - белок семейства D-изомер-специфической 2-оксикислоты дегидрогеназы
BI01710 1576714 1578168 + переносчик резистентности к лекарственным препаратам, семейство EmrB/QacA, предположительно
BI01711 1578399 1579418 - переносчик рибозы ABC, белок пермеазы VCA0129 [импортированный], предположительно
BI01712 1579418 1580485 - переносчик рибозы ABC, белок пермеазы VCA0129 [импортированный], предположительно
BI01713 1580490 1582028 - АТФ-связывающий белок переносчика ABC
BI01714 1582172 1583152 - переносчик рибозы ABC, периплазматический D-рибозасвязывающий белок
BI01715 1583472 1585199 - липопротеин, предположительно
BI01716 1585199 1586752 - сенсорная гистидинкиназа MtrB
BI01717 1586893 1587837 - гипотетический приемный домен регулятора ответа
BI01718 1587674 1589005 - консервативный АТФ/ГТФ связующий белок
BI01719 1589136 1591535 - COG0513: Суперсемейство II ДНК и РНК геликаз
BI01720 1591837 1592907 - семейство домена с неизвестной функцией (DUF344)
BI02350t 1592976 1593215 - консервативный гипотетический белок
BI01721 1593208 1593801 - COG0737: 5'-нуклеотидаза/2',3'-циклическая фосфодиэстераза и родственные эстеразы
BI01722 1593841 1595364 - гипотетический секретируемый белок с возможным доменом кислотной фосфатазы
BI01723 1595471 1596568 - переносчик глутамина ABC, глутаминсвязывающий белок/белок пермеазы, предположительно
BI01724 1596577 1597251 - переносчик глутамина ABC, белок пермеазы
BI01725 1597254 1598090 - переносчик аминокислот ABC, аминокислота-связывающий белок, предположительно
BI01726 1598125 1598964 - переносчик аминокислот ABC, АТФ-связывающий белок
BI01727 1599401 1600468 + консервативный гипотетический белок
BI01728 1600932 1602728 - аспартил-тРНК синтетаза
BI01729 1602767 1604107 - гистидил-тРНК синтетаза
BI01730 1604264 1605721 + консервативный гипотетический белок
BI01731 1605933 1607723 - белок семейства 5-нуклеотидазы, предположительно
BI01732 1607898 1608653 - креатинин амидогидролаза, креатининаза
BI01733 1608742 1610115 - переносчик пролина/бетаина
BI01734 1610158 1610328 + гипотетический белок
BI01735 1610308 1611378 - гипотетический белок, слабо схожий с предположительным регулятором транскрипции Streptomyces
BI01736 1611950 1613266 + белок семейства N-ацил-D-аминокислота деацилазы, предположительно
BI01737 1613452 1616058 - АТФ-зависимая CIp протеаза, АТФ-связывающая субъединица CIpC
BI01738 1616208 1617170 + demannu, предположительно
BI01739 1617288 1618208 - гипотетический белок Blon021510
BI01740 1618484 1618870 - cspB
BI01741 1618943 1620931 - сенсорная гистидинкиназа
BI01742 1620965 1621738 - ДНК-связывающий регулятор ответа
BI01743 1621689 1622492 - консервативный гипотетический белок
BI01744 1622567 1622854 + консервативный гипотетический белок
BI01745 1622957 1624579 - шаперон
BI01746 1624820 1625056 - белок семейства домена холодового шока
BI01747 1625289 1625870 - гипотетический белок Blon020592
BI01748 1626163 1626771 + урацил-DNA гликозилаза
BI01749 1626814 1627890 + АТФаза, семейство MoxR
BI01750 1628022 1628837 + Белок семейства с неизвестной функцией
BI01751 1628840 1629388 + консервативный гипотетический белок
BI01752 1629388 1630443 + консервативный гипотетический белок
BI01753 1630443 1631471 + консервативный гипотетический белок
BI01754 1631444 1632070 + тромбоцит-связывающий белок GspB, предположительно
BI01755 1632316 1632660 + консервативный гипотетический белок
BI01756 1632660 1634261 + консервативный гипотетический белок
BI01757 1634531 1634893 + консервативный гипотетический белок
BI01758 1635034 1635672 - гипотетический мембранный белок с неизвестной функцией
BI01759 1635805 1637238 + аденилосукцинат лиаза VC1126 [импортированный]
BI01760 1637373 1639931 + узко консервативный гипотетический мембранный белок
BI01761 1640080 1640358 + ДНК-связывающий белок HU
BI01762 1640480 1641937 - возможно, ДНК-связывающий белок
BI01763 1641940 1642203 - гипотетический белок с неизвестной функцией (DUF797)
BI01764 1642234 1643133 - возможно, инозит монофосфатаза
BI01765 1643139 1644803 - гипотетический протеосома-ассоциированный белок
BI01766 1644828 1646390 - белок контроля клеточного деления 48, семейство ААА
BI01767 1646454 1647149 - белок семейства DedA
BI01768 1647410 1647919 + фосфосерин фосфатаза SerB
BI01769 1648166 1650271 + примосомальный белок N
BI01770 1650333 1651034 + возможно, альфа бета-гидролаза
BI01771 1651061 1652044 + метионил-тРНК формилтрансфераза
BI01772 1652142 1653908 - дигидрокси-кислота дегидратаза
BI01773 1654203 1654484 + ДНК-направленная РНК полимераза, омега-субъединица
BI01774 1654765 1655982 + S-аденозилметионин синтетаза
BI02420t 1656352 1657425 + гипотетический белок CV1232

Открытые рамки считывания (ORF), перечисленные в Таблице 1, определяются по их положению в геномной последовательности SEQ ID NO. 1. Например, BI00001 определяется нуклеотидной последовательностью оснований №№1667321 и 1667608 (включительно) SEQ ID NO. 1.


Приведенные далее примеры дополнительно описывают и демонстрируют варианты исполнения, входящие в объем изобретения. Примеры приводятся только для иллюстрации и не должны истолковываться как ограничения настоящего изобретения, поскольку возможны многие его варианты, не выходящие за пределы сущности и объема изобретения.

Пример 1 - Выделение Bifidobacterium lonsum биотип infantis UCC 35624

Проводили скрининг аппендиксов и срезов большой и малой кишки ЖКТ человека, полученных при реконструктивной хирургии, на пробиотические бактериальные штаммы. Все образцы сохраняли немедленно после хирургии при -80°С в стерильных контейнерах. Замороженные ткани оттаивали, взвешивали и помещали в цистеинированный (0,05%) раствор Рингера четвертинной крепости. Каждый образец осторожно встряхивали для удаления слабо прикрепленных микроорганизмов. После переноса во второй объем раствора Рингера, образец обрабатывали на вихревой мешалке в течение 7 мин для удаления прочно прикрепленных бактерий. Для выделения бактерий, внедренных в ткани, образцы также гомогенизировали в смесителе Braun. Растворы серийно разбавляют и высеивают на поверхности чашек (100 мкл) со следующими агаровыми средами: RCM (обогащенная среда для клостридий) и RCM, доведенная до рН 5,5 с помощью уксусной кислоты; TPY (триптиказо-пептонная с дрожжевым экстрактом), Chevalier, P. et al. (1990). MRS (среда de Mann-Rogosa-Sharpe); ROG (ацетатная среда (SL) Rogosa); LLA (печеночно-лактозный агар Lapiere); BHI (агар с сердечно-мозговым настоем); LBS (Lactobacillus-селективный агар) и TSAYE (триптон-соевый агар с добавкой 0,6% дрожжевого экстракта). Все агаровые среды поставлялись фирмой Oxoid Chemicals, за исключением агара TPY. Пластинки инкубируют в анаэробных банках (BBL, Oxoid) с использованием наборов для генерирования CO2 (Anaerocult A, Merck) в течение 2-5 дней при 37°С.

Изоляты грампозитивных, каталаза-негативных палочковидных или раздвоенных/плеоморфных бактерий высеивали штрихами для определения чистоты на комплексную неселективную среду (TPY). Изоляты в обычном порядке культивируют в среде TPY, если не указано иное, при 37°С в анаэробных условиях. Предполагаемые виды бифидобактерий помещали в 40% глицерин и хранили при -20 и -80°С.

Было отобрано приблизительно полторы тысячи каталаза-негативных бактериальных изолятов из разных образцов и охарактеризовано по показателям реакции на окраску по методу Грама, размера клеток и морфологии, роста при 15°С и 45°С и конечным продуктам ферментации из глюкозы. Более шестидесяти процентов исследованных изолятов были грампозитивными, гомоферментативными кокками, объединенными в тетрады, цепи или группы. Восемнадцать процентов изолятов были грамнегативными палочкообразными и гетероферментативными коккобациллами.

Остальные изоляты (двадцать два процента) представляли собой преимущественно гомоферментативные коккобациллы. Тридцать восемь штаммов были охарактеризованы более детально. Все тридцать восемь изолятов были негативными как по восстановлению нитратов, так и по продуцированию индола из триптофана.

Штамм 35624 Bifidobacterium longum биотип infantis был выбран из этой группы штаммов для полного секвенирования генома вследствие его подтвержденной противовоспалительной активности в мышиных моделях колита (McCarthy et al., 2004) и его иммуномодулирующих эффектов после перорального приема пациентами с синдромом раздраженного кишечника (IBS) (O'Mahony et al., 2005).

Пример 2 - Секвенирование генома Bifidobacterium longum infantis 35624

Последовательность генома штамма 35624 Bifidobacterium longum биотип infantis была определена с использованием метода дробовика. С этой целью были сконструированы две библиотеки: библиотека малых инсерций (размер инсерций в интервале значений от 2 до 4 т.п.о.) с использованием вектора pGEM-Т easy (Promega) и космидная библиотека больших инсерций (размер инсерций в интервале значений от 40 до 45 т.п.о.) (Epicentre Technologies). Отбор последовательностей из этих банков дал чуть больше 26828618 пар оснований, пригодных для использования данных о последовательности, что соответствует примерно 11,9-кратному покрытию генома Bifidobacterium longum биотип infantis штамм 35624 (выполнен фирмой MWG-Biotech, Ebersberg, Germany). Результаты расшифровки последовательности были собраны с помощью Phrap (Green) в 11 контигов. Перекрывание гэпов и повышение качества первичной сборки последовательности достигалось с помощью дополнительного праймер-направленного секвенирования с использованием предварительно идентифицированных клонов из библиотек, что привело к единому контигу, представлявшему собой кольцевую хромосому длиной 2264374 п.о. На основе конечной консенсусной балльной оценки качества, мы оценили общую частоту ошибок в <1 на 4×105 оснований.

Пример 3 - Анализ генома Bifidobacterium longum биотип infantis 35624

Кодирующие белки открытые рамки считывания (ORF) были предсказаны с использованием комбинации способов Glimmer (Delcher et al., 1999b; Salzberg et al., 1998) и GeneBuilder (программное обеспечение собственной разработки), а также сравнительного анализа с использованием BLASTX (Altschul et al., 1997)

Результаты, полученные с помощью программ определения генов, объединяли вручную, и предварительную идентификацию ORF производили на основании анализа с использованием BLASTP (Altschul et al., 1997) по сравнению с не содержащей повторяющихся последовательностей (non-redundant) базой данных для белков, предоставленной Национальным центром биотехнологической информации (National Centre for Biotechnology Information) (Wheeler et al., 2005). Программа Artemis (Rutherford et al., 2000) была использована для проверки идентифицированных ORF и ассоциированных с ними результатов BLASTP. Проверка вручную проводилась для подтверждения или, в случае необходимости, переопределения начала и конца каждого предсказанного кодирующего участка. Программа Annotation использовала возможность Artemis построения графиков содержания ГЦ в рамках (GC frame plot feature), информацию о рибосомасвязывающем сайте, полученную от RBSfinder (Suzek et al., 2001), результаты выравнивания со схожими ORF других организмов, и анализ содержания G+C.

Пример 4 - Идентификация уникальных генов в геноме Bifidobacterium longum infantis 35624

Соотнесение функций белков с предсказанными кодирующими областями генома Bifidobacterium longum биотип infantis штамм 35624 осуществляли с использованием программного обеспечения собственной разработки и проверки вручную. Первичная функциональная классификация генных продуктов Bifidobacterium longum биотип infantis штамм 35624 производилась в соответствии с правилами Riley (Riley, 1998a; Riley, 1993). Соотнесение COG осуществляли с использованием XUGNITOR (Tatusov). HMMER (Eddy) была использована для установления соответствия классификации PFAM (Bateman et al., 2002) с предсказанными белками. ТМНММ (Krogh et al., 2001) была использована для предсказания трансмембранных последовательностей, и SignalP (Bendtsen et al., 2004) была использована для предсказания сигнальных пептидов. Гены рибосомальных РНК детектировали на основе поиска BLASTN и аннотировались вручную. Гены транспортных РНК идентифицировали с помощью tRNAscan-SE (Lowe and Eddy, 1997). Различные кодирующие РНК идентифицировали по базе данных Rfam (Griffiths-Jones et al., 2005), используя пакет программ INFERNAL (Eddy, 2002). Элементы последовательностей инсерций идентифицировали с помощью Repeatfinder (Volfovsky et al., 2001), Reputer (Kurtz & Schleiermcher, 1999) и BLAST (Altschul et al., 1990) и аннотировали вручную. Семейства IS определяли с помощью ISFinder (http://www-is.biotoul.fr/is.html). Ферменты, проявляющие активность по отношению к углеводам, идентифицировали на основании сходства с записями базы данных активных по отношению к углеводам ферментов (CAZy) (Coutinho & Henrissat, 1999), и классы COG и PFAM аннотировали с указанием активности ферментов углеводного обмена. Классификация переносчиков осуществлялась в соответствии со схемой TC-DB (Busch & Saier, 2002).

Мы идентифицировали область оснований №№44824-472245 (включительно) SEQ ID NO. 1, которую обозначили как область 1 экзополисахарида (EPS) (SEQ ID NO. 2). Область 1 EPS кодирует следующие гены:

Таблица 2
Открытые рамки считывания области 1 EPS генома UCC 35624
Ген Нить Описание Последовательность ДНК Белковая последовательность
BI00778 + гликозил трансфераза CpsE SEQ. ID NO. 93 SEQ. ID NO. 133
BI00779 + COG0840: Метил-акцептирующий белок хемотаксиса SEQ. ID NO. 94 SEQ. ID NO. 134
BI00780 + возможно, Etk-подобная тирозинкиназа, вовлеченная в биосинтез Eps SEQ. ID NO. 95 SEQ. ID NO. 135
BI00781 + белок семейства гипотетической гликозилтрансферазы, группа 1 SEQ. ID NO. 96 SEQ. ID NO. 136
BI00782 + предположительно, белок гликозилтрансферазы SEQ. ID NO. 97 SEQ. ID NO. 137
BI00783 + белок семейства NAD-зависимой эпимеразы/дегидратазы SEQ. ID NO. 98 SEQ. ID NO. 138
BI00784 + УДФ-глюкоза 6-дегидрогеназа SEQ. ID NO. 99 SEQ. ID NO. 139
BI00785 + белок семейства гипотетической гликозилтрансферазы, группа 1 SEQ. ID NO. 100 SEQ. ID NO. 140
BI00786 + гипотетический Eps 111 SEQ. ID NO. 101 SEQ. ID NO. 141
BI00787 + гипотетический гексапептид бактериальной трансферазы (три повтора) SEQ. ID NO. 102 SEQ. ID NO. 142
BI00788 + гипотетический белок синтеза капсульного полисахарида SEQ. ID NO. 103 SEQ. ID NO. 143
BI00789 + гипотетический белок SEQ. ID NO. 104 SEQ. ID NO. 144
BI00790 + Eps9K SEQ. ID NO. 105 SEQ. ID NO. 145
BI00791 + гипотетический белок биосинтеза полисахарида SEQ. ID NO. 106 SEQ. ID NO. 146
BI00792 + гипотетический гексапептид бактериальной трансферазы (три повтора) SEQ. ID NO. 107 SEQ. ID NO. 147
BI00793 - белок семейства NAD-зависимой эпимеразы/дегидратазы, SEQ. ID NO. 108 SEQ. ID NO. 148
BI00794 - транспозаза, вырожденная SEQ. ID NO. 109 SEQ. ID NO. 149
BI00795 гипотетические COG2963: Транспозаза и инактивирован-ные производные SEQ. ID NO. 110 SEQ. ID NO. 150
BI00796 + dTDP-глюкоза 4,6-дегидратаза SEQ. ID NO. 111 SEQ. ID NO. 151
BI00797 + dTDP-4-дегидрорамноза 3,5-эпимераза SEQ. ID NO. 112 SEQ. ID NO. 152
BI00798 + глюкоза-1-фосфат тимидилилтрансфераза SEQ. ID NO. 113 SEQ. ID NO. 153

Мы также идентифицировали область оснований №№2071426-2097099 (включительно) SEQ ID NO. 1, которую мы обозначили как область 2 EPS (SEQ ID NO. 3). Область 2 EPS кодирует следующие гены:

Таблица 3
Открытые рамки считывания области 2 EPS генома UCC 35624
Ген Нить Описание Последовательность ДНК Белковая последовательность
BI00319 + dTDP-глюкоза 4,6-дегидратаза SEQ. ID NO. 114 SEQ. ID NO. 154
BI00320 + консервативный гипотетический белок SEQ. ID NO. 115 SEQ. ID NO. 155
BI00321 + консервативный гипотетический белок SEQ. ID NO. 116 SEQ. ID NO. 156
Bl00423t + Консервативная, предположительно, транспозаза SEQ. ID NO. 117 SEQ. ID NO. 157
BI00322 - IS1533,OrfB SEQ. ID NO. 118 SEQ. ID NO. 158
BI00323 транспозаза (25) ВН3998 [импортированный], предположительно SEQ. ID NO. 119 SEQ. ID NO. 159
BI00324 - гликозилтрансфераза, предположительно SEQ. ID NO. 120 SEQ. ID NO. 160
BI00325 консервативная сиаловая кислота-специфическая 9-O-ацетилэстераза SEQ. ID NO. 121 SEQ. ID NO. 161
BI00326 + гипотетическое семейство ацилтрансферазы SEQ. ID NO. 122 SEQ. ID NO. 162
BI00327 консервативныый гипотетический мембранный белок с неизвестной функцией SEQ. ID NO. 123 SEQ. ID NO. 163
BI00328 - гипотетическая гликозил трансфераза семейство 8 SEQ. ID NO. 124 SEQ. ID NO. 164
BI00329 белок семейства гипотетической гликозил трансферазы, групп 2 SEQ. ID NO. 125 SEQ. ID NO. 165
BI00330 полисахарид переносчик ABC, АТФ-связывающий белок SEQ. ID NO. 126 SEQ. ID NO. 166
BI00331 Полисахарид, переносчик ABC, белок пермеазы, предположительно SEQ. ID NO. 127 SEQ. ID NO. 167
BI00332 + гипотетическая гликозил трансфераза семейство 8 SEQ. ID NO. 128 SEQ. ID NO. 168
BI00333 - УДФ-глюкоза 6-дегидрогеназа SEQ. ID NO. 129 SEQ. ID NO. 169
BI00334 + гипотетическое семейство NAD-зависимой эпимеразы/ дегидратазы SEQ. ID NO. 130 SEQ. ID NO. 170
BI00335 - мембранный белок, предположительно SEQ. ID NO. 131 SEQ. ID NO. 171
BI00336 - консервативный гипотетический белок SEQ. ID NO. 132 SEQ. ID NO. 172

Пример 5 - Выделение и скрининг EPS-продуцирующего штамма бифидобактерий из образцов фекалий

Приготовление образца фекалий

Образцы фекалий собирали у субъектов с использованием системы сбора образцов из гигиенических приспособлений для ухода за лежачими больными (commode specimen collection) Kendall Precision. Собранные образцы хранили в замороженном состоянии в термоконтейнере с пакетированными охлаждающими элементами (cold pack) до обработки образцов. Для анализов использовались только образцы, взятые за последние двадцать четыре часа.

Образец 10,0 г смешанного материала фекалий помещают в пластиковый пакет для гомогенизатора, содержащий 90 мл солевого раствора. Суспензию обрабатывают в гомогенизаторе в течение 2 минут. Суспензию фильтруют через марлевый компресс, помещенный в воронку одноразового пользования. После фильтрации, 45 мл фильтрованного гомогената фекалий переносят в центрифужную пробирку для одноразового использования на 50 мл. Эту суспензию фекалий впоследствии используют для экстракции ДНК или для выделения бактерий.

Скрининг образцов фекалий с использованием трех анализов методом ПЦР в реальном времени TaqMan.

Получение ДНК образца фекалий. Получают осадок аликвоты 2,0 мл гомогената фекалий с помощью микроцентрифуги. Осадки ресуспендируют в 20 мг/мл лизозима в течение 2 часов при 37°С. ДНК экстрагируют с помощью набора QIAamp DNA Stool Mini Kit (Qiagen). Концентрацию ДНК измеряют с использованием метода анализа Pico Green (Molecular Probes). После измерения концентрации ДНК, ДНК хранят при 4°С.

Реакции ПНР в реальном времени TaqMan. Тестируемые образцы разбавляют до концентрации ДНК, равной 2 нг/мкл, так чтобы в 5 мкл содержалось в целом 10 нг ДНК. Образцы оценивют в общем с использованием трех отдельных методов анализа.

Готовят следующую реакционную смесь:

Вода 15,75 мкл
10 мкМ прямого праймера 1,5 мкл (конечная концентрация 300 нМ)
10 мкМ обратного праймера 1,5 мкл (конечная концентрация 300 нМ)
10 мкМ зонда TaqMan 1 мкл (конечная концентрация 200 нМ)
BSA (бычий сывороточный альбумин) (20 мг/мл) 0,25 мкл (конечная концентрация 0,1 мкг/мл)
Универсальная реакционная смесь для ПЦР TaqMan 25 мкл

Готовят общую смесь для ряда образцов для анализа. Аликвоту 45 мкл дозируют в каждую лунку 96-луночного микротитровального планшета, затем прибавляют в каждую лунку 5 мкл ДНК. Планшет кратковременно центрифугируют и помещают в термоциклер (АВ1 7900 НТ). Используют стандартный протокол термоциклирования TaqMan.

Программа TaqMan RT-PCR (ПЦР с обратной транскрипцией). Стандартный протокол количественного ПЦР-термоциклирования TaqMan выглядит следующим образом:

Стадия 1: 95°С в течение 10 минут (для активации полимеразы AmpliTaq Gold)

Стадия 2: 95°С в течение 15 секунд (стадия денатурации)

Стадия 3: 60°С в течение 60 секунд (стадия праймирования/полимеризации)

Стадии 2 и 3 повторяют 40 раз. Данные флуоресценции собирают на стадии 3.

Праймеры и зонды для трех анализов TaqMan RT-PCR. Образцы ДНК фекалий подвергают скринингу с использованием EPS ген-специфического анализа и двух В.infantis 35624 неизвестный ген-специфических анализов (неизвестные гены UNK1 и UNK2). Конкретные используемые гены и наборы праймеров TaqMan для них приведены в Таблице 4 ниже.

Таблица 4
UCC 35624 набор праймеров для TaqMan PCR
Ген-мишень Название Последовательность 5'-3' Начало в геноме Конец в геноме Метка зонда TaqMan
BI01615 (UNK-1) UNK1-F1 CCATGAGCGGTTTCACGAA (SEQ ID NO. 4) 1451446 1451428 5' 6-FAM
UNK1-MGB1 CGGGCAATCAAC (SEQ ID NO. 6) 1451426 1451415
С (SEQ ID NO. 7)
1656479 1656503 5' 6-FAM
UNK2-MGB1 TGCGACCAACACGC (SEQ ID NO. 9) 1656525 1656538

Образцы фекалий, демонстрировавшие высокую концентрацию ДНК по результатам ген-специфического анализа EPS B.infantis 35624, но негативные реакции при проведении В.infantis 35624 неизвестный ген-специфических анализов, использовались в дальнейшем для выделения потенциальных EPS-продуцирующих бактерий.

Пример 6 - Выделение и характеризация BL1207 из образцов фекалий.

Один миллилитр бактериальной суспензии (см. Пример 5 выше) переносят в 9,0 мл стерильного фосфатно-солевого буфера, что соответствует разбавлению 10-1. Один миллилитр этого разбавления 10-1 переносят в 9,0 мл стерильного фосфатно-солевого буфера, что соответствует разбавлению 10-2. Этот процесс повторяют до получения разбавления 10-10. Затем 0,1 мл каждого разбавления высеивают на поверхности пластин обогащенного агара для клостридий (RCA) (BD или эквивалентный) и пластин агара для Lactobacillus Man-Rogosa Sharpe (MRSA) (BD или эквивалентный). Пластины инкубируют в анаэробных условиях (анаэробная камера COY) при 33±2°С в течение 48-72 часов.

После инкубации отбирают отдельные колонии (в общей сложности приблизительно 100 колоний) с пластин RCA и MRSA и высеивают штрихом на новые пластины для очистки изолята. Пластины с высеянными штрихом колониями инкубируют в анаэробных условиях (анаэробная камера COY) при 33±2°С в течение 48-72 часов. После инкубации, чистые колонии, полученные на пластинках, используют для экстракции ДНК.

Скрининг изолятов фекалий с использованием трех анализов TaqMan ПЦР в реальном времени

Бактериальную ДНК экстрагируют с использованием системы Preman™ Ultra Sample Preparation Reagent and Protocol (Applied Biosystems). ДНК затем анализируют с использованием трех анализов TaqMan RT-PCR (EPS ген-специфический анализ [EPS-1] и двух В.infantis 35624 неизвестный ген-специфических анализов [UNK1 и UNK2], как описано выше в Примере 5. Только один изолят продемонстрировал позитивный B.infantis 35624 EPS ген-специфический анализ, но негативные В.infantis 35624 неизвестный ген-специфические анализы. Этот изолят был затем идентифицирован путем секвенирования 16S рДНК.

Идентификация потенциально EPS-продуцирующего штамма путем секвенирования 16S рДНК.

Амплифицируют фрагмент гена 16S рРНК и секвенируют с использованием набора для ПЦР ABI Full Gene PCR (Applied Biosystems, Foster City, CA).

(1) Амплификация гена 16S рРНК:

ПЦР-амплификацию проводят с помощью термоциклера GeneAmp PCR System 9700 со следующей программой:

Начальное выдерживание: 95°С в течение 10 минут
30 циклов: 95°С в течение 30 секунд (денатурация)
60°С в течение 30 секунд (отжиг)
72°С в течение 45 секунд (удлинение)
Конечное наращивание: 72°С в течение 10 минут

(2) Секвенирование гена 16S рРНК:

Секвенирование затем проводят в термоциклере с использованием следующей программы:

25 циклов: 96°С в течение 10 секунд (денатурация)
50°С в течение 5 секунд (отжиг)
60°С в течение 4 минут (удлинение)
Конечная стадия выдерживание при 4°С

Продукт ПЦР-секвенирования далее очищают с помощью набора для выделения ДНК DyeEX™ 2.0 и секвенируют с помощью прибора 3130 xl Genetic Analyzer (Applied Biosystems, Foster City, CA).

(3) Анализ данных последовательности:

Сравнение консенсусных последовательностей с последовательностями GenBank проводят с использованием Basic Local Alignment Search Tool (BLAST). Поиск в GenBank показал, что В infantis 35624 EPS ген-специфически позитивный, но В.infantis 35624 неизвестный ген-специфически негативный штамм представляет собой Bifidobacterium longum. Этот штамм обозначен BL1207.

Пример 7 - Выделение и скрининг EPS-экспрессирующих штаммов Bifidobacterium longum

Выделение бактериальных штаммов

Бактерии выделяют из тканей кишечника и/или образцов фекалий с использованием методологии, описанной в Примере 1 выше. В частности, штамм Bifidobacterium longum AH121A выделяют из ткани кишечника кошки и штамм Bifidobacterium longum AH1714 выделяют из ткани, полученной при биопсии толстой кишки здоровых людей.

Скрининг генного кластера EPS

Бактериальные штаммы подвергали скринингу на присутствие генов из кластера 1 EPS (Таблица 2 выше) и кластера 2 EPS (Таблица 3 выше) с использованием праймеров, перечисленных в Таблицах 5 и 6, ниже. Вкратце, для ПЦР-скрининга генного кластера EPS используют следующую методологию:

Инокулируют асептически 10 мл модифицированной бульонной питательной среды Rogosa (+0,05% цистеина) свежевыращенной колонией бактериального штамма и инкубируют анаэробно при 37°С до помутнения (от примерно 16 до примерно 24 часов). Бульонные культуры центрифугируют и ДНК выделяют из полученного осадка, используя процедуру экстракции Sigma™. Используют нанокаплю для установления концентрации ДНК в образце и образцы разбавляют обработанной диэтилпирокарбонатом стерильной водой до конечной концентрации 50 нг/мкл ДНК на образец. Образцы матричной ДНК используют в индивидуальных ПЦР-реакциях с наборами праймеров, перечисленными в Таблицах 5 и 6 ниже, в следующих условиях:

Стадия Температура (°С) Время (с)
1 95 240
2 95 45
3 60 45
4 72 45 стадии 2-4 повторяют 25 раз
5 4 выдерживание

Праймеры были специально предназначены для амплификации продукта ПЦР размером приблизительно 500 пар оснований для 40 генов кластеров 1 и 2 EPS. Продукты ПЦР визуализируют после электрофореза на агарозном геле с соответствующей линейкой ДНК-маркеров молекулярного веса для сравнительного определения размера. Присутствие (ДА) или отсутствие (НЕТ) 500 п.о. продукта ПЦР указано в Таблицах 7 и 8 ниже.

Таблица 5
Праймеры для скрининга бактериальных штаммов на присутствие генов из кластера 1 EPS
Ген Название праймера LRFR Последовательность SEQ ID NO.
BI00778 1.01 L tat gtt gcc ggc att tat ca SEQ ID NO. 13
BI00778 1.01 R tgc gcg ttc atg tea ata at SEQ ID NO. 14
BI00779 1.02 L ggc gta gca agt tea agg ag SEQ ID NO. 15
BI00779 1.02 R aat aac cgc tgc agg aac ac SEQ ID NO. 16
BI00780 1.03 L gtg cag gac ggt aat gga gt SEQ ID NO. 17
BI00780 1.03 R get teg ggt ctg gat cat ta SEQ ID NO. 18
BI00781 1.04 L tgc tga caa gtg gag tct gg SEQ ID NO. 19
BI00781 1.04 R cca cgt eta cga gca act ca SEQ ID NO. 20
BI00782 1.05 L gaa age gaa gag tgg tct gg SEQ ID NO. 21
BI00782 1.05 R ccg get gat ttg atg aga tt SEQ ID NO. 22
BI00783 1.06 L tgc cgc tgt act ggt cac SEQ ID NO. 23
BI00783 1.06 R gca tgt gcc aac age tea SEQ ID NO. 24
BI00784 1.07 L cca аса cgt ate tgg cac tg SEQ ID NO. 25
BI00784 1.07 R teg gag cca aag aag gta ga SEQ ID NO. 26
BI00785 1.08 L ata ccg cgt atg ctt tgg ac SEQ ID NO. 27
BI00785 1.08 R aaa egg taa cca etc get tg SEQ ID NO. 28
BI00786 1.09 L atg gga teg atg cat gaa at SEQ ID NO. 29
BI00786 1.09 R ttc teg gca ata aac cgt tc SEQ ID NO. 30
BI00787 1.10 L cca gcg gtt att teg ttg tt SEQ ID NO. 31
BI00787 1.10 R ggt ggc atg ate ctt atg ct SEQ ID NO. 32
BI00788 1.11 L get ate ttc ace gca ttg gt SEQ ID NO. 33
BI00788 1.11 R cca gtc agg gaa ggt cac at SEQ ID NO. 34
BI00789 1.12 L tga aat аса cgc aac ccg ta SEQ ID NO. 35
BI00789 1.12 R aatgcgtcaaaaccgatacc SEQ ID NO. 36
BI00790 1.13 L gga aag caa tga gga age tg SEQ ID NO. 37
BI00790 1.13 R gat ttg atg caa age aag ca SEQ ID NO. 38
BI00791 1.14 L gtg agt ace gtt tec gca at SEQ ID NO. 39
BI00791 1.14 R ttc ctt ggt tec cgt gat ag SEQ ID NO. 40
BI00792 1.15 L get ggg att ttg gaa gtg aa SEQ ID NO. 41
BI00792 1.15 R tgt tac ccc egg cat aat aa SEQ ID NO. 42
BI00793 1.16 L ace ggt aac gtt cag att gc SEQ ID NO. 43
BI00793 1.16 R gca ata ccg cct tga cct ta SEQ ID NO. 44
BI00794 1.17 L ttg tac cac cac acg tac eg SEQ ID NO. 45
BI00794 1.17 R cgc gag ttc aat ggc tat g SEQ ID NO. 46
BI00795 1.18 L аса teg ace tec ate tec ag SEQ ID NO. 47
BI00795 1.18 R ata cgt aac age ggc tec ac SEQ ID NO. 48
BI00796 1.19 L aag tac gat gtg cgc tac ca SEQ ID NO. 49
BI00796 1.19 R cat cac ggt cag gat gtc ac SEQ ID NO. 50
BI00797 1.20 L cga ata cac gga cat caa eg SEQ ID NO. 51
BI00797 1.20 R gag aat cga gca get gga ac SEQ ID NO. 52
BI00798 1.21 L tgg gag agg agt tea teg ac SEQ ID NO. 53
BI00798 1.21 R gta tec age cat gcg taa cc SEQ ID NO. 54
Таблица 6
Праймеры для скрининга бактериальных штаммов на присутствие генов из EPS кластера 2
Ген Название праймера LRFR Последовательность SEQ ID NO.
BI00319 2.01 L acg gac tea aaa cca cca tc SEQ ID NO. 55
BI00319 2.01 R ace ctg ctt ccg gta ctt tt SEQ ID NO. 56
BI00320 2.02 L gcc tac gca aga cct tat gc SEQ ID NO. 57
BI00320 2.02 R cgt tat acg cgt get tga ga SEQ ID NO. 58
BI00321 2.03 L tgg aac gca ata ttc aac ga SEQ ID NO. 59
BI00321 2.03 R cca agt atg get cca cga at SEQ ID NO. 60
BI00423t 2.04 L acg cct gtc tat ggt tgg aa SEQ ID NO. 61
BI00423t 2.04 R egg tag gac teg ttc teg tc SEQ ID NO. 62
BI00322 2.05 L teg agg ttc gag gtg aag at SEQ ID NO. 63
BI00322 2.05 R cct gtt cga gaa gga gaa eg SEQ ID NO. 64
BI00323 2.06 L atg gaa gca tgt ggt cct tc SEQ ID NO. 65
BI00323 2.06 R att tec tgg tgg tgt cgt tc SEQ ID NO. 66
BI00324 2.07 L atg gcg aaa ctg ttg gac tc SEQ ID NO. 67
BI00324 2.07 R get ace gtg cct tct cat tc SEQ ID NO. 68
BI00325 2.08 L gee gaa teg ctt ttg aaa ta SEQ ID NO. 69
BI00325 2.08 R aaa tec tea teg ggg aaa ac SEQ ID NO. 70
BI00326 2.09 L gtt tat ttt cgc cgt gee ta SEQ ID NO. 71
BI00326 2.09 R aat tec aat ggc ttt tgc tg SEQ ID NO. 72
BI00327 2.10 L atg tgc gaa tec gac ata ca SEQ ID NO. 73
BI00327 2.10 R tgc tta tct cgt ccc cat tc SEQ ID NO. 74
BI00328 2.11 L gca aaa tgc ttg get tct tc SEQ ID NO. 75
BI00328 2.11 R ctg gat tec gat gat get tt SEQ ID NO. 76
BI00329 2.12 L ctg cac gta teg gga ttt tt SEQ ID NO. 77
BI00329 2.12 R etc ggc aga gga cag gat ag SEQ ID NO. 78
BI00330 2.13 L gat cat cga cac gca atg ac SEQ ID NO. 79
BI00330 2.13 R taa ggc cat cct cat caa gg SEQ ID NO. 80
BI00331 2.14 L tct ggg gaa age agg tta tg SEQ ID NO. 81
BI00331 2.14 R ctg tgc ggt ace tgt ttg tg SEQ ID NO. 82
BI00332 2.15 L aat tac gtc ccg atg etc ac SEQ ID NO. 83
BI00332 2.15 R caa tac ace ggc ttg gaa gt SEQ ID NO. 84
BI00333 2.16 L tgt aga cct tgt cgc tea eg SEQ ID NO. 85
BI00333 2.16 R gca teg gtg acg get ata at SEQ ID NO. 86
BI00334 2.17 L gtg etc gac aag ctg acg ta SEQ ID NO. 87
BI00334 2.17 R gtg ttc cgc ata cca ate g SEQ ID NO. 88
BI00335 2.18 L ggc gag tgc ace aaa taa at SEQ ID NO. 89
BI00335 2.18 R cga ttc cgt eta ttg gtt eg SEQ ID NO. 90
BI00336 2.19 L ata agt ccg gtg gca ate ag SEQ ID NO. 91
BI00336 2.19 R caa tgg atg ata egg tgc tg SEQ ID NO. 92
Таблица 7
Результаты скрининга гена кластера 1 EPS
Ген Набор праймеров B.longum 35624 В.longum 1207 В.longum АН121А В.longum 1714
BI00778 1.01 ДА ДА НЕТ ДА
BI00779 1.02 ДА ДА НЕТ ДА
BI00780 1.03 ДА ДА НЕТ ДА
BI00781 1.04 ДА ДА ДА ДА
BI00782 1.05 ДА ДА ДА ДА
BI00783 1.06 ДА ДА ДА ДА
BI00784 1.07 ДА ДА ДА ДА
BI00785 1.08 ДА ДА ДА ДА
BI00786 1.09 ДА ДА ДА ДА
BI00787 1.10 ДА ДА ДА ДА
BI00788 1.11 ДА ДА ДА НЕТ
BI00789 1.12 ДА ДА ДА ДА
BI00790 1.13 ДА ДА ДА ДА
BI00791 1.14 ДА ДА ДА ДА
BI00792 1.15 ДА ДА ДА ДА
BI00793 1.16 ДА ДА НЕТ ДА
BI00794 1.17 ДА ДА НЕТ ДА
BI00795 1.18 ДА ДА НЕТ ДА
BI00796 1.19 ДА ДА ДА ДА
BI00797 1.20 ДА НЕТ НЕТ НЕТ
BI00798 1.21 ДА ДА ДА ДА
Где ДА указывает на присутствие и НЕТ указывает на отсутствие 500 п.о. продукта ПЦР.
Таблица 8
Результаты скрининга гена кластера 1 EPS
Ген Набор праймеров B.longum 35624 В.longum 1207 В.longum АН121А В.longum 1714
BI00319 2.01 ДА НЕТ НЕТ НЕТ
BI00320 2.02 ДА НЕТ НЕТ НЕТ
BI00321 2.03 ДА НЕТ НЕТ НЕТ
BI00423t 2.04 ДА НЕТ НЕТ НЕТ
BI00322 2.05 ДА НЕТ НЕТ НЕТ
BI00323 2.06 ДА НЕТ НЕТ НЕТ
BI00324 2.07 ДА НЕТ НЕТ НЕТ
BI00325 2.08 ДА НЕТ НЕТ НЕТ
BI00326 2.09 ДА НЕТ НЕТ НЕТ
BI00327 2.10 ДА НЕТ НЕТ НЕТ
BI00328 2.11 ДА НЕТ НЕТ НЕТ
BI00329 2.12 ДА НЕТ НЕТ НЕТ
BI00330 2.13 ДА НЕТ НЕТ НЕТ
BI00331 2.14 ДА НЕТ НЕТ НЕТ
BI00332 2.15 ДА НЕТ НЕТ НЕТ
BI00333 2.16 ДА НЕТ НЕТ НЕТ
BI00334 2.17 ДА НЕТ НЕТ НЕТ
BI00335 2.18 ДА ДА НЕТ ДА
BI00336 2.19 ДА ДА ДА ДА
Где ДА указывает на присутствие и НЕТ указывает на отсутствие 500 п.о. продукта ПЦР

Скрининг на агаре с конго красным

Скрининг на агаре с конго красным используют для фенотипического скрининга бактериальных штаммов, экспрессирующих EPS. Вкратце, 10 мл модифицированной бульонной питательной среды Rogosa (+0,05% цистеина) инокулируют асептически свежевырощенной колонией бактериального штамма и инкубируют анаэробно при 37°С до помутнения (от примерно 16 до примерно 24 часов). Бульонные культуры асептически высеивают штрихом на агаровые пластинки с конго красным и инкубируют анаэробно при 37°С в течение 48 часов. Считается, что EPS, продуцируемый как побочный продукт роста и/или метаболизма определенных штаммов, препятствует поглощению красителя конго красного, что приводит к образованию колоний сливочной/белой морфологии. Штаммы (stains), продуцирующие меньшее количество EPS, легко поглощают краситель конго красный, давая розовую/красную морфологию колоний. Штаммы, не продуцирующие EPS, окрашиваются в красный цвет и выглядят почти прозрачными на фоне красного агара.

На Фиг.6-12 представлены следующие наблюдавшиеся морфологии колоний:

Таблица 9
Морфологии колоний при скрининге на агаре с конго красным
Бактериальный штамм Морфологии колоний
В.longum 35624 (Фиг.6) Выпуклые, мукоидные, ярко-белые колонии
В.longum АН121А (Фиг.7) Выпуклые, мукоидные, ярко-белые колонии
В.longum AH1714 (Фиг.8) Выпуклые, мукоидные, ярко-белые колонии
В.longum AH0119 (Фиг.9) Выпуклые, мукоидные, бледно-розовые / беловатые колонии
В.breve UCC2003 (Фиг.10) Выпуклые, мукоидные, бледно-розовые / беловатые колонии
L.rhamnosus AH308 (Фиг.11) Плоские, полумукоидные, бледно-розовые / беловатые колонии
L.salivarius UCC1 (Фиг.12) Плоские, немукоидные, светлые/прозрачные колонии

Пример 8 - B.infantis 35624 и BL1207 индуцируют почти идентичные профили цитокинов в РВМС.

Мононуклеарные клетки периферической крови (РВМС) изолируют из свежей периферической крови человека, используя пробирки BD Vacutainer CPT (каталог BD 362761), в соответствии с инструкциями производителя. РВМС промывают и ресуспендируют в модифицированной по Дульбекко среде Игла (Dulbecco's MEM) (каталог Gibco 10569-010) плюс 25 мМ HEPES, 10% сыворотки плода коровы (каталог Sigma F4135) и 1% пенициллина/стрептомицина (каталог Sigma P0781). Высеивают 2×105 РВМС (в 200 мкл DMEM) в каждую лунку 96-луночного культурального планшета.

Бактерии выращивают в среде Difco MRS и собирают сразу после достижения стационарной фазы. Все клетки выращивают в анаэробных условиях при 37°С. Для каждых условий роста строят кривые роста (зависимость оптической плотности (OD) от числа живых клеток) и промытые клетки нормируют по числу клеток перед прибавлением к РВМС.

Бактерии (20 мкл в фосфатно-солевом буфере (PBS)) прибавляют в каждую лунку РВМС для получения общего числа бактерий, указанного для каждого эксперимента. Испытания проводились с тремя разными количествами бактерий: 1,25Е+07, 6,25Е+06 и 3,13Е+06 прибавляли в разные лунки с РВМС. Также проводился контроль без использования бактерий. Все анализы выполнялись с тремя параллельными измерениями. После 2 дней инкубирования при 37°С планшеты центрифугировали при 300×g и супернатанты удаляли и хранили в замороженном состоянии при -80°С до проведения анализа.

Цитокины в супернатантах культур анализировали с использованием 96-луночного набора для анализа фирмы Meso Scale Discovery (Gaithersburg, MD; каталог K15008 В-1). Интерлейкин 1-бета человека (II-1b), интерлейкин 10 (II-10), интерлейкин 12р70 (II-12р70) и фактор некроза опухолей-альфа (TNFα) определяли количественно и выражали в пикограммах на миллилитр. Каждый образец анализировали с двумя параллельными измерениями.

Фиг.2-5 показывают результаты типичного эксперимента. Для каждого представленного цитокина, В.infantis 35624 и BL1207 индуцировали почти идентичные уровни цитокинов. Эти уровни очень сильно отличаются от уровней, индуцируемых тремя другими штаммами бифидобактерий, с которыми производилось сравнение.

Пример 9 - Бифидобактерии со схожими генами EPS и высоким уровнем продуцирования EPS индуцируют значительно повышенное соотношение IL-10:IL-12 по сравнению со штаммами, не имеющими этих генов.

Мононуклеарные клетки периферической крови (РВМС) изолируют из периферической крови здорового человека с помощью пробирок BD Vacutainer СРТ (BD каталог 362761), в соответствии с инструкциями производителя. РВМС промывают и ресуспендируют в Dulbecco's Modified Eagle Medium (модифицированная по Дульбекко среда Игла)-Glutamax™ (Glutamax (заменитель глутамина) + пируват + 4,5 г/л глюкозы (каталог Gibco 10569-010), 10% сыворотке плода коровы (каталог Sigma F4135) и 1% пенициллина/стрептомицина (каталог Sigma P0781). Инкубируют РВМС (2×105 клеток на лунку) в плоскодонных 96-луночных планшетах и прибавляют 20 мкл бактериальной суспензии (с концентрацией 1×107 КОЕ/мл). Ко-инкубируют РВМС с бактериями в течение 48 часов при 37°С / 5% СО2 в инкубаторе. После 2-дневного периода инкубирования, планшеты центрифугируют при 300×g и супернатанты отбирают и хранят замороженными при -80°С до проведения анализа. Количественно определяют кровни интерлейкина-10 (IL-10) и интерлейкина-12р70 (IL-12p70) в супернатантах культур с использованием 96-луночного набора для анализов фирмы Meso Scale Discovery (Gaithersburg, MD; каталог K15008B-1)

Бактерии готовят для экспериментов с сокультивированием в двух форматах, (а) Свежевырощенные бактерии выращивают в среде Difco MRS и собирают сразу после перехода в стационарную фазу. Все клетки выращивают в анаэробных условиях при 37°С. (b) Бактерии выращивают в анаэробных условиях при 37°С в среде Difco MRS и собирают сразу после перехода в стационарную фазу. Лиофилизированные порошки получают для каждой из таких бактерий и хранят при -80°С во флаконах на 100 мг с предварительно отмерянными аликвотами. Непосредственно перед использованием, одну аликвоту каждого штамма вынимают из морозильной камеры и дают ей согреться до комнатной температуры. Каждый штамм промывают 3 раза по 10 мл раствора Рингера (ringers) с последующим центрифугированием. Каждый раз используют свежий флакон. Строят кривые роста (зависимость оптической плотности (OD) от числа живых клеток) для каждых условий выращивания и промытые клетки нормируют по числу клеток перед прибавлением к РВМС. Все эксперименты также включают безбактериальный контроль. Все анализы проводят с тремя параллельными измерениями.

Бифидобактерии, содержавшие многие гены EPS, проявляли схожий эффект воздействия на индукцию IL-10:IL-12, в то время как бактериальные штаммы, не содержащие гены EPS, индуцировали значительно более низкое соотношение IL-10:IL-12 (Фиг.13). Как свежевыращенные, так и лиофилизированные культуры проявляли аналогичный эффект, выражавшийся в том, что штаммы, содержащие схожие гены EPS, индуцировали более высокое соотношение IL-10:IL-12, чем штаммы, не содержащие этих генов.

Контроль воспалительных заболеваний проявляется на ряде уровней. Факторы контроля включают гормоны, простагландины, реакционноспособные промежуточные соединения кислорода и азота, лейкотриены и цитокины. Цитокины представляют собой низкомолекулярные биологически активные белки, вовлеченные в вырабатывание и контроль иммунологических и воспалительных ответов. Ряд клеточных типов продуцируют такие цитокины, причем основными источниками при воспалительных реакциях являются нейтрофилы, моноциты и лимфоциты вследствие их больших количеств на месте поражения.

Существуют многочисленные механизмы, по которым цитокины генерируют воспалительный ответ в местах воспаления. Хемотаксис стимулирует хоминг воспалительных клеток к месту повреждения, а определенные цитокины промотируют инфильтрацию клеток в ткань. Цитокины, выделяемые в пораженной ткани, приводят к активации воспалительного инфильтрата. Большинство цитокинов являются плейотропными и экспрессируют множество биологически перекрывающихся активностей. Неконтролируемые воспалительные ответы могут привести к заболеваниям, таким как IBD (болезнь раздраженного кишечника), и есть основания предполагать, что у лиц, страдающих такими болезнями, нарушено продуцирование цитокинов.

Интерлейкин-10 (IL-10) представляет собой противовоспалительный цитокин, который продуцируется многими типами клеток, включая моноциты, макрофаги, дендритные клетки, мастоциты и лимфоциты (в частности, регуляторные Т-клетки). IL-10 осуществляет понижающую регуляцию экспрессии провоспалительных цитокинов Th1, антигенов МНС класса II и костимулирующих молекул на антиген-презентирующих клетках. Он также увеличивает выживаемость В-клеток, пролиферацию и продуцирование антител. Этот цитокин может блокировать активность NF-κВ, вовлечен в регуляцию сигнального пути JAK-STAT. Исследования на нокаут-мышах продемонстрировали существенную роль IL-10 в иммунорегуляции, поскольку у IL-10KO-мышей развивался тяжелый колит. Кроме того, было показано, что бактерии, являющиеся сильными индукторами IL-10, промотируют дифференцировку регуляторных Т-клеток in vivo, тем самым внося свой вклад в иммунологический гомеостаз (O'Mahony et al., AJP 2006; O'Mahony et al., PLoS Pathogens 2008).

Интерлейкин-12 (IL-12) поедставляет собой провоспалительный цитокин, ассоциированный с поляризацией Th1-эффекторных Т-клеточных ответов и стимулирует продуцирование других провоспалительных Th1 цитокинов, таких как интерферон-гамма (IFN-γ) и фактор некроза опухолей-альфа (TNF-α), Т-клетками и природными клетками-убийцами (NK). Высокие уровни экспрессии IL-12 ассоциированы с аутоиммунитетом. Было показано, что введение IL-12 лицам, страдающим от аутоиммунных заболеваний, ухудшает симптомы болезни. В отличие от этого, IL-12-нокаут-мыши или введение мышам антител, нейтрализующих IL-12, ослабляло заболевание.

Воспалительный ответ контролируется цитокиновыми каскадами и сетями, а не действием конкретного цитокина на конкретный тип клеток. Относительные уровни экспрессии, или баланс, двух цитокинов (таких как IL-10 и IL-12) являются более информативными, чем экспрессия одного цитокина. В этих исследованиях мы стимулировали РВМС человека рядом различных бактериальных штаммов. Все штаммы индуцировали IL-10 и все штаммы индуцировали IL-12. Однако анализ соотношения между индукцией IL-10 и IL-12 показал, что некоторые бактериальные штаммы индуцировали более высокую величину соотношения (то есть, больше IL-10 и меньше IL-12) по сравнению с другими штаммами. Это важное наблюдение, поскольку именно баланс таких противодействующих сигналов в конечном счете определяет иммунологический исход. Ожидается, что высокое соотношение IL-10:IL-12 будет промотировать противовоспалительный ответ, ассоциированный с соответствующей иммунорегуляторной активностью, в то время как низкое соотношение IL-10:IL-12 будет способствовать ТП1-поляризации иммунного ответа. Таким образом, соотношение IL-10:IL-12 РВМС является важным критерием выбора при идентификации бактериальных штаммов, обладающих иммунорегуляторными свойствами.

Размеры и значения величин, раскрытые тут, не следует понимать как строго ограниченные приведенными точными численными значениями. Вместо этого, если не указано иное, каждый такой размер должен обозначать как приведенное значение, так и функционально эквивалентый интервал, окружающий данное значение. Например, размер, раскрытый как "40 мм", должен обозначать "примерно 40 мм".

Все документы, упоминаемые в детальном описании изобретения, в релевантной части, включаются сюда в качестве ссылок; упоминание любого документа не должно истолковываться как допущение того, что он представляет собой известный уровень техники по отношению к настоящему изобретению. В той степени, в которой любое значение или определение термина в данном документе противоречит любому значению или определению этого же термина в документе, включенном в качестве ссылки, главенствующим должно считаться значение или определение, указанное для такого термина в данном документе.

Хотя были проиллюстрированы и описаны конкретные варианты исполнения настоящего изобретения, квалифицированным специалистам в данной области техники должно быть очевидно, что различные другие изменения и модификации могут быть выполнены без выхода за пределы сущности и объема изобретения. Поэтому предполагается, что приложенная формула изобретения будет охватывать все такие изменения и модификации, входящие в объем настоящего изобретение.


Altschul, S.F., Madden, T.L, Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D.J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25, 3389-3402.

Altschul S.F., Gish W., Miller W., Myers E.W. and Lipman D.J. (1990) Basic local alignment search tool. J Mol Biol. 215: 403-410.

Bateman, A., Birney, E., Cerruti, L, Durbin, R., Etwiller, L, Eddy, S.R., Griffiths-Jones, S., Howe, K.L., Marshall, M., and Sonnhammer, E.L. (2002). The Pfam protein families database. Nucleic Acids Res 30, 276-280.

Bendtsen J.D., Nielsen H., von Heijne G. and Brunak S. (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol. 340: 783-795.

Bouhnik Y. Survival And Effects Of Bacteria Ingested In Fermented Milk In Man Lait 73(2): 241-247 1993

Busch W., Saier M.H. The Transporter Classification (TC) system, 2002 Critical Reviews In Biochemistry And Molecular Biology 37 (5): 287-337 2002

Chevalier, P. et al. (1990) J. Appl. Bacteriol 68, 619-624)

Coutinho & Henrissat, 1999

Delcher A.L., Harmon D., Kasif S., White O., Salzberg S.L. Improved microbial gene identification with GLIMMER Nucleic Acids Research 27 (23): 4636-4641 DEC 1 1999

Eddy, S.R. The HMMER software tools, (http://hmmer.janelia.org/). http://hmmerjaneliaorg/.

Eddy S.R. A memory-efficient dynamic programming algorithm for optimal alignment of a sequence to an RNA secondary structure BMC BIOINFORMATICS 3: Art. No. 18 2002

Green, P. The Phred/Phrap/Consed system home page (http://www.phrap.org). http://wwwphraporg.

Griffiths-Jones S., Moxon S., Marshall M., Khanna A., Eddy S.R., Bateman A. Rfam: annotating non-coding RNAs in complete genomes Nucleic Acids Research 33: D121-D124 Sp. Iss. SI JAN 1 2005

Krogh A., Larsson В., von Heijne G., Sonnhammer E.L.L., Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes Journal Of Molecular Biology 305 (3): 567-580 JAN 19 2001

Kurtz S., Schleiermacher C. REPuter: fast computation of maximal repeats in complete genomes Bioinformatics 15 (5): 426-427 MAY 1999

Lowe T.M., Eddy S.R. tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence Nucleic Acids Research 25 (5): 955-964 MAR 1 1997

Liu M., van Enckevort F.H., Siezen R.J., Genome update: lactic acid bacteria genome sequencing is booming Microbiology 2005, vol 151 pp 3811-3814

McCarthy et al., 2004

O'Mahony L., McCarthy J., Kelly P., Hurley G., Luo F., Chen K., O'Sullivan G.C., Kiely В., Collins J.K., Shanahan F., Quigley E.M. Lactobacillus and bifidobacterium in irritable bowel syndrome: symptom responses and relationship to cytokine profiles. Gastroenterology. 2005 Mar, 128(3):541-51.

O'Mahony et al., AJP 2006

O'Mahony et al., PLoS Pathogens 2008

Riley, 1993

Riley, 1998a

Rutherford, K., Parkhill, J., Crook, J., Horsnell, Т., Rice, P., Rajandream, M.A., and Barrell, B. (2000). Artemis: sequence visualization and annotation. Bioinformatics 16, 944-945.

Salzberg S., Delcher A.L., Fasman K.H., Henderson J. A decision tree system for finding genes in DNA Journal Of Computational Biology 5 (4): 667-680 WIN 1998

Suzek, B.E., Ermolaeva, M.D., Schreiber, M., and Salzberg, S.L. (2001). A probabilistic method for identifying start codons in bacterial genomes. Bioinformatics 17, 1123-1130.

Tatusov, R.L, The XUGNITOR software ftp://ftp.ncbi.nih.g0v/pub/COG/old/util/xugnitor.c.

Volfovsky et al, 2001

Wheeler et al, 2005

1. Изолированный штамм Bifidobacterium longum BL1207 (РТА-9608), экспрессирующий экзополисахарид, при этом указанный штамм индуцирует соотношение [IL10]:[IL12], равное по меньшей мере 10, по результатам анализа ко-инкубированием с мононуклеарными клетками периферической крови (РМВС), при концентрации бактерий 1×107 КОЕ/мл.

2. Изолированный штамм Bifidobacterium longum АН121А (NCIMB 41675), экспрессирующий экзополисахарид, при этом указанный штамм индуцирует соотношение [IL10]:[IL12], равное по меньшей мере 10, по результатам анализа ко-инкубированием с мононуклеарными клетками периферической крови (РМВС), при концентрации бактерий 1×107 КОЕ/мл.

3. Изолированный штамм Bifidobacterium longum АН1714 (NCIMB 41676), экспрессирующий экзополисахарид, при этом указанный штамм индуцирует соотношение [IL10]:[IL12], равное по меньшей мере 10, по результатам анализа ко-инкубированием с мононуклеарными клетками периферической крови (РМВС), при концентрации бактерий 1×107 КОЕ/мл.

4. Изолированный штамм по любому из пп. 1-3, отличающийся тем, что находится в форме жизнеспособных клеток.

5. Изолированный штамм по любому из пп. 1-3, отличающийся тем, что находится в форме нежизнеспособных клеток.

6. Пробиотический состав, пригодный для приема внутрь, содержащий изолированный штамм Bifidobacterium longum по любому из пп. 1-5, и пригодный для приема внутрь носитель.

7. Пробиотический состав по п. 6, отличающийся тем, что пригодный для приема внутрь носитель представляет собой фармацевтически приемлемый носитель, такой как капсула, таблетка или порошок.

8. Пробиотический состав по п. 6, отличающийся тем, что пригодный для приема внутрь носитель представляет собой пищевой продукт, такой как сквашенное молоко, йогурт, замороженный йогурт, сухое молоко, молочный концентрат, пастообразные сырные продукты, соусы или напитки.

9. Пробиотический состав по любому из пп. 6-8, отличающийся тем, что штамм присутствует в количестве более 106 КОЕ на грамм пригодного для приема внутрь носителя.

10. Фармацевтическая пробиотическая композиция, содержащая изолированный штамм Bifidobacterium longum по любому из пп. 1-5 и фармацевтически приемлемый носитель.

11. Применение штамма Bifidobacterium longum по любому из пп. 1-5 в качестве пробиотического штамма.


Похожие патенты:

Изобретение относится к ветеринаринарной микробиологии. Питательная среда для выявления возбудителя некробактериоза содержит среду 199, сыворотку крови крупного рогатого скота и 40%-ный раствор глюкозы в заданных соотношениях компонентов.

Изобретение относится к области биотехнологии. Штамм Komagataeibacter xylinus депонирован во Всероссийской коллекции промышленных микроорганизмов (ВКПМ) под регистрационным номером ВКПМ В-12068.

Изобретение относится к сельскохозяйственной микробиологии. Предложен штамм клубеньковых бактерий Bradyrhizobium japonicum ВКМ B-2629D для изготовления бактериального удобрения под сою.

Изобретение относится к промышленной микробиологии. Биопрепарат содержит гидролизат, содержащий продукт анаэробной ферментации смеси листьев растений, свекольной или тростниковой мелассы и воды, взятых в заданных соотношениях, и культуральную жидкость, образованную в процессе получения микробной массы аборигенных углеводородокисляющих микроорганизмов при заданном соотношении компонентов.

Изобретение относится к области медицинской микробиологии. Изобретение представляет собой питательную среду для визуального выявления Ureaplasma urealyticum, содержащую питательную основу, стимуляторы роста, мочевину, селективные компоненты, лошадиную сыворотку, pH индикатор и дистиллированную воду.

Изобретение относится к микробиологии. Штамм бактерий Staphylococcus aureus 113, обладающий антилизоцимной активностью, депонирован в Государственной коллекции микроорганизмов нормальной микрофлоры ФБУН «МНИИЭМ им.
Изобретение относится к биотехнологии. Штамм Streptococcus salivarius М-11, обладающий высокой антагонистической активностью, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-11174 и может быть использован при производстве кисломолочных продуктов.

Предлагаемое изобретение относится к биотехнологии. Способ предусматривает приготовление питательной среды на основе осветленной творожной сыворотки, стерилизацию и охлаждение.

Изобретения относятся к области биотехнологии и касаются штамма Francisella tularensis 15/23-1ΔrecA и способа его получения. Охарактеризованный штамм является генетически маркированным: имеет только одну копию гена iglC и делетированный ген recA.

Изобретение касается применения композиции, содержащей Bifidobacterium longum АТСС ВАА-999, для поддержания уменьшения веса или сохранения веса у половозрелых людей или животных.

Изобретение относится к способу инкапсуляции лактобифадола. Указанный способ характеризуется тем, что лактобифадол диспергируют в суспензию альгината натрия в гексане в присутствии препарата Е472с при перемешивании, далее приливают четыреххлористый углерод, полученную суспензию нанокапсул отфильтровывают и сушат, при этом соотношение ядро/оболочка в нанокапсулах составляет 1:3, 1:5 или 5:1.
Изобретение относится к области ветеринарной медицины и предназначено для коррекции минерального обмена при лечении диктиокаулеза овец. Способ включает проведение дегельминтизации с помощью альбена и введение иммуномодуляторов Т-активина и В-активина и пробиотика лактоферона.

Изобретения относится к ветеринарии и может быть использовано для профилактики желудочно-кишечных болезней новорожденных телят. Для этого проводят выпаивание телятам, начиная со второй выпойки молозива, препарата из группы ЭМ.

Настоящее изобретение относится к композиции нереплицирующихся пробиотических микроорганизмов, приведенных в нерециплирующееся состояние термической обработкой при 120-140°С в течение 1-120 секунд; композиция предназначена для профилактики желудочно-кишечных инфекций, в частности от диареи у детей.

Изобретение относится к медицине, а именно к гинекологии, и может быть использовано для лечения эктопии шейки матки. За месяц до проведения коагуляции на третий день менструального цикла проводят курс иммунотерапии Пирогеналом.
Изобретение относится к биотехнологии. Штамм Streptococcus salivarius М-11, обладающий высокой антагонистической активностью, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-11174 и может быть использован при производстве кисломолочных продуктов.

Изобретение касается применения композиции, содержащей Bifidobacterium longum АТСС ВАА-999, для поддержания уменьшения веса или сохранения веса у половозрелых людей или животных.
Изобретение относится к биотехнологии. Штамм Streptococcus thermophilus Во4-I, обладающий высокой антагонистической активностью, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-10893 и может быть использован при производстве кисломолочных продуктов и пробиотических препаратов.
Изобретение относится к биотехнологии. Штамм Lactobacillus plantarum В2-II, обладающий высоко антагонистической активностью, депонирован во Всероссийской коллекции промышленных микроорганизмов под регистрационным номером ВКПМ В-10816 и может быть использован при производстве кисломолочных продуктов и пробиотических препаратов.
Изобретение относится к биотехнологии. Штамм Streptococcus salivarius М-9, обладающий высокой антагонистической активностью, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-11177 и может быть использован при производстве кисломолочных продуктов и пробиотических препаратов.

Изобретение относится к общественному питанию, в частности к производству формованных кулинарных изделий для питания детей школьного возраста. Способ производства формованных кулинарных изделий в виде сырников предусматривает подготовку сырья, приготовление смеси путем соединения творога, яиц, муки пшеничной высшего сорта, сахара, формование полуфабрикатов, их панирование и термическую обработку.

Представленная группа изобретений касается штаммов Bifidobacterium longum и их применений в качестве пробиотиков в виде различных составов и композиций. Изолированные штаммы Bifidobacterium longum BL1207, AH121A, AH1714 экспрессируют экзополисахарид и индуцируют соотношение [IL10]:[IL12], равное, по меньшей мере, 10, по результатам анализа ко-инкубированием с мононуклеарными клетками периферической крови, при концентрации бактерий 1×107 КОЕмл. Представленные изобретения могут быть использованы в медицине в качестве пробиотических составов и композиций. 6 н. и 5 з.п. ф-лы, 13 ил., 9 табл., 9 пр.
