Олигонуклеотидные праймеры и флуоресцентно-меченый зонд для идентификации днк вируса оспы свиней методом полимеразной цепной реакции в режиме реального времени

Изобретение относится к области биотехнологии, а именно к набору для выявления ДНК вируса оспы свиней методом полимеразной цепной реакции в реальном времени. Набор включает олигонуклеотидные праймеры и флуоресцентно-меченый зонд следующего состава: SPVU - 5' - gta сса ttt tgg agg аса cg - 3', SPVD - 5' - ttc aat aaa tcg cca gtt gta с - 3', SPVZ - 5'- [FAM] ggt acc ata tct ata tat ccc tgt tg [BHQ1] - 3'. Предложенное изобретение позволяет повысить степень специфичности и чувствительности, а также сокращает время проведения диагностической работы по обнаружению ДНК вируса оспы свиней в пробах исследуемого биоматериала. 1 табл., 3 пр.

 

Вирус оспы свиней - это единственный представитель рода Suipoxvirus, одного из 8 родов в подсемействе Chordopoxvirinae семейства Poxviridae. Оспа свиней - повсеместно распространенная контагиозная болезнь, протекающая с признаками интоксикации, лихородки, узелково-папулезной сыпи на коже и слизистой оболочке. Наиболее тяжело болезнь протекает у поросят (до 4 месяцев), заболеваемость среди которых может достигать 100% [8].

Источник возбудителя - больные животные, выделяющие вирус с оспенными корочками, со слюной, истечениями из глаз и носа. В организм животных вирус проникает респираторным путем, через кожу и слизистые оболочки, через пищеварительный тракт. Факторы передачи возбудителя - объекты внешней среды (особенно трупы погибших животных, кожа, шкуры), контаминированные возбудителем. Механическими переносчиками оспенных вирусов могут быть грызуны, москиты, накожные паразиты, в частности свиная вошь Haematopinus suis, у которой они могут сохраняться до года и более. Вспышки заболевания встречаются в течение круглого года, но чаще возникают и тяжелее протекают зимой и весной. Болезнь быстро охватывает до 80% поголовья, но у каждого животного она протекает сравнительно медленно - в течение 20-60 дней [1, 2, 5, 6].

Оспу свиней также могут вызывать представители рода Orthopoxvirus - вирусы оспы коров и осповакцины. Тем не менее свиньи, переболевшие оспой, вызванной вирусом оспы свиней, сохраняют восприимчивость к вирусам оспы коров и осповакцины, и наоборот [1]. Поэтому возникает необходимость в четкой идентификации вируса, вызвавшего болезнь у свиней. В настоящее время наиболее быстрым и специфичным методом идентификации возбудителей вирусных инфекций является полимеразная цепная реакция (ПЦР). В России и за рубежом разработано большое количество тест-систем на основе молекулярно-генетических методов для диагностики инфекций, вызываемых поксвирусами, в том числе и вирусом коровьей оспы [3, 4, 7]. В то же время тест-системы на основе ПЦР для идентификации вируса оспы свиней не разработаны.

Целью данного изобретения является разработка олигонуклеотидных праймеров и флуоресцентно-меченого зонда для выявления ДНК вируса оспы свиней в различных образцах биоматериала методом ПЦР в реальном времени.

Изобретение представляет собой олигонуклеотидные праймеры SPVU и SPVD и флуоресцентно-меченый зонд SPVZ, характеризующиеся тем, что они комплементарны фрагменту гена ингибитора протеинкиназы (SPV032) вируса оспы свиней. Нуклеотидный состав используемых праймеров и зонда следующий:

SPVU - 5' - gta сса ttt tgg agg аса eg - 3'

SPVD - 5' - ttc aat aaa tcg cca gtt gta с - 3'

SPVZ - 5'- [FAM] ggt acc ata tct ata tat ccc tgt tg [BHQ1] - 3'

Техническим результатом изобретения является повышение степени специфичности и чувствительности, а также сокращение времени проведения диагностической работы по обнаружению ДНК вируса оспы свиней в пробах исследуемого биоматериала (смывы с ротовой и носовой полостей, суспензии струпьев от больных свиней, культуры клеток).

Сущность изобретения состоит в том, что при помощи указанных праймеров (SPVU и SPVD) и зонда (SPVZ) проводят ПЦР в реальном времени, позволяющую выявить ДНК вируса оспы свиней. При наличии в исследуемых образцах ДНК вируса оспы свиней в ходе ПЦР синтезируется фрагмент ДНК размером 79 пар оснований.

Детекция продуктов амплификации осуществляется методом регистрации флуоресценции, генерируемой в результате разрушения гибридизационного зонда, содержащего на 5'-конце флуорофор FAM, а на 3'-конце - гаситель BHQ1. В отсутствие мишени флуорофор и гаситель сближены, и наблюдается лишь незначительная флуоресценция, так как гаситель поглощает испускаемое флуорофором излучение. При накоплении в ходе ПЦР специфических продуктов зонд гибридизуется на ампликон, что ведет к его разрушению за счет 5'-экзонуклеазной активности Taq-полимеразы. В результате флуорофор отделяется от гасителя и его излучение может быть детектировано. Таким образом, увеличение флуоресценции прямо пропорционально количеству синтезированного ПЦР-продукта.

Существенным отличием данных праймеров и зонда является то, что они комплементарны консервативной области гена ингибитора протеинкиназы (SPV032) вируса оспы свиней и не комплементарны каким-либо участкам геномов других вирусов.

Изобретение иллюстрируется несколькими примерами.

Пример 1. Амплификация фрагмента ДНК вируса оспы свиней.

Расчет первичной структуры олигонуклеотидных праймеров и зонда.

С помощью программы "Bio Edit 7.0" выравнены доступные в базе данных GenBank нуклеотидные последовательности геномов вирусов оспы свиней (AF410153.1), нодулярного дерматита (AF409138.1, AF325528.1), осповакцины (М14783.1, DQ121394.1, EU410304.1), оспы коров (КС813512.1, AF482758.2, КС813511.1), оспы овец (AY077832.1, AY077834.1, AY077833.1) и оспы коз (AY077836.1, AY077835.1). В результате проведенного анализа в качестве мишени для амплификации в полимеразной цепной реакции выбран ген ингибитора протеинкиназы (SPV032) вируса оспы свиней.

С помощью программы "Oligo 6.0" рассчитаны первичные структуры олигонуклеотидных праймеров, фланкирующих выбранный участок генома. Для детекции продуктов амплификации подобран олигонуклеотидный флуоресцентно-меченый зонд, комплементарный участку нуклеотидной последовательности, ограниченной позициями отжига праймеров SPVU и SPVD (нуклеотидные позиции 5'→3':25709-25787).

ПЦР в реальном времени проводили на детектирующем амплификаторе "Rotor Gene 6000" (Corbett Research, Австралия). Температурный режим для проведения ПЦР включает следующие этапы: 2 мин предварительной денатурации при 94°C и 40 циклов амплификации (94°C - 10 с, 60°C - 15 с). Измерение флуоресценции проводили при температуре 60°C по каналу "Green" (FAM). Результаты ПЦР анализировали с помощью программного обеспечения амплификатора.

Результаты интерпретировали на основании наличия/отсутствия пересечения кривой флуоресценции с установленной на уровне 0,02 пороговой линией (Threshold). Образец считали положительным на наличие ДНК вируса оспы свиней, если кривая флуоресценции пересекала пороговую линию не позднее 35 цикла амплификации.

Пример 2. Определение специфичности ПЦР в реальном времени.

ДНК из исследуемого материала выделяли с использованием комплекта реагентов для выделения ДНК, входящего в состав набора «Тест-система для выявления ДНК вируса АЧС методом ПЦР» (ГНУ ВНИИВВиМ Россельхозакадемии).

Для оценки специфичности ПЦР в реальном времени исследовали препараты ДНК, выделенной из образцов культурального материала, содержащего вирусы оспы свиней, оспы коров, осповакцины, оспы овец, оспы коз, бугорчатки КРС, интактной культуры клеток РК-15 и из смывов с ротовой полости интактной свиньи. При этом положительный результат получен только при исследовании ДНК, выделенной из образца, содержащего вирус оспы свиней, что свидетельствует о специфичности разработанных праймеров и зонда.

Результаты ПЦР в реальном времени

Пример 3. Определение аналитической чувствительности ПЦР в реальном времени.

Аналитическую чувствительность метода определяли с использованием рекомбинантной плазмиды, содержащей амплифицируемый фрагмент геномной ДНК вируса оспы свиней. Спектрофотометрически измеренная концентрация плазмиды составила 305,5 нг/мкл, что соответствует 0,923*1010 копиям ДНК в 1 мкл.

Десятикратные разведения (в трех повторах) данной плазмиды использовали для определения аналитической чувствительности ПЦР в реальном времени. Пределом чувствительности считали максимальное разведение, при котором регистрировали положительный результат. Рассчитанное значение аналитической чувствительности метода ПЦР в реальном времени составило 9 копий ДНК/мкл, что соответствует 45 копиям ДНК в реакционной смеси.

Источники информации

1. В.Н. Сюрин. Вирусные болезни животных / В.Н. Сюрин, А.Я. Самуйленко, Б.В. Соловьев, Н.В. Фомина. - Москва, ВНИТИБП. - 1998. - 928 с.

2. Cheville, N.F. The cytopathology of swine pox in the skin of swine / N.F. Cheville // Am. J. Pathol. - 1996. - Vol.49. - P. 339-352.

3. Cowpox virus in a 12-year-old boy: rapid identification by an orthopoxvirus-specific polymerase chain reaction / Р. Schupp [et. al] // Br. J. Dermatol. - 2001. - Vol.145. - P. 146-150.

4. Development of real-time PCR assay for specific detection of cowpox virus / E.V. Gavrilova [et. al] // J. Clin. Virol. - 2010. - Vol.49. - №1. - P. 37-40.

5. House, J.A. Swine pox / J.A. House, C.A. House // Diseases of swine, 7th ed. - Iowa State University Press, Ames. - 1994. - P. 358-361.

6. Munz, E. Swinepox / E. Munz, K. Dumbell // Infectious diseases of livestock, vol.1. Oxford University Press, New York, N.Y. - 1994. - P. 627-629.

7. Real-Time PCR system for detection of orthopoxviruses and simultaneous identification of smallpox virus / V.A. Olson [et al.] // J. Clin. Microbiol. - 2004. - V.42. - P. 1940-1946.

8. The genome of swinepox virus / E.R. Afonso [et al.] // J. of Virology. - 2002. - Vol.76. - №2. - P. 783-790.

Набор для выявления ДНК вируса оспы свиней методом полимеразной цепной реакции в реальном времени, включающий олигонуклеотидные праймеры и флуоресцентно-меченый зонд следующего состава:



 

Похожие патенты:

Изобретение относится к области биотехнологии. Способ обнаружения вещества, которое опосредует положительную регуляцию транскрипции гена биологического маркера, или определения, опосредует ли вещество положительную регуляцию транскрипции гена биологического маркера, состоит из следующих этапов: обеспечение первой системы анализа, включающей последовательность мРНК, которая содержит область, кодирующую первый репортерный белок, функционально связанную с промотором первого биологического маркера; обеспечение второй системы анализа, включающей вторую последовательность мРНК, которая содержит область, кодирующую второй репортерный белок, функционально связанную с промотором второго биологического маркера; осуществление контакта указанной второй системы анализа с веществом; осуществления контакта указанной первой системы анализа со стандартным веществом или контрольным веществом и определение уровней транскрипции указанных первой и второй последовательностей мРНК.

Изобретение относится к биотехнологии и представляет собой выделенную нуклеиновую кислоту для типирования и/или маркировки штаммов Bifidobacterium lactis, состоящую из последовательности локуса CRISPR В.lactis, выбранной из группы, состоящей из a) Balal (SEQ ID NO: 1); b) последовательности повтора Balal, выбранной из последовательности SEQ ID NO: 2 и ее вариантов; c) последовательности спейсера Balal, выбранной из SEQ ID NO:3-24; где варианты последовательности SEQ ID NO: 2 выбраны из группы, состоящей из: замены Т в положении 12, замены Т в положении 14 и замены А в положении 36.
Изобретение относится к биотехнологии, а именно к способу диагностики хронической сердечной недостаточности (ХСН). Способ включает исследование крови человека методом полимеразной цепной реакции с гибридизационно-флуоресцентной детекцией продуктов амплификации.
Изобретение относится к биотехнологии, а именно к способу диагностики хронической сердечной недостаточности (ХСН). Способ включает исследование крови человека методом полимеразной цепной реакции с гибридизационно-флуоресцентной детекцией продуктов амплификации.

Изобретение относится к биотехнологии. Предложен способ определения наличия в биологических жидкостях, окружающей среде и продуктах питания бактерий Escherichia coli штамма O157:Н7, включающий дезинтеграцию бактерий ферментативной обработкой и лизис неионным детергентом, адсорбцию на парамагнитных частицах при помощи специфического моноклонального антитела, детекцию антигена бактерий Е.coli O157:Н7 при помощи специфического биотинилированного моноклонального антитела, связывание полученного комплекса с нековалентным коньюгатом ДНК-матрицы с нейтравидином, диссоциацию твердофазного комплекса "антитело-антиген Е.coli O157:Н7 - биотинилированное антитело-коньюгат" добавлением раствора глицин - HCl рН 2.6, ПЦР-амплификацию ДНК-матрицы и выявление наличия бактерий Е.coli O157:Н7 по скорости нарастания флуоресцентного сигнала.

Изобретение касается способа дифференциальной диагностики новообразований щитовидной железы (ЩЖ) человека. Способ включает выделение из образца опухолевой ткани ЩЖ человека и образца прилежащей неизмененной ткани железы (в качестве контроля) суммарного пула РНК (в том числе содержащий и микроРНК) любым из известных способов.

Изобретение относится к медицине, а именно к акушерству и гинекологии, и предназначено для выявления риска развития и степени тяжести преэклампсии. Для прогнозирования риска возникновения преэклампсии тяжелого течения у женщин русской национальности, уроженок Центрального Черноземья, выделяют ДНК из периферической венозной крови и анализируют генетические полиморфизмы: -308 G/A TNFα (rs1800629), +36 A/G TNFR1 (rs767455), -801 G/A SDF 1(rs1801157), C/G MCP-1 (rs285765).

Изобретение относится к медицине, а именно к акушерству и гинекологии, и предназначено для выявления риска развития преэклампсии. Для прогнозирования риска развития преэклампсии у женщин русской национальности, уроженок Центрального Черноземья, выделяют ДНК из периферической венозной крови и проводят анализ полиморфизмов генов цитокинов.

Изобретение относится к области биотехнологии. Предложен способ специфического выделения полного ДНК-содержимого бактериальных возбудителей инфекции.

Изобретение относится к биотехнологии, а именно к способу комбинирования определения генотипа IL28B вместе с измерением сывороточного уровня IFN-γ-индуцируемого белка 10 (IP-10) для прогнозирования получения устойчивого вирусологического ответа (SVR) или отсутствия ответа на пегинтерферон и рибавирин для индивидуальных пациентов, инфицированных HCV, а также к диагностическому набору для применения в данном способе.

Изобретение относится к биотехнологии, а именно к выделенному пептиду, который имеет индуцибельность цитотоксических Т-лимфоцитов (CTL), а также к его применению. Предложенный пептид может использоваться в противораковой иммунотерапии, более конкретно, в противораковых вакцинах.

Группа изобретений относится к области биотехнологии, в частности к антисмысловым олигомерам, используемым в качестве активного ингредиента в фармацевтических композициях для лечения мышечной дистрофии.

Изобретение относится к биотехнологии, а именно к способам детекции нуклеиновокислотной последовательности-мишени из ДНК или смеси нуклеиновых кислот в анализе с РТОСЕ (расщеплением и удлинением РТО).

Изобретение относится к биотехнологии, а именно к последовательности ДНК-аптамеров. Указанный ДНК-аптамер связывается с шига-токсином типа 2 и представляет собой одноцепочечную ДНК AptStx2B17 длиной 81 нуклеотид и молекулярной массой 27 кДа.

Изобретение относится к биотехнологии, а именно к последовательности ДНК-аптамера. Указанный ДНК-аптамер связывается с бактериями Escherichia coli O157:Н7 и представлен одноцепочечной ДНК O157Flank длиной 81 нуклеотид и молекулярной массой 27 кДа.

Изобретение относится к биотехнологии, а именно к последовательности ДНК, которую используют в качестве зонда для обеспечения максимального соотношения «сигнал/фон» в тест-системах на основе иммуно-ПЦР.

Изобретение относится к области биотехнологии и касается способа дифференциации биоваров и геновариантов штаммов Yersinia pestis основного подвида с помощью полимеразной цепной реакции.

Изобретение относится к биотехнологии, а именно к способу захвата и амплификации избранной последовательности и набору для его осуществления. Способ включает получение субстрата, представленного твердофазной подложкой, содержащего первую и вторую популяции связанных с поверхностью олигонуклеотидов, где данные олигонуклеотиды распределены случайным образом относительно друг друга на субстрате.

Изобретение относится к области биотехнологии, конкретно к получению вариантов плазминогена и плазмина, содержащих одну или несколько точковых мутаций в каталитическом домене, которые снижают или предотвращают аутокаталитическую потерю протеазной активности плазмина, и может быть использовано в медицине.

Изобретение относится к области биохимии, в частности к соединениям и композициям для ослабления экспрессии гентингтина. Заявлены варианты одноцепочечного модифицированного олигонуклеотида, ингибирующего экспрессию гентингтина.

Изобретение относится к биотехнологии, а именно к последовательности ДНК-аптамера, которая связывается с протеолитической субъединицей нейротоксина типа A Clostridium botulinum. Данная последовательность ДНК-аптамера состоит из одноцепочечной ДНК длиной 81 нуклеотид, выбранной из группы: APT/LCBONTA N10, представляющая собой CATACGTTCGACTGCTACCCTCCACTTTTGACGGCTTCCTCGGGATTATACGGCTA ACCGAGGGTGAGATGTACAGACTAG, или APT/LCBONTA N16, представляющая собой CATACGTTCGACTGCTACTCTGCTGGGATGGCCTAGCAGCCGATTATTGG GCTAAGCGGGCGTGTGAGATGTACAGACTAG. Данная последовательность ДНК-аптамера обладает высокой специфичностью в отношении протеолитической субъединицы (легкой цепи) токсина типа A Clostridium botulinum с константами аффинности соответственно 1,2·109 М-1, 1,3·109 М-1. Изобретение позволяет ингибировать протеолитическую активность легкой цепи BoNT/A с высокой эффективностью. 10 ил., 4 пр.

Изобретение относится к области биотехнологии, а именно к набору для выявления ДНК вируса оспы свиней методом полимеразной цепной реакции в реальном времени. Набор включает олигонуклеотидные праймеры и флуоресцентно-меченый зонд следующего состава: SPVU - 5 - gta сса ttt tgg agg аса cg - 3, SPVD - 5 - ttc aat aaa tcg cca gtt gta с - 3, SPVZ - 5- [FAM] ggt acc ata tct ata tat ccc tgt tg [BHQ1] - 3. Предложенное изобретение позволяет повысить степень специфичности и чувствительности, а также сокращает время проведения диагностической работы по обнаружению ДНК вируса оспы свиней в пробах исследуемого биоматериала. 1 табл., 3 пр.

Наверх