Гуманизированные антитела против axl



Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl
Гуманизированные антитела против axl

 


Владельцы патента RU 2571224:

УЗ ФАРМА ГмбХ (DE)

Изобретение относится к биохимии. Описано моноклональное гуманизированное антитело, которое специфически связывается с внеклеточным доменом рецепторной тирозинкиназы AXL и которое, по меньшей мере, частично ингибирует активность AXL. Представлена молекула нуклеиновой кислоты, кодирующая описанное антитело. Также представлен экспрессионный вектор и клетка-хозяин. Раскрыт способ производства описанного антитела. Также раскрыта фармацевтическая композиция, содержащая описанное антитело. Описан способ диагностики состояния здоровья, связанного с экспрессией AXL. Раскрыто применение описанного антитела для лечения рака, устойчивого к лекарствам. Изобретение расширяет арсенал лекарственных средств, в частности, применяемых для терапии рака. 13 н. и 4 з.п. ф-лы, 39 ил., 2 табл., 29 пр.

 

Настоящее изобретение касается гуманизированных моноклональных антител, которые связываются с внеклеточным доменом рецепторной тирозинкиназы AXL и которые, по меньшей мере, частично ингибируют активность AXL.

Уровень техники

Рецепторная тирозинкиназа AXL (Ark, UFO, Tyro-7) является членом семейства киназ Туrо-3, другими членами которого являются Mer (Eyk, Nyk, Tyro-12) и Sky (Rse, Tyro-3, Dtk, Etk, Brt, Tif). Она активируется при связывании гетерофильного лиганда Gas6, 70 кДа белка, гомологичного антикоагуляционному фактору - белку S. В отличие от других рецепторных протеинкиназ, фосфорилирование тирозина AXL может также индуцироваться посредством гомофильного связывания. Активация AXL приводит к включению сигнального пути через РI-3-киназу/Akt (Franke et al., Oncogene 22: 8983-8998, 2003) и других основных сигнальных путей, таких как Ras/Erk и β-катенин/TCF (Goruppi et al., Mol. Cell Biol. 21: 902-915, 2001).

AXL слабо экспрессируется в ряде нормальных тканей, включая мозг, сердце, скелетные мышцы, оболочки органов и соединительные ткани некоторых других органов, а также в моноцитах, но не в лимфоцитах. Индуцируемое AXL фосфорилирование Akt было описано в выживающих фибробластах (Goruppi et al., Mol Cell Biol 17: 4442-4453 1997), эндотелиальных клетках (Hasanbasic et al., Am J Physiol Heart Circ Physiol, 2004), клетках гладких мышц сосудов (Melaragno et al., J. Mol. Cell Cardiol. 37: 881-887, 2004) и нейронах (Alien et al., Mol. Endocrinol. 13: 191-201 1999). Более того, AXL играет роль в клеточной адгезии и хемотаксисе. Нокаут AXL демонстрирует ослабленную стабилизацию агрегатов тромбоцитов и образование тромба как результат пониженной активации интегрина IIb3 тромбоцитов.

Сверхэкспрессия AXL была продемонстрирована в различных типах раковых клеток, например, в клетках рака молочной железы (Meric et al., Clin. Cancer Res. 8: 361-367, 2002; Berclaz et al., Ann. Oncol. 12: 819-824, 2001), толстого кишечника (Chen et al., Int. J. Cancer 83: 579-584, 1999; Craven et al., Int. J. Cancer 60: 791-797, 1995), простаты (Jacob et al., Cancer Detect. Prev.23: 325-332, 1999), легких (Wimmel et al., Eur J Cancer 37: 2264-2274, 2001), желудка (Wu et al., Anticancer Res 22: 1071-1078, 2002), яичников (Sun et al., Oncology 66: 450-457, 2004), эндометрия (Sun et al., Ann. Oncol. 14: 898-906, 2003), почек (Chung et al., DNA Cell Biol. 22: 533-540, 2003), клеток печени (Tsou et al., Genomics 50:331-340, 1998), щитовидной железы (Ito et al., Thyroid 12:971-975, 2002; Ito et al., Thyroid 9: 563-567, 1999) и карциномы пищевода (Nemoto et al., 1997), кроме того, в клетках CML (хронической гранулоцитарной лейкемии) (Janssen et al., A novel putative tyrosine kinase receptor with oncogenic potential. Oncogene, 6: 2113-2120, 1991; Braunger et al., Oncogene 14:2619-2631 1997; O'Bryan et al., Mol Cell Biol 11:5016-5031,1991), AML (острой миелобластной лейкемии) (Rochlitz et al., Leukemia 13: 1352-1358, 1999), остеосаркомы (Nakano et al., J. Biol. Chem. 270:5702-5705, 2003), меланомы (van Ginkel et al., Cancer Res 64:128-134, 2004) и клетках плоскоклеточной карциномы головы и шеи (Green et al., Br J Cancer. 2006 94:1446-5, 2006).

Более того, AXL был идентифицирован как ген, ассоциированный с метастазами, активность которого повышена в агрессивных клеточных линиях рака молочной железы по сравнению с неинвазивными клетками. Было обнаружено, что in vitro активность AXL необходима для миграции и инвазии, и эта активность может быть заингибирована путем обработки антителами (WO 04008147). Подобно этому, подавление активности AXL in vivo, либо путем экспрессии доминантной негативной версии AXL (Vajkoczy, P., et al., Proc. Natl. Acad. Science U.S.A. 103: 5799-5804. 2005), либо путем опосредованного siPHK снижения активности AXL (Holland et al., Cancer Res. 65: 9294-9303, 2005), предотвращает подкожный или ортотопический рост клеток у мышей в экспериментах с ксенотрансплантатами.

К настоящему времени описаны антитела, которые связываются с AXL и обладают биологической активностью. Например, одно известное антитело способно снижать опосредованную AXL инвазию клеток (WO 04008147), тогда как другое антитело, как сообщалось, снижает эффективность взаимодействия AXL/Лиганд. Однако все известные антитела являются поликлональными или негуманизированными моноклональными антителами. Негуманизированные антитела, поликлональные или моноклональные, быстро удаляются из циркуляции и обычно вызывают системные воспалительные эффекты, что делает их непригодными для терапевтического применения.

Таким образом, в плане терапевтического потенциала AXL, существует острая потребность в моноклональных гуманизированных антителах против AXL, фрагментах антител или их производных, которые эффективно и специфически блокируют опосредуемую AXL передачу сигнала и которые являются пригодными для терапевтического лечения.

В соответствии с этим, первый аспект настоящего изобретения касается моноклонального гуманизированного антитела, включая его фрагмент или производное, которое связывается с внеклеточным доменом AXL, в частности AXL человека, и, по меньшей мере, частично ингибирует активность AXL.

Предпочтительно гуманизированное антитело настоящего изобретения обладает, по меньшей мере, одним или более из следующих свойств: способностью снижать или блокировать опосредуемую AXL передачу сигнала, способностью снижать или блокировать фосфорилирование AXL, способностью снижать или блокировать пролиферацию клеток, способностью снижать или блокировать ангиогенез, способностью снижать или блокировать миграцию клеток, способностью снижать или блокировать метастазирование опухоли и способностью снижать или блокировать опосредуемый AXL анти-апоптоз, увеличивая, таким образом, например, чувствительность клеток к обработке антинеопластическим агентом.

В соответствии с наиболее предпочтительным воплощением настоящего изобретения, описанные здесь гуманизированные антитела демонстрируют способность снижать и/или блокировать лиганд-индуцируемое фосфорилирование молекул, находящихся ниже в сигнальном пути AXL, таких как ERK1/2, АКТ, GSK-3P, TSC2, mTOR и/или S6K1.

Более того, гуманизированные антитела настоящего изобретения могут проявлять высокую специфичность к AXL, в частности AXL человека, и незначительно распознавать других членов семейства Tyro-3, например, MER и/или SKY, и/или AXL млекопитающих, не являющихся приматами, такой как AXL мыши.

Термин «активность» в используемом здесь значении относится к биологической функции AXL, которая оказывает влияние на фенотип клетки, в частности, но этим не ограничиваясь, на раковые фенотипы, такие как устойчивость к апоптозу, самодостаточность в отношении ростовых сигналов, клеточная пролиферация, инвазия в ткани и/или метастазирование, нечувствительность к противоростовым сигналам (анти-апоптоз) и/или устойчивый ангиогенез.

Термин «опосредуемая AXL передача сигнала» означает активацию сигнальных путей с участием вторичного мессенжера, таких как расположенный ниже сигнальный путь, запускаемый прямым или непрямым взаимодействием AXL с молекулами вторичного мессенжера.

Термин «фосфорилирование AXL» относится к фосфорилированию аминокислотных остатков, предпочтительно остатков тирозина, либо вторым белком AXL (трансфосфорилирование), либо другим белком, обладающим протеинкиназной активностью.

Термин «пролиферация клеток» относится ко всем процессам с участием AXL, лежащим в основе размножения клеток человека, в частности, но ими не ограничиваясь, раковых клеток человека. Эти процессы вносят свой вклад или приводят к репликации клеточной ДНК, разделению дуплицированной ДНК на две группы хромосом равного размера и физическое деление (называемое цитокинезом) целых клеток, и должны стимулироваться или быть опосредованными некаталитическими или каталитическими активностями AXL, предпочтительно включая фосфорилирование AXL и/или опосредуемую AXL передачу сигнала.

Термин «ангиогенез» относится ко всем процессам с участием AXL, которые вносят вклад в рост новых кровеносных сосудов из ранее существующих сосудов, в частности, но этим не ограничиваясь, новых кровеносных сосудов, снабжающих опухоль. Эти процессы включают множественные клеточные события, такие как пролиферация, выживание, миграция и прорастание эндотелиальных клеток сосудов, привлечение и миграция перицитов, а также образование базальной мембраны для стабилизации сосудов, кровоснабжение сосудов или секреция ангиогенных факторов клетками стромы или опухолевыми клетками, и должны стимулироваться или быть опосредованы некаталитической или каталитической активностями AXL, предпочтительно включая фосфорилирование AXL и/или опосредуемую AXL передачу сигнала.

Термин «метастазирование» относится ко всем процессам с участием AXL, которые обеспечивают распространение раковых клеток из первичной опухоли, проникновение в лимфатические и/или кровеносные сосуды, циркуляцию в кровотоке, и рост в отдаленном участке (метастазы) в нормальных тканях в другом месте в теле. В частности, этот термин относится к клеточным событиям в опухолевых клетках, таким как пролиферация, миграция, независимость в «заякоривании», избегание апоптоза или секреция ангиогенных факторов, что лежит в основе метастазирования и стимулируется или опосредуется некаталитической или каталитической активностями AXL, предпочтительно включая фосфорилирование AXL и/или опосредуемую AXL передачу сигнала.

Термин «опосредуемый AXL анти-апоптоз» относится ко всем процессам с участием AXL, которые защищают клетки человека, предпочтительно, но ими не ограничиваясь, раковые клетки человека, от программируемой гибели клеток (апоптоза). В частности, это относится к процессам, которые защищают клетки человека, предпочтительно, но ими не ограничиваясь, раковые клетки человека, от индукции апоптоза через удаление факторов роста, гипоксию, подвергание действию химиотерапевтических агентов или радиации, или инициацию сигнального каскада, опосредуемого рецептором Fas/Apo-1, и стимулируются или опосредуются некаталитической или каталитической активностями AXL, предпочтительно включая фосфорилирование AXL и/или опосредуемую AXL передачу сигнала.

Термин «участок» или «домен» являются в настоящем изобретении взаимозаменяемыми.

Антитела, обозначаемые как "11В7" и "11D5" в настоящем изобретении могут также обозначаться как "#11В7" и "#11D5" соответственно.

Согласно второму аспекту настоящего изобретения гуманизированные антитела, описываемые здесь, являются производными от одного из химерных (крыса/человек) антител против AXL 11B7 (аминокислотная последовательность его легкой и тяжелой цепей представлена SEQ ID NO: 135 и 136 соответственно), 11D5 (аминокислотная последовательность его легкой и тяжелой цепей представлена SEQ ID NO: 137 и 138 соответственно), или 10D12 или антитела, распознающего тот же самый эпитоп на внеклеточном домене AXL человека. Особенно предпочтительно, чтобы гуманизированные антитела являлись производными от 11B7 и 11D5. Предпочтительно гуманизированное антитело содержит, по меньшей мере, одну мутацию в каркасном участке, по меньшей мере, одного вариабельного домена. Такие мутации могут быть введены любым методом, известным специалисту в данной области техники, для изменения аминокислотных последовательностей. Данная мутация заменяет предпочтительно аминокислоту в каркасном участке 11B7 или 11D5 на аминокислоту, которая является консервативной в каркасных участках антител человека. Методы для выявления консервативных или консенсусных аминокислот в каркасных участках антител человека, такие как, например, моделирование по гомологии с применением программ, таких как IgBLAST, известны специалисту в данной области техники.

Согласно другому предпочтительному воплощению гуманизированные антитела настоящего изобретения являются производными от антител против AXL, предпочтительно антител 11В7 или 11D5 против AXL человека, где каркасные участки, по меньшей мере, одного вариабельного домена антитела, предпочтительно 11B7 или 11D5, заменены на каркасные участки антитела человека или являются гуманизированными.

Связывающая активность антитела настоящего изобретения по отношению к AXL может быть определена методами, известными специалистам в данной области техники. Например, эта активность может быть определена с помощью поверхностного плазменного резонанса на приборе Biacore и/или методами ELISA (твердофазный иммуноферментный анализ), EIA (ферментативный иммуноанализ), RIA (радиоиммуноанализ) или методами с использованием флуоресцентно-меченых антител, например, FACS.

Предпочтительно гуманизированные антитела настоящего изобретения являются менее иммуногенными по сравнению с поликлональными или моноклональными негуманизированными антителами против AXL, такими как 11В7 или 11D5 крысы. Наряду с другими методами, известными специалистам в данной области техники, пониженная иммуногенность может быть определена методами НАНА или НАМА на основе ELISA (IBL-America, Minnesota / LiSrarFish, Italy). Более того, предпочтительно антитела настоящего изобретения не удаляются быстро из кровотока и не вызывают системных воспалительных ответов при введении пациенту.

Антитела настоящего изобретения могут иметь, по меньшей мере, один антиген-связывающий участок, например, один или два антиген-связывающих участка. Кроме того, антитело предпочтительно включает, по меньшей мере, одну тяжелую цепь иммуноглобулина и, по меньшей мере, одну легкую цепь иммуноглобулина. Цепь иммуноглобулина включает вариабельный домен и, не обязательно, константный домен. Вариабельный домен может включать участки, определяющие комплементарность (CDRs), например, участок CDR1, CDR2 и/или CDR3, и каркасные участки. Термин «участок, определяющий комплементарность» (complementary determining region, CDR) хорошо известен в данной области техники (смотри, например, Harlow and Lane, "Antibodies, a Laboratory Manual", CSH Press, Cold Spring Harbour, 1988) и обозначает последовательность аминокислот в пределах вариабельного участка антитела, которая в основном обеспечивает контакт с антигеном.

Согласно другому воплощению гуманизированные антитела настоящего изобретения являются производными от антитела 11В7 против AXL и могут включать аминокислотную последовательность тяжелой цепи, выбираемую из группы, состоящей из последовательностей от SEQ ID NO:40 до SEQ ID NO:48, или, по меньшей мере, их вариабельный домен, или имеют аминокислотную последовательность, по меньшей мере, на 90% идентичную этим последовательностям и представляющую вариабельный участок, обладающий связывающей активностью в отношении AXL, которая эквивалентна таковой вариабельного участка, имеющего идентичность последовательности 100%,

или аминокислотная последовательность вариабельного домена тяжелой цепи выбирается из группы, состоящей из последовательностей от SEQ ID NO:80 до SEQ ID NO:82, или вариабельный домен имеет аминокислотную последовательность, по меньшей мере, на 90% идентичную этим последовательностям и представляющую вариабельный участок, обладающий связывающей активностью в отношении AXL, которая эквивалентна таковой вариабельного участка, имеющего идентичность последовательности 100%,

и/или аминокислотная последовательность легкой цепи выбирается из группы, состоящей из последовательностей от SEQ ID NO:18 до SEQ ID NO:30, или, по меньшей мере, вариабельный домен этой последовательности, или аминокислотная последовательность имеет, по меньшей мере, 90% идентичность с этими последовательностями и представляет собой вариабельный участок, обладающий связывающей активностью в отношении AXL, которая эквивалентна таковой вариабельного участка, имеющего идентичность последовательности 100%,

или аминокислотная последовательность вариабельного домена легкой цепи выбирается из группы, состоящей из последовательностей от SEQ ID NO:73 до SEQ ID NO:79, или аминокислотная последовательность имеет, по меньшей мере, 90% идентичность с этими последовательностями и представляет собой вариабельный участок, обладающий связывающей активностью в отношении AXL, которая эквивалентна таковой вариабельного участка, имеющего идентичность последовательности 100%,

или фрагмент этой последовательности, распознающий тот же самый эпитоп на внеклеточном домене AXL. Описание последовательностей согласно настоящему изобретению приведено ниже в разделе «Описание Последовательностей» и в Списке Последовательностей.

Согласно другому дополнительному аспекту гуманизированные антитела настоящего изобретения являются производными от антитела 11В7 против AXL и могут включать аминокислотную последовательность тяжелой цепи, выбираемую из группы, состоящей из последовательностей SEQ ID NO:150 и SEQ ID NO:151, или, по меньшей мере, вариабельный домен этой последовательности, или аминокислотная последовательность имеет, по меньшей мере, 90% идентичность с этими последовательностями и представляет собой вариабельный участок, обладающий связывающей активностью в отношении AXL, которая эквивалентна таковой вариабельного участка, имеющего идентичность последовательности 100%,

и/или аминокислотную последовательность легкой цепи, выбираемую из группы, состоящей из последовательностей SEQ ID NO:146 и SEQ ID NO:147, или, по меньшей мере, вариабельный домен этой последовательности, или аминокислотная последовательность имеет, по меньшей мере, 90% идентичность с этими последовательностями и представляет собой вариабельный участок, обладающий связывающей активностью в отношении AXL, которая эквивалентна таковой вариабельного участка, имеющего идентичность последовательности 100%.

В конкретном предпочтительном воплощении гуманизированные антитела h#HB7 выбираются из группы, состоящей из антител h#l 1B7-T1, h#l 1B7-T2, h#l 1B7-T3, h#l 1B7-T4, h#HB7-T5, h#HB7-T6, h#HB7-T7, h#HB7-T8, ЫШВ7-Т9, h#HB7-T10, h#l 1B7-T11, h#HB7-T12, h#HB7-T13, h#HB7-T14, h#HB7-T15, h#HB7-T16, h#HB7-T17, h#HB7-T18, ЫЛ1В7-Т19, h#HB7-T20, h#HB7-T21, h#HB7-T22, M11B7-T23, h#HB7-T24, h#HB7-T25, h#HB7-T26, и h#HB7-T27. Таблица 1 (Пример 10) суммирует, какими комбинациями специфических гуманизированных аминокислотных последовательностей тяжелых и легких цепей, соответственно, и какой комбинацией соответствующих экспрессионных векторов характеризуются указанные выше гуманизированные антитела h#l 1B7 в настоящем изобретении.

В другом конкретном предпочтительном воплощении гуманизированные антитела h#HB7 выбираются из группы, состоящей из антител h#HB7-T28, h#HB7-T29, h#HB7-Т30 и h#HB7-T31. Таблица 2 (Пример 22) суммирует, какими комбинациями специфических гуманизированных аминокислотных последовательностей тяжелых и легких цепей, соответственно, и какой комбинацией соответствующих экспрессионных векторов характеризуются указанные выше гуманизированные антитела h#HB7 в настоящем изобретении.

Гуманизированное антитело, происходящее от моноклонального антитела #11В7 крысы против AXL человека, не ограничивается специфическими антителами, показанными в качестве примеров в предшествующих абзацах, до тех пор, пока указанное гуманизированное антитело содержит все шесть участков CDRs и проявляет связывающую активность в отношении антигена AXL. Указанное гуманизированное антитело содержит CDRH1 (SNYWG; SEQ ID NO:124), CDRH2 (YITYSGSTSYNPSLKS; SEQ ID NO:125) и CDRH3 (TTFYY; SEQ ID NO:126) в своей тяжелой цепи, и CDRL4 (RASQDIGNYLR; SEQ ID NO:121), CDRL5 (GATNLAA; SEQ ID NO:122) и CDRL6 (LQSKESPWT; SEQ ID NO:123) в своей легкой цепи соответственно.

Согласно дополнительному воплощению гуманизированные антитела настоящего изобретения являются производными от 11D5 и включают аминокислотную последовательность тяжелой цепи, выбираемую из группы, состоящей из последовательностей от SEQ ID NO:67 до SEQ ID NO:72, или, по меньшей мере, вариабельного домена этой последовательности, или аминокислотной последовательности, имеющей, по меньшей мере, 90% идентичность с этими последовательностями и представляющей собой вариабельный участок, обладающий связывающей активностью в отношении AXL, которая эквивалентна таковой вариабельного участка, имеющего идентичность последовательности 100%,

или аминокислотная последовательность вариабельного домена тяжелой цепи выбирается из группы, состоящей из последовательностей от SEQ ID NO:114 до SEQ ID NO:120, или аминокислотной последовательности, имеющей, по меньшей мере, 90% идентичность с этими последовательностями и представляющей собой вариабельный участок, обладающий связывающей активностью в отношении AXL, которая эквивалентна таковой вариабельного участка, имеющего идентичность последовательности 100%,

и/или аминокислотная последовательность легкой цепи выбирается из группы, состоящей из последовательностей от SEQ ID NO:55 до SEQ ID NO:60, или, по меньшей мере, вариабельного домена этой последовательности, или аминокислотной последовательности, имеющей, по меньшей мере, 90% идентичность с этими последовательностями и представляющей собой вариабельный участок, обладающий связывающей активностью в отношении AXL, которая эквивалентна таковой вариабельного участка, имеющего идентичность последовательности 100%,

или аминокислотная последовательность вариабельного домена легкой цепи выбирается из группы, состоящей из последовательностей от SEQ ID NO:83 до SEQ ID NO:113,

или аминокислотной последовательности, имеющей, по меньшей мере, 90% идентичность с этими последовательностями и представляющей собой вариабельный участок, обладающий связывающей активностью в отношении AXL, которая эквивалентна таковой вариабельного участка, имеющего идентичность последовательности 100%, или его фрагмент, распознающий тот же самый эпитоп на внеклеточном домене AXL.

В конкретном предпочтительном воплощении гуманизированные антитела h#HD5 выбираются из группы, состоящей из антител h#11D5-T1, h#11D5-T2, h#11D5-T3, h#11D5-T4, h#HD5-T5 или h#HD5-T6. Примеры 11, 12 и 14 показывают, какими комбинациями специфических гуманизированных аминокислотных последовательностей тяжелых и легких цепей, соответственно, и какой комбинацией соответствующих экспрессионных векторов характеризуются указанные выше гуманизированные антитела h#11D5.

Одним из предпочтительных воплощений настоящего изобретения является гуманизированное антитело, имеющее относительно высокую среднюю точку термоденатурации (Тm). В настоящем изобретении гуманизированное антитело имеет Тm, по меньшей мере, 70°С, предпочтительно Тm, по меньшей мере, 75°С, более предпочтительно Тm, по меньшей мере, 78°С, еще более предпочтительно Тm, по меньшей мере, 80°С, все еще более предпочтительно 82°С. Или в настоящем изобретении гуманизированное антитело имеет Тm, эквивалентную Тm его предшественника - антитела крысы или химерного антитела, но предпочтительно Тm, по меньшей мере, на 3°С выше, более предпочтительно Тm, по меньшей мере, на 6°С выше, еще более предпочтительно Tm, по меньшей мере, на 8°С выше, все еще более предпочтительно Тm, по меньшей мере, на 10°С выше, чем Тm его предшественника - антитела крысы или химерного антитела. Такое предпочтительное, более предпочтительное, еще более предпочтительное или все еще более предпочтительное гуманизированное антитело является менее склонным к денатурации (разворачиванию) или инактивации и является пригодным для приготовления в форме растворов, которые могут стабильно храниться в течение длительного времени.

Гуманизированное антитело, происходящие от моноклонального антитела #11D5 крысы против AXL человека, не ограничивается специфическими антителами, показанными в качестве примеров в предшествующих абзацах, до тех пор, пока указанное гуманизированное антитело содержит все шесть участков CDRs и проявляет связывающую активность в отношении антигена AXL. Указанное гуманизированное антитело содержит CDRH1 (SNYWG; SEQ ID NO:130), CDRH2 (HITNSGNTTYNPSLKS; SEQ ID NO:131) и CDRH3 (GAFDY; SEQ ID NO:132) в своей тяжелой цепи и CDRL4 (RASQDIGNYLS; SEQ ID NO:127), CDRL5 (GAIKLAV; SEQ ID NO:128) и CDRL6 (LQYIQFPLT; SEQ ID NO:129) в своей легкой цепи соответственно.

Другое предпочтительное воплощение настоящего изобретения представляет собой антитело, которое (специфически) связывает или распознает один из IG-доменов около С-конца (домен, включающий аминокислотные остатки аминокислот NOS. 129-220 в базе данных белков NCBI, ACCESSION No.P_30530: SEQ ID NO:139; Фигура 30А), Такое предпочтительное антитело не ограничивается гуманизированным антителом, но может быть антителом человека или функциональным фрагментом одного из них. Более предпочтительно, такое предпочтительное антитело ингибирует, по меньшей мере, одну из биологических активностей, которыми обладает AXL.

Антитело (полноразмерное) настоящего изобретения может быть получено, например, путем выполнения следующих стадий: конструирование вектора для экспрессии тяжелых цепей и вектора для экспрессии легких цепей, где каждый из указанных векторов содержит вставку, включающую вариабельный участок и константный участок; введение указанных векторов в клетку-хозяина; культивирование указанной клетки; выделение полипептидов антитела из культурального супернатанта (кондиционированной среды), как описано в Примерах с 9 по 12.

В используемом здесь значении «идентичность последовательностей» между двумя полипептидными последовательностями указывает процент аминокислот, которые являются идентичными в данных последовательностях. Методы для определения «идентичности последовательностей» между двумя данными полипептидными последовательностями известны специалистам в данной области техники. Предпочтительные полипептидные последовательности настоящего изобретения имеют идентичность последовательностей, по меньшей мере, 90%, более предпочтительно, по меньшей мере, 95% и еще более предпочтительно, по меньшей мере, 98%. Идентичность последовательностей можно определить, например, с помощью программы BLAST, алгоритма, предложенного Karlin и Altschul (Proc. Natl. Acad. Sci. USA, 90, pp5873 (1993)) или FASTA (Methods in Enzymol., 183, pp63 (1990)). Доступна программа, называемая BLASTN или BLASTX (J. Mol. BioL, 215, рр403 (1990)).

Антитело настоящего изобретения может быть антителом IgA-, IgD-, IgE, IgG- или IgM-типа, предпочтительно IgG- или IgM-типа, включая, но ими не ограничиваясь, IgG1-, IgG2-, IgG3-, IgG4-, IgM1- и IgM2-тип.

Антитела настоящего изобретения могут быть предпочтительно сконструированы путем гомологичного моделирования с применением любого пригодного метода, известного специалисту в данной области техники. Более того, гуманизированные формы данных антител, такие как 11В7 или 11D5, могут быть получены согласно методам, известным в данной области техники, таким как химеризация или прививка CDR. Альтернативные методы для получения гуманизированных антител хорошо известны в данной области техники и описаны, например, в ЕР-А1 0239400 и WO 9007861. Обычно гуманизированное антитело содержит один или более аминокислотных остатков, которые введены в него из источника, который не является человеком. Эти не относящиеся к человеку аминокислотные остатки часто обозначаются как «импортные» остатки, которые обычно берутся из «импортного» вариабельного домена. Гуманизирование может быть проведена, например, по методу Winter и соавторов (Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)), путем замены CDRs или последовательностей CDR, происходящих не из человека, на соответствующие последовательности антитела человека. В соответствии с этим, такие «гуманизированные» антитела представляют собой химерные антитела (U.S. Pat. No. 4,816,567), где значительно меньший участок, чем интактный вариабельный домен человека, заменен на соответствующую последовательность из видов, не являющихся человеком. На практике гуманизированные антитела обычно представляют собой антитела человека, в которых некоторые остатки в CDR и, возможно, некоторые остатки FR заменены на остатки из аналогичных участков в антителах, происходящих не из человека.

Антитело человека может быть получено из библиотеки фагового дисплея антител человека (Wormstone, I.M. et.al, Investigative Ophthalmology & Visual Science. (2002) 43 (7), p.2301-2308; Carmen, S. et.al., Briefings in Functional Genomics and Proteomics (2002), 1 (2), p.189-203; Siriwardena, D. et.al., Opthalmology (2002) 109 (3), p.427-431), что хорошо известно специалисту в данной области техники.

Например, может использоваться метод фагового дисплея, который включает получение вариабельного участка антитела человека, экспрессирующегося на поверхности фага в виде одноцепочечного антитела, scFv, и отбор фага, который связывается с антигеном (Nature Biotechnology (2005), 23, (9), p.1105-1116).

С помощью анализа гена выбранного фага может быть определена последовательность ДНК, кодирующая вариабельный участок антитела человека, связывающегося с антигеном.

После того, как определена последовательность ДНК scFv, антитело человека может быть получено путем конструирования экспрессионного вектора, включающего указанную последовательность, и введения указанного вектора в подходящую клетку-хозяина для экспрессии антитела (WO 92001047, WO 92020791, WO 93006213, WO 93011236, WO 93019172, WO 95001438, WO 95015388 и Annu.Rev.Immunol (1994) 12, р.433-455 и Nature Biotechnology (2005) 23 (9), p.1105-1116).

Любое антитело человека, независимо от способа его получения, может являться воплощением настоящего изобретения, если указанное антитело обладает связывающей активностью по отношению к антигену - AXL человека, и содержит все шесть следующих CDRs: CDRH1 (SNYWG; SEQ ID NO:130), CDRH2 (HITNSGNTTYNPSLKS; SEQ ID NO:131) и CDRH3 (GAFDY; SEQ ID NO:132) в своей тяжелой цепи и CDRL4 (RASQDIGNYLS; SEQ ID NO:127), CDRL5 (GAIKLAV; SEQ ID NO:128) и CDRL6 (LQYIQFPLT; SEQ ID NO:129) в своей легкой цепи соответственно, альтернативно этому, если указанное антитело человека обладает связывающей активностью по отношению к антигену - AXL человека, и содержит все шесть следующих CRDs: CDRH1 (SNYWG; SEQ ID NO:124), CDRH2 (YITYSGSTSYNPSLKS; SEQ ID NO:125) и CDRH3 (TTFYY; SEQ ID NO:126) в своей тяжелой цепи и CDRL4 (RASQDIGNYLR; SEQ ID NO:121), CDRL5 (GATNLAA; SEQ ID NO:122) и CDRL6 (LQSKESPWT; SEQ ID NO:123) в своей легкой цепи соответственно.

Для терапевтических целей антитело может быть конъюгировано с терапевтической эффекторной группой, например, с радиоактивной группой или цитотоксической группой.

Для диагностических целей антитело может быть меченым. Пригодные метки включают радиоактивные метки, флуоресцентные метки или ферментативные метки.

Как говорилось выше, антитело настоящего изобретения может существовать во множестве форм помимо полных антител; включая, например, Fv, Fab, Fab' и F(ab')2, диабоди, минибоди, двухвалентное или поливалентное антитело, включающее фрагмент более чем одного антитела, а также в виде одиночных цепей (scFV); смотри, например, WO 8809344.

Антитело настоящего изобретения может представлять собой би-специфичное или мульти-специфичное антитело, которое является специфичным по отношению более чем к одному антигену или эпитопу.

Одноцепочечный вариабельный фрагмент scFv может быть получен путем слияния вариабельного участка тяжелой цепи иммуноглобулина с вариабельным участком легкой цепи иммуноглобулина через полипептидный линкер (Pluckthun, The Pharmacology of Monoclonal Antibodies, 113, edited by Rosenburg and Moore, Springer Verlag, New York, p.269-315 (1994) и Nature Biotechnology (2005), 23, p.1126-1136). Биспецифичный фрагмент BiscFv может быть получен путем слияния двух разных scFV через полипептидный линкер.

Методы для получения scFv хорошо известны специалисту в данной области техники (US 4,946,778, US 5,260,203, US 5,091,513, US 5,455,030 и т.д.). Предпочтительно линкер между двумя вариабельными участками не должен образовывать конъюгат (Huston, J.S.et al., Proc.Natl.Acad.Sci.U.S.A. (1988) 85, р.5879-5883). Вариабельный участок scFV тяжелой цепи иммуноглобулина и вариабельный участок scFV легкой цепи иммуноглобулина могут происходить из идентичного антитела или из двух антител, одно из которых отличается от другого. Полипептидный линкер может представлять собой одноцепочечный пептид, состоящий из, например, от 12 до 19 аминокислотных остатков.

ДНК, кодирующая scFV, может быть получена с помощью ПЦР, которая включает амплификацию фрагмента ДНК с использованием ДНК, кодирующей полноразмерный или часть вариабельного участка тяжелой цепи иммуноглобулина или вариабельного участка легкой цепи, и двух олигонуклеотидов, соответствующих каждому из двух концов, в качестве матрицы и в качестве пары праймеров, соответственно, и последующую амплификацию с использованием пары праймеров, которые сконструированы таким образом, что вариабельный участок тяжелой цепи и вариабельный участок легкой цепи являются присоединенными к одному концу и к другому концу полипептидного линкера соответственно.

Функциональный фрагмент антитела, включающий scFv, может быть получен путем введения ДНК, кодирующей указанный scFv, в клетку-хозяина и культивирования указанной клетки, как описано в другом месте в настоящем изобретении.

Одно из воплощений настоящего изобретения представляет собой мультимерное антитело, которое имеет более высокое сродство при связывании с антигеном по сравнению с мономерным антителом. Единицы указанного мультимерного антитела могут быть одинаковыми или отличаться друг от друга, когда одна единица связывается с одним эпитопом антигена и другая единица связывается с другим эпитопом того же самого антигена. Для получения мультимерного антитела может применяться связывание домена СН3 IgG и двух scFv, связывание со стрептавидином и введение мотива спираль-поворот-спираль.

Если это желательно, антитела настоящего изобретения могут быть мутированы в вариабельных доменах тяжелых и/или легких цепей для изменения связывающих свойств антитела. Например, может быть сделана мутация в одном или более участках CDR для увеличения или уменьшения Kd антитела и AXL, или для изменения связывающей специфичности антитела. Методы сайт-направленного мутагенеза хорошо известны в данной области техники. Смотри, например, Sambrook et al. и Ausubel et al., supra. Кроме того, в вариабельном участке антитела против AXL могут быть сделаны мутации по аминокислотному остатку, который, как известно, изменен по сравнению с зародышевой линией.

В другом аспекте, помимо мутаций, связанных с гуманизированием, могут быть введены дополнительные мутации в один или более каркасных участков. Мутация может быть сделана в каркасном участке или в константном домене для увеличения времени полу-жизни антитела против AXL. Смотри, например, WO 0009560. Мутация в каркасном участке или в константном домене может быть также сделана для изменения иммуногенности антитела, для создания участка для ковалентного или нековалентного связывания с другой молекулой, или для изменения таких свойств, как связывание комплемента. Мутации могут быть сделаны в каждом из каркасных участков, константном домене и вариабельных доменах единственного мутированного антитела. Альтернативно этому, мутации могут быть сделаны только в одном из каркасных участков, вариабельных участков или в константном домене единственного мутированного антитела.

Одно из воплощений настоящего изобретения представляет собой поликлональное антитело, включающее более чем одно антитело настоящего изобретения.

Одно из воплощений настоящего изобретения представляет собой химическую модификацию антитела настоящего изобретения или его функционального фрагмента. Для создания модифицированного антитела или модифицированного функционального фрагмента могут использоваться молекулы, такие как полимер (полиэтиленгликоль и тому подобное).

В дополнительном воплощении гуманизированное антитело согласно настоящему изобретению может содержать константный домен с эффекторными функциями, вследствие чего клетки, экспрессирующие AXL, которые будут связывать антитело, фрагмент антитела или его производное на клеточной поверхности, могут быть атакованы иммунной системой. Например, антитело может обладать способностью связывать комплемент и участвовать в комплемент-зависимой цитотоксичности (CDC). Более того, антитело может обладать способностью связываться с Fc рецепторами на эффекторных клетках, таких как моноциты и клетки-натуральные киллеры (NK), и участвовать в антитело-зависимой клеточно-опосредованной цитотоксичности (ADCC).

В еще одном дополнительном аспекте описываемые здесь антитела являются применимыми для терапевтического лечения, предпочтительно для лечения гиперпролиферативных заболеваний, сердечнососудистых заболеваний, в частности, атеросклероза и тромбоза, связанных с диабетом заболеваний, в частности, гломерулярной гипертрофии или диабетической нефропатии, и особенно заболеваний, связанных с, сопровождающихся или вызываемых экспрессией, сверхэкспрессией или гиперактивностью AXL. Гиперпролиферативные заболевания предпочтительно выбираются из заболеваний, связанных с, сопровождающихся или вызываемых экспрессией, сверхэкспрессией или гиперактивностью AXL, таких как рак, например, рак молочной железы, рак толстой кишки, рак легких, рак почек, фолликулярная лимфома, миелоидная лейкемия, рак/меланома кожи, глиобластома, рак яичников, рак простаты, рак поджелудочной железы, рак пищевода Барретта и рак пищевода, рак желудка, рак мочевого пузыря, рак шейки матки, рак печени, рак щитовидной железы, рак головы и шеи, или гиперпластические и неопластические заболевания или другие Гиперпролиферативные заболевания, связанные с экспрессией или сверхэкспрессией AXL.

Применимость антител настоящего изобретения для лечения любых связанных с AXL заболеваний, таких как Гиперпролиферативные заболевания, может быть продемонстрирована, показана или предположена с помощью экспериментов in vitro, m vivo или ex vivo, включая таковые по лиганд-индуцированному автофосфорилированию AXL, влиянию на опосредованную AXL передачу сигнала на лежащие ниже компоненты сигнального каскада, такие как лиганд-индуцируемое фосфорилирование Akt и р42/44 МАР-киназой, миграцию или пролиферацию раковых клеток, лиганд-индуцированную миграцию или пролиферацию клеток, экспрессирующих AXL, ангиогенез тканей или клеток и рост или метастазирование рака человека или раковых клеток человека, трансплантированных в животных, не являющихся человеком, таких как мыши с ксенотрансплантатами, а также любыми другими преклиническими/неклиническими экспериментами и клиническими испытаниями.

В другом аспекте антитела настоящего изобретения могут применяться для совместного введения с антинеопластическим агентом для лечения одного из упомянутых выше заболеваний.

Совместное введение в используемом здесь значении включает введение антитела настоящего изобретения с антинеопластическим агентом, предпочтительно антинеопластическим агентом, индуцирующим апоптоз. Термин «совместное введение» дополнительно включает введение антитела настоящего изобретения и антинеопластического агента, предпочтительно, антинеопластического агента, индуцирующего апоптоз, в форме единой композиции или в форме двух или более разных композиций. Совместное введение включает введение антитела настоящего изобретения с антинеопластическим агентом, предпочтительно антинеопластическим агентом, индуцирующим апоптоз, одновременно (то есть в одно и то же время) или последовательно (то есть с интервалами).

Настоящее изобретение дополнительно касается молекулы нуклеиновой кислоты, кодирующей антитело, фрагмент антитела или его производное согласно настоящему изобретению. Молекула нуклеиновой кислоты настоящего изобретения, кодирующая описанное выше антитело, фрагмент антитела или его производное, может представлять собой, например, ДНК, кДНК, РНК или синтетически полученную ДНК или РНК, или полученную рекомбинантную химерную молекулу нуклеиновой кислоты, включающую любую из этих молекул нуклеиновой кислоты либо саму по себе, либо в комбинации. Данная молекула нуклеиновой кислоты может также представлять собой геномную ДНК, соответствующую целому гену или его значительной части, или его фрагментам и производным. Нуклеотидная последовательность может соответствовать встречающейся в природе нуклеотидной последовательности или может содержать одну или множество нуклеотидных замен, делеций или добавлений (вставок). В конкретном предпочтительном воплощении настоящего изобретения молекула нуклеиновой кислоты представляет собой молекулу кДНК.

Согласно дополнительному аспекту настоящее изобретение касается изолированной молекулы нуклеиновой кислоты, выбираемой из группы, состоящей из:

(a) последовательности нуклеиновой кислоты, кодирующей моноклональное антитело согласно настоящему изобретению, фрагмент антитела или его производное,

(b) последовательности нуклеиновой кислоты, как показано в одной из последовательностей с SEQ ID Nos, выбираемой из группы, состоящей из последовательностей от SEQ ID NO:5 до SEQ ID NO:17, от SEQ ID NO:31 до SEQ ID NO:39, от SEQ ID NO:49 до SEQ ID NO:54 и от SEQ ID NO:60 до SEQ ID NO:66,

(c) последовательности нуклеиновой кислоты, кодирующей полипептид, выбираемый из группы, состоящей из последовательностей от SEQ ID NO:18 до SEQ ID NO:30, от SEQ ID NO:40 до SEQ ID NO:48, от SEQ ID NO:55 до SEQ ID NO:60, от SEQ ID NO:67 до SEQ ID NO:72, от SEQ ID NO:73 до SEQ ID NO:120 и от SEQ ID NO:121 до 132,

(d) нуклеиновой кислоты, комплементарной любой из последовательностей, указанных в пунктах от (а) до (с), или

(e) последовательности нуклеиновой кислоты, способной гибридизоваться с последовательностями, указанными в пунктах (а), (b), (с) или (d), в жестких условиях и кодирующей полипептид, где антитело или его функциональный фрагмент, включающий указанный полипептид, связывается с внеклеточным доменом AXL,

(f) последовательности нуклеиновой кислоты, как показано в одной из последовательностей с SEQ ID Nos, выбираемой из группы, состоящей из последовательностей SEQ ID NO:144 и SEQ ID 145, и SEQ ID NO:148 и SEQ ID NO:149,

(g) последовательности нуклеиновой кислоты, кодирующей полипептид, выбираемый из группы, состоящей из последовательностей SEQ ID NO:146 и SEQ ID NO:147, и SEQ ID NO:150 и SEQ ID NO:151,

(h) нуклеиновой кислоты, комплементарной любой из последовательностей, указанных в пунктах (f) или (g), или

(i) последовательности нуклеиновой кислоты, способной гибридизоваться с последовательностями, указанными в пунктах (f), (g) или (h) в жестких условиях и кодирующей полипептид, где антитело или его функциональный фрагмент, включающий указанный полипептид, связывается с внеклеточным доменом AXL.

Термин «гибридизация в жестких условиях» означает, что два фрагмента нуклеиновой кислоты гибридизуются друг с другом в стандартизованных условиях гибридизации, как описано, например, в Sambrook et al., "Expression of cloned genes in E.coli" in Molecular Cloning: A laboratory manual (1989), Cold Spring Harbor Laboratory Press, New York, USA. Такие условия представляют собой, например, гибридизацию в 6,0 × SSC при примерно 45°С с последующей стадией отмывки в 2,0 × SSC при 50°С, предпочтительно 2,0 × SSC при 65°С, или 0,2 × SSC при 50°С, предпочтительно 0,2 × SSC при 65°С.

Настоящее изобретение также касается вектора, включающего молекулу нуклеиновой кислоты настоящего изобретения. Указанный вектор может представлять собой, например, фаг, плазмиду, вирусный или ретровирусный вектор. Ретровирусные векторы могут быть репликационно-компетентными или репликационно-дефективными. В последнем случае размножение вируса будет происходить, как правило, только в комплементирующих клетках-хозяевах.

Молекулы нуклеиновой кислоты настоящего изобретения могут быть включены в вектор, содержащий селективные маркеры для размножения в хозяине. Как правило, плазмидный вектор вводится в преципитат, такой как преципитат фосфата кальция или преципитат хлорида рубидия, или в состав комплекса с заряженным липидом или в кластеры на основе углерода, такие как фуллерены. Если вектор должен представлять собой вирус, он может быть «упакован» in vitro с использованием подходящей для упаковывания клеточной линии до его внесения в клетки-хозяева.

Предпочтительно вектор настоящего изобретения представляет собой экспрессионный вектор, в котором молекула нуклеиновой кислоты функционально связана с одной или более контрольными последовательностями, что обеспечивает транскрипцию и, не обязательно, экспрессию в прокариотических и/или эукариотических клетках-хозяевах. Экспрессия указанной молекулы нуклеиновой кислоты включает транскрипцию молекулы нуклеиновой кислоты предпочтительно в пригодную для трансляции мРНК. Регуляторные элементы, обеспечивающие экспрессию в эукариотических клетках, предпочтительно клетках млекопитающих, хорошо известны специалистам в данной области техники. Они обычно включают регуляторные последовательности, обеспечивающие инициацию транскрипции и, не обязательно, поли-А сигналы, обеспечивающие терминацию транскрипции и стабилизацию транскрипта. Дополнительные регуляторные элементы могут включать транскрипционные и трансляционные энхансеры. Возможные регуляторные элементы, обеспечивающие экспрессию в прокариотических клетках-хозяевах, включают, например, lac, trp или tac промотор в E.coli, а примерами регуляторных элементов, обеспечивающих экспрессию в эукариотических клетках-хозяевах, являются AOXI или GAL1 промотор в дрожжах или CMV-, SV40-, RSV-промотор (вирус саркомы Рауса), CMV-энхансер, SV40- энхансер или глобиновый интрон в клетках млекопитающих и клетках других животных. Помимо элементов, которые отвечают за инициацию транскрипции, такие регуляторные элементы могут также включать сигналы терминации транскрипции, такие как SV40-поли-А сайт или tk-поли-А сайт, расположенные после данного полинуклеотида. В этом контексте пригодные экспрессионные векторы являются известными в данной области техники, это, например, Okayama-Berg cDNA экспрессионный вектор pcDV1 (Pharmacia), pCDM8, pRc/CMV, pcDNA1, pcDNA3 (Invitrogen) или pSPORTI (GIBCO BRL). Предпочтительно указанный вектор представляет собой экспрессионный вектор и/или вектор для переноса гена или направляющий (адресующий) вектор. Экспрессионные векторы, происходящие из вирусов, таких как ретровирусы, вирус осповакцины, аденоассоциированный вирус, вирус герпеса, вирус папилломы крупного рогатого скота, могут применяться для доставки полинуклеотидов или вектора настоящего изобретения в целевую клеточную популяцию. Для конструирования рекомбинантных вирусных векторов могут применяться методы, которые хорошо известны специалистам в данной области техники, смотри, например, методы, описанные в Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (2001, Third Edition) N.Y. и Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1994). Альтернативно этому молекулы нуклеиновой кислоты настоящего изобретения могут быть встроены в липосомы для доставки в целевые клетки.

Настоящее изобретение дополнительно касается хозяина, включающего вектор настоящего изобретения. Указанный хозяин может представлять собой прокариотическую или эукариотическую клетку или трансгенное животное, не являющееся человеком. Полинуклеотид или вектор настоящего изобретения, который присутствует в хозяине, может быть либо интегрирован в геном хозяина, либо может поддерживаться внехромосомно. В этом отношении необходимо также понимать, что молекула нуклеиновой кислоты настоящего изобретения может применяться для «адресации в ген» и/или «замещения гена» для восстановления мутантного гена или создания мутантного гена путем гомологичной рекомбинации, смотри, например, Mouellic, Proc. Natl. Acad. Sci. USA, 87 (1990), 4712-4716; Joyner, Gene Targeting, A Practical Approach, Oxford University Press.

Хозяин может представлять собой любую прокариотическую или эукариотическую клетку, такую как клетка бактерии, насекомого, гриба, растения, животного, млекопитающего или, предпочтительно, клетку человека. Предпочтительными клетками грибов являются, например, таковые рода Saccharomyces, в частности, таковые вида S. cerevisiae. Термин «прокариоты» включает все бактерии, которые могут быть трансформированы или трансфецированы полинуклеотидом для экспрессии варианта полипептида настоящего изобретения. Прокариотические хозяева могут включать как грамотрицательные, так и грамположительные бактерии, такие как, например, E.coli, S. typhimurium, Serratia marcescens и Bacillus subtilis. Полинуклеотид, кодирующий мутантную форму вариантов полипептидов настоящего изобретения, может применяться для трансформации или трансфекции хозяина с использованием любого из методов, обычно известных специалистам средней квалификации в данной области техники. Методы для получения слитых функционально связанных генов и их экспрессии в бактериях или клетках животных хорошо известны в данной области техники (Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (2001, Third Edition). Генетические конструкции и методы, которые здесь описаны, могут применяться для экспрессии вариантов антител, фрагментов антител или их производных согласно настоящему изобретению, например, в прокариотических хозяевах. Как правило, экспрессионные векторы, содержащие промоторные последовательности, которые обеспечивают эффективную транскрипцию встроенной молекулы нуклеиновой кислоты, применяются в соответствии с используемым хозяином. Экспрессионный вектор обычно содержит область начала репликации, промотор и терминатор, а также специфические гены, которые обеспечивают проведение фенотипической селекции трансформированных клеток. Трансформированные прокариотические хозяева могут выращиваться в ферментерах и культивироваться согласно способам, известным в данной области техники, для достижения оптимального клеточного роста. Антитела, фрагменты антител и их производные настоящего изобретения могут после этого выделяться из культуральной среды, клеточных лизатов или фракций клеточных мембран. Выделение и очистка экспрессированных микробиологически или иным способом антител, фрагментов антител или их производных согласно настоящему изобретению может проводиться любым стандартным способом, таким как, например, препаративное хроматографическое разделение и иммунологическое разделение, как, например, таковое, включающее применение моноклональных или поликлональных антител.

В предпочтительном воплощении настоящего изобретения хозяин представляет собой клетку бактерии, гриба, растения, амфибии или животного. Предпочтительные животные клетки включают, но ими не ограничиваются, клетки яичников Китайского хомячка (СНО) (СНО cell, ATCC CCL-61) или их штамм, дефицитный по дигидрофолатредуктазе (Uriaub, G. and Chasin, L.A. Proc.Natl.Acad.Sci.U.S.A. (1980) 77, p.4126-4220), клетки почек новорожденного хомячка (ВНК), клетки почек мартышки (COS) (Gluzman, Y. Cell (1981) 23, р.175-182 и ATCC CRL-1650), ЗТЗ клетки или NIH3T3 клетки, происходящие из фибробластов мыши (ATCC No. CRL-1658), NSO клетки и большое число других клеточных линий, включая клетки человека, например, Реr.С6. В другом предпочтительном воплощении указанная клетка животного представляет собой клетку насекомого. Предпочтительные клетки насекомых включают, но ими не ограничиваются, клетки клеточных линий SF9.

В более предпочтительном воплощении настоящего изобретения указанный хозяин представляет собой клетку человека или клеточную линию человека. Указанные клетки человека включают, но ими не ограничиваются, эмбриональные клетки почек человека (НЕK293, 293Т, 293 freestyle). Кроме того, указанные клеточные линии человека включают, но ими не ограничиваются, клетки HeLa, клетки гепатоклеточной карциномы человека (например, Нер G2), клетки А549.

Настоящее изобретение также предоставляет трансгенных животных, не являющихся человеком, включающих одну или более молекул нуклеиновой кислоты настоящего изобретения, которые могут применяться для продукции антител настоящего изобретения. Антитела могут быть продуцированы и извлечены из ткани или жидкостей тела, таких как молоко, кровь или моча, коз, крупного рогатого скота, лошадей, свиней, крыс, мышей, кроликов, хомячков или других млекопитающих. Смотри, например, U.S. Patent Nos. 5,827,690; 5,756,687; 5,750,172; и 5,741,957. Как описано выше, трансгенные животные, не являющиеся человеком, которые содержат локус иммуноглобулина человека, могут быть получены путем иммунизации AXL или его частью.

Настоящее изобретение дополнительно касается способа для получения антитела, включающего культивирование хозяина согласно настоящему изобретению в условиях, которые обеспечивают синтез указанного антитела и выделение указанного антитела из указанной культуры.

Трансформированные хозяева могут выращиваться в ферментерах и культивироваться согласно способам, известным в данной области техники, для достижения оптимального клеточного роста. После их экспрессии целые антитела, их димеры, индивидуальные легкие и тяжелые цепи или другие формы иммуноглобулинов настоящего изобретения могут очищаться согласно стандартным методам, известным в данной области техники, включая осаждение сульфатом аммония, аффинные колонки, колоночную хроматографию, гель-электрофорез и тому подобное, смотри, Scopes, "Protein Purification", Springer-Verlag, N.Y. (1982). Антитело или соответствующая цепь(цепи) иммуноглобулина настоящего изобретения могут после этого быть выделены из культуральной среды, клеточных лизатов или фракций клеточных мембран. Выделение и очистка, например, микробиологически экспрессированных антител или цепей иммуноглобулина настоящего изобретения может проводиться любым стандартным способом, таким как, например, препаративное хроматографическое разделение и иммунологическое разделение, как, например, таковое, включающее применение моноклинальных или поликлональных антител, направленных, например, против константного участка антитела настоящего изобретения.

Специалисту в данной области техники должно быть понятно, что антитела настоящего изобретения могут дополнительно быть связаны с другими остатками, например, для целей адресной доставки лекарства и для визуализации. Такое связывание может быть проведено химическим путем после экспрессии антитела или антигена по участку присоединения, или соединенный продукт может быть введен в антитело или антиген настоящего изобретения на уровне ДНК. Данные ДНК затем экспрессируются в подходящей системе хозяина и экспрессированные белки выделяются и, если это необходимо, ренатурируются.

В предпочтительном воплощении настоящего изобретения антитело связано с эффектором, таким как радиоизотоп или токсический химиотерапевтический агент. Предпочтительно эти конъюгаты антител являются пригодными для целевой доставки в клетки, например, в раковые клетки, экспрессирующие AXL, для их уничтожения. Связывание антител/фрагментов антител настоящего изобретения с радиоизотопами, например, обеспечивает преимущества в лечении опухолей. В отличие от химиотерапии и других форм лечения рака, радиоиммунотерапия или введение комбинации радиоизотоп-антитело прямо направлено на раковые клетки, что приводит к минимальным повреждениям окружающей нормальной, здоровой ткани. Предпочтительные радиоизотопы включают, например, 3H, 14С, 15N, 35S, 90Y, 99Тc, 111In,125I,131I.

Кроме того, антитела настоящего изобретения могут применяться для лечения рака, когда они конъюгированы с токсическими химиотерапевтическими агентами, такими как гелданамицин (Mandler et al., J. Natl. Cancer Inst., 92(19), 1549-51 (2000) и майтансин, например, майтансиноидный агент DM1 (Liu et al., Proc. Natl. Acad. Sci. U.S.A. 93:8618-8623 (1996), и ауристатин-Е или монометилауристатин-Е (Doronina et al., Nat. Biotechnol. 21:778-784 (2003) или калихеамицит. Для этого способа применяются разные линкеры, которые обеспечивают высвобождение лекарства в кислых или восстанавливающих условиях или при экспонировании со специфическими протеазами. Антитела настоящего изобретения могут быть конъюгированы, как это описано в данной области техники.

Одно из воплощений настоящего изобретения представляет собой химическую модификацию антитела или его функционального фрагмента настоящего изобретения. Для получения модифицированного антитела или модифицированного функционального фрагмента могут использоваться молекулы, такие как полимеры (полиэтиленгликоль или тому подобное).

Настоящее изобретение дополнительно касается фармацевтической композиции, включающей антитело, молекулу нуклеиновой кислоты, вектор, хозяина согласно настоящему изобретению или антитело, полученное по способу настоящего изобретения.

Термин «композиция» в используемом здесь значении включает, по меньшей мере, одно соединение настоящего изобретения. Предпочтительно такая композиция представляет собой фармацевтическую или диагностическую композицию.

Предпочтительно, чтобы указанная фармацевтическая композиция включала фармацевтически приемлемый носитель и/или растворитель. Раскрываемая здесь фармацевтическая композиция может быть частично пригодной для лечения заболеваний, связанных с, сопровождающихся или вызываемых экспрессией, сверхэкспрессией или гиперактивностью AXL, например, гиперпролиферативных заболеваний, сердечнососудистых заболеваний, в частности, атеросклероза и тромбоза, связанных с диабетом заболеваний, в частности, гломерулярной гипертрофии или диабетической нефропатии. Указанные заболевания включают, но ими не ограничиваются, рак, например, рак молочной железы, рак толстой кишки, рак легких, рак почек, фолликулярную лимфому, миелоидную лейкемию, рак/меланому кожи, глиобластому, рак яичников, рак простаты, рак поджелудочной железы, рак пищевода Барретта и рак пищевода, рак желудка, рак мочевого пузыря, рак шейки матки, рак печени, рак щитовидной железы, рак головы и шеи или другие гиперпластические или неопластические заболевания или другие заболевания, связанные с экспрессией или сверхэкспрессией AXL.

Термин «гиперактивность» в используемом здесь значении относится к неконтролируемой активации AXL-сигнального пути, которая может быть вызвана отсутствием и/или дисфункцией отрицательной регуляции. Пример отрицательной регуляции включает дефосфорилирование, деградацию и/или эндоцитоз белков. Более того, неконтролируемая активация AXL-сигнального пути может быть следствием генетических изменений, как соматических, так и генеративных клеток, которые приводят к изменениям аминокислотной последовательности AXL.

Примеры пригодных фармацевтических носителей, наполнителей и/или растворителей хорошо известны в данной области техники и включают растворы фосфатного буфера, воду, эмульсии, такие как эмульсии масло/вода, различные типы увлажняющих агентов, стерильные растворы и т.д. Композиции, включающие такие носители, могут быть приготовлены хорошо известными стандартными методами. Эти фармацевтические композиции могут вводиться субъекту в подходящей дозе. Введение подходящих композиций может проводиться различными путями, например, внутривенно, внутрибрюшинно, подкожно, внутримышечно, топически, внутрикожно, внутриназально или внутрибронхиально. Композиции настоящего изобретения могут также вводиться непосредственно в целевой участок, например, путем биолистической доставки к внешнему или внутреннему целевому участку, например, к мозгу. Режим дозировки будет определяться лечащим врачом и клиническими факторами. Как хорошо известно в медицинской области техники, дозировки для любого конкретного пациента зависят от множества факторов, включая размер пациента, площадь поверхности тела, возраст, конкретное соединение, которое вводится, пол, время и способ введения, общее состояние здоровья и другие лекарства, которые вводятся одновременно. Фармацевтически активное вещество белковой природы может присутствовать в количествах между 1 мкг и 100 мг/кг веса тела на одну дозировку; однако могут рассматриваться дозы ниже или выше этого примерного диапазона, особенно с учетом вышеуказанных факторов. Если введение представляет собой непрерывное вливание, диапазон также должен составлять от 1 пг до 100 мг на килограмм веса тела в минуту.

Прогресс лечения может оцениваться путем периодических обследований. Композиции настоящего изобретения могут вводиться локально или системно. Препараты для парентерального введения включают стерильные водные или неводные растворы, суспензии и эмульсии. Примерами неводных растворителей являются пропиленгликоль, полиэтиленгликоль, растительные масла, такие как оливковое масло, и пригодные для инъекций органические эфиры, такие как этилолеат. Водные носители включают воду, спирто/водные растворы, эмульсии или суспензии, включая физиологический раствор и буферные среды. Парентеральные носители включают раствор хлорида натрия, раствор Рингера с декстрозой, декстрозу и хлорид натрия, раствор Рингера с лактатом или нелетучие масла. Внутривенные носители включают жидкие и питательные добавки, добавки электролитов (такие как добавки на основе раствора Рингера с декстрозой) и тому подобное. Могут также присутствовать консерванты и другие добавки, такие как, например, антимикробные агенты, антиоксиданты, хелатирующие агенты и инертные газы и тому подобное. Кроме того, фармацевтическая композиция настоящего изобретения может включать дополнительные агенты в зависимости от предполагаемого применения фармацевтической композиции.

Особенно предпочтительно, чтобы фармацевтическая композиция включала, по меньшей мере, один дополнительный активный агент, например, дополнительный антинеопластический агент, низкомолекулярный ингибитор, противоопухолевый агент, химиотерапевтический агент или комбинацию этих агентов.

Настоящее изобретение также касается фармацевтической композиции, включающей гуманизированное антитело против AXL настоящего изобретения в комбинации, по меньшей мере, с одним дополнительным антинеопластическим агентом. Указанная комбинация является эффективной, например, для ингибирования ненормального клеточного роста.

В данной области техники в настоящее время известно множество антинеопластических агентов. В целом данный термин включает все агенты, которые обладают способностью предотвращать, облегчать и/или лечить гиперпролиферативные заболевания. В одном воплощении антинеопластический агент выбирается из группы терапевтических белков, включая, но ими не ограничиваясь, антитела или иммуномодуляторные белки. В другом воплощении антинеопластический агент выбирается из группы низкомолекулярных ингибиторов или химиотерапевтических агентов, состоящей из ингибиторов митоза, ингибиторов киназ, алкилирующих агентов, анти-метаболитов, интеркалирующих антибиотиков, ингибиторов факторов роста, ингибиторов клеточного цикла, ферментов, ингибиторов топоизомеразы, ингибиторов деацетилазы гистонов, снижающих жизнеспособность агентов, модификаторов биологических ответов, анти-гормонов, например, анти-андрогенов, и агентов, подавляющих ангиогенез.

Конкретные примеры антинеопластических агентов, которые могут применяться в комбинации с предоставляемыми в настоящем изобретении антителами, включают, например, гефитиниб, лапатиниб, сунитиниб, пеметрексед, бевацисумаб, цетуксимаб, иматиниб, трастузумаб, алемтузумаб, ритуксимаб, эрлотиниб, бортезомиб и тому подобное. Другие конкретные антинеопластические агенты для применения в композициях, которые здесь раскрываются и заявляются, включают, например, химиотерапевтические агенты, такие как капецитабин, даунорубицин, дауномицин, дактиномицин, доксорубицин, эпирубицин, идарубицин, эзорубицин, блеомицин, мафосфамид, ифосфамид, цитозинарабинозид, бис-хлорэтилнитрозомочевина, бусульфан, митомицин С, актиномицин D, митрамицин, преднизон, гидроксипрогестерон, тестостерон, тамоксифен, дакарбазин, прокарбазин, гексаметилмеламин, пентаметилмеламин, митоксантрон, амсакрин, хлорамбуцил, метилциклогексилнитрозомочевина, азотистый иприт (хлорметин), мелфалан, циклофосфамид, 6-меркаптопурин, 6-тиогуанин, цитарабин (СА), 5-азацитидин, гидроксимочевина, дезоксикоформицин, 4-гидроксипероксициклофосфорамид, 5-фторурацил (FU), 5-фтордезоксиуридин (5-FUdR), метотрексат (МТХ), колхицин, таксол, винкристин, винбластин, этопозид, триметрексат, тенипозид, цисплатин и диэтилстильбестрол (DES). Смотри, в целом, The Merck Manual of Diagnosis and Therapy, 15th Ed. 1987, pp.1206-1228, Berkow et al., eds., Rahway, N.J. Особенно предпочтительными являются такие антинеопластические агенты, которые индуцируют апоптоз.

Настоящее изобретение также касается поликлонального антитела, включающего более чем одно антитело настоящего изобретения.

При применении с описанными антителами против AXL такие антинеопластические агенты могут применяться индивидуально (например, 5-FU и антитело), последовательно (например, 5-FU и антитело в течение определенного периода времени, затем МТХ и антитело), или в комбинации с одним или более другими такими антинеопластическими агентами (например, 5-FU, МТХ и антитело, или 5-FU, радиотерапия и антитело).

Термин «антинеопластический (противоопухолевый) агент» может также включать терапевтические процедуры, например, облучение или радиотерапию.

Фармацевтическая композиция настоящего изобретения предпочтительно применяется для лечения людей, но может применяться также для ветеринарных целей.

Кроме того, настоящее изобретение касается применения антитела настоящего изобретения, молекулы нуклеиновой кислоты, вектора, хозяина согласно настоящему изобретению или антитела, полученного согласно способу настоящего изобретения, для получения фармацевтической композиции для диагностики, профилактики или лечения гиперпролиферативных заболеваний, сердечнососудистых заболеваний, в частности, атеросклероза и тромбоза, связанных с диабетом заболеваний, в частности, гломерулярной гипертрофии или диабетической нефропатии, и в особенности заболеваний, связанных с, сопровождающихся или вызванных экспрессией, сверхэкспрессией или гиперактивностью AXL.

Как упоминалось выше, гиперпролиферативное заболевание включает любую неоплазию, то есть любой ненормальный и/или неконтролируемый новый рост ткани. Термин «неконтролируемый новый рост ткани» в используемом здесь значении может быть связан с дисфункцией и/или потерей регуляции роста. Гиперпролиферативное заболевание включает опухолевые заболевания и/или рак, такой как метастазирующие или инвазивные формы рака.

В предпочтительном воплощении применения настоящего изобретения указанное гиперпролиферативное заболевание представляет собой, в частности, рак молочной железы, рак толстого кишечника, рак легких, рак почек, фолликулярную лимфому, миелоидную лейкемию, рак/меланому кожи, глиобластому, рак яичников, рак простаты, рак поджелудочной железы, рак пищевода Барретта и рак пищевода, рак желудка, рак мочевого пузыря, рак шейки матки, рак печени, рак щитовидной железы, рак головы и шеи или другие гиперпластические или неопластические заболевания или другие гиперпролиферативные заболевания, связанные с экспрессией или сверхэкспрессией AXL.

В еще одном другом воплощении настоящее изобретение касается применения гуманизированного антитела против AXL настоящего изобретения для производства лекарства для совместного введения вместе с антинеопластическим агентом для лечения одного из указанных выше заболеваний.

Согласно дополнительному предпочтительному воплощению настоящее изобретение направлено на применение гуманизированного антитела против AXL настоящего изобретения для производства фармацевтической композиции для лечения устойчивого к лекарствам рака.

Кроме того, настоящее изобретение касается диагностической композиции, включающей антитело настоящего изобретения, молекулу нуклеиновой кислоты, вектор, хозяина согласно настоящему изобретению или антитело, полученное согласно способу настоящего изобретения, и, не обязательно, фармацевтически приемлемый носитель.

Диагностическая композиция настоящего изобретения является пригодной для выявления нежелательной экспрессии, сверхэкспрессии или гиперактивности AXL млекопитающих в разных клетках, тканях или другом пригодном образце, включающего контактирование образца с антителом настоящего изобретения и выявление присутствия AXL в данном образце. В соответствии с этим, диагностическая композиция настоящего изобретения может применяться для выявления признаков или статуса заболевания в случае гиперпролиферативного заболевания.

Кроме того, злокачественные клетки, такие как экспрессирующие AXL раковые клетки, могут обнаруживаться (превращаться в мишень) с помощью антител настоящего изобретения. Таким образом, клетки, которые связали антитело настоящего изобретения, могут быть атакованы компонентами иммунной системы, такими как система комплемента или система опосредованной клетками цитотоксичности, что приводит к снижению количества или уничтожению раковых клеток. Эти соображения в равной мере применимы к лечению метастазов и повторных опухолей.

В другом аспекте настоящего изобретения антитело настоящего изобретения связано с меченой группой. Как уже говорилось выше, такие антитела особенно пригодны для диагностических целей. В используемом здесь значении термин «меченая группа» обозначает маркер, который можно детектировать, например, радиоактивномеченую аминокислоту или биотинилированные группы, которые можно выявить с помощью меченого авидина. В данной области техники известны многочисленные методы для мечения полипептидов и гликопротеинов, таких как антитела, которые могут применяться при воплощении настоящего изобретения. Примеры пригодных групп для мечения включают, но ими не ограничиваются, следующие: радиоизотопы или радионуклиды (например, 3H, 14С, 15N, 35S, 90Y, 99Тc, 111In, 125I, 131I), флуоресцентные группы (например, ФИТЦ, родамин, люминофоры на основе лантанидов), ферментативные группы (например, пероксидаза хрена, β-галактозидаза, люцифераза, щелочная фосфатаза), хемилюминесцентные группы, биотинилированные группы или заранее заданные полипептидные эпитопы, распознаваемые вторичной меткой (например, парные последовательности лейциновых молний, участки связывания вторичных антител, металл-связывающие домены, эпитопные таги (метки)).

В определенных аспектах может быть желательно, чтобы меченые группы были присоединены через спейсеры определенной длины с целью снижения потенциальных стерических затруднений.

В другом воплощении настоящее изобретение касается способа выявления наличия клеток, экспрессирующих AXL, включающего контактирование антитела настоящего изобретения с клетками или тканью, в которых предполагается присутствие AXL на их/ее поверхности. Пригодными методами для выявления экспрессии AXL в образце могут быть Твердофазный Иммуноферментный Анализ (ELISA) или иммуногистохимия (IHC).

Метод ELISA может быть проведен с использованием планшетов для микротитрования, в которых, например, в лунках планшета для микротитрования адсорбированы антитела против AXL. Лунки промываются и обрабатываются блокирующим агентом, таким как белок молока или альбумин, для предотвращения неспецифического связывания анализируемого агента. После этого лунки обрабатываются тестируемым образцом. После удаления тестируемого образца или стандарта лунки обрабатываются вторым антителом против AXL, которое является меченым, например, путем конъюгирования с биотином. После удаления избытка вторичных антител метка выявляется, например, с помощью конъюгированной с авидином пероксидазы хрена (HRP) и подходящего хромогенного субстрата. Концентрация антигена AXL в тестируемых образцах определяется путем сравнения со стандартной кривой, построенной с использованием стандартных образцов.

Для IHC может использоваться залитая в парафин ткань, где из ткани, например, сначала с помощью ксилена удаляется парафин, а затем проводится дегидрирование, например, с помощью этанола, после чего ткань промывается дистиллированной водой. Антигенные эпитопы, оказавшиеся замаскированными при фиксации формалином и заливке в парафин, могут открываться путем демаскирования эпитопов, путем ферментативного расщепления или обработки сапонином. Для демаскирования эпитопов парафиновые срезы могут нагреваться в паровом нагревателе, водяной бане или микроволновой печи в течение 20-40 минут в эпитоп-восстанавливающем растворе, таком как, например, раствор 2 Н HCI (рН 1,0). В случае ферментативного расщепления срезы ткани могут инкубироваться при 37°С в течение 10-30 минут в растворах различных ферментов, таких как протеиназа К, трипсин, проназа, пепсин и т.д. После отмывки от эпитоп-восстанавливающего раствора или от избытка ферментов, срезы ткани обрабатываются блокирующим буфером для предотвращения неспецифических взаимодействий. Первичные антитела против AXL добавляются в подходящих концентрациях. Избыток первичных антител удаляется, и срезы инкубируются в блокирующем пероксидазу растворе в течение 10 минут при комнатной температуре. После еще одной стадии промывки срезы ткани инкубируются с вторичными мечеными антителами, например, мечеными группой, которая может выступать в качестве якоря для определенного фермента. Такими примерами являются меченые биотином вторичные антитела, которые распознаются связанной со стрептавидином пероксидазой хрена. Выявление комплекса антитело/фермент достигается инкубацией с подходящим хромогенным субстратом.

В дополнительном воплощении настоящее изобретение касается способа блокирования функции AXL, включающего контактирование антитела настоящего изобретения с клетками или тканью, в которых предполагается присутствие AXL на их/ее поверхности, в условиях, при которых антитело способно блокировать функцию AXL. Контактирование может проводиться in vitro или in vivo.

Настоящее изобретение также касается способа лечения гиперпролиферативного заболевания, сердечнососудистых заболеваний, в частности, атеросклероза и тромбоза, связанных с диабетом заболеваний, в частности, гломерулярной гипертрофии или диабетической нефропатии, включающего введение пациенту, который в этом нуждается, подходящей дозы антитела или фрагмента антитела или его производного настоящего изобретения. Гиперпролиферативное заболевание предпочтительно выбирается из заболеваний, связанных с, сопровождающихся или вызванных экспрессией, сверхэкспрессией или гиперактивностью AXL, таких как рак, например, рак молочной железы, рак толстого кишечника, рак легких, рак почек, фолликулярная лимфома, миелоидная лейкемия, рак/меланома кожи, глиобластома, рак яичников, рак простаты, рак поджелудочной железы, рак пищевода Барретта и рак пищевода, рак желудка, рак мочевого пузыря, рак шейки матки, рак печени, рак щитовидной железы, рак головы и шеи или другие гиперпластические и неопластические заболевания или другие гиперпролиферативные заболевания, связанные с экспрессией или сверхэкспрессией AXL.

Согласно другому предпочтительному воплощению настоящего изобретения рак, который требуется лечить, представляет собой устойчивый к лекарствам рак, предпочтительно выбираемый из группы раковых заболеваний, приведенных выше.

Настоящее изобретение дополнительно касается способа лечения заболевания, в котором антитело настоящего изобретения вводится млекопитающему и в котором указанное заболевание прямо или косвенно коррелирует с ненормальным уровнем экспрессии или активности AXL.

Наконец, настоящее изобретение касается набора, включающего антитело против AXL, предпочтительно антитело, фрагмент антитела или его производное настоящего изобретения, молекулу нуклеиновой кислоты, кодирующей указанные компоненты и/или вектор настоящего изобретения.

Все воплощения, описывающие раскрываемые здесь соединения, могут применяться в виде отдельных соединений или в комбинации для приготовления лекарства.

Краткое описание Фигур

Фигура 1: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков легкой цепи моноклонального антитела крысы против AXL человека #11В7, обозначенных номерами от h#11B7-T1L до h#11B7-T7L.

Фигура 2: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков легкой цепи моноклонального антитела крысы против AXL человека #11В7, обозначенных номерами от h#11B7-T8L до h#11B7-T14L.

Фигура 3: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков легкой цепи моноклонального антитела крысы против AXL человека #11В7, обозначенных номерами от h#11B7-T15L до h#11B7-T20L.

Фигура 4: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков тяжелой цепи моноклонального антитела крысы против AXL человека #11В7, обозначенных номерами от h#HB7-T1H до h#HB7-Т6Н.

Фигура 5: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков тяжелой цепи моноклонального антитела крысы против AXL человека #11В7, обозначенных номерами от h#HB7-T7H до h#HB7-Т12Н.

Фигура 6: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков легкой цепи моноклонального антитела крысы против AXL человека #11D5, обозначенных номерами от h#11D5-T1L до h#11D5-T7L.

Фигура 7: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков легкой цепи моноклонального антитела крысы против AXL человека #11D5, обозначенных номерами от h#11D5-T8L to h#11D5-T14L.

Фигура 8: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков легкой цепи моноклонального антитела крысы против AXL человека #11D5, обозначенных номерами от h#11D5-T15L до h#11D5-T21L.

Фигура 9: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков легкой цепи моноклонального антитела крысы против AXL человека #11D5, обозначенных номерами от h#11D5-T22L до h#11D5-T28L.

Фигура 10: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков легкой цепи моноклонального антитела крысы против AXL человека #11D5, обозначенных номерами от h#11D5-T29L до h#11D5-T35L.

Фигура 11: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков легкой цепи моноклонального антитела крысы против AXL человека #11D5, обозначенных номерами h#11D5-T36L и h#11D5-T37L.

Фигура 12: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков тяжелой цепи моноклонального антитела крысы против AXL человека #11D5, обозначенных номерами от h#11D5-T1H до h#11D5-Т7Н.

Фигура 13: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков тяжелой цепи моноклонального антитела крысы против AXL человека #11D5, обозначенных номерами от h#HD5-T8H до h#HD5-Т13Н.

Фигура 14: На этой Фигуре показаны нуклеотидные последовательности праймеров EFF1 и EfsmR, Фрагмента В, включающего сигнал секреции и константный участок каппа-цепи человека и поли(А) добавочный сигнал, фрагмента ДНК, кодирующего полипептид, который включает сигнал IgG1 человека, константный домен и Лидерную последовательность, а также аминокислотная последовательность CDRs моноклональных антител крысы против AXL человека 11В7 и 11D5, тяжелой и легкой цепей химерного антитела #11В7 (IgG1/каппа), тяжелой и легкой цепей химерного антитела #11D5 (IgG1/каппа) и лидерной последовательности.

Фигура 15. А. Анализ с помощью проточной цитометрии присутствия AXL на клеточной поверхности фибробластов RatI-Mock и RatI-AXL c1.2. Поликлональные RatI-Mock и клональные RatI-AXL c1.2 клетки, полученные путем инфицирования фибробластов RatI экотрофным вирусом pLXSN и pLXSN-hAXL соответственно, были собраны и прокрашены контрольным антителом мыши 72А1 (левая панель) или первичным антителом мыши МАВ154 против AXL (правая панель) в концентрации 3 мкг/мл и РЕ-конъюгированными анти-мышиными вторичными антителами. Для выяснения деталей смотри текст. Прокрашивание клеток RatI-AXL c1.2 приводит к сдвигу на три порядка величины и демонстрирует сверхэкспрессию AXL на поверхности этих клеток,

В. Анализ с помощью проточной цитометрии присутствия AXL на клеточной поверхности фибробластов NIH3T3-Mock и NIH3T3-AXL с1.7. Поликлональные NIH3T3-Mock и клональные NIH3T3-AXL с1.7. клетки, полученные путем инфицирования фибробластов NIH3T3 экотрофным вирусом pLXSN и pLXSN-AXL соответственно, были собраны и прокрашены контрольным антителом мыши 72А1 (левая панель) или первичным антителом мыши МАВ154 против AXL (правая панель) в концентрации 3 мкг/мл и РЕ-конъюгированными анти-мышиными вторичными антителами. Для выяснения деталей смотри текст. Прокрашивание клеток NIH3T3-AXL с1.7 приводит к сдвигу на два порядка величины и демонстрирует сверхэкспрессию AXL на поверхности этих клеток.

Фигура 16. Модель ортотопического ксенотрансплантата для изучения влияния антител крысы против AXL на рост карциномы простаты человека в безтимусных мышах. Клетки карциномы простаты PC-3-LN были ортотопически имплантированы в простату мышей NMRI-nu/nu. Животные были случайным образом разделены на 4 группы и получали 25 мг/кг изотипного контрольного антитела 1D5 или антагонистического антитела крысы 11В7 против AXL, а также 40 мг/кг Сутента или 12,5 мг/кг Таксотера. В ходе лечения рост ортотопически имплантированных опухолей PC-3-LN и периферических метастазов анализировался один раз в неделю с помощью биолюминесцентного анализа in vivo в день 15, день 23, день 29 и день 34. Для выяснения деталей смотри текст. По сравнению с изотипным контрольным антителом 1D5 антагонистическое антитело крысы 11В7 против AXL снижало общий рост опухолей простаты PC-3-LN у безтимусных мышей.

Фигура 17. Модель ортотопического ксенотрансплантата для изучения влияния антител крысы против AXL на метастазирование карциномы простаты человека в безтимусных мышах. Клетки карциномы простаты PC-3-LN были ортотопически имплантированы в простату мышей NMRI-nu/nu. Животные были случайным образом разделены на 4 группы и получали 25 мг/кг изотопического контрольного антитела 1D5 или антагонистического антитела крысы 11В7 против AXL, а также 40 мг/кг Сутента или 12,5 мг/кг Таксотера. После вскрытия животных были взяты некоторые органы (печень, селезенка, легкое, бедренная кость и часть поясничного отдела позвоночника) и проанализированы на наличие метастазов с помощью биолюминесцентного анализа. Для выяснения деталей смотри текст. По сравнению с изотопическим контрольным антителом 1D5 антагонистическое антитело крысы 11В7 против AXL настоящего изобретения снижало появление метастазов в селезенке. Необходимо отметить, что антиметастатический эффект 11В7 в этом эксперименте был сильнее, чем таковой Сутента.

Фигура 18: На этой Фигуре показана конструкция вектора pEF6KCL.

Фигура 19: На этой Фигуре показана связывающая активность гуманизированных антител крысы против AXL человека от h#11B7-T1 до h#11B7-T6, определенная методом ELISA с использованием планшета, покрытого AXL-Fc человека.

Фигура 20: На этой Фигуре показана связывающая активность гуманизированных антител крысы против AXL человека от h#11B7-T7 до h#11B7-T13, определенная методом ELISA с использованием планшета, покрытого AXL-Fc человека.

Фигура 21: На этой Фигуре показана связывающая активность гуманизированных антител крысы против AXL человека от h#11B7-T14 до h#HB7-T20, определенная методом ELISA с использованием планшета, покрытого AXL-Fc человека.

Фигура 22: На этой Фигуре показана связывающая активность гуманизированных антител крысы против AXL человека от h#HB7-T21 до h#HB7-T27, определенная методом ELISA с использованием планшета, покрытого AXL-Fc человека.

Фигура 23: На этой Фигуре показана связывающая активность гуманизированных антител крысы против AXL человека от h#11D5-T1 до h#11D5-T6, определенная методом ELISA с использованием планшета, покрытого AXL-Fc человека.

Фигура 24 (верхняя и нижняя панели): На этой Фигуре показана концентрация белка гуманизированных антител крысы против AXL человека от h#11B7-T1 до h#HB7-Т27, определенная методом прямого измерения поглощения белка.

Фигура 25: На этой Фигуре показана концентрация белка гуманизированных антител крысы против AXL человека от h#11D5-T1 до h#11D5-T6, определенная методом прямого измерения поглощения белка.

Фигура 26: На этой Фигуре показано определение домена на антигене AXL человека, с которым связывается моноклональное антитело крысы #11В7 против AXL человека.

Фигура 27. Эксперименты ELISA для исследования эффектов гуманизированных антител 11В7 против AXL на фосфорилирование рецептора AXL. Клетки рака молочной железы Hs578T (вверху) и клетки рака легких NCI-H292 (внизу) были истощены, проинкубированы с 10 мкг/мл контрольного антитела Gammagard, химерных mAb chm11B7 (IgG1/Kappa) антител против AXL и гуманизированных антител против AXL h#HB7-T2, h#HB7-T3, h#HB7-T4, h#HB7-T5 и h#HB7-T6 (T2-T6) настоящего изобретения, обработаны или не обработаны 400 нг/мл mGas6 и лизированы. Лизаты переносили в покрытый антителом 4G10 против фосфотирозина 96-луночный планшет Maxi-Sorp, который после этого промывали и инкубировали с 0,125 мкг/мл биотинилированного антитела крысы 12В7 против AXL, АР-конъюгированным стрептавидином и раствором субстрата AttoPhos для измерения интенсивности флуоресценции. Для выяснения деталей смотри текст. По сравнению с контрольным антителом Gammagard, химерное антитело против AXL chm11B7 и гуманизированные антитела против AXL h#HB7-T2, h#HB7-T3, h#HB7-T4, h#HB7-T5 и h#HB7-T6 настоящего изобретения были способны блокировать или достоверно снижать опосредованную Gas6 активацию AXL в обеих клеточных линиях, что видно по уменьшению уровней фосфорилирования тирозина в AXL в Gаs6-стимулированных клетках по сравнению с соответствующими нестимулированными клетками.

Фигура 28А. Эксперименты Вестерн-Блот для исследования эффектов гуманизированных антител 11В7 против AXL на фосфорилирование ERK1/2. Клетки рака молочной железы Hs578T (вверху) и клетки рака легких NCI-H292 (внизу) были истощены, проинкубированы с 10 мкг/мл контрольного антитела Gammagard, химерного mAb chmllB7 (IgG1/Kappa) антитела против AXL или гуманизированных антител против AXL h#HB7-T2, h#HB7-T3, h#HB7-T4, h#HB7-T5 и h#HB7-T6 настоящего изобретения до обработки или без обработки 400 нг/мл mGas6 и лизированы. Лизаты целых клеток разделяли SDS-электрофорезом в ПААГ и анализировали методом Вестерн-блоттинга с применением антитела против фосфо- р44/42 MAP киназы (Thr202/Tyr204). После этого те же самые фильтры повторно обрабатывали антителом против р44/42 MAP киназы. Для выяснения деталей смотри текст. По сравнению с контрольным антителом Gammagard химерное антитело chmllB7 против AXL и гуманизированные антитела против AXL h#HB7-T2, h#HB7-T3, h#HB7-T4, h#HB7-T5 и h#HB7-T6 настоящего изобретения препятствовали слабому Gаs6-индуцированному увеличению активации ERK1/2 в клетках рака молочной железы Hs578T. Однако, вследствие высокой базальной активности ERK1/2 в этой клеточной линии эти эффекты, которые указывают на сниженные уровни фосфорилирования ERK1/2 Thr202/Tyr204 в Gаs6-стимулированных клетках по сравнению с соответствующими не стимулированными клетками являются только относительно небольшими. В противоположность этому, ингибиторные эффекты химерного антитела chm11B7 против AXL и гуманизированных антител против AXL h#HB7-T2, h#HB7-T3, h#HB7-T4, h#HB7-T5, или h#HB7-T6 на фосфорилирование ERK1/2 Thr202/Tyr204 являются значительно более явно выраженными в клетках рака легких NCI-H292.

Фигура 28В. Эксперименты Вестерн-Блот для исследования эффектов гуманизированных антител 11В7 против AXL на фосфорилирование АКТ. Клетки рака молочной железы Hs578T (вверху) и клетки рака легких NCI-H292 (внизу) были истощены, проинкубированы с 10 мкг/мл контрольного антитела Gammagard, химерного mAb chm11B7 (IgG1/Kappa) антитела против AXL или гуманизированных антител против AXL h#HB7-T2, h#HB7-T3, h#HB7-T4, h#HB7-T5 и h#HB7-T6 настоящего изобретения до обработки или без обработки 400 нг/мл mGas6 и лизированы. Лизаты целых клеток разделяли SDS-электрофорезом в ПААГ и анализировали методом Вестерн-блоттинга с применением антитела против АКТ 1/2/3. После этого тот же самый фильтр повторно обрабатывали антителом против фосфо-АКТ (Ser473). Для выяснения деталей смотри текст. По сравнению с контрольным антителом Gammagard химерное антитело chm11B7 против AXL и гуманизированные антитела против AXL h#HB7-T2, h#HB7-T3, h#HB7-Т4, h#HB7-T5 и h#HB7-T6 настоящего изобретения были способны достоверно снижать Gаs6-индуцируемую активацию АКТ в клетках рака молочной железы Hs578T (вверху) и клетках рака легких NCI-H292 (внизу), что видно по уменьшенным уровням фосфорилирования АКТ Ser473 в Gаs6-стимулированных клетках по сравнению с соответствующими не стимулированными клетками.

Фигура 28С. Эксперименты Вестерн-Блот для исследования эффектов гуманизированных антител 11В7 против AXL на фосфорилирование GSK-3р. Клетки рака молочной железы Hs578T (вверху) и клетки рака легких NCI-H292 (внизу) были истощены, проинкубированы с 10 мкг/мл контрольного антитела Gammagard, химерного mAb chm11B7 (IgG1/Kappa) антитела против AXL или гуманизированных антител против AXL h#HB7-T2, h#HB7-T3, h#HB7-T4, h#HB7-T5 и h#HB7-T6 настоящего изобретения до обработки или без обработки 400 нг/мл mGas6 и лизированы. Лизаты целых клеток разделяли SDS-электрофорезом в ПААГ и анализировали методом Вестерн-блоттинга с применением антитела против фосфо-GSK-3β(Ser9). После этого тот же самый фильтр повторно обрабатывали антителом против GSK-3β. Для выяснения деталей смотри текст. По сравнению с контрольным антителом Gammagard химерное антитело chm11B7 против AXL и гуманизированные антитела против AXL h#HB7-T2, h#HB7-T3, h#HB7-T4, h#HB7-T5 и h#HB7-T6 настоящего изобретения были способны достоверно снижать Gas6-индyциpyeмyю активацию GSK-3β в клетках рака молочной железы Hs578T (вверху) и клетках рака легких NCI-H292 (внизу), что видно по уменьшенным уровням фосфорилирования GSK-3β Ser9 в Gаs6-стимулированных клетках по сравнению с соответствующими не стимулированными клетками.

Фигура 28D. Эксперименты Вестерн-Блот для исследования эффектов гуманизированных антител 11В7 против AXL на фосфорилирование TCS2. Клетки рака молочной железы Hs578T (вверху) и клетки рака легких NCI-H292 (внизу) были истощены, проинкубированы с 10 мкг/мл контрольного антитела Gammagard, химерного mAb chm11B7 (IgG1/Kappa) антитела против AXL или гуманизированных антител против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения до обработки или без обработки 400 нг/мл mGas6 и лизированы. Лизаты целых клеток разделяли SDS-электрофорезом в ПААГ и анализировали методом Вестерн-блоттинга с применением антитела против TSC2. После этого тот же самый фильтр повторно обрабатывали антителом против фосфо-Т8С2 (Thr1462). Для выяснения деталей смотри текст. По сравнению с контрольным антителом Gammagard химерное антитело chm11B7 против AXL и гуманизированные антитела против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения были способны достоверно снижать Gаs6-индуцируемое фосфорилирование TCS2 по Thr1462 в клетках рака молочной железы Hs578T (вверху) и клетках рака легких NCI-H292 (внизу), что видно по уменьшенным уровням фосфорилирования этого аминокислотного остатка в Gаs6-стимулированных клетках по сравнению с соответствующими не стимулированными клетками.

Фигура 28Е. Эксперименты Вестерн-Блот для исследования эффектов гуманизированных антител 11В7 против AXL на фосфорилирование mTOR. Клетки рака молочной железы Hs578T (вверху) и клетки рака легких NCI-H292 (внизу) были истощены, проинкубированы с 10 мкг/мл контрольного антитела Gammagard, химерного mAb chm11B7 (IgG1/Kappa) антитела против AXL или гуманизированных антител против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения до обработки или без обработки 400 нг/мл mGas6 и лизированы. Лизаты целых клеток разделяли SDS-электрофорезом в ПААГ и анализировали методом Вестерн-блоттинга с применением антитела против фосфо-mTOR (Ser2448). После этого тот же самый фильтр повторно обрабатывали антителом против mTOR. Для выяснения деталей смотри текст. Ингибиторные эффекты антител против AXL в клетках рака молочной железы Hs578T были относительно слабыми (вверху). Однако по сравнению с контрольным антителом Gammagard химерное антитело chm11B7 против AXL и гуманизированные антитела против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения были способны ослаблять Gas6-индyциpyeмyю активацию mTOR в клетках рака легких NCI-H292, что видно по уменьшенным уровням фосфорилирования mTOR Ser2448 в Gas6-стимулированных клетках по сравнению с соответствующими не стимулированными клетками (внизу).

Фигура 28F. Эксперименты Вестерн-Блот для исследования эффектов гуманизированных антител 11В7 против AXL на фосфорилирование S6K1. Клетки рака молочной железы Hs578T (вверху) и клетки рака легких NCI-H292 (внизу) были истощены, преинкубированы с 10 мкг/мл контрольного антитела Gammagard, химерного mAb chm11B7 (IgG1/Kappa) антитела против AXL или гуманизированных антител против AXL h#HB7-T2, h#HB7-T3, h#HB7-T4, h#HB7-T5 и h#HB7-T6 настоящего изобретения до обработки или без обработки 400 нг/мл mGas6 и лизированы. Лизаты целых клеток разделяли SDS-электрофорезом в ПААГ и анализировали методом Вестерн-блоттинга с применением антитела против фосфо-р70 S6 Киназы 1 (Thr421/Ser424). После этого тот же самый фильтр повторно обрабатывали антителом против β-актина. Для выяснения деталей смотри текст. По сравнению с контрольным антителом Gammagard химерное антитело chm11B7 против AXL и гуманизированные антитела против AXL h#HB7-T2, h#HB7-T3, h#HB7-T4, h#HB7-T5 и h#HB7-T6 настоящего изобретения продемонстрировали некоторые ингибиторные эффекты на Gаs6-индуцируемую активацию S6K1 в клетках рака молочной железы Hs578T, что видно по уменьшенным уровням фосфорилирования S6K1 Thr421/Ser424 в Gаs6-стимулированных клетках по сравнению с соответствующими не стимулированными клетками (вверху). Однако гораздо более значительное снижение Fаs6-стимулируемого фосфорилирования S6K1 Thr421/Ser424 и, следовательно, снижение активации после предварительной обработки химерным антителом chm11B7 против AXL и гуманизированными антителами против AXL h#HB7-T2, h#HB7-T3, h#HB7-T4, h#HB7-T5 или h#HB7-T6 настоящего изобретения можно наблюдать в клетках рака легких NCI-H292 (внизу).

Фигура 29. Эксперименты ELISA для исследования эффектов гуманизированных антител 11D5 против AXL на фосфорилирование рецептора AXL. Клетки рака молочной железы Hs578T были истощены, преинкубированы с 10 мкг/мл контрольного антитела Gammagard, химерного mAb chm11B7 (IgG1/Kappa) антитела против AXL или гуманизированных антител против AXL h#11B7-T2, h#11B7-T3, h#11В7-Т4, h#HB7-T5 и h#HB7-T6 настоящего изобретения, обработаны или не обработаны 400 нг/мл mGas6 и лизированы. Лизаты переносили в покрытый антителом 4G10 против фосфотирозина 96-луночный планшет Maxi-Sorp, который после этого промывали и инкубировали с 0,125 мкг/мл биотинилированного антитела крысы 12В7 против AXL, АР-конъюгированным стрептавидином и раствором субстрата AttoPhos для измерения интенсивности флуоресценции. Для выяснения деталей смотри текст. По сравнению с контрольным антителом Gammagard химерное антитело chm11B7 против AXL и гуманизированные антитела против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#HB7-T6 настоящего изобретения были способны блокировать или достоверно снижать опосредованную Gas6 активацию AXL, что видно по уменьшению уровней фосфорилирования тирозина в AXL в Gаs6-стимулированных клетках по сравнению с соответствующими нестимулированными клетками.

Фигура 30А: Аминокислотная последовательность AXL человека. Accession No. Р_30530, база данных по белкам NCBI.

Фигура 30В: Аминокислотная последовательность вариабельного участка легкой цепи моноклонального антитела крысы против AXL человека 11В7.

Фигура 30С: Аминокислотная последовательность вариабельного участка тяжелой цепи моноклонального антитела крысы против AXL человека 11В7.

Фигура 30D: Аминокислотная последовательность вариабельного участка легкой цепи моноклонального антитела крысы против AXL человека 11D5.

Фигура 30Е: Аминокислотная последовательность вариабельного участка тяжелой цепи моноклонального антитела крысы против AXL человека 11D5.

Фигура 31. Эксперименты ELISA для сравнения эффектов антител крысы и химерных антител против AXL на фосфорилирование AXL. Клетки рака шейки матки CaSki были истощены, проинкубированы с 50 нг/мл, 100 нг/мл, 300 нг/мл, 750 нг/мл, 1 мкг/мл и 10 мкг/мл антитела крысы против AXL 11В7 (А) или химерного антитела против AXL ch11В7 (В), обработаны или не обработаны 400 нг/мл mGas6 и лизированы. Лизаты переносили в покрытый антителом 4G10 против фосфотирозина 96-луночный планшет Maxi-Sorp. После этого планшет промывали и инкубировали с 0,5 мкг/мл биотинилированного антитела крысы 12В7 против AXL, АР-конъюгированным стрептавидином и раствором субстрата AttoPhos для измерения интенсивности флуоресценции. Для выяснения деталей смотри текст. Как видно из концентрационно-зависимого снижения относительного фосфорилирования AXL в клеточной линии рака шейки матки CaSki, антитело крысы 11В7 против AXL (А) и химерное антитело ch11В7 (В) настоящего изобретения были способны блокировать лиганд-индуцируемую активацию рецепторной тирозинкиназы AXL в одинаковой степени.

Фигура 32А: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков легкой цепи моноклонального антитела крысы против AXL человека #11В7, обозначенного как h#HB7-T15L и h#HB7-T18L, соответственно.

Фигура 32В: На этой Фигуре показана аминокислотная последовательность гуманизированных вариабельных участков тяжелой цепи моноклонального антитела крысы против AXL человека #11В7, обозначенного как h#11B7-T11Н и h#11B7-T12H, соответственно.

Фигура 33: На этой Фигуре показана связывающая активность гуманизированных антител крысы против AXL человека от h#11B7-T28 до h#HB7-Т31, определенная методом ELISA с использованием планшетов, покрытых AXL-Fc человека (ELISA).

Фигура 34: На этой Фигуре показана концентрация белка гуманизированных антител крысы против AXL человека от h#HB7-T28 до h#HB7-T31, измеренная методом ВЭЖХ (HPLC assay) (Смотри Пример 24).

Фигуры от 35(1) до 35(32): Эти Фигуры описывают определение Тm гуманизированных антител крысы против AXL человека от h#11B7-T1 до h#11B7-T31 и химерного антитела h#HB7 методом дифференциальной сканирующей калориметрии (DSC).

Фигура 36. Эксперименты ELISA для исследования эффектов гуманизированных антител 11В7 против AXL на фосфорилирование рецептора AXL. Клетки рака молочной железы Hs578T (вверху) и клетки рака легких NCI-H292 (внизу) были истощены, проинкубированы без антител или с 10 мкг/мл контрольного антитела Gammagard или гуманизированных антител против AXL 11B7-T5, 11В7-Т6, 11В7-Т11, 11В7-Т23 и 11В7-Т25 настоящего изобретения, обработаны или не обработаны 400 нг/мл mGas6 и лизированы. Лизаты переносили в покрытый антителом 4G10 против фосфотирозина 96-луночный планшет Maxi-Sorp, который после этого промывали и инкубировали с 0,125 мкг/мл биотинилированного антитела крысы 12В7 против AXL, АР-конъюгированным стрептавидином и раствором субстрата AttoPhos для измерения интенсивности флуоресценции. Для выяснения деталей смотри текст. По сравнению с контрольным антителом Gammagard гуманизированные антитела против AXL 11B7-T5, 11В7-Т6, 11В7-Т11, 11В7-Т23 и 11В7-Т25 настоящего изобретения достоверно снижали опосредованную Gas6 активацию AXL в обеих клеточных линиях, что видно по уменьшению уровней фосфорилирования тирозина в AXL в Gas6- стимулированных клетках по сравнению с соответствующими нестимулированными клетками.

Фигура 37. Эксперименты ELISA для исследования эффектов гуманизированных антител 11В7 против AXL на фосфорилирование Akt-киназы. Клетки рака молочной железы Hs578T (вверху) и клетки рака легких NCI-H292 (внизу) были истощены, проинкубированы без антител или с 10 мкг/мл контрольного антитела Gammagard или гуманизированных антител против AXL 11B7-T5, 11В7-Т6, 11В7-Т11, 11В7-Т23 и 11В7-Т25 настоящего изобретения, обработаны или не обработаны 400 нг/мл mGas6 и зафиксированы формальдегидом. Клетки были промыты, погашены (quenched) и проинкубированы с первичным антителом против фосфо-Akt (Ser473), HRP-конъюгированным анти-кроличьим вторичным антителом и раствором тетраметилбензидина для измерения интенсивности поглощения. Для выяснения деталей смотри текст. По сравнению с контрольным антителом Gammagard гуманизированные антитела против AXL 11B7-T5, 11В7-Т6, 11В7-Т11, 11В7-Т23 и 11В7-Т25 настоящего изобретения были способны блокировать или снижать опосредованную Gas6 активацию Akt-киназы в обеих клеточных линиях, что видно по уменьшению уровней фосфорилирования Akt (Ser473) в Gas6-стимулированных клетках по сравнению с соответствующими нестимулированными клетками.

Фигура 38. Анализ FACS для исследования эффектов гуманизированных антител 11В7 против AXL на интернализацию рецептора AXL. Клетки рака молочной железы Hs578T были истощены, инкубированы без антител или с 10 мкг/мл контрольного антитела Gammagard или гуманизированных антител против AXL 11B7-T5, 11В7-Т6, 11В7-Т11, 11В7-Т23 и 11В7-Т25 настоящего изобретения в течение указанных периодов времени и зафиксированы формальдегидом. Клетки были прокрашены первичным антителом крысы против AXL mAb 2A1 и РЕ-конъюгированным вторичным антителом осла против IgG крысы, после чего был проведен анализ FACS. Для выяснения деталей смотри текст. В противоположность контрольному антителу Gammagard, обработка клеток рака молочной железы Hs578T гуманизированными антителами против AXL 11В7-Т5, 11В7-Т6, 11В7-Т11, 11В7-Т23 и 11В7-Т25 приводит к интернализации рецептора AXL. Показаны относительные уровни экспрессии AXL в %, определенные как средние интенсивности флуоресценции обработанных mAb против AXL образцов по отношению к необработанным образцам за соответствующий период обработки.

Фигура 39 А+В. Анализ клеточного ангиогенеза на основе использования сфероидов для исследования эффектов гуманизированных антител 11В7 против AXL с применением прорастающих Gas6-индуцированных эпителиальных клеток. Сфероиды HUVEC, преобработанные VEGF-A, помещались в трехмерный коллагеновый гель, стимулировались 1 мг/мл Gas6 человека и обрабатывались указанными концентрациями контрольного антитела Gammagard или гуманизированных антител против AXL 11B7-T5, 11В7-Т6, 11В7-Т11, 11В7-Т23 и 11В7-Т25 настоящего изобретения в течение 24 часов. Было проанализировано среднее значение ± SEM суммарной длины отростков 10 случайным образом выбранных сфероидов на каждую точку (левая панель), и было определено относительное ингибирование антителом (правая панель). Построение кривых IС50 и расчет значений IС50 проводили с использованием программы GraphPad Prism 4.03. Для выяснения деталей смотри текст.

Описание Последовательностей

[SEQ ID NO:1] нуклеотидная последовательность праймера для амплификации Фрагмента А, обозначенного как Праймер EFF1

[SEQ ID NO:2] нуклеотидная последовательность праймера для амплификации Фрагмента А, обозначенного как Праймер EFsmaR

[SEQ ID NO:3] нуклеотидная последовательность Фрагмента В, включающая сигнал секреции и константный участок каппа-цепи человека, и сигнал для добавления поли(А)

[SEQ ID NO:4] нуклеотидная последовательность Фрагмента ДНК, включающая нуклеотидную последовательность, кодирующую аминокислотную последовательность сигнальной последовательности и константного участка IgG1 человека

[SEQ ID NO:5] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T1L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:6] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T2L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:7] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T3L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:8] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T4L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:9] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T5L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:10] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T6L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:11] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T7L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:12] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T8L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:13] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T9L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:14] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T10L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:15] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#11B7-THL, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:16] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T12L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:17] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T13L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:18] аминокислотная последовательность h#HB7-T1L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:19] аминокислотная последовательность h#HB7-T2L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:20] аминокислотная последовательность h#HB7-T3L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:21] аминокислотная последовательность h#HB7-T4L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:22] аминокислотная последовательность h#HB7-T5L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:23] аминокислотная последовательность h#HB7-T6L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:24] аминокислотная последовательность h#HB7-T7L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:25] аминокислотная последовательность h#HB7-T8L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:26] аминокислотная последовательность h#HB7-T9L, сигнальную последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:27] аминокислотная последовательность h#HB7-T10L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:28] аминокислотная последовательность h#11B7-T11L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:29] аминокислотная последовательность h#HB7-T12L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:30] аминокислотная последовательность h#11B7-T13L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:31] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T1H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (397-1386)

[SEQ ID NO:32] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T2H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (397-1386)

[SEQ ID No:33] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T3H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (397-1386)

[SEQ ID NO:34] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T4H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (397-1386)

[SEQ ID NO:35] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T5H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (397-1386)

[SEQ ID NO:362] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T6H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (397-1386)

[SEQ ID NO:37] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T7H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (397-1386)

[SEQ ID NO:38] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T8H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (397-1386)

[SEQ ID NO:39] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T9H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (397-1386)

[SEQ ID NO:40] аминокислотная последовательность h#HB7-T1H, сигнальная последовательность (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:41] аминокислотная последовательность h#HB7-T2H, сигнальная последовательности (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:42] аминокислотная последовательность h#HB7-T3H, сигнальная последовательность (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:43] аминокислотная последовательность h#11В7-Т4Н, сигнальная последовательность (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:44] аминокислотная последовательность h#HB7-T5H, сигнальная последовательность (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:45] аминокислотная последовательность h#HB7-T6H, сигнальная последовательность (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:46] аминокислотная последовательность h#HB7-T7H, сигнальная последовательность (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:47] аминокислотная последовательность h#HB7-T8H, сигнальная последовательность (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:48] аминокислотная последовательность h#HB7-T9H, сигнальная последовательности (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:49] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#11D5-T1L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:50] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HD5-T2L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:51] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HD5-T3L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:52] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HD5-T4L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:53] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HD5-T5L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:54] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HD5-T6L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок(388-702)

[SEQ ID NO:55] аминокислотная последовательность h#HD5-T1L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID N0:56] аминокислотная последовательность h#HD5-T2L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:57] аминокислотная последовательность h#HD5-T3L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:58] аминокислотная последовательность h#HD5-T4L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:59] аминокислотная последовательность h#HD5-T5L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:60] аминокислотная последовательность h#HD5-T6L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:61] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HD5-T1H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (297-1386)

[SEQ ID NO:62] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HD5-T2H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (297-1386)

[SEQ ID NO:63] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HD5-T3H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (297-1386)

[SEQ ID NO:64] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HD5-T4H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (297-1386)

[SEQ ID NO:65] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HD5-T5H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (297-1386)

[SEQ ID NO:66] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#11D5-T6H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (297-1386)

[SEQ ID NO:67] аминокислотная последовательность h#11D5-T1H, сигнальная последовательность (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:68] аминокислотная последовательность h#HD5-T2H, сигнальная последовательности (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:69] аминокислотная последовательность h#11D5-T3H, сигнальная последовательность (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:70] аминокислотная последовательность h#HD5-T4H, сигнальная последовательность (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:71] аминокислотная последовательность h#HD5-T5H, сигнальная последовательность (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:72] аминокислотная последовательность h#HD5-T6H, сигнальная последовательность (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:73] аминокислотная последовательность h#11B7-T14L, вариабельный участок

[SEQ ID NO:74] аминокислотная последовательность h#11B7-T15L, вариабельный участок

[SEQ ID NO:75] аминокислотная последовательность h#11B7-T16L, вариабельный участок

[SEQ ID NO:76] аминокислотная последовательность h#11B7-T17L, вариабельный участок

[SEQ ID NO:77] аминокислотная последовательность h#11B7-T18L, вариабельный участок

[SEQ ID NO:78] аминокислотная последовательность h#11B7-T19L, вариабельный участок

[SEQ ID NO:79] аминокислотная последовательность h#11B7-T20L, вариабельный участок

[SEQ ID NO:80] аминокислотная последовательность h#HB7-T10H, вариабельный участок

[SEQ ID NO:81] аминокислотная последовательность h#11B7-THH, вариабельный участок

[SEQ ID NO:82] аминокислотная последовательность h#HB7-T12H, вариабельный участок

[SEQ ID NO:83] аминокислотная последовательность h#11D5-T7L, вариабельный участок

[SEQ ID NO:84] аминокислотная последовательность h#11D5-T8L, вариабельный участок

[SEQ ID NO:85] аминокислотная последовательность h#11D5-T9L, вариабельный участок

[SEQ ID NO:86] аминокислотная последовательность h#HD5-T10L, вариабельный участок

[SEQ ID NO:87] аминокислотная последовательность h#11D5-THL, вариабельный участок

[SEQ ID NO:88] аминокислотная последовательность h#HD5-T12L, вариабельный участок

[SEQ ID NO:89] аминокислотная последовательность h#HD5-T13L, вариабельный участок

[SEQ ID NO:90] аминокислотная последовательность h#HD5-T14L, вариабельный участок

[SEQ ID NO:91] аминокислотная последовательность h#HD5-T15L, вариабельный участок

[SEQ ID NO:92] аминокислотная последовательность h#11D5-T16L, вариабельный участок

[SEQ ID NO:93] аминокислотная последовательность h#HD5-T17L, вариабельный участок

[SEQ ID NO:94] аминокислотная последовательность h#HD5-T18L, вариабельный участок

[SEQ ID NO:95] аминокислотная последовательность h#HD5-T19L, вариабельный участок

[SEQ ID NO:96] аминокислотная последовательность h#HD5-T20L, вариабельный участок

[SEQ ID NO:97] аминокислотная последовательность h#HD5-T21L, вариабельный участок

[SEQ ID NO:98] аминокислотная последовательность h#HD5-T22L, вариабельный участок

[SEQ ID NO:99] аминокислотная последовательность h#HD5-T23L, вариабельный участок

[SEQ ID NO:100] аминокислотная последовательность h#HD5-T24L, вариабельный участок

[SEQ ID NO:101] аминокислотная последовательность h#HD5-T25L, вариабельный участок

[SEQ ID NO:102] аминокислотная последовательность h#HD5-T26L, вариабельный участок

[SEQ ID NO:103] аминокислотная последовательность h#HD5-T27L, вариабельный участок

[SEQ ID NO:104] аминокислотная последовательность h#HD5-T28L, вариабельный участок

[SEQ ID NO:105] аминокислотная последовательность h#HD5-T29L, вариабельный участок

[SEQ ID NO:106] аминокислотная последовательность h#HD5-T30L, вариабельный участок

[SEQ ID NO:107] аминокислотная последовательность h#11D5-T31L, вариабельный участок

[SEQ ID NO:108] аминокислотная последовательность h#HD5-T32L, вариабельный участок

[SEQ ID NO:109] аминокислотная последовательность h#HD5-T33L, вариабельный участок

[SEQ ID NO:110] аминокислотная последовательность h#HD5-T34L, вариабельный участок

[SEQ ID NO:111] аминокислотная последовательность h#HD5-T35L, вариабельный участок

[SEQ ID NO:112] аминокислотная последовательность h#HD5-T36L, вариабельный участок

[SEQ ID NO:113] аминокислотная последовательность h#HD5-T37L, вариабельный участок

[SEQ ID NO:114] аминокислотная последовательность h#HD5-T7H, вариабельный участок

[SEQ ID NO:115] аминокислотная последовательность h#HD5-T8H, вариабельный участок

[SEQ ID NO:116] аминокислотная последовательность h#HD5-T9H, вариабельный участок

[SEQ ID NO:117] аминокислотная последовательность h#HD5-T10H, вариабельный участок

[SEQ ID NO:118] аминокислотная последовательность h#11D5-THH, вариабельный участок

[SEQ ID NO:119] аминокислотная последовательность h#11D5-T12H, вариабельный участок

[SEQ ID NO:120] аминокислотная последовательность h#HD5-T13H, вариабельный участок

[SEQ ID NO:121] аминокислотная последовательность 11В7 Легкая цепь CDRL4

[SEQ ID NO:122] аминокислотная последовательность 11В7 Легкая цепь CDRL5

[SEQ ID NO:123] аминокислотная последовательность 11В7 Легкая цепь CDRL6

[SEQ ID NO:124] аминокислотная последовательность 11В7 Тяжелая цепь CDRH1

[SEQ ID NO:125] аминокислотная последовательность 11В7 Тяжелая цепь CDRH2

[SEQ ID NO:126] аминокислотная последовательность 11В7 Тяжелая цепь CDRH3

[SEQ ID NO:127] аминокислотная последовательность 11D5 Легкая цепь CDRL4

[SEQ ID NO:128] аминокислотная последовательность 11D5 Легкая цепь CDRL5

[SEQ ID NO:129] аминокислотная последовательность 11D5 Легкая цепь CDRL6

[SEQ ID NO:130] аминокислотная последовательность 11D5 Тяжелая цепь CDRH1

[SEQ ID NO:131] аминокислотная последовательность 11D5 Тяжелая цепь CDRH2

[SEQ ID NO:132] аминокислотная последовательность 11D5 Тяжелая цепь CDRH3

[SEQ ID NO:133] нуклеотидная последовательность Лидерной последовательности

[SEQ ID NO:134] аминокислотная последовательность Лидерной последовательности

[SEQ ID NO:135] аминокислотная последовательность #11В7-химерной легкой цепи

[SEQ ID NO:136] аминокислотная последовательность #11В7-химерной тяжелой цепи

[SEQ ID NO:137] аминокислотная последовательность #11D5-химерной легкой цепи

[SEQ ID NO:138] аминокислотная последовательность #11D5-химерной тяжелой цепи

[SEQ ID NO:139] аминокислотная последовательность AXL человека, Accession No. Р_30530 базы данных по белкам NCBI, которая также описана в Фигуре 30А

[SEQ ID NO:140] аминокислотная последовательность вариабельного участка легкой цепи моноклонального антитела крысы против AXL человека 11В7, которая также описана в Фигуре 30В и которая идентична аминокислотной последовательности, состоящей из аминокислот No. 1-108 #11В7-химерной легкой цепи (SEQ ID NO:135)

[SEQ ID NO:141] аминокислотная последовательность вариабельного участка тяжелой цепи моноклонального антитела крысы против AXL человека 11В7, которая также описана в Фигуре 30С и которая идентична аминокислотной последовательности, состоящей из аминокислот No. 1-113 #11В7-химерной тяжелой цепи (SEQ ID NO:136)

[SEQ ID NO:142] аминокислотная последовательность вариабельного участка легкой цепи моноклонального антитела крысы против AXL человека 11D5, которая также описана в Фигуре 30D и которая идентична аминокислотной последовательности, состоящей из аминокислот No. 1-108 #11D5-химерной легкой цепи (SEQ ID NO:137)

[SEQ ID NO:143] аминокислотная последовательность вариабельного участка тяжелой цепи моноклонального антитела крысы против AXL человека 11D5, которая также описана в Фигуре 30Е и которая идентична аминокислотной последовательности, состоящей из аминокислот No. 1-113 #11D5-химерной тяжелой цепи (SEQ ID NO:138)

[SEQ ID NO:144] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T15L, сигнальную последовательности (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:145] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T18L, сигнальную последовательность (1-60), вариабельный участок (61-387), константный участок (388-702)

[SEQ ID NO:146] аминокислотная последовательность h#HB7-T15L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:147] аминокислотная последовательность h#HB7-T18L, сигнальная последовательность (1-20), вариабельный участок (21-129), константный участок (130-234)

[SEQ ID NO:148] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-THH, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (397-1386)

[SEQ ID NO:149] нуклеотидная последовательность, кодирующая аминокислотную последовательность h#HB7-T12H, сигнальную последовательность (1-57), вариабельный участок (58-396), константный участок (397-1386)

[SEQ ID NO:150] аминокислотная последовательность h#11В7-Т11Н, сигнальная последовательности (1-19), вариабельный участок (20-132), константный участок (133-462)

[SEQ ID NO:151] аминокислотная последовательность h#HB7-T12H, сигнальная последовательность (1-19), вариабельный участок (20-132), константный участок (133-462)

Примеры

Пример 1. Получение сверхэкспрессирующих AXL фибробластов RatI в качестве иммуногена

Полноразмерная кодирующая последовательность рецепторной тирозинкиназы AXL человека, вариант транскрипта 1 согласно контрольной последовательности (NM_021913) базы National Center for Biotechnology Information (NCBI), была субклонирована в pLXSN через фланкирующие элементы, которые узнаются эндонуклеазами рестрикции EcoRI и BamHI, в результате чего был создан ретровирусный экспрессионный вектор pLXSN-hAXL.

Для получения антител, которые специфически связываются с рецепторной тирозиновой киназой AXL человека, с помощью ретровирусного переноса гена были получены фибробласты RatI, стабильно сверхэкспрессирующие AXL человека. Вкратце, 3×105 клеток Phoenix-E было посеяно на 60 мм чашки Петри и трансфецировано 2 мкг/мл вектора pLXSN или pLXSN-hAXL с использованием кальций-фосфатного метода. Через 24 часа среда была заменена свежей средой, в которой клетки Phoenix-E инкубировались в течение 4 часов. Супернатанты клеток Phoenix-E, высвобождающих pLXSN или pLXSN-hAXL экотрофный вирус, собирались и использовались для инкубации субконфлуентных клеток RatI (2×105 клеток на 6 см чашку Петри) в течение 3 часов в присутствии Polybrene (4 мг/мл, Aldrich). Одновременно с этим клетки Phoenix-E были ре-инкубированы в свежей среде, которая через следующие 3 часа была использована для второго инфицирования фибробластов RatI в присутствии Polybrene (4 мг/мл, Aldrich). Подобным образом был проведен третий цикл инфицирования. После смены среды начинали селекцию клеток RatI с помощью G418. Как правило, стабильные клоны отбирались после селекции в течение 21 дня.

Была создана панель стабильных клонов, в которых была проведена количественная оценка экспрессии локализованного в мембране AXL человека с помощью анализа FACS. Более конкретно, с помощью 10 мМ ЭДТА в PBS было собрано 1×105 клеток, клетки промывали один раз буфером FACS (PBS, 3% FCS, 0,4% азида) и высевали в круглодонный 96-луночный планшет. Клетки осаждали центрифугированием в течение 3 минут при 1000 об/мин для удаления супернатанта и ресуспендировали с первичным антителом мыши против AXL MAB154 (R&D Systems, 3 мкг/мл). Суспензии клеток инкубировали на льду в течение 1 часа, дважды промывали буфером FACS и ресуспендировали в растворе (по 100 мкл/лунку) РЕ-конъюгированных анти-мышиных вторичных антител осла (Jackson), разведенных 1:50 в буфере FACS. Суспензии клеток инкубировали на льду и в темноте в течение 30 минут, дважды промывали буфером FACS и исследовали с помощью проточного цитометра Epics XL-MCL (Beckman Coulter).

Фигура 15А показывает результаты анализа FACS моноклональной популяции RatI-Mock, стабильно инфицированной пустым вектором pLXSN, и RatI-AXL c1.2, стабильно инфицированной pLXSN-hAXL, и демонстрирует сверхэкспрессию AXL на клеточной поверхности этого репрезентативного клона.

Кроме того, чтобы создать пригодную клеточную модельную систему для экспериментальных задач, фибробласты NIH3T3, стабильно сверхэкспрессирующие AXL, были получены способом, аналогичным описанному для RatI. Вкратце, 3×105 клеток Phoenix-E было посеяно на 60 мм чашки Петри и трансфецировано 2 мкг/мл вектора pLXSN или pLXSN-hAXL кДНК с использованием кальций-фосфатного метода. Через 24 часа среда была заменена свежей средой, в которой клетки Phoenix-E инкубировались в течение 4 часов. Супернатанты клеток Phoenix-E, высвобождающих pLXSN или pLXSN-hAXL экотрофный вирус, собирались и использовались для инкубации субконфлуентных клеток NIH3T3 (2×105 клеток на 6 см чашку Петри) в течение 3 часов в присутствии Polybrene (4 мг/мл, Aldrich). Одновременно с этим клетки Phoenix-E были ре-инкубированы в свежей среде, которая через следующие 3 часа была использована для второго инфицирования фибробластов NIH3T3 в присутствии Polybrene (4 мг/мл, Aldrich). Подобным образом был проведен третий цикл инфицирования. После смены среды начинали селекцию клеток NIH3T3 с помощью G418. Как правило, стабильные клоны отбирались после селекции в течение 21 дня.

Была создана панель стабильных клонов, в которых была проведена количественная оценка экспрессии локализованного в мембране AXL человека с помощью анализа FACS. Более конкретно, с помощью 10 мМ ЭДТА в PBS было собрано 1×105 клеток, клетки один раз промывали буфером FACS (PBS, 3% FCS, 0,4% азида) и высевали в круглодонный 96-луночный планшет. Клетки осаждали центрифугированием в течение 3 минут при 1000 об/мин для удаления супернатанта и ресуспендировали с первичным антителом мыши МАВ154 (R&D Systems, 3 мкг/мл) против AXL. Суспензию клеток инкубировали на льду в течение 1 часа, дважды промывали буфером FACS и ресуспендировали (по 100 мкл/лунку) в растворе РЕ-конъюгированных анти-мышиных вторичных антител осла (Jackson), разведенных 1:50 в буфере FACS. Суспензии клеток инкубировали на льду и в темноте в течение 30 минут, дважды промывали буфером FACS и исследовали с помощью проточного цитометра Epics XL-MCL (Beckman Coulter).

Фигура 15В показывает результаты анализа FACS поликлональной популяции NIH3T3-Mock, стабильно инфицированной пустым вектором pLXSN, и NIH3T3-AXL с1.7, стабильно инфицированной pLXSN-hAXL, и демонстрирует сверхэкспрессию AXL на клеточной поверхности этого репрезентативного клона.

Пример 2. Получение моноклональных антител крысы против AXL

Моноклональные антитела крысы против AXL были получены путем инъекции примерно 10×106 замороженных клеток RatI-AXL c1.2 как внутрибрюшинно, так и подкожно крысам Lou/C или Long Evans. После интервала в 8 недель была сделана конечная бустер-инъекция внутрибрюшинно и подкожно за 3 дня перед слиянием клеток. Слияние клеточной линии миеломы P3X63-Ag8.653 с иммунными клетками селезенки крыс было проведено согласно стандартной процедуре, в результате чего было получено 105 гибридом. Через 2 недели были собраны первые супернатанты от гибридом, которые проанализировали первичным методом FACS на связывание с фибробластами NIH3T3-AXL с1.7 по сравнению с контрольными клетками NIH3T3-Mock. Клоны, положительные по связыванию AXL, культивировались далее. Из 50 мл супернатанта от этих клонов были очищены антитела и был проведен повторный анализ на специфическое связывание с AXL на фибробластах NIH3T3-AXL с1.7 по сравнению с контрольными клетками NIH3T3-Mock. Очищенные антитела, специфически связывающиеся с фибробластами NIH3T3-AXL с1.7, но не с контрольными клетками NIH3T3-Mock, были дополнительно протестированы на [их влияние] на фосфорилирование Akt-киназы методом ELISA, и был проведен анализ ELISA для определения [их] изотипа. Для очистки антител крысы супернатант центрифугировали 20 минут при 5000×g, после чего проводили стерильную фильтрацию. Добавляли 500 мкл протеин G-Сефарозы FF и инкубировали при 4°С в течение, по меньшей мере, 1 часа в центрифужных стаканах. Сефарозу осаждали центрифугированием, супернатант выливали, а матрицу с белком G дважды промывали PBS перед проведением элюции белка, используя цитратный буфер (100 мМ) с рН 2,1. Элюируемые фракции немедленно забуферивались до нейтральных рН добавлением 1 М Tris рН 8,0 и диализовались против PBS.

Из протестированных олигоклональных антител 91 антитело специфически связывалось с фибробластами NIH3T3-AXL с1.7 и не связывалось с контрольными клетками NIH3T3-Mock, 9 ингибировало Gas6-индуцируемое фосфорилирование Akt в тех же самых клетках, тогда как 71 стимулировало фосфорилирование Akt. Четыре антагонистических антитела (I11B7, I10D12, I6E7 и III11D5, в следующих Примерах обозначаются как 11В7, 10D12, 6Е7 и 11D5 соответственно) два антагонистических антитела (в следующих Примерах обозначаются как I11D7 и III2A1) и одно контрольное антитело (III1D5; в следующих Примерах обозначается как 1D5) были крио-консервированы и субклонированы.

Пример 3: Структура и свойства антител против AXL

3.1. Нуклеотидные последовательности вариабельных доменов антитела крысы

Вариабельные домены антитела крысы против AXL были клонированы из гибридомных клеток. РНК получали с использованием набора RNA-Extraction kit RNeasy (RNeasy midi-kit, Qiagen). кДНК, кодирующая гены антитела, была получена с использованием набора 5'RACE kit (Invitrogen) согласно инструкции производителя.

Вкратце, одноцепочечная кДНК была синтезирована на матрице общей РНК с использованием ген-специфичных праймеров GSP1 и обратной транскриптазы Superscript™ II. После синтеза первой цепи кДНК исходная матрица мРНК удалялась обработкой РНКазой (RNase Mix). После этого к 3'-концу кДНК присоединялся гомополимерный хвост. ПЦР-амплификация проводилась с использованием Taq ДНК-полимеразы, гнездового ген-специфичного праймера (GSP2), который отжигается по участку, расположенному внутри молекулы кДНК, и якорного праймера, предоставленных в наборе. После амплификации 5' RACE продукты были клонированы в вектор pLXSN-ESK для секвенирования. Для облегчения клонирования якорный праймер (АР) включал последовательность для узнавания Sal I, праймеры GSP2 содержали сайт для XhoI.

GSP1 праймер:

каппа _GSP1: GATGGATGCATTGGTGCAGC

новый_каппа_GSP1: atagatacagttggtgcagc

тяжелый_GSР1: CAGGGTCACCATGGAGTTA

GSP2 Праймер:

XhoI-hGSP2: CCGCTCGAGCGGGCCAGTGGATAGACAGATGG

XhoI-kGSP2: CCGCTCGAGCGGCCGTTTCAGCTCCAGCTTGG

Применение праймеров GSP для клонирования Mab крысы против AXL:

11В7: каппа GSP1; XhoI-kGSP2

тяжелый GSP1; XhoI-hGSP2

10D12: каппа_GSР1, новый_каппа_GSP1; XhoI-kGSP2

тяжелый GSP1; XhoI-hGSP2

11D5: новый_каппа_GSP1; XhoI-kGSP2

тяжелый GSP1; XhoI-hGSP2

3.2. Аминокислотная последовательность вариабельных доменов антитела крысы против AXL

Последовательности вариабельных доменов антитела крысы были транслированы с секвенированных генов, клонированных в векторы pLXSN-ESK. Данные аминокислотные последовательности начинаются с положения один вариабельного домена. Гипервариабельные участки (CDRs), необходимые для специфического связывания антитела с его мишенью, определяли согласно методу Kabat (Rabat et al. Sequences of Proteins of Immunological Interest, Fifth Edition. NIH Publication No. 91-3242, 1991). Определение по методу Kabat основывается на вариабельности последовательности внутри вариабельных доменов. Специфические CDR участки антител против AXL приведены на Фигуре 14 и в последовательностях от SEQ ID NO:121 до SEQ ID NO:132. Индивидуальные CDRs включают следующие положения:

CDR-L1: 24-34 CDR-L2: 50-56 CDR-L3: 89-97

CDR-H1: 31-35b CDR-H2: 50-65 CDR-H3: 95-102

Аминокислотные последовательности вариабельных участков легкой и тяжелой цепей антитела крысы 11В7 представлены последовательностями SEQ ID NOs: 140 и 141 соответственно. Подклассы легкой и тяжелой цепей антитела крысы 11В7 представляют собой каппа и IgG1 соответственно.

Аминокислотные последовательности вариабельных участков легкой и тяжелой цепей антитела крысы 11D5 представлены последовательностями SEQ ID NOs: 142 и 143 соответственно. Подклассы легкой и тяжелой цепей антитела крысы 11D5 представляют собой каппа и IgG2a соответственно.

3.3 Экспрессия и очистка антитела крысы:

Гибридомы культивировали в биореакторах Celline CL 1000 (Integra Biosciences) при 37°С, 5-7% CO2 с использованием среды DMEM, включающей 4,5 г/л глюкозы, 1% глутамина, 1% пирувата, 1% смеси пенициллин/стрептомицин. Добавка фетальной сыворотки теленка (FCS) составляла 1% для питательного отсека и 5% FCS с низким содержанием IgG для клеточного отсека. Сбор и замену среды проводили два раза в неделю. Разделение клеток проводили в отношении 1/1 -> 1/3 в зависимости от их роста. Продуктивность определяли один раз в неделю с помощью SDS-электрофореза в ПААГ. Супернатанты хранили при -20°С до стадии очистки. Тест на микоплазму в растущих культурах проводили один раз в неделю.

Антитела очищали на Протеин А или G Сефарозе FF (GE-Healthcare) с использованием системы Äkta Explorer 100 System (GE-Healthcare). Для каждой очистки колонки набивали индивидуально. Размер колонки подбирался в соответствии с ожидаемой продуктивность и размером каждой партии (обычно 50-500 мг). Содержащие белок растворы держали на льду или при 4°С везде, где это было возможно. На всех стадиях процесса использовались стерильные буферные растворы и бидистиллированная вода.

Супернатанты размораживали, забуферивали добавлением 50 мМ Трис, рН 8,5, центрифугировали, фильтровали через мембраны с размером пор 0,22 мкм и наносили на колонку. После промывания 8 объемами колонки (CV) 50 мМ Р04, рН 8,5, антитело элюировали 10 CV 100 мМ глицина, рН 3,3. Фракции элюата немедленно забуферивали до нейтральных значений рН добавлением 1/5 объема 1 М Трис, рН 8,0 (1 мл Триса на 4 мл фракции элюата), после чего анализировали rSDS-электрофорезом в ПААГ. Собирали фракции, содержащие чистое антитело, диализовали их против PBS при 4°С и стерилизовали фильтрацией.

Требования к буферным системам подбирали согласно индивидуальным свойствам каждого антитела. В частности, антитело IgG2a крысы 11D5 связывали с матрицей Протеин G 4 FF (GE-Healthcare) и смывали высокими концентрациями соли (2М NaCl). Антитело IgG1 крысы 11В7 очищали на матрице Протеин A (rProtein A, GE-Healthcare) и смывали высокими концентрациями соли, как и 11D5. Элюцию антитела проводили при рН 5,5. Для повышения эффективности связывания при очистке антител крысы необходимо поддерживать низкую скорость протока.

В качестве второй стадии очистки можно использовать либо ионообменную хроматографию (с индивидуальным подбором подходящих условий), либо препаративную хроматографию в исключенном объеме (PBS, рН 7,4).

Стандартный протокол для контроля качества очищенных антител включает:

Анализ с помощью rSDS-электрофореза в ПААГ, прокрашивание Кумасси или серебром

Тест ВСА (Pierce #23227 ВСА Protein Assay Kit; стандарт IgG крысы #31233)

Аналитическая эксклюзионная хроматография (Superdex 200 Tricom 10/300 GL, ~250 мг в 250 мкл; 0,5 мл/мин, Äkta Explorer 100)

Тест на эндотоксины (LAL, Cambrex QCL-1000® Chromogenic LAL Endpoint Assay # US50-648U)

Анализ активности на основе клеток (связывание FACS; pAkt; pAXL)

Очищенные антитела хранили в PBS, рН 7,4, в стерильных условиях при 4°С или -20°С в зависимости от их стабильности.

Одно из полученных антител крысы, 11В7, применялось в Примерах 5, 6 и 16.

3.4. Определение сродства антитела по графику Скетчарда FACS

Клетки NIH3T3, сверхэкспрессирующие AXL человека, собирали инкубацией в 10 мМ ЭДТА в PBS и ресуспендировали по 6 миллионов клеток на 1 мл в буфере FACS (PBS, рН 7,4, 3% FCS, 0,1% NaNa3). По 100 мкл клеточной суспензии добавляли в лунки круглодонного планшета для микротитрования к 100 мкл раствора антител, содержащего антитела 11В7, 11D5, ch11B7-IgG1, ch11B7-IgG2, ch11D5-IgG1 или ch11D5-IgG2 в концентрациях между 40 и 0,002 мкг/мл (266 и 0,01 нМ) в буфере FACS. Связывание антител проводили в течение 2 часов на льду. После этого клетки дважды промывали 250 мкл буфера FACS на лунку и ресуспендировали в 200 мкл вторичного антитела (анти-крысиное-РЕ; Jackson), разведенного 1:50 в буфере FACS. Через 45 минут инкубации клетки снова дважды промывали буфером FACS и ресуспендировали в 500 мл PBS для анализа FACS. Анализ проводили на приборе Beckman-Coulter FACS FC500. Для определения кажущейся константы сродства KDapp средние значения флуоресценции откладывали на графике против отношения средней флуоресценции и соответствующей концентрации антитела ([М]). Рассчитанные по обратному наклону прямой на графике значения KDapp представлены ниже:

Клон Значение KD (нМ)
11В7 0,38
ch11B7-IgG1 0,6
11D5 0,81
Ch11D5-IgG1 0,4

Представленные выше значения KD включают таковые химерных антител, полученных в Примере 4.

Пример 4: Химеризация антител крысы против AXL:

Гены легкой цепи и тяжелой цепи каппа IgG1/2 человека были клонированы из мононуклеарных клеток (РВМС) периферической крови людей-добровольцев, как описано ниже.

Клетки РВМС выделяли из цельной крови. Кровь разводили в соотношении 1/2,5 в PBS/ 2 мМ ЭДТА с 10 ед./мл гепарина при комнатной температуре, наслаивали поверх 15 мл раствора Biocoll, покрытого диафрагмой (35 мл/центрифужную пробирку) [Biocoll от Biochrom # L6115]. Образцы центрифугировали при комнатной температуре в течение 30 мин при 400×g и удаляли сыворотку (-15 мл). Промежуточный слой, содержащий клетки РВМС, осторожно собирали Пастеровской пипеткой. Клетки РВМС промывали два раза в PBS/2 мМ ЭДТА (первая промывка в 100 мл, вторая промывка в 50 мл) и осаждали центрифугированием при 300 × g в течение 10 мин. Осадок клеток ресуспендировали в RPMI/10% FCS (25 мл) с выходом 5,5×107 клеток РВМС.

РНК из РВМС выделяли с использованием набора RNeasy kit от Qiagen (# 75142) согласно инструкции производителя. Очищенную РНК (30 мкг) хранили в аликвотах при -80°С.

кДНК для антитела IgG гамма 1 и 2 и для каппа цепей были получены из выделенной РНК с помощью РТ-ПЦР с использованием набора Superskript III Reverse Transkriptase (invitrogen # 18080-93) согласно инструкциям производителя с применением следующих праймеров:

1) RT-гамма: GCG TGT AGT GGT TGT GCA GAG

2) КТ-гамма2: ggg ctt gee ggc cgt g

3) RT-каппа: TGG AAC TGA GGA GCA GOT GG

4) 5'Blp: AGA TAA GCT TTG CTC AGC GTC CAC CAA GGG CCC АТС GGT

5) 3'Bam(GAG): AGA TGG АТС CTC ATT TAC CCG GAG АСА GGG AGA G

6) 5'Bsi: AGA TAA GCT TCG TAC GGT GGC TGC ACC АТС TGT CTT CAT

7) 3'Bam(CTT): AGA TGG АТС CCT AAC ACT CTC CCC TGT TGA AGC TCT

Праймеры растворяли до концентрации 100 мкМ. Реакции РТ-ПЦР проводили с использованием 2 пмоль олиго RTγ и RTκ соответственно с добавлением 1 мкг РНК, 10 мМ смеси дНТФ при нагревании в течение 5 минут до 65°C. Было добавлено 4 мкл буфера для первой цепи, 1 мкл 0,1 М ДТТ, 1 мкл ингибитора РНКазы (40 ед./мкл Fermentas # E00311) и 2 мкл Superscript III RT, смесь была перемешана и нагревалась при 50°С в течение 1 часа, после чего следовала стадия термоинактивации в течение 15 минут при 70°C.

Для второй стадии ПЦР брали 2 мкл реакционной смеси первой цепи и использовали Taq-полимеразу (Eurochrom # EMEO 10001) для получения двухцепочечной ДНК константных доменов антител. Для амплификации константных участков γ-цепи использовали праймеры 5'Blp и 3'Bam(GAG) и для амплификации константных участков κ-цепи использовали праймеры 5'Bsi и 3'Ват(СТТ), проводя ПЦР в следующем режиме: амплификация κ-цепи:

94°С 120 сек
94°С 30 сек
55°С 30 сек
72°С 45 сек 35 циклов
72°С 10 мин

амплификация γ-цепи:

94°С 120 сек
94°С 30 сек
45°С 30 сек
72°С 60 сек 5 циклов
94°С 30 сек
50°С 30 сек
72°С 60 сек 35 циклов
72°С 10 мин

Продукты ПЦП анализировали в 2% агарозном геле в буфере ТАЕ. Была обнаружена одна полоса размером -350 п.о. для легкой цепи каппа и одна полоса размером ~ 1000 п.о. для тяжелых цепей γ1 и γ2. Продукты ПЦР очищали с использованием Qiagen gel extraction kit, (QIAGEN, #28784) согласно инструкциям производителя. Для клонирования фрагментов ПЦР по множественным сайтам полилинкера вектора pcDNA3 (Invitrogen), вектор pcDNA3 и фрагменты ПЦР расщепляли эндонуклеазами рестрикции HindIII (5') и BamHI (3'). Сайты рестрикции входили в состав праймеров для ПЦР. Расщепленные фрагменты были очищены с использованием Qiagen PCR purification kit (QIAGEN, 28104), и ДНК, кодирующая γ1, γ2 и к цепи, была лигирована в вектор pcDNA3 с помощью Т4 ДНК-лигазы при 16°С в течение ночи. Лигазу инактивировали нагреванием в течение 10 минут при 65°С. Лигированные плазмидные ДНК были непосредственно трансформированы в CaCl3-компетентные E.coli с использованием стандартного протокола, которые высевали на LB-чашки, содержащие Ампициллин. После инкубации при 37°С в течение ночи собирали одиночные колонии, суспендировали их в 10 мкл Н2О и проверяли на содержание плазмид, несущих соответствующую цепь антитела с помощью ПЦР (5 мкл суспензии клеток, Taq-полимераза, праймеры 5Вlp и 3Bam(GAG) для колоний γ1/γ2 и 5Bsi и 3Bam(СТТ) для колоний κ:

94°С 120 сек
94°С 30 сек
55°С 30 сек
72°С 60 сек 35 циклов
72°С 10 мин

Образцы анализировали в 1,5% агарозном геле на содержание ПЦР-продуктов. Колонии, содержащие гены антител, были отобраны и инокулированы в 5 мл среды LB/Ампициллин. После инкубации при 37°C в течение ночи E.coli были собраны и из них была получена ДНК с использованием набора Qiagen miniprep kit (QIAGEN, # 12123). Контрольное расщепление (HindIII, BamHI) показало наличие вставки всех генов κ и γ цепей ожидаемого размера; правильность последовательностей была подтверждена секвенированием ДНК на Medigenomix.

Вариабельные домены крысы были амплифицированы с помощью ПЦР из вектора pLXSN-ESK и клонированы в векторы g1/g2 и k pcDNA3 для получения химерных полноразмерных антител. Вариабельные VL домены были амплифицированы с использованием следующих праймеров, содержащих сайт HindIII и BsmI на 5'-конце и сайт BsiWI на 3'-конце:

VL-11B7-5': AGA ТАА GCT TGT GCA TTC CGA CAT CCA GAT GAC CCA GGC TCC

VL-11B7-3': AGA TCG TAC GTT TCA GCT CCA GCT TGG TGC CTC

VL-11D5-5': AGA ТАА GCT TGT GCA TTC CGA CAT CCA GAT GAC CCA GTC TCC АТС

VL-11D5-3': AGA TCG TAC GTT TCA GCT TGG TCC CAG

Вариабельные VH домены были амплифицированы с использованием следующих праймеров, содержащих сайт HindIII и BsmI на 5'-конце и сайт В1рI на 3'-конце:

VH-11B7/11D5-5': AGA ТАА GCT TGT GCA TTC CGA GGT GCA GCT TCA GGA GTC AGG

VH-11B7/11D5-3': AGA TGC TGA GCT GAC AGT GAC CAT GAC TCC TTG GCC

Сайты BsiWI для легкой цепи и В1рI для тяжелой цепи являются единственными сайтами на 5'-конце константных участков для того, чтобы обеспечить прямое слияние с 3'-концом генов вариабельных доменов.

Гены, кодирующие цепи химерных антител, слитые с лидерной последовательностью SEQ ID No. : 133, полученной из вектора pLNOH2 (Norderhaug et. al. J. Immunol. Methods 204, 1997; Neuberger EMBO J. 1983; 2 (8): 1373-8,1983), были клонированы в векторную систему рСЕР для рекомбинантной экспрессии. Гены легких цепей были клонированы с помощью NheI (5') и XhoI (3') в рСЕР4 (Invitrogen), гены тяжелых цепей были клонированы с помощью KpnI (5') и XhoI (3') в pCEP-Pu (Kohfeld FEBS Vol 414; (3) 557ff, 1997).

Клетки НЕК 293 высевали на чашки размером 20×20 см и котрансфецировали 1 мг/мл каждой плазмиды, кодирующей гены легкой и тяжелой цепей, с использованием стандартного метода трансфекции с CaРO4 для промежуточной экспрессии. Культивирование проводили при 37°С, 5% CO2 в среде DMEM/F12 с высоким содержанием глюкозы, содержащей 5% FCS с пониженным уровнем IgG, 1% пирувата, 1% глутамина, 1% смеси пенициллин/стрептомицин. Через 24 часа после трансфекции среда заменялась свежей средой. Супернатанты собирали каждые 2-3 дня в течение примерно 3 недель. Химерные антитела очищали из примерно 600 мл супернатанта с применением 1 мл колонок Hitrap rProtein A (GE-Healthcare) в стандартных условиях забуферивания (нанесение: 50 мМ Трис, рН 8,5, промывка: 50 мМ РO4; рН=8,5, элюция: 100 мМ глицин; рН 3,3), как это описано для очистки антител крысы.

Одна из полученных химерных молекул, происходящих из антитела 11В7 крысы, состояла из тяжелой цепи IgG1 человека, представленной аминокислотной последовательностью SEQ ID NO:136 (Фигура 14) и каппа легкой цепи человека, представленной аминокислотной последовательностью SEQ ID NO:135 (Фигура 14).

Одна из полученных химерных молекул, происходящих из антитела 11D5 крысы, состояла из тяжелой цепи IgG1 человека, представленной аминокислотной последовательностью SEQ ID NO:138 (Фигура 14) и каппа легкой цепи человека, представленной аминокислотной последовательностью SEQ ID NO:137 (Фигура 14).

Эти химерные антитела 11В7 и 11D5, обозначенные как ch11B7-IgG1 и ch11D5-IgG1 соответственно, были использованы в Примерах 3, 13, 14 и 17-20.

Пример 5. Антитела крысы против AXL настоящего изобретения снижают рост карциномы простаты человека у безтимусных мышей

Противоопухолевая эффективность терапевтических антител часто оценивается в исследованиях ксенотрансплантатов опухолей человека. В этих модельных системах опухоли человека растут в виде ксенотрансплантатов в мышах с ослабленным иммунитетом, и терапевтическая эффективность измеряется по степени ингибирования роста опухоли. Целью настоящего исследования была оценка того, является ли антитело крысы 11В7 против AXL настоящего изобретения антагонистом роста опухоли клеток рака простаты человека в безтимусных мышах. Вкратце, в день 0 самцов мышей линии NMRI-nu/nu возрастом 7-8 недель (примерный вес 30 г после акклиматизации) анестезировали 1,5-2,0 объемными процентами изофлурана при скорости тока кислорода 2 л/мин и ортотопически имплантировали им в простату 1×106 клеток PC-3-LN в 25 мкл PBS. Клетки PC-3-LN были получены из клеточной линии карциномы простаты РС-3, которая была инфицирована ретровирусом, кодирующим слитый белок люцифераза-неомицин. Таким образом, начало роста опухоли и развитие опухоли можно было анализировать in vivo путем анализа биолюминесценции. Для этой цели мышам внутрибрюшинно вводили люциферин и через 10 минут после инъекции измеряли испускание света с помощью прибора NightOWL LB 981 bioluminescence imaging system (Berthold Technologies, Germany). Перед началом лечения мышей разделяли случайным образом на группы и проводили статистический анализ для подтверждения однородности исходных размеров опухолей (среднее значение, медиана и стандартное отклонение) во всех обрабатываемых группах по 10 мышей в каждой. В день 8 начинали все обработки и продолжали их до дня 34, после чего в день 35 проводили вскрытие. Животным в группах 1 и 2 внутрибрюшинно в дозе 25 мг/кг 3 раза в неделю (понедельник, среда, пятница) вводили изотопическое контрольное антитело 1D5 и антагонистическое антитело крысы 11В7 против AXL соответственно. Животные в группе 3 перорально получали 40 мг/кг Сутента 1 раз в день. Животным в группе 4 внутривенно вводили три инъекции 12,5 мг/кг Таксотера с перерывом в 4 дня между инъекциями. Обзор всех групп, получавших обработку, приведен ниже.

Фигура 16 показывает результаты этого эксперимента. По сравнению с изотипным контрольным антителом 1D5 антагонистическое антитело крысы 11В7 против AXL настоящего изобретения снижало общий рост опухолей простаты PC-3-LN у безтимусных мышей.

Пример 6. Антитела крысы против AXL настоящего изобретения ингибируют метастазирование карциномы простаты человека

В эксперименте, аналогичном тому, который описан в Примере «Антитела крысы против AXL настоящего изобретения снижают рост карциномы простаты человека у безтимусных мышей», после вскрытия было проанализировано переселение опухолевых клеток PC-3-LN в другие органы (метастазирование) для оценки анти-метастатических эффектов антагонистического антитела крысы 11В7 против AXL настоящего изобретения. Для этой цели после вскрытия были взяты некоторые органы (печень, селезенка, легкие, бедренная кость, часть поясничного отдела позвоночника), гомогенизированы, и в гомогенат был введен люциферин. После этого измеряли испускание света с помощью прибора NightOWL LB 981 bioluminescence imaging system (Berthold Technologies, Germany).

Фигура 17 показывает результаты этого эксперимента, полученные при анализе селезенок. По сравнению с изотипным контрольным антителом 1D5 антагонистическое антитело крысы 11В7 против AXL настоящего изобретения снижало появление метастазов в селезенке. Необходимо отметить, что анти-метастатический эффект 11В7 в этом эксперименте был более сильным, чем таковой Сутента. Аналогичные наблюдения были получены для метастазов в печени, легких, бедренной кости и поясничном отделе позвоночника.

Пример 7: Дизайн гуманизированного антитела

7.1 Дизайн гуманизированной версии #11В7

7.1.1 Молекулярное моделирование вариабельных доменов #11В7

Молекулярное моделирование вариабельных доменов #11В7 было проведено согласно методу, обычно известному в данной области техники как метод моделирования по гомологии (Methods in Enzymology, 203, 121-153, (1991)). Первичные последовательности (доступны трехмерные структуры, полученные на основе рентгеноструктурного анализа кристаллических структур) вариабельных доменов иммуноглобулинов человека, зарегистрированные в базе данных по белкам Protein Data Bank (Nuc. Acid Res. 35, D301-D303 (2007)), сравнивали с полученными для вариабельных доменов #11В7. В результате был выбран 1JPT, как имеющий наивысшую гомологию последовательности с вариабельным доменом легкой цепи #11В7. Более того, был выбран 1F8T, как имеющий наивысшую гомологию последовательности с вариабельным доменом тяжелой цепи #11В7. Трехмерные структуры каркасных доменов были построены на основе «модели каркаса», полученной путем комбинирования координат для 1JPT и 1F8T, соответствующих легкой и тяжелой цепям #11В7. Для #11В7 CDRs, CDRL1, CDRL2, CDRL3, CDRH1 и CDRH2 были созданы кластеры 11А, 7А, 9А, 10А и 9А соответственно, согласно классификации Thomton et al. (J. Mol. BioL, 263, 800-815, (1996)). CDRHs был классифицирован как k (3) согласно Н3-правилам (FEBS letters 399, 1-8 (1996)). После этого типичная конформация каждого CDR была включена в модель каркаса.

Наконец, для получения возможных молекулярных моделей вариабельных доменов #11В7 в терминах энергии, был проведен расчет энергии для исключения невыгодного межатомного контакта. Эти расчеты были сделаны с использованием коммерчески доступной программы предсказания трехмерной структуры белков Prime и программы поиска координат MacroModel (Schrodinger, LLC).

7.1.2 Дизайн аминокислотной последовательности гуманизированного антитела #11В7

Гуманизированные антитела #11В7 были сконструированы согласно методу, обычно известному в данной области техники как метод «прививки CDR» (CDR grafting) (Proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)). Акцепторные антитела выбирались двумя способами на основе аминокислотной гомологии в пределах каркасных доменов.

Последовательности каркасных доменов #11В7 сравнивали с таковыми всех каркасных доменов человека, зарегистрированных в базе данных Kabat Database (Nuc. Acid Res. 29, 205-206 (2001)), содержащей аминокислотные последовательности антител. В результате в качестве акцептора было выбрано антитело GM4672'CL, с которым гомология между каркасными доменами составила 72%. Аминокислотные остатки каркасных доменов GM4672'CL выравнивались с соответствующими аминокислотными остатками в #11В7 для идентификации положений, в которых в них присутствуют разные аминокислоты. Положения этих остатков были проанализированы с помощью сконструированной трехмерной модели #11В7. После этого выбирали донорные остатки для введения их в акцептор согласно критерию, предоставленному Queen et al. (Proc. Natl. Acad. Sci. USA 86,10029-10033 (1989)).

Последовательности каркасных доменов #11В7 сравнивали с таковыми всех каркасных доменов человека, зарегистрированных в базе данных IgBLAST (Nuc. Acid Res. 36, D25-D30 (2007)). В результате ВАС01582 была выбрана в качестве акцепторной L-цепи на основании 76% гомологии между их каркасными доменами. AAF80028 была выбрана в качестве акцепторной Н-цепи на основании 66% гомологии между их каркасными доменами. Аминокислотные остатки каркасных доменов в ВАС01582 L цепи и в AAF80028 Н-цепи выравнивались с соответствующими аминокислотными остатками в #11В7 для идентификации положений, в которых в них присутствуют разные аминокислоты. Положения этих остатков были проанализированы с помощью сконструированной трехмерной модели #11В7. После этого выбирали донорные остатки для введения их в акцептор согласно критерию, предоставленному Queen et al. (Proc. Natl. Acad. Sci. USA 86,10029-10033 (1989)).

Во всех методах гуманизированные последовательности #11В7 конструировали, как описано ниже в Примерах, путем переноса некоторых выбранных донорных остатков в акцепторные антитела.

7.1.3 Гуманизация легкой цепи #11В7 (Фигуры 1, 2 и 3)

7.1.3.1 Легкая цепь h#11В7-Т1L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 36 (фенилаланин), 43 (серии), 45 (аргинин), 47 (метионин), 65 (серин), 66 (аргинин), 69 (серии), 71 (тирозин), 72 (серин), 73 (лейцин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, тирозин, аланин, лизин, лейцин, треонин, глицин, треонин, фенилаланин, треонин, фенилаланин, глутамин, пролин, фенилаланин, треонин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T1L-типа ".

7.1.3.2 Легкая цепь h#HB7-T2L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 43 (серин), 45 (аргинин), 65 (серин), 66 (аргинин), 69 (серин), 72 (серин), 73 (лейцин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, аланин, лизин, треонин, глицин, треонин, треонин, фенилаланин, глутамин, пролин, фенилаланин, треонин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T2L"-типа.

7.1.3.3 Легкая цепь h#HB7-T3L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 43 (серин), 45 (аргинин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, аланин, лизин, треонин, глутамин, пролин, фенилаланин, треонин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T3L"-типа.

7.1.3.4 Легкая цепь h#11В7-Т4L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 36 (фенилаланин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, тирозин, аланин, лизин, лейцин, глицин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#HB7-T4L"-типа.

7.1.3.5 Легкая цепь h#HB7-T5L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 43 (серин), 45 (аргинин), 66 (аргинин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO: 140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, аланин, лизин, глицин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#HB7-T5L"-типа.

7.1.3.6 Легкая цепь h#11В7-Т6L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 43 (серин), 45 (аргинин), 66 (аргинин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, аланин, лизин, глицин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11В7-Т6L"-типа.

7.1.3.7 Легкая цепь h#11В7-Т7L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 36 (фенилаланин), 43 (серин), 45 (аргинин), 66 (аргинин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, тирозин, аланин, лизин, глицин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11В7-Т7L"-типа.

7.1.3.8 Легкая цепь h#11B7-T8L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, аланин, лизин, лейцин, глицин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T8L"-типа.

7.1.3.9 Легкая цепь h#11B7-T9L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 43 (серин), 45 (аргинин), 66 (аргинин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, аланин, лизин, глицин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T9L"-типа.

7.1.3.10 Легкая цепь h#11В7-Т10L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 36 (фенилаланин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, тирозин, аланин, лизин, лейцин, глицин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T10L"-типа.

7.1.3.11 Легкая цепь h#11B7-T11L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 43 (серии), 45 (аргинин), 47 (метионин), 66 (аргинин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серии), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, аланин, лизин, лейцин, глицин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T11L''-типа.

7.1.3.12 Легкая цепь h#11B7-T12L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 36 (фенилаланин), 43 (серин), 45 (аргинин), 66 (аргинин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью in SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, тирозин, аланин, лизин, глицин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T12L"-типа.

7.1.3.13 Легкая цепь h#11B7-T13L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 36 (фенилаланин), 43 (серии), 45 (аргинин), 47 (метионин), 66 (аргинин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, тирозин, аланин, лизин, лейцин, глицин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T13L"-типа.

7.1.3.14 Легкая цепь h#11B7-T14L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 36 (фенилаланин), 43 (серии), 45 (аргинин), 66 (аргинин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, тирозин, аланин, лизин, глицин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T14L"-типа.

7.1.3.15 Легкая цепь h#11B7-T15L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, аланин, лизин, лейцин, глицин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T15L"-типа.

7.1.3.16 Легкая цепь h#11B7-T16L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 43 (серин), 45 (аргинин), 66 (аргинин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, аланин, лизин, глицин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T16L"-типа.

7.1.3.17 Легкая цепь h#11B7-T17L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 36 (фенилаланин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серии, валин, тирозин, аланин, лизин, лейцин, глицин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11В7-Т17L"-типа.

7.1.3.18 Легкая цепь h#11B7-T18L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серин, серин, валин, аланин, лизин, лейцин, глицин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T18L"-типа.

7.1.3.19 Легкая цепь h#11В7-Т19L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 36 (фенилаланин), 43 (серин), 45 (аргинин), 66 (аргинин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ-ID NO: 140 Списка Последовательностей (Фигура ЗОВ), на серин, серин, валин, тирозин, аланин, лизин, глицин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-T19L"-типа.

7.1.3.20 Легкая цепь h#11B7-T20L-типа:

Гуманизированный вариабельный участок легкой цепи #11В7, созданный путем замены аминокислот №№7 (аланин), 12 (пролин), 15 (лейцин), 36 (фенилаланин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 71 (тирозин), 72 (серии), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (аспарагиновая кислота), 100 (глицин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11В7, представленной последовательностью SEQ ID NO:140 Списка Последовательностей (Фигура 30В), на серии, серии, валин, тирозин, аланин, лизин, лейцин, глицин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11B7-Т20L"-типа.

7.1.4 Гуманизация тяжелой цепи #11В7 (Фигуры 4 и 5)

7.1.4.1 Тяжелая цепь h#11В7-Т1Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11В7, созданный путем замены аминокислот №№1 (глутаминовая кислота), 2 (валин), 17 (серии), 23 (серии), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагиновая кислота), 44 (лизин), 45 (метионин), 48 (метионин), 67 (изолейцин), 68 (серин), 70 (треонин), 71 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (серин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11В7, представленной последовательностью SEQ ID NO:141 Списка Последовательностей (Фигура 30С), на глутамин, изолейцин, треонин, аланин, серин, глутамин, пролин, лизин, глицин, лейцин, изолейцин, валин, треонин, серин, валин, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11В7-Т1Н"-типа.

7.1.4.2 Тяжелая цепь h#11В7-Т2Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11В7, созданный путем замены аминокислот №№1 (глутаминовая кислота), 2 (валин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагиновая кислота), 44 (лизин), 45 (метионин), 70 (треонин), 71 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (серин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11В7, представленной последовательностью SEQ ID NO:141 Списка Последовательностей (Фигура 30С), на глутамин, изолейцин, треонин, аланин, серин, глутамин, пролин, лизин, глицин, лейцин, серин, валин, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11В7-Т2Н"-типа.

7.1.4.3 Тяжелая цепь h#11В7-Т3Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11В7, созданный путем замены аминокислот №№1 (глутаминовая кислота), 17 (серин), 23 (серин), 25 (треонин), 40 (фенилаланин), 44 (лизин), 45 (метионин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (серин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11В7, представленной последовательностью SEQ ID NO:141 Списка Последовательностей (Фигура 30С), на глутамин, треонин, аланин, серии, пролин, глицин, лейцин, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11В7-Т3Н"-типа.

7.1.4.4 Тяжелая цепь h#11В7-Т4Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11В7, созданный путем замены аминокислот №№1 (глутаминовая кислота), 6 (глутаминовая кислота), 7 (серии), 9 (пролин), 12 (валин), 16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагиновая кислота), 44 (лизин), 45 (метионин), 48 (метионин), 67 (изолейцин), 68 (серин), 70 (треонин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (серин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11В7, представленной последовательностью SEQ ID NO:141 Списка Последовательностей (Фигура 30С), на глутамин, глутамин, триптофан, аланин, лейцин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, изолейцин, валин, треонин, серин, серин, лизин, серин, аланин, аланин, валин, треонин и треонин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11В7-Т4Н"-типа.

7.1.4.5 Тяжелая цепь h#11В7-Т5Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11В7, созданный путем замены аминокислот №№1 (глутаминовая кислота), 6 (глутаминовая кислота), 7 (серин), 9 (пролин), 12 (валин), 16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагиновая кислота), 44 (лизин), 45 (метионин), 70 (треонин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (серин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11В7, представленной последовательностью SEQ ID NO:141 Списка Последовательностей (Фигура 30С), на глутамин, глутамин, триптофан, аланин, лейцин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, серин, серин, лизин, серии, аланин, аланин, валин, треонин и треонин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11В7-Т5Н"-типа.

7.1.4.6 Тяжелая цепь h#11В7-Т6Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11В7, созданный путем замены аминокислот №№1 (глутаминовая кислота), 16 (глутамин), 17 (серии), 23 (серии), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагиновая кислота), 44 (лизин), 45 (метионин), 70 (треонин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (серин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11В7, представленной последовательностью SEQ ID NO:141 Списка Последовательностей (Фигура 30С), на глутамин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, серин, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11В7-Т6Н"-типа.

7.1.4.7 Тяжелая цепь h#11В7-Т7Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11В7, созданный путем замены аминокислот №№1 (глутаминовая кислота), 16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагиновая кислота), 44 (лизин), 45 (метионин), 48 (метионин), 67 (изолейцин), 70 (треонин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (серин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11В7, представленной последовательностью SEQ ID NO:141 Списка Последовательностей (Фигура 30С), на глутамин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, изолейцин, валин, серин, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "11#11В7-Т7Н"-типа.

7.1.4.8 Тяжелая цепь h#11В7-Т8Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11В7, созданный путем замены аминокислот №№1 (глутаминовая кислота), 16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагиновая кислота), 44 (лизин), 45 (метионин), 68 (серин), 70 (треонин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (серии), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11В7, представленной последовательностью SEQ ID NO:141 Списка Последовательностей (Фигура 30С), на глутамин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, треонин, серии, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11В7-Т8Н"-типа.

7.1.4.9 Тяжелая цепь h#11В7-Т9Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11В7, созданный путем замены аминокислот №№1 (глутаминовая кислота), 16 (глутамин), 17 (серин), 23 (серии), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагиновая кислота), 44 (лизин), 45 (метионин), 48 (метионин), 67 (изолейцин), 68 (серии), 70 (треонин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (серин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11В7, представленной последовательностью SEQ ID NO:141 Списка Последовательностей (Фигура 30С), на глутамин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, изолейцин, валин, треонин, серин, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11В7-Т9Н"-типа.

7.1.4.10 Тяжелая цепь h#11В7-Т10Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11В7, созданный путем замены аминокислот №№1 (глутаминовая кислота), 6 (глутаминовая кислота), 7 (серин), 9 (пролин), 12 (валин), 16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагиновая кислота), 44 (лизин), 45 (метионин), 48 (метионин), 67 (изолейцин), 70 (треонин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (серин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11В7, представленной последовательностью SEQ ID NO:141 Списка Последовательностей (Фигура 30С), на глутамин, глутамин, триптофан, аланин, лейцин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, изолейцин, валин, серин, серин, лизин, серин, аланин, аланин, валин, треонин и треонин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11В7-Т10Н"-типа.

7.1.4.11 Тяжелая цепь h#11B7-T11Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11В7, созданный путем замены аминокислот №№1 (глутаминовая кислота), 6 (глутаминовая кислота), 7 (серин), 9 (пролин), 12 (валин), 16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагиновая кислота), 44 (лизин), 45 (метионин), 68 (серин), 70 (треонин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (серин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11В7, представленной последовательностью SEQ ID NO:141 Списка Последовательностей (Фигура 30С), на глутамин, глутамин, триптофан, аланин, лейцин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, треонин, серин, серин, лизин, серии, аланин, аланин, валин, треонин и треонин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11В7-Т11Н"-типа.

7.1.4.12 Тяжелая цепь h#11В7-Т12Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11В7, созданный путем замены аминокислот №№1 (глутаминовая кислота), 6 (глутаминовая кислота), 7 (серин), 9 (пролин), 12 (валин), 16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагиновая кислота), 44 (лизин), 45 (метионин), 48 (метионин), 67 (изолейцин), 68 (серин), 70 (треонин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (серин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11В7, представленной последовательностью SEQ ID NO:141 Списка Последовательностей (Фигура 30С), на глутамин, глутамин, триптофан, аланин, лейцин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, изолейцин, валин, треонин, серии, серин, лизин, серин, аланин, аланин, валин, треонин и треонин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11В7-Т12Н"-типа.

7.2 Дизайн гуманизированной версии #11D5

7.2.1 Молекулярное моделирование вариабельных доменов #11D5

Молекулярное моделирование вариабельных доменов #11D5 было проведено согласно методу, обычно известному в данной области техники как метод моделирования по гомологии (Methods in Enzymology, 203, 121-153, (1991)). Первичные последовательности (доступны трехмерные структуры, полученные на основе рентгеноструктурного анализа кристаллических структур) вариабельных доменов иммуноглобулинов человека, зарегистрированные в базе данных по белкам Protein Data Bank (Nuc. Acid Res. 35, D301-D303 (2007)), сравнивали с полученными для вариабельных доменов #11D5. В результате был выбран 1D5I, как имеющий наивысшую гомологию последовательности с вариабельным доменом легкой цепи #11D5. Более того, был выбран 10RS, как имеющий наивысшую гомологию последовательности с вариабельным доменом тяжелой цепи #11D5. Трехмерные структуры каркасных доменов были построены на основе «модели каркаса», полученной путем комбинирования координат для 1D5I и 10RS, соответствующих легкой и тяжелой цепям #11D5. Для #11D5 CDRs, CDRL1, CDRL2, CDRL3, CDRH1 и CDRH2 были созданы кластеры 11А, 7А, 9А, 10А и 9А соответственно, согласно классификации Thomton et al. (J. Mol. Biol., 263, 800-815, (1996)). CDRH3 был классифицирован как k (3) согласно Н3-правилам (FEBS letters 399, 1-8 (1996)). После этого типичная конформация каждого CDR была включена в модель каркаса.

Наконец, для получения возможных молекулярных моделей вариабельных доменов #11D5 в терминах энергии, был проведен расчет энергии для исключения невыгодного межатомного контакта. Эти расчеты были сделаны с использованием коммерчески доступной программы предсказания трехмерной структуры белков Prime и программы поиска координат MacroModel (Schrodinger, LLC).

7.2.2 Дизайн аминокислотной последовательности гуманизированного антитела #11D5

Гуманизированные антитела #11D5 были сконструированы согласно методу, обычно известному в данной области техники как метод «прививки CDR» (CDR grafting) (Proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)). Акцепторные антитела выбирались двумя способами на основе аминокислотной гомологии в пределах каркасных доменов.

Последовательности каркасных доменов #11D5 сравнивали с таковыми всех каркасных доменов человека, зарегистрированных в базе данных Kabat Database (Nuc. Acid Res. 29, 205-206 (2001)), содержащей аминокислотные последовательности антител. В результате в качестве акцептора было выбрано антитело Т33-4'CL, гомология каркасных доменов с которым составила 70%. Аминокислотные остатки каркасных доменов Т33-4'CL выравнивались с соответствующими аминокислотными остатками в #11D5 для идентификации положений, в которых присутствуют разные аминокислоты. Положения этих остатков были проанализированы с помощью сконструированной трехмерной модели #11D5. После этого выбирали донорные остатки для введения их в акцептор согласно критерию, предоставленному Queen et al. (Proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)).

Последовательности каркасных доменов #11D5 сравнивали с таковыми всех каркасных доменов человека, зарегистрированных в базе данных IgBLAST (Nuc. Acid Res. 36, D25-D30 (2007)). В результате 1603260В была выбрана в качестве акцепторной L-цепи на основании 74% гомологии между их каркасными доменами. AAF80028 была выбрана в качестве акцепторной Н-цепи на основании 66% гомологии между их каркасными доменами. Аминокислотные остатки каркасных доменов в 1603260В L-цепи и в AAF80028 Н-цепи выравнивались с соответствующими аминокислотными остатками в #11D5 для идентификации положений, в которых в них присутствуют разные аминокислоты. Положения этих остатков были проанализированы с помощью сконструированной трехмерной модели #11D5. После этого выбирали донорные остатки для введения их в акцептор согласно критерию, предоставленному Queen et al. (Proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)).

Во всех методах гуманизированные последовательности #11D5 конструировали, как описано ниже в Примерах, путем переноса некоторых выбранных донорных остатков в акцепторные антитела.

7.2.3 Гуманизация легкой цепи #11D5 (Фигуры 6, 7, 8, 9, 10 и 11)

7.2.3.1 Легкая цепь h#11D5-T1L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№2 (изолейцин), 11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 45 (аргинин), 46 (аргинин), 47 (метионин), 66 (аргинин), 69 (серин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на валин, лейцин, аланин, валин, тирозин, пролин, аланин, лизин, лейцин, лейцин, глицин, треонин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T1L"-типа.

7.2.3.2 Легкая цепь h#11D5-T2L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серин), 46 (аргинин), 66 (аргинин), 69 (серин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, лейцин, глицин, треонин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи"h#11D5-Т2L"-типа.

7.2.3.3 Легкая цепь h#11D5-T3L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 72 (серии), 79 (глутаминовая кислота), 80 (серии), 83 (метионин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, треонин, глутамин, пролин, фенилаланин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T3L"-типа.

7.2.3.4 Легкая цепь h#11D5-T4L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 69 (серин), 70 (аспарагиновая кислота), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, лизин, лейцин, глицин, треонин, глутаминовую кислоту, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глицин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T4L"-типа.

7.2.3.5 Легкая цепь h#11D5-T5L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серин), 66 (аргинин), 69 (серин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, глицин, треонин, треонин, глутамин, пролин, фенилаланин, треонин, глицин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи"h#11D5-Т5L"-типа.

7.2.3.6 Легкая цепь h#11D5-T6L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серин), 66 (аргинин), 69 (серин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, глицин, треонин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи"h#11D5-Т6L"-типа.

7.2.3.7 Легкая цепь h#11D5-T7L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 69 (серин), 70 (аспарагиновая кислота), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, лизин, лейцин, глицин, треонин, глутаминовую кислоту, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T7L"-типа.

7.2.3.8 Легкая цепь h#11D5-T8L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 69 (серин), 70 (аспарагиновая кислота), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, лизин, лейцин, глицин, треонин, глутаминовую кислоту, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T8L"-типа.

7.2.3.9 Легкая цепь h#11D5-T9L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 47 (метионин), 66 (аргинин), 69 (серии), 70 (аспарагиновая кислота), 71 (тирозин), 72 (серии), 79 (глутаминовая кислота), 80 (серии), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, лейцин, глицин, треонин, глутаминовую кислоту, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T9L"-типа.

7.2.3.10 Легкая цепь h#11DS-T10L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 45 (аргинин), 66 (аргинин), 69 (серии), 70 (аспарагиновая кислота), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, лизин, глицин, треонин, глутаминовую кислоту, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T10L"-типа.

7.2.3.11 Легкая цепь h#11D5-T11L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 69 (серин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, лизин, лейцин, глицин, треонин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи «h#11D5-T11L»-типа.

7.2.3.12 Легкая цепь h#11D5-T12L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 69 (серии), 70 (аспарагиновая кислота), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, лизин, лейцин, глицин, треонин, глутаминовую кислоту, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T12L"-типа.

7.2.3.13 Легкая цепь h#11D5-T13L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серин), 47 (метионин), 66 (аргинин), 69 (серин), 70 (аспарагиновая кислота), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, лейцин, глицин, треонин, глутаминовую кислоту, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T13L"-типa.

7.2.3.14 Легкая цепь h#11D5-T14L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серин), 45 (аргинин), 66 (аргинин), 69 (серин), 70 (аспарагиновая кислота), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серии), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, лизин, глицин, треонин, глутаминовую кислоту, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T14L"-типа.

7.2.3.15 Легкая цепь h#11D5-T15L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серии), 45 (аргинин), 47 (метионин), 66 (аргинин), 69 (серин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30В), на лейцин, аланин, валин, пролин, аланин, лизин, лейцин, глицин, треонин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T15L"-типа.

7.2.3.16 Легкая цепь h#11D5-T16L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 69 (серин), 70 (аспарагиновая кислота), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, лизин, лейцин, глицин, треонин, глутаминовую кислоту, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T16L"-типа.

7.2.3.17 Легкая цепь h#11D5-T17L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 66 (аргинин), 69 (серин), 70 (аспарагиновая кислота), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, глицин, треонин, глутаминовую кислоту, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T17L"-типа.

7.2.3.18 Легкая цепь h#11D5-T18L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 47 (метионин), 66 (аргинин), 69 (серии), 71 (тирозин), 72 (серии), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, лейцин, глицин, треонин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T18L"-типа.

7.2.3.19 Легкая цепь h#11D5-T19L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 47 (метионин), 66 (аргинин), 69 (серин), 70 (аспарагиновая кислота), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, лейцин, глицин, треонин, глутаминовую кислоту, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-Т19L"-типа.

7.2.3.20 Легкая цепь h#11D5-T20L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 45 (аргинин), 66 (аргинин), 69 (серин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, лизин, глицин, треонин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T20L"-типа.

7.2.3.21 Легкая цепь h#11D5-T21L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 45 (аргинин), 66 (аргинин), 69 (серин), 70 (аспарагиновая кислота), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, лизин, глицин, треонин, глутаминовую кислоту, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11В5-Т21L"-типа.

7.2.3.22 Легкая цепь h#11D5-Т22L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 69 (серин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, лизин, лейцин, глицин, треонин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-Т22L"-типа.

7.2.3.23 Легкая цепь h#11D5-T23L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серин), 66 (аргинин), 69 (серин), 70 (аспарагиновая кислота), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, глицин, треонин, глутаминовую кислоту, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T23L"-типа.

7.2.3.24 Легкая цепь h#11D5-Т24L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серии), 47 (метионин), 66 (аргинин), 69 (серии), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серии), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, лейцин, глицин, треонин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T24L"-типа.

7.2.3.25 Легкая цепь h#11D5-T25L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серин), 47 (метионин), 66 (аргинин), 69 (серин), 70 (аспарагиновая кислота), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серии), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, лейцин, глицин, треонин, глутаминовую кислоту, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T25L"-типа.

7.2.3.26 Легкая цепь h#11D5-T26L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серин), 45 (аргинин), 66 (аргинин), 69 (серин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, лизин, глицин, треонин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T26L"-типа.

7.2.3.27 Легкая цепь h#11D5-Т27L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серии), 45 (аргинин), 66 (аргинин), 69 (серии), 70 (аспарагиновая кислота), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30В), на лейцин, аланин, валин, пролин, аланин, лизин, глицин, треонин, глутаминовую кислоту, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T27L"-типа.

7.2.3.28 Легкая цепь h#11D5-T28L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серин), 45 (аргинин), 47 (метионин), 66 (аргинин), 69 (серин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, лизин, лейцин, глицин, треонин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T28L"-типа.

7.2.3.29 Легкая цепь h#11D5-T29L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 66 (аргинин), 69 (серин), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, глицин, треонин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T29L"-типа.

7.2.3.30 Легкая цепь h#11D5-T30L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 66 (аргинин), 69 (серин), 70 (аспарагиновая кислота), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура ЗОВ), на лейцин, аланин, валин, тирозин, пролин, аланин, глицин, треонин, глутаминовую кислоту, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T30L"-типа.

7.2.3.31 Легкая цепь h#11D5-T31L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 47 (метионин), 66 (аргинин), 69 (серин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30В), на лейцин, аланин, валин, тирозин, пролин, аланин, лейцин, глицин, треонин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T31L"-типа.

7.2.3.32 Легкая цепь h#11D5-Т32L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 45 (аргинин), 66 (аргинин), 69 (серин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серии), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, лизин, глицин, треонин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T32L"-типа.

7.2.3.33 Легкая цепь h#11D5-T33L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серии), 66 (аргинин), 69 (серии), 71 (тирозин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, глицин, треонин, фенилаланин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T33L"-типа.

7.2.3.34 Легкая цепь h#11D5-T34L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серин), 66 (аргинин), 69 (серин), 70 (аспарагиновая кислота), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, глицин, треонин, глутаминовую кислоту, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T34L"-типа.

7.2.3.35 Легкая цепь h#11D5-T35L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серин), 47 (метионин), 66 (аргинин), 69 (серин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, лейцин, глицин, треонин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T35L"-типа.

7.2.3.36 Легкая цепь h#11D5-T36L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 40 (валин), 43 (серии), 45 (аргинин), 66 (аргинин), 69 (серин), 72 (серин), 79 (глутаминовая кислота), 80 (серии), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO:142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, пролин, аланин, лизин, глицин, треонин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T36L"-типа.

7.2.3.37 Легкая цепь h#11D5-T37L-типа:

Гуманизированный вариабельный участок легкой цепи #11D5, созданный путем замены аминокислот №№11 (метионин), 13 (треонин), 15 (лейцин), 36 (фенилаланин), 40 (валин), 43 (серин), 66 (аргинин), 69 (серин), 72 (серин), 79 (глутаминовая кислота), 80 (серин), 83 (метионин), 85 (изолейцин), 100 (серин), 104 (лейцин), 106 (лейцин) и 109 (пролин) вариабельного участка легкой цепи #11D5, представленной последовательностью SEQ ID NO: 142 Списка Последовательностей (Фигура 30D), на лейцин, аланин, валин, тирозин, пролин, аланин, глицин, треонин, треонин, глутамин, пролин, фенилаланин, треонин, глутамин, валин, изолейцин и треонин соответственно, был обозначен как вариабельный участок легкой цепи "h#11D5-T37L"-типа.

7.2.4 Гуманизация тяжелой цепи #11D5 (Фигуры 12 и 13)

7.2.4.1 Тяжелая цепь h#11D5-T1H-типа:

Гуманизированный вариабельный участок тяжелой цепи #11D5, созданный путем замены аминокислот №№1 (глутаминовая кислота), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагин), 44 (лизин), 45 (метионин), 67 (изолейцин), 68 (серин), 71 (аргинин), 75 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (треонин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11D5, представленной последовательностью SEQ ID NO: 143 Списка Последовательностей (Фигура 30Е), на глутамин, треонин, треонин, серин, глутамин, пролин, метионин, глицин, лейцин, валин, треонин, валин, глутаминовую кислоту, серин, лизин, серин, пролин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11D5-T1H"-типа.

7.2.4.2 Тяжелая цепь h#11D5-Т2Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11D5, созданный путем замены аминокислот №№17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагин), 44 (лизин), 45 (метионин), 71 (аргинин), 75 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (треонин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11D5, представленной последовательностью SEQ ID NO: 143 Списка Последовательностей (Фигура 30Е), на треонин, треонин, серин, глутамин, пролин, метионин, глицин, лейцин, валин, глутаминовую кислоту, серин, лизин, серин, пролин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11D5-Т2Н"-типа.

7.2.4.3 Тяжелая цепь h#11D5-Т3Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11D5, созданный путем замены аминокислот №№17 (серин), 23 (серин), 25 (треонин), 75 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (треонин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11D5, представленной последовательностью SEQ ID NO: 143 Списка Последовательностей (Фигура 30Е), на треонин, треонин, серин, лизин, серин, лизин, серин, пролин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11D5-T3H"-типа.

7.2.4.4 Тяжелая цепь h#11D5-Т4Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11D5, созданный путем замены аминокислот №№1 (глутаминовая кислота), 6 (глутаминовая кислота), 7 (серин), 9 (пролин), 12 (валин), 16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагин), 44 (лизин), 45 (метионин), 67 (изолейцин), 68 (серин), 75 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (треонин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11D5, представленной последовательностью SEQ ID NO: 143 Списка Последовательностей (Фигура 30Е), на глутамин, глутамин, триптофан, аланин, лейцин, глутаминовую кислоту, треонин, треонин, серии, глутамин, пролин, лизин, глицин, лейцин, валин, треонин, лизин, серии, лизин, серии, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11D5-T4H"-типа.

7.2.4.5 Тяжелая цепь h#11D5-T5H-типа:

Гуманизированный вариабельный участок тяжелой цепи #11D5, созданный путем замены аминокислот №№6 (глутаминовая кислота), 7 (серин), 9 (пролин), 12 (валин), 16 (глутамин), 17 (серин), 23 (серии), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагин), 44 (лизин), 45 (метионин), 75 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (треонин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11D5, представленной последовательностью SEQ ID NO: 143 Списка Последовательностей (Фигура 30Е), на глутамин, триптофан, аланин, лейцин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, лизин, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11D5-Т5Н"-типа.

7.2.4.6 Тяжелая цепь h#11D5-T6H-типа:

Гуманизированный вариабельный участок тяжелой цепи #11D5, созданный путем замены аминокислот №№16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагин), 44 (лизин), 45 (метионин), 75 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (треонин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11D5, представленной последовательностью SEQ ID NO: 143 Списка Последовательностей (Фигура 30Е), на глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, лизин, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11D5-Т6Н"-типа.

7.2.4.7 Тяжелая цепь h#11D5-T7H-типа:

Гуманизированный вариабельный участок тяжелой цепи #11D5, созданный путем замены аминокислот №№1 (глутаминовая кислота), 16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагин), 44 (лизин), 45 (метионин), 67 (изолейцин), 68 (серин), 75 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (треонин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11D5, представленной последовательностью SEQ ID NO: 143 Списка Последовательностей (Фигура 30Е), на глутамин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, валин, треонин, лизин, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11D5-T7H"-типа.

7.2.4.8 Тяжелая цепь h#11D5-Т8Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11D5, созданный путем замены аминокислот №№16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагин), 44 (лизин), 45 (метионин), 67 (изолейцин), 68 (серин), 75 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (треонин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #HD5, представленной последовательностью SEQ ID NO: 143 Списка Последовательностей (Фигура 30Е), на глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, валин, треонин, лизин, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11D5-Т8Н"-типа.

7.2.4.9 Тяжелая цепь h#11D5-Т9Н-типа:

Гуманизированный вариабельный участок тяжелой цепи #11D5, созданный путем замены аминокислот №№1 (глутаминовая кислота), 16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагин), 44 (лизин), 45 (метионин), 68 (серин), 75 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (треонин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11D5, представленной последовательностью SEQ ID NO: 143 Списка Последовательностей (Фигура 30Е), на глутамин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, треонин, лизин, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11D5-T9H"-типа.

7.2.4.10 Тяжелая цепь h#11D5-T10H-типа:

Гуманизированный вариабельный участок тяжелой цепи #11D5, созданный путем замены аминокислот №№1 (глутаминовая кислота), 16 (глутамин), 17 (серии), 23 (серии), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагин), 44 (лизин), 45 (метионин), 67 (изолейцин), 75 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (треонин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11D5, представленной последовательностью SEQ ID NO: 143 Списка Последовательностей (Фигура 30Е), на глутамин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, валин, лизин, серин, лизин, серии, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11В5-Т10Н"-типа.

7.2.4.11 Тяжелая цепь h#11D5-T11H-типа:

Гуманизированный вариабельный участок тяжелой цепи #11D5, созданный путем замены аминокислот №№16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагин), 44 (лизин), 45 (метионин), 68 (серин), 75 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (треонин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11D5, представленной последовательностью SEQ ID NO: 143 Списка Последовательностей (Фигура 30Е), на глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, треонин, лизин, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11D5-T11Н"-типа.

7.2.4.12 Тяжелая цепь h#11D5-T12H-типа:

Гуманизированный вариабельный участок тяжелой цепи #11D5, созданный путем замены аминокислот №№16 (глутамин), 17 (серин), 23 (серин), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагин), 44 (лизин), 45 (метионин), 67 (изолейцин), 75 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (треонин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11D5, представленной последовательностью SEQ ID NO: 143 Списка Последовательностей (Фигура 30Е), на глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, валин, лизин, серин, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11D5-T12H"-типа.

7.2.4.13 Тяжелая цепь h#11D5-T13H-типа:

Гуманизированный вариабельный участок тяжелой цепи #11D5, созданный путем замены аминокислот №№1 (глутаминовая кислота), 16 (глутамин), 17 (серии), 23 (серии), 25 (треонин), 39 (лизин), 40 (фенилаланин), 43 (аспарагин), 44 (лизин), 45 (метионин), 75 (аргинин), 79 (фенилаланин), 81 (глутамин), 83 (аспарагин), 87 (треонин), 88 (глутаминовая кислота), 92 (треонин), 107 (валин) и 108 (метионин) вариабельного участка тяжелой цепи #11D5, представленной последовательностью SEQ ID NO: 143 Списка Последовательностей (Фигура 30Е), на глутамин, глутаминовую кислоту, треонин, треонин, серин, глутамин, пролин, лизин, глицин, лейцин, лизин, серии, лизин, серин, аланин, аланин, валин, треонин и лейцин соответственно, был обозначен как вариабельный участок тяжелой цепи "h#11D5-Т13Н"-типа.

Пример 8: Конструирование универсальных векторов для экспрессии гуманизированных антител

8.1 Конструирование вектора pEF6KCL для экспрессии легких цепей гуманизированных антител.

ПЦР проводили с использованием в качестве матрицы плазмиды pEF6/V5-His В (Invitrogen Corp.) и показанных ниже праймеров для получения фрагмента ДНК, находящегося сразу за участком BGHpA (2174) и до SmaI (2958) (фрагмента ДНК, содержащего область начала репликации f1 и промотор и область начала репликации SV40, далее называемый «фрагмент А»):

5'-ccacgcgccctgtagcggcgcattaagc-3' (праймер EFF1: SEQ ID NO:1) и

5'-aaacccgggagctttttgcaaaagcctagg-3' (праймер EFsmaR: SEQ ID NO:2).

Полученный фрагмент А лигировали ПЦР с перекрытием с фрагментом ДНК, включающим последовательность ДНК, кодирующую сигнал секреции κ-цепи человека, константный участок κ-цепи человека и сигнал добавления поли-(А) человека (SEQ ID NO:3; далее называемый "фрагмент В"). Полученный фрагмент ДНК, в котором фрагмент А был лигирован с фрагментом В (далее называемый "фрагмент А+В") был расщеплен эндонуклеазами рестрикции KpnI и SmaI и лигирован в плазмиду pEF6/V5-His В (Invitrogen Corp.), предварительно расщепленную эндонуклеазами рестрикции KpnI и SmaI для создания плазмиды для экспрессии L-цепи человека "pEF6KCL" (Фигура 19), содержащей сигнальную последовательность, сайт для клонирования, последовательность, кодирующую константный участок κ-цепи человека, и сигнальную последовательность добавления поли-(А) человека под промотором EF1.

8.2 Конструирование вектора, pEF1/FCCU-1 для экспрессии тяжелых цепей гуманизированных антител.

8.2.1 Конструирование pEF1/KCL

Плазмида pEF6KCL, полученная описанным выше способом, расщеплялась эндонуклеазами рестрикции KpnI и SmaI. Полученный фрагмент ДНК дотировали в pEF1/myc-His В (Invitrogen Corp.), предварительно расщепленную эндонуклеазами рестрикции KpnI и SmaI, для получения плазмиды pEF1/KCL.

8.2.2 Конструирование pEF1/FCCU-1

Фрагмент ДНК, включающий последовательность, кодирующую аминокислотную последовательность сигнальной последовательности и константного участка IgG1 человека (SEQ ID NO: 4), расщепляли эндонуклеазами рестрикции NheI и PmeI и лигировали в плазмиду pEF1/KCL, предварительно расщепленную эндонуклеазами рестрикции NheI и PmeI для создания плазмиды pEF1/FCCU-1 для экспрессии тяжелой цепи человека, содержащей сигнальную последовательность, сайт для клонирования, последовательность, кодирующую константный участок тяжелой цепи человека, и сигнальную последовательность добавления поли-(А) человека под промотором EF1.

Пример 9: Получение гена гуманизированного антитела моноклонального антитела крысы #11В7 против AXL человека

а) Конструирование векторов для экспрессии легких цепей h#11B7-T1L, h#11B7-T2L, h#11B7-T3L, h#11B7-T4L, h#11B7-T5L, h#11B7-T6L, h#11B7-T7L, h#11B7-T8L, h#11B7-T9L, h#11B7-T10L, h#11B7-T11L, h#11B7-T12L и h#11B7-T13L

Каждая ДНК, содержащая ген, кодирующий вариабельный участок легкой цепи h#11B7-T1L, h#11B7-T2L, h#11B7-T3L, h#11B7-T4L, h#11B7-T5L, h#11B7-T6L, h#11B7-T7L, h#11B7-T8L, h#11B7-T9L, h#11B7-T10L, h#11B7-THL, h#11B7-T12L или h#11B7-T13L (Фигуры 1 и 2), представленный аминокислотными остатками Nos. от 21 до 129 последовательностей SEQ ID NO:18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 соответственно из Списка Последовательностей, слитая с сигналом секреции, была синтезирована (MBL Medical & Biological Laboratories Co., Ltd, Artificial Gene Synthesis Service) и расщеплена эндонуклеазами рестрикции NheI и BsiWI. Полученные фрагменты ДНК по отдельности были встроены по сайтам универсальных векторов для экспрессии легких цепей гуманизированных антител (pEF6KCL), предварительно расщепленных эндонуклеазами рестрикции NheI и BsiWI, для создания векторов для экспрессии легких цепей h#11B7-T1L, h#11B7-T2L, h#11B7-T3L, h#11B7-T4L, h#11B7-T5L, h#11B7-T6L, h#11B7-T7L, h#11B7-T8L, h#11B7-T9L, h#11B7-T10L, h#11B7-THL, h#11B7-T12L и h#11B7-T13L. Полученные экспрессионные векторы были обозначены как "pEF6KCL/h#11B7-T1L", "pEF6KCL/h#11B7-T2L", "pEF6KCL/h#11B7-T3L", "pEF6KCL/h#11B7-T4L", "pEF6KCL/h#11B7-T5L", "pEF6KCL/h#11B7-T6L", "pEF6KCL/h#11B7-T7L", "pEF6KCL/h#11B7-T8L", "pEF6KCL/h#11B7-T9L", "pEF6KCL/h#HB7-T10L", "pEF6KCL/h#HB7-THL", "pEF6KCL/h#HB7-T12L" или "pEF6KCL/h#HB7-T13L", и вставка из каждого экспрессионного вектора представлена нуклеотидной последовательностью SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 или 17 из Списка Последовательностей соответственно.

b) Конструирование векторов для экспрессии тяжелых цепей h#11B7-T1H, h#11В7-Т2Н, h#11B7-T3H, h#11B7-T4H, h#11B7-T5H, h#11B7-T6H, h#11B7-T7H, h#11B7-T8H и h#11B7-T9H

Каждая ДНК, содержащая ген, кодирующий вариабельный участок тяжелой цепи h#11B7-T4H, h#11B7-T5H, h#11B7-T6H, h#11B7-T7H, h#11B7-T8H или h#11B7-T9H (Фигуры 4 и 5), представленный аминокислотными остатками Nos. от 20 до 132 последовательностей SEQ ID NO:40, 41, 42, 43, 44, 45, 46, 47 или 48 соответственно, из Списка Последовательностей, была синтезирована (MBL Medical & Biological Laboratories Co., Ltd, Artificial Gene Synthesis Service) и расщеплена эндонуклеазой рестрикции BlpI. Полученные фрагменты ДНК по отдельности были вставлены в сайты универсальных векторов для экспрессии тяжелых цепей гуманизированных антител (pEF1/FCCU-1), предварительно расщепленных эндонуклеазой рестрикции BlpI, для создания векторов для экспрессии тяжелых цепей #11B7-T1H, h#11B7-T2H, h#11B7-T3H, h#11B7-T4H, h#11B7-T5H, h#11B7-T6H, h#11B7-T7H, h#11B7-T8H и h#HB7-T9H. Полученные экспрессионные векторы были обозначены как "pEF1/FCCU/h#11B7-T1H", "pEF1/FCCU/h#11B7-T2H", "pEF1/FCCU/h#11B7-T3H", "pEF1/FCCU/h#11B7-T4H", "pEF1/FCCU/h#11B7-T5H", "pEF1/FCCU/h#11B7-T6H", "pEF1/FCCU/h#11B7-T7H", "pEF1/FCCU/h#11B7-T8H" или "pEF1/FCCU/h#11B7-T9H", и вставка из каждого экспрессионного вектора представлена нуклеотидной последовательностью SEQ ID NO:31, 32, 33, 34, 35, 36, 37, 38 или 39 из Списка Последовательностей соответственно.

Пример 10: Получение гуманизированного антитела моноклонального антитела крысы #11В7 против AXL человека

а) Получение гуманизированного антитела

Клетки FreeStyle 293-F в количестве 1,5×108 в логарифмической фазе роста были высеяны в 100 мл свежей среды FreeStyle 293 Expression Medium (Invitrogen Corp.) и культивировались при перемешивании (125 об/мин) в инкубаторе при 37°С в атмосфере 8% СО2. Полиэтиленимин (Polyscience #24765) в количестве 1 мг растворяли в 4 мл среды Opti-Pro SFM (Invitrogen Corp.) и оставляли при комнатной температуре на 5 минут. Плазмида для экспрессии тяжелой цепи (0,05 мг) и плазмида для экспрессии легкой цепи (0,15 мг), полученные с использованием набора PureLink HiPure Plasmid kit (Invitrogen Corp.), были суспендированы в 4 мл среды Opti-Pro SFM (Invitrogen Corp.). После этого 4 мл смешанного раствора плазмида для экспрессии/ Opti-Pro SFM добавляли к 4 мл смешанного раствора Полиэтиленимин/Opti-Pro SFM, который был выдержан при комнатной температуре в течение 5 минут, и дополнительно оставляли при комнатной температуре на 5 минут. После этого 8 мл смешанного раствора Полиэтиленимин/плазмида для экспрессии/Opti-Pro SFM добавляли к суспензии клеток FreeStyle 293-F и продолжали их культивирование при перемешивании. Через 7 дней культивирования при 37°С в атмосфере 8% CO2 собирали культуральный супернатант.

b) Очистка гуманизированного антитела

Культуральный супернатант, полученный в предшествующем параграфе а), был очищен аффинной хроматографией на колонке с Протеином А. Для этого 100 мл культурального супернатанта помещали в колбу с крышкой объемом 500 мл, в которую добавляли 1 мл суспензии MabSelect SuRe (GE Healthcare Bio-science Ltd.) (50% суспензия), уравновешенной буфером PBS. Смесь перемешивали в течение ночи при 100 об/мин в инкубаторе при 10°С. Культуральный супернатант клеток FreeStyle 293-F/суспензию MabSelect SuRe обрабатывали носителем из 5 мл колонки Zeba Spin Column (PIERCE). Весь носитель вносили в колонку и промывали 10 мл 1 М NaCl. После этого промывали колонку 1 мл 1 М раствора аргинина (рН 4,0) и собирали фракции, содержащие антитела. Фракции вносили в пробирки Centrifugal Filter Device (Amicon Ultra-4, отсечение по молекулярному весу: 50 кДа, Millipore Corp.), после чего заменяли раствор на цитратный буфер и доводили объем до 200 мкл для получения очищенных образцов.

Гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T1L и pEF1/FCCU/h#11B7-T1H, было обозначено как "h#11B7-T1"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T2L и pEF1/FCCU/h#11B7-T2H, было обозначено как "h#11B7-T2"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T3L и pEF1/FCCU/h#11B7-T3H, было обозначено как "h#11B7-T3"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T4L и pEF1/FCCU/h#11B7-Т4Н, было обозначено как "h#11B7-T4"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T5L и pEF1/FCCU/h#11B7-T5H, было обозначено как "h#11B7-T5"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T6L и pEF1/FCCU/h#11B7-T6H, было обозначено как "h#11B7-T6"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T7L и pEF1/FCCU/h#11B7-T7H, было обозначено как "h#11B7-T7"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T8L и pEF1/FCCU/h#11B7-T7H, было обозначено как "h#11B7-T8"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T9L и pEF1/FCCU/h#11B7-Т7Н, было обозначено как "h#11B7-T9"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T10L и pEF1/FCCU/h#11B7-T7H, было обозначено как "h#11B7-T10"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-THL и pEF1/FCCU/h#11B7-T7H, было обозначено как "h#11B7-T11"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T12L и pEF1/FCCU/h#11B7-T7H, было обозначено как "h#11B7-T12"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T13L и pEF1/FCCU/h#HB7-T7H, было обозначено как "h#11B7-T13"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T7L и pEF1/FCCU/h#11B7-Т8Н, было обозначено как "h#11B7-T14"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T8L и pEF1/FCCU/h#11B7-T8H, было обозначено как "h#11B7-T15"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T9L и pEF1/FCCU/h#11B7-T8H, было обозначено как "h#11B7-T16"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T10L и pEF1/FCCU/h#11B7-T8H, было обозначено как "h#11B7-T17"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-THL и pEF1/FCCU/h#11B7-T8H, было обозначено как "h#11B7-T18"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T12L и pEF1/FCCU/h#11B7-Т8Н, было обозначено как "h#HB7-T19"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T13L и pEF1/FCCU/h#11B7-T8H, было обозначено как "h#11B7-T20"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T7L и pEF1/FCCU/h#11B7-T9H, было обозначено как "h#11B7-T21"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T8L и pEF1/FCCU/h#11B7-T9H, было обозначено как "h#11B7-T22"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T9L и pEF1/FCCU/h#11B7-T9H, было обозначено как "h#11B7-T23"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T10L и pEF1/FCCU/h#11B7-Т9Н, было обозначено как "h#11B7-T24"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T11L и pEF1/FCCU/h#11B7-T9H, было обозначено как "h#11B7-T25"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T12L и pEF1/FCCU/h#11B7-T9H, было обозначено как "h#11B7-T26"; и гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T13L и pEF1/FCCU/h#11B7-T9H, было обозначено как "h#11B7-T27".

Таблица 1
h#11B7 плазмида Н плазмида L
h#11B7-T1 pEF1/FCCU/h#11B7-T1H pEF6KCL/h#11B7-T1L
h#11B7-T2 pEF1/FCCU/h#11B7-T2H pEF6KCL/h#11B7-T2L
h#11B7-T3 pEF1/FCCU/h#11B7-T3H pEF6KCL/h#11B7-T3L
h#11B7-T4 pEF1/FCCU/h#11B7-T4H pEF6KCL/h#11B7-T4L
h#11B7-T5 pEF1/FCCU/h#11B7-T5H pEF6KCL/h#11B7-T5L
h#11B7-T6 pEF1/FCCU/h#11B7-T6H pEF6KCL/h#11B7-T6L
h#11B7-T7 pEF1/FCCU/h#11B7-T7H pEF6KCL/h#11B7-T7L
h#11B7-T8 pEF1/FCCU/h#11B7-T7H pEF6KCL/h#11B7-T8L
h#11B7-T9 pEF1/FCCU/h#11B7-T7H pEF6KCL/h#11B7-T9L
h#11B7-T10 pEF1/FCCU/h#11B7-T7H pEF6KCL/h#11B7-T10L
h#11B7-T11 pEF1/FCCU/h#11B7-T7H pEF6KCL/h#11B7-THL
h#11B7-T12 pEF1/FCCU/h#11B7-T7H pEF6KCL/h#11B7-T12L
h#11B7-T13 pEF1/FCCU/h#11B7-T7H pEF6KCL/h#11B7-T13L
h#11B7-T14 pEF1/FCCU/h#11B7-T8H pEF6KCL/h#11B7-T7L
h#11B7-T15 pEF1/FCCU/h#11B7-T8H pEF6KCL/h#11B7-T8L
h#11B7-T16 pEF1/FCCU/h#11B7-T8H pEF6KCL/h#11B7-T9L
h#11B7-T17 pEF1/FCCU/h#11B7-T8H pEF6KCL/h#11B7-T10L
h#11B7-T18 pEF1/FCCU/h#11B7-T8H pEF6KCL/h#11B7-THL
h#11B7-T19 pEF1/FCCU/h#11B7-T8H pEF6KCL/h#11B7-T12L
h#11B7-T20 pEF1/FCCU/h#11B7-T8H pEF6KCL/h#11B7-T13L
h#11B7-T21 pEF1/FCCU/h#11B7-T9H pEF6KCL/h#11B7-T7L
h#11B7-T22 pEF1/FCCU/h#11B7-T9H pEF6KCL/h#11B7-T8L
h#11B7-T23 pEF1/FCCU/h#11B7-T9H pEF6KCL/h#11B7-T9L
h#11B7-T24 pEF1/FCCU/h#11B7-T9H pEF6KCL/h#11B7-T10L
h#11B7-T25 pEF1/FCCU/h#11B7-T9H pEF6KCL/h#11B7-THL
h#11B7-T26 pEF1/FCCU/h#11B7-T9H pEF6KCL/h#11B7-T12L
h#11B7-T27 pEF1/FCCU/h#11B7-T9H pEF6KCL/h#11B7-T13L

Пример 11: Получение гена гуманизированного антитела моноклонального антитела крысы #11D5 против AXL человека

a) Конструирование векторов для экспрессии легких цепей h#11D5-T1L, h#11D5-T2L, h#11D5-T3L, h#11D5-T4L, h#11D5-T5L и h#11D5-T6L

Каждая ДНК, содержащая ген, кодирующий вариабельный участок легкой цепи h#11D5-T1L, h#11D5-T2L, h#11D5-T3L, h#11D5-T4L, h#11D5-T5L и h#11D5-T6L (Фигура 6), представленный аминокислотными остатками Nos. от 21 до 129 последовательностей SEQ ID N0:55, 56, 57, 58, 59 или 60 соответственно, из Списка Последовательностей, слитая с сигналом секреции, была синтезирована (MBL Medical & Biological Laboratories Co., Ltd, Artificial Gene Synthesis Service) и расщеплена эндонуклеазами рестрикции NheI и BsiWI. Полученные фрагменты ДНК по отдельности были вставлены по сайтам универсальных векторов для экспрессии легких цепей гуманизированных антител (pEF6KCL), предварительно расщепленных эндонуклеазами рестрикции NheI и BsiWI, для создания векторов для экспрессии легких цепей h#11D5-T1L, h#11D5-T2L, h#11D5-T3L, h#11D5-T4L, h#11D5-T5L и h#11D5-T6L. Полученные экспрессионные векторы были обозначены как "pEF6KCL/h#11D5-T1L", "pEF6KCL/h#11D5-T2L", "pEF6KCL/h#11D5-T3L", "pEF6KCL/h#11D5-T4L", "pEF6KCL/h#11D5-T5L" или "pEF6KCL/h#11B7-T6L", и вставка из каждого экспрессионного вектора представлена нуклеотидной последовательностью SEQ ID NO:49, 50, 51, 52, 53 или 54 из Списка Последовательностей соответственно.

b) Конструирование векторов для экспрессии тяжелых цепей h#11D5-T1H, h#11D5-Т2Н, h#11D5-T3H, h#11D5-T4H, h#11D5-T5H и h#11D5-T6H Каждая ДНК, содержащая ген, кодирующий вариабельный участок тяжелой цепи h#11D5-Т1Н, h#11D5-T2H, h#11D5-T3H, h#11D5-T4H, h#11D5-T5H или h#11D5-T6H (Фигура 12), представленный аминокислотными остатками Nos. от 20 до 132 последовательностей SEQ ID NO:67, 68, 69, 70, 71, или 72 соответственно, из Списка Последовательностей, была синтезирована (MBL Medical & Biological Laboratories Co., Ltd, Artificial Gene Synthesis Service) и расщеплена эндонуклеазой рестрикции BlpI Полученные фрагменты ДНК по отдельности были встроены по сайтам универсальных векторов для экспрессии тяжелых цепей гуманизированных антител (pEF1/FCCU-1), предварительно расщепленных эндонуклеазой рестрикции В1р1, для создания векторов для экспрессии тяжелых цепей M11D5-T1H, h#11D5-T2H, h#11D5-T3H, h#11D5-T4H, h#11D5-T5H и h#11D5-T6H. Полученные экспрессионные векторы были обозначены как "pEF1/FCCU/h#11D5-T1H", "pEF1/FCCU/h#11D5-T2H", "pEF1/FCCU/h#11D5-T3H", "pEF1/FCCU/h#11D5-T4H", "pEF1/FCCUM11D5-T5H" или "pEF1/FCCU/h#11D5-T6H", и вставка из каждого экспрессионного вектора представлена нуклеотидной последовательностью SEQ ID NO:61, 62, 63, 64, 65 или 66 из Списка Последовательностей соответственно.

Пример 12: Получение гуманизированного антитела моноклонального антитела крысы #11D5 против AXL человека

а) Получение гуманизированного антитела

Клетки FreeStyle 293-F в количестве 1,5×108 в логарифмической фазе роста были высеяны в 100 мл свежей среды FreeStyle 293 Expression Medium (Invitrogen Corp.) и культивировались при перемешивании (125 об/мин) в инкубаторе при 37°С в атмосфере 8% СO2. Полиэтиленимин (Polyscience #24765) в количестве 1 мг растворяли в 4 мл среды Opti-Pro SFM (Invitrogen Corp.) и оставляли при комнатной температуре на 5 минут. Плазмида для экспрессии тяжелой цепи (0,05 мг) и плазмида для экспрессии легкой цепи (0,15 мг), полученные с использованием набора PureLink HiPure Plasmid kit (Invitrogen Corp.), были суспендированы в 4 мл среды Opti-Pro SFM (Invitrogen Corp.). После этого 4 мл смешанного раствора плазмида для экспрессии/ Opti-Pro SFM добавляли к 4 мл смешанного раствора Полиэтиленимин/Opti-Pro SFM, который был выдержан при комнатной температуре в течение 5 минут, и дополнительно оставляли при комнатной температуре на 5 минут. После этого 8 мл смешанного раствора Полиэтиленимин/плазмида для экспрессии/Opti-Pro SFM добавляли к суспензии клеток FreeStyle 293-F и продолжали их культивирование на шейкере. Через 7 дней культивирования при 37°С в атмосфере 8% СO2 собирали культуральный супернатант.

b) Очистка гуманизированного антитела

Культуральный супернатант, полученный в предшествующем параграфе а), был очищен аффинной хроматографией на колонке с Протеином А. Для этого 100 мл культурального супернатанта помещали в колбу с крышкой объемом 500 мл, в которую добавляли 1 мл суспензии MabSelect SuRe (GE Healthcare Bio-science Ltd.) (50% суспензия), уравновешенной буфером PBS. Смесь перемешивали в течение ночи при 100 об/мин в инкубаторе при 10°С. Культуральный супернатант клеток FreeStyle 293-F/суспензию MabSelect SuRe обрабатывали носителем из 5 мл колонки Zeba Spin Column (PIERCE). Весь носитель вносили в колонку и промывали 10 мл 1 М NaCl. После этого промывали колонку 1 мл 1 М раствора аргинина (рН 4,0) и собирали фракции, содержащие антитела. Фракции вносили в пробирки Centrifugal Filter Device (Amicon Ultra-4, отсечение по молекулярному весу: 50 кДа, Millipore Corp.), после чего заменяли раствор на цитратный буфер и доводили конечный объем до 200 мкл для получения очищенных образцов.

Гуманизированное антитело #11D5, полученное комбинацией между pEF6KCL/h#11D5-T1L и pEF1/FCCU/h#11D5-T1H, было обозначено как "h#11D5-T1"; гуманизированное антитело #11D5, полученное комбинацией между pEF6KCL/h#11D5-T2L и pEF1/FCCU/h#11D5-T2H, было обозначено как "h#11D5-T2"; гуманизированное антитело #11D5, полученное комбинацией между pEF6KCL/h#11D5-T3L и pEF1/FCCU/h#11D5-T3H, было обозначено как "h#11D5-T3"; гуманизированное антитело #11D5, полученное комбинацией между pEF6KCL/h#11D5-T4L и pEF1/FCCU/h#11D5-Т4Н, было обозначено как "h#11D5-T4"; гуманизированное антитело #11D5, полученное комбинацией между pEF6KCL/h#11D5-T5L и pEF1/FCCU/h#11D5-T5H, было обозначено как "h#11D5-T5"; и гуманизированное антитело #11D5, полученное комбинацией между pEF6KCL/h#11D5-T6L и pEF1/FCCU/h#11D5-T6H, было обозначено как "h#11D5-T6".

Пример 13: Определение сродства гуманизированного антитела моноклонального антитела крысы #11В7 против AXL человека к слитому белку AXL-Fc человека

Гуманизированные антитела от h#11B7-T1 до h#11B7-T27, происходящие из моноклонального антитела крысы #11В7 против AXL человека, были оценены по их сродству к AXL-Fc человека описанным ниже способом. AXL-Fc человека (производство R&D Systems, #154-AL) был растворен в PBS до концентрации 1 мкг/мл. После этого данный раствор вносили по 100 мкл/лунку в планшет Immuno Plate (производство Nalge Nunc International K.K., #437111) и оставляли его инкубироваться в течение ночи при 4°С для адсорбции белка на планшете. На следующий день лунки промывали 5 раз раствором PBS-T (PBS и 0,05% (по объему) Tween 20). После этого добавляли раствор, содержащий обезжиренное молоко (производство Morinaga Milk Industry Co., Ltd.), разведенное до 5% буфером PBS, в количестве 100 мкл/лунку и выдерживали при комнатной температуре в течение 2 часов. Растворы из лунок удаляли и промывали лунки 5 раз раствором PBS-T. После этого очищенные гуманизированные антитела от Т1 до Т27 крысы против AXL человека, полученные из моноклонального антитела крысы #11В7 в Примере 10, по отдельности разводили до конечной концентрации от 1 мкг/мл до 0,00256 нг/мл (серии 5-кратных разведений) в растворе PBS, содержащем 0,5% обезжиренного молока. Затем этот раствор вносили в лунки в количестве 100 мкл/лунку и оставляли планшет при комнатной температуре на 2 часа. В данном эксперименте концентрация каждого антитела определялась, как описано в Примере 15. Лунки промывали 5 раз раствором PBS-T. После этого добавляли конъюгированный с щелочной фосфатазой AffiniPure IgG козы против антител человека (производство Jackson ImmunoResearch Laboratories, Inc., #109-055-097), разведенный в 2500 раз раствором TBS-T (TBS и 0,05% (по объему) Tween 20) в количестве 100 мкл/лунку и оставляли при комнатной температуре на 1 час. После этого растворы удаляли и промывали лунки 5 раз раствором TBS-T. После этого добавляли раствор флуоресцентного субстрата (производство Roche Diagnostics K.K., #11681982001) в количестве 100 мкл/лунку для проведения флуоресцентной реакции. Интенсивность флуоресценции в планшетах с адсорбированным AXL-Fc человека измеряли через 15 минут после добавления флуоресцентного субстрата с использованием прибора SpectraMax M5 (производство Molecular Devices Corp.). В результате было установлено, что из 27 исследованных образцов гуманизированных моноклональных антител #11В7 крысы против AXL человека, антитела #11В7-Т1 и h#11B7-T4 имеют более низкую связывающую активность, чем химерное антитело человека. Однако было показано, что остальные 25 образцов имеют связывающую активность, которая почти равна таковой химерного антитела человека к белку AXL-Fc человека, зависимым от концентрации антитела образом (Фигуры 19, 20, 21 и 22).

Пример 14: Определение сродства гуманизированного антитела моноклонального антитела крысы #11D5 против AXL человека к слитому белку AXL-Fc человека

Гуманизированные антитела от h#11D5-T1 до h#11D5-T6, происходящие из моноклонального антитела крысы #11D5 против AXL человека, были оценены по их сродству к AXL-Fc человека описанным ниже способом. AXL-Fc человека (производство R&D Systems, #154-AL) был растворен в PBS до концентрации 1 мкг/мл. После этого данный раствор вносили по 100 мкл/лунку в планшет Immuno Plate (производство Nalge Nunc International K.K., #437111) и оставляли его инкубироваться в течение ночи при 4°С для адсорбции белка на планшете. На следующий день лунки промывали 5 раз раствором PBS-T (PBS и 0,05% (по объему) Tween 20). После этого добавляли раствор, содержащий обезжиренное молоко (производство Morinaga Milk Industry Co., Ltd.), разведенное до 5% буфером PBS, в количестве 100 мкл/лунку и выдерживали при комнатной температуре в течение 2 часов. Растворы из лунок удаляли и промывали лунки 5 раз раствором PBS-T. После этого очищенные гуманизированные антитела от Т1 до Т6 крысы против AXL человека, полученные из моноклонального антитела крысы #11D5 в Примере 12, по отдельности разводили до конечной концентрации от 1 мкг/мл до 0,00256 нг/мл (серии 5-кратных разведений) в растворе PBS, содержащем 0,5% обезжиренного молока. Затем этот раствор вносили в лунки в количестве 100 мкл/лунку и оставляли при комнатной температуре на 2 часа. В данном эксперименте концентрация каждого антитела определялась, как описано в Примере 15. Лунки промывали 5 раз раствором PBS-T. После этого добавляли конъюгированный с щелочной фосфатазой AffiniPure IgG козы против антител человека (производство Jackson ImmunoResearch Laboratories, Inc., #109-055-097), разведенный в 2500 раз раствором TBS-T (TBS и 0,05% (по объему) Tween 20) в количестве 100 мкл/лунку и оставляли планшет при комнатной температуре на 1 час. После этого растворы удаляли и промывали лунки 5 раз раствором TBS-T. После этого добавляли раствор флуоресцентного субстрата (производство Roche Diagnostics K.K., #11681982001) в количестве 100 мкл/лунку для проведения флуоресцентной реакции. Интенсивность флуоресценции в планшетах с адсорбированным AXL-Fc человека измеряли через 15 минут после добавления флуоресцентного субстрата с использованием прибора SpectraMax M5 (производство Molecular Devices Corp.). В результате было установлено, что из 6 исследованных образцов гуманизированных антител из моноклонального антитела #11D5 крысы против AXL человека, антитела h#11D5-T4, h#11D5-T5 и h#11D5-T6 имеют связывающую активность, которая почти равна таковой химерного антитела человека к белку AXL-Fc человека, зависимым от концентрации антител образом (Фигура 23).

Пример 15: Расчет коэффициента поглощения и прямое измерение поглощения белка гуманизированных антител из моноклональных антител крысы #11В7 и #11D5 против AXL человека

Концентрацию белка гуманизированных антител от h#11В7-Т1 до h#11B7-T27, полученных из моноклонального антитела крысы #11В7 против AXL человека, и от h#11D5-T1 до h#11D5-T6, полученных из моноклонального антитела крысы #11D5 против AXL человека, определяли методом, приведенным ниже. Каждое гуманизированное антитело на основе моноклональных антител крысы #11В7 или #11D5 против AXL человека, полученное в Примерах 10 или 12 соответственно, разводили с учетом его массы с использованием весов МХ5 Automated-S microbalance (METTLER TOLEDO). Измеряли поглощение при 280 нм (А280) для каждого антитела на спектрофотометре DU-7400 UV-vis Spectrophotometer (Beckman Coulter, Inc.) при комнатной температуре, используя кварцевые кюветы. Концентрацию белка каждого антитела рассчитывали с учетом коэффициента поглощения. Коэффициент поглощения каждого антитела определяли с использованием программы Sednterp, которую можно скачать с сайта National Institute of Health (http://jphilo.mailway.com/download.htm). Результаты представлены на Фигурах 24 (верхняя панель для антител от h#11B7-T1 до h#11B7-T14; нижняя панель для антител от h#11B7-T15 до h#11B7-T27) и 25 (для антител от h#11D5-T1 до h#11D5-Т6).

Пример 16: Определение участка связывания (эпитопа) для моноклонального антитела крысы #11В7 против AXL человека

a) Экспрессия и очистка тандемного IG домена AXL человека

ДНК, кодирующая белок, включающий IG домены AXL человека (аминокислоты Nos. от 26 до 220 в Базе Данных белков NCBI ACCESSION No. P_30530: SEQ ID NO: 139), слитый с N-концевым His-tag и последовательностью для узнавания тромбином, была встроена в вектор pDEST14 (Invitrogen Corp., catalog No.: 11801-016). Бактерии E.coli Rosetta-gami B(DE3) (Novagen, catalog No.: 71136-4) трансформировали этой плазмидой и культивировали в среде ТВ (Invitrogen Corp., catalog No.: 22711-022). Выращенные бактериальные клетки разрушали ультразвуком и центрифугировали, а супернатант очищали с использованием колонки HisTrap HP (GE Healthcare, catalog No.: 17-5247-01). Элюат собирали и обессоливали на колонке PD-10 (GE Healthcare, catalog No.: 17-0851-01), после чего His-tag отщепляли обработкой тромбином (Sigma-Aldrich, catalog No.: T-7009). Расщепленный белок очищали на MONO Q 5/50 GL(GE Healthcare, catalog No.: 17-5166-01) и на колонке Superdex 75 10/300 (GE Healthcare, catalog No.: 17-5174-01) до получения единственной белковой полосы с молекулярной массой 21 кДа.

b) Экспрессия и очистка одиночного IG домена AXL человека

ДНК, кодирующая белок, включающий IG домены AXL человека (аминокислоты Nos. от 26 до 131 и от 129 до 220 в Базе Данных белков NCBI ACCESSION No. P_30530), слитый с N-концевым His-tag и последовательностью для узнавания Фактором Ха, была встроена в вектор pDEST14 (Invitrogen Corp., catalog No.: 11801-016). Бактерии E.coli Rosetta-gami B(DE3) (Novagen, catalog No.: 71136-4) трансформировали этой плазмидой и культивировали в среде ТВ (Invitrogen Corp., catalog No.: 22711-022). Выращенные бактериальные клетки разрушали ультразвуком и центрифугировали, а супернатант очищали с использованием колонки HisTrap HP (GE Healthcare, catalog No.: 17-5247-01). После этого IG домены AXL человека очищали электрофорезом на колонке Superdex 75 10/300 (GE Healthcare, catalog No.: 17-5174-01) до получения единственной белковой полосы с молекулярной массой 11 кДа.

с) Определение участка связывания (эпитопа) на IG домене AXL человека для моноклонального антитела крысы #11В7 против AXL человека

Участок связывания (эпитоп) на IG домене AXL человека для моноклонального антитела крысы #11В7 против AXL человека был выявлен следующим методом: Пептиды, содержащие один их двух IG доменов AXL человека (NHis-hAXL26-131 и NHis-hAXL129-220), и пептид, содержащий оба этих IG домена AXL человека (hAXL26-220), были по отдельности разведены PBS до концентрации 1 мкг/мл. После этого каждый раствор был внесен в количестве 100 мкл/лунку в планшет Immuno Plate (производство Nalge Nunc International K.K., #437111) и оставлен на ночь при 4°С для связывания пептида на планшете. На следующий день лунки промывали 5 раз раствором PBS-T solution (PBS и 0,05% (по объему) Tween 20). После этого в лунки добавляли раствор, содержащий обезжиренное молоко (производство Morinaga Milk Industry Co., Ltd.), разведенное PBS до 5%, в количестве 100 мкл/лунку и оставляли при комнатной температуре на 2 часа. Раствор из лунок удаляли и промывали лунки 5 раз раствором PBS-T. Моноклональное антитело крысы #11В7 против AXL человека разводили до 0,04 мкг/мл раствором PBS, содержащим 0,5% обезжиренного молока. Затем этот раствор вносили в количестве 100 мкл/лунку и выдерживали при комнатной температуре в течение 2 часов. После этого лунки промывали 5 раз раствором PBS-T. После этого добавляли конъюгированный с щелочной фосфатазой AffiniPure козы против IgG человека (производство Jackson ImmunoResearch Laboratories, Inc., #109-055-097), разведенный в 2500 раз раствором TBS-Т (TBS и 0,05% (по объему) Tween 20) в количестве 100 мкл/лунку и оставляли при комнатной температуре на 1 час. После этого растворы удаляли и промывали лунки 5 раз раствором TBS-T. После этого добавляли раствор флуоресцентного субстрата (производство Roche Diagnostics K.K., #11681982001) в количестве 100 мкл/лунку для проведения флуоресцентной реакции. Интенсивность флуоресценции в планшетах с адсорбированным IG доменом AXL человека измеряли через 15 минут после добавления раствора флуоресцентного субстрата с использованием прибора SpectraMax M5 (производство Molecular Devices Corp.). В результате проведения ELISA было установлено, что только hAXL26-220 и NHis-hAXL 129-220 обладают связывающей активностью. Таким образом, было показано, что эпитоп для моноклонального антитела крысы #11В7 против AXL человека находится в расположенном ближе к С-концу IG домене из двух IG доменов AXL человека (домен, который включает аминокислотные остатки Nos. 129-220 в Базе Данных белков NCBI ACCESSION No. P_30530: SEQ ID NO:139; Фигура 30А) (Фигура 26).

Пример 17: Гуманизированные антитела против AXL настоящего изобретения ингибируют лиганд-индуцированное фосфорилирование AXL in vitro

Белок, кодируемый геном 6 специфической задержки пролиферации, Gas6, представляет собой природный лиганд рецепторной тирозинкиназы AXL. Связывание Gas6 с AXL приводит к активации рецептора, что проявляется в увеличенных уровнях фосфорилирования рецепторной тирозинкиназы. Эксперименты, описанные в Примере 17, были проведены для оценки влияния, которое оказывают гуманизированные антитела против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения на опосредуемую Gas6 активацию рецепторной тирозинкиназы AXL.

Пример 17.1: Гуманизированные антитела против AXL настоящего изобретения ингибируют лиганд-индуцированное фосфорилирование AXL in vitro как определено методом ELISA

Для выяснения вопроса, способны ли гуманизированные антитела против AXL настоящего изобретения блокировать лиганд Gаs6-индуцируемое фосфорилирование AXL, были проведены эксперименты ELISA. Вкратце, в день 1 клетки в количестве 3×104 на лунку были высеяны в нормальную среду роста в плоскодонные 96-луночные планшеты. На следующий день среда роста была заменена на бессывороточную среду для того, чтобы клетки голодали в течение 24 часов. Также через день черные 96-луночные планшеты Maxi-Sorp (Nunc) были покрыты антителами мыши 4G10 против фосфотирозина в концентрации 2 мкг/мл PBS при 4°С. В день 3 раствор антител 4G10 был удален, и лунки Maxi-Sorp были заблокированы раствором PBS, 0,5% БСА, по меньшей мере, в течение 4 часов при комнатной температуре. Параллельно с этим клетки проинкубировали с 10 мкг/мл контрольного антитела Gammagard (Sigma), химерного антитела против AXL mAb #11B7, а также гуманизированных антител против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 в течение 3 часов при 37°С, после чего обрабатывали или не обрабатывали 400 нг/мл Gas6 (R&D Systems) в течение 15 минут при 37°С. После этого среду удаляли и лизировали клетки в лизирующем буфере (50 мМ HEPES, рН 7,5, 150 мМ NaCl, 1 мМ ЭДТА, 10% глицерин и 1% Тритон Х-100) с добавлением ингибиторов фосфатаз и протеаз (10 мМ Na4P2O7, 1 мМ фенилметилсульфонилфторид, 1 мМ ортованадат, 1 мМ NaF и 0,5% апротинин) в течение 30 мин на льду. В это время из планшетов удаляли блокирующий буфер и планшеты Maxi-Sorp промывали 6 раз буфером для промывки (PBS, 0,05% Tween 20), после чего вносили клеточные лизаты и инкубировали в течение ночи при 4°С. После того, как в день 4 планшеты промывали 6 раз буфером для промывки, лунки инкубировали с биотинилированным антителом крысы 12В7 против AXL в концентрации 0,5 мкг/мл PBS в течение 2 часов при комнатной температуре. Планшеты промывали 6 раз буфером для промывки и в каждую лунку добавляли АР-конъюгированный стрептавидин (Chemicon #SA110), разведенный 1:4000 в PBS, и планшеты инкубировали 30 минут при комнатной температуре. После этого лунки промывали 6 раз буфером для промывки и добавляли в них раствор субстрата AttoPhos (Roche #11681982). С использованием флуориметра Victor plate reader (Perkin Elmer) регистрировали флуоресценцию в каждой лунке при длине волны возбуждающего света 430 нм и длине волны испускаемого света 580 нм.

Фигура 27 показывает репрезентативные результаты этого эксперимента для клеток рака молочной железы Hs578T. По сравнению с контрольным антителом Gammagard, химерное антитело #11В7 против AXL и гуманизированные антитела против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения были способны блокировать или достоверно снижать Gas6-опосредуемую активацию AXL в клетках рака молочной железы Hs578T, что видно по снижению уровней фосфорилирования тирозина в AXL. Аналогичные эффекты с той же панелью антител наблюдались в фибробластах NIH3T3-AXL с1. 7, сверхэкспрессирующих AXL, клеточной линии NCI-H292 рака легких, клеточной линии С-8161 меланомы и клеточных линиях РС-3 и DU-145 рака простаты.

Пример 17.2: Гуманизированные антитела против AXL настоящего изобретения ингибируют лиганд-индуцируемое фосфорилирование AXL in vitro как показано методом Вестерн-Блоттинг

Кроме того, для подтверждения способности гуманизированных антител оказывать влияние на лиганд Gas6-индуцируемую активацию AXL, был проведен Вестерн-Блот анализ. Для этого клетки рака молочной железы Hs578T в количестве 1,5×106 были высеяны на 10 см культуральные чашки Петри в день 1. На следующий день среда была заменена на бессывороточную среду для того, чтобы клетки голодали в течение 24 часов. В день 3 клетки преинкубировали с 10 мкг/мл контрольного антитела Gammagard (Sigma), химерного mAb #11В7 против AXL и гуманизированных антител против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 в течение 3 часов при 37°С, и далее обрабатывали или не обрабатывали 400 нг/мл Gas6 (R&D Systems) в течение 15 минут при 37°С. После этого среду удаляли и лизировали клетки в 1 мл лизирующего буфера (50 мМ HEPES, рН 7,5, 150 мМ NaCl, 1 мМ ЭДТА, 10% глицерин и 1% Тритон Х-100) с добавлением ингибиторов фосфатаз и протеаз (10 мМ Na4P2O7, 1 мМ фенилметилсульфонилфторид, 1 мМ ортованадат, 1 мМ NaF и 0,5% апротинин) в течение 30 мин на льду, и удаляли обломки клеток центрифугированием в течение 10 мин при 10000 × g и 4°С. Для проведения иммунопреципитации определили концентрацию белка в супернатантах и 500 мкг общих лизатов клеток инкубировали с 30 мкл суспензии Протеин А-сефарозы и 1 мкг моноклонального антитела крысы 12В7 против AXL при вращении в течение 3 часов при 4°С. Преципитаты промывали три раза 0,7 мл холодного буфера HNTG (20 мМ HEPES рН 7,5, 150 мМ NaCl, 0,1% Тритон-Х-100, 10% глицерин и 10 мМ Na4P2O7), суспендировали и кипятили в 40 мкл 3-кратного буфера для образцов по Леммли, после чего проводили SDS-электрофорез в ПААГ. Для проведения Вестерн-Блот анализа белки переносили на нитроцеллюлозную мембрану. После этого мембрану блокировали NET-Желатином и инкубировали с первичным моноклональным антителом мыши против фосфотирозина 4G10 (Upstate) в течение ночи. На следующий день мембрану промывали 3 раза NET-Желатином и инкубировали с HRP-конъюгированными вторичными анти-мышиными антителами в течение 1 часа при комнатной температуре, после чего снова промывали 3 раза NET-Желатином. Далее мембраны экспонировали с пленками (Kodak) с использованием набора для определения хемилюминесценции согласно инструкциям производителя (GE Healthcare). После этого те же самые мембраны были повторно проанализированы с использованием антитела против AXL.

Фигура 27 показывает репрезентативные результаты этого эксперимента. По сравнению с контрольным антителом Gammagard, химерное антитело #11В7 против AXL и гуманизированные антитела против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения были способны блокировать или достоверно снижать Gas6-опосредуемую активацию AXL в клетках рака молочной железы Hs578T, что видно по снижению уровней фосфорилирования тирозина в AXL.

Пример 18: Гуманизированные антитела против AXL настоящего изобретения ингибируют лиганд-индуцируемое фосфорилирование нижележащих сигнальных молекул в сигнальном пути AXL in vitro

Gas6-индyциpyeмaя активация рецепторной тирозинкиназы AXL выражается не только в повышенных уровнях фосфорилирования тирозина самого AXL, но также приводит к индукции расположенных ниже сигнальных каскадов, включая сигнальные пути с участием ERK1/2 и PKB/АКТ. Таким образом, были продолжены эксперименты для выяснения способности гуманизированных антител против AXL h#11B7-T2, h#11B7-Т3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения подавлять Gas6-опосредуемую активацию ERK1 и ERK2, а также АКТ. Более того, мы обнаружили, что уровень фосфорилирования сигнальных молекул GSK-3β, TSC2, mTOR и S6K1 также модулируется при стимуляции Gas6, поэтому мы проанализировали ингибиторное действие гуманизированных антител против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения также и на эти молекулы.

Пример 18.1: Гуманизированные антитела 11В7 против AXL настоящего изобретения ингибируют лиганд-индуцируемое фосфорилирование ERK1/2 in vitro

Для изучения способности гуманизированных антител настоящего изобретения оказывать влияние на Gas6-индуцируемую активацию ERK1/2, был проведен Вестерн-Блот анализ. Gas6-опосредуемая активация ERK1/2 проявляется в повышенных уровнях фосфорилирования этого белка по положениям Thr202 и Тyr204. С этой целью клетки рака молочной железы Hs578T в количестве 5×106 или клетки рака легких NCI-H292 в количестве 3×106 были высеяны на 10 см культуральные чашки Петри в день 1. На следующий день среда роста была заменена на бессывороточную среду для того, чтобы клетки голодали в течение 24 часов. В день 3 клетки преинкубировали с 10 мкг/мл контрольного антитела Gammagard (Baxter), химерного mAb chm11B7 против AXL и гуманизированных антител против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 в течение 3 часов при 37°С, и далее обрабатывали или не обрабатывали 400 нг/мл Gas6 (R&D Systems) в течение 15 минут при 37°С. После этого среду удаляли и лизировали клетки в 800 мкл лизирующего буфера (50 мМ HEPES, рН 7,5, 150 мМ NaCl, I мМ ЭДТА, 10% глицерин и 1% Тритон Х-100) с добавлением ингибиторов фосфатаз и протеаз (10 мМ Na4P2O7, 1 мМ фенилметилсульфонилфторид, 1 мМ ортованадат, 1 мМ NaF и 0,5% апротинин) в течение 30 мин на льду, и удаляли обломки клеток центрифугированием в течение 10 мин при 10000 × g и 4°С. Определяли концентрацию белка в супернатантах и 50 мкг общих лизатов клеток суспендировали и кипятили в 3-кратном буфере для образцов по Леммли, после чего проводили SDS-электрофорез в ПААГ. После переноса белков на нитроцеллюлозную мембрану, мембрану блокировали NET-Желатином и инкубировали с первичным поликлональным антителом кролика против фосфо-р44/42 МАР-киназы (Thr202/Tyr204) (Cell Signaling Technologies, #9101) в течение ночи. На следующий день мембрану промывали 3 раза NET-Желатином, инкубировали с HRP-конъюгированными вторичными анти-кроличьими антителами (Dianova, #111-036-045) в течение 1 часа при комнатной температуре и снова промывали 3 раза NET-Желатином. Далее мембраны экспонировали с пленками (Kodak) с использованием набора для определения хемилюминесценции согласно инструкциям производителя (GE Healthcare). После этого те же самые мембраны были повторно проанализированы с использованием антитела против р44/42 МАР-киназы (Santa Cruz K-23, #sc-153).

Фигура 28А показывает репрезентативные результаты этого эксперимента. По сравнению с контрольным антителом Gammagard, химерное антитело chm11B7 против AXL и гуманизированные антитела против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения были способны влиять на слабое Gas6-индуцируемое увеличение активации ERK1/2 в клетках рака молочной железы Hs578T. Однако вследствие высокой базальной активности ERK1/2 в этой клеточной линии, эти эффекты, которые проявляются в пониженных уровнях фосфорилирования ERK1/2 Thr202/Tyr204 в Gаs6-стимулированных по сравнению с соответствующими нестимулированными клетками, выглядят только относительно слабыми (вверху). В противоположность этому, ингибиторные эффекты химерного антитела против AXL chm11B7 и гуманизированных антител против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 или h#11B7-T6 на фосфорилирование ERK1/2 Thr202/Tyr204 значительно более отчетливо видны на клеточной линии рака легких NCI-H292 (внизу).

Пример 18.2: Гуманизированные антитела 11В7 против AXL настоящего изобретения ингибируют лиганд-индуцируемое фосфорилирование АКТ in vitro

Для изучения способности гуманизированных антител настоящего изобретения оказывать влияние на Gаs6-индуцируемую активацию АКТ, был проведен Вестерн-Блот анализ. Gаs6-опосредуемая активация АКТ проявляется в повышенных уровнях фосфорилирования этого белка по положению Ser473. С этой целью этого клетки рака молочной железы Hs578T в количестве 5×106 или клетки рака легких NCI-H292 в количестве 3×106 были высеяны на 10 см культуральные чашки Петри в день 1. На следующий день среда роста была заменена на бессывороточную среду для того, чтобы клетки голодали в течение 24 часов. В день 3 клетки проинкубировали с 10 мкг/мл контрольного антитела Gammagard (Baxter), химерного mAb chm11B7 против AXL или гуманизированных антител против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 в течение 3 часов при 37°С, и далее обрабатывали или не обрабатывали 400 нг/мл Gas6 (R&D Systems) в течение 15 минут при 37°С. После этого среду удаляли и лизировали клетки в 800 мкл лизирующего буфера (50 мМ HEPES, рН 7,5, 150 мМ NaCl, 1 мМ ЭДТА, 10% глицерин и 1% Тритон Х-100) с добавлением ингибиторов фосфатаз и протеаз (10 мМ Na4P2O7, 1 мМ фенилметилсульфонилфторид, 1 мМ ортованадат, 1 мМ NaF и 0,5% апротинин) в течение 30 мин на льду, и удаляли обломки клеток центрифугированием в течение 10 мин при 10000 × g и 4°С. Определяли концентрацию белка в супернатантах и 50 мкг общих лизатов клеток суспендировали и кипятили в 3-кратном буфере для образцов по Леммли, после чего проводили SDS-электрофорез в ПААГ. После переноса белков на нитроцеллюлозную мембрану, мембрану блокировали NET-Желатином и инкубировали с первичными поликлональными антителами кролика против АКТ1/2/3 (Cell Signaling Technologies, #9272) в течение ночи. На следующий день мембрану промывали 3 раза NET-Желатином, инкубировали с HRP-конъюгированными вторичными анти-кроличьими антителами (Dianova, #111-036-045) в течение 1 часа при комнатной температуре и снова промывали 3 раза NET-Желатином. Далее мембраны экспонировали с пленками (Kodak) с использованием набора для определения хемилюминесценции согласно инструкциям производителя (GE Healthcare). После этого те же самые мембраны были повторно проанализированы с использованием антитела против фосфо-АКТ (Ser473) (Cell Signaling Technologies, #9271).

Фигура 28В показывает репрезентативные результаты этого эксперимента. По сравнению с контрольным антителом Gammagard, химерное антитело chm11B7 против AXL и гуманизированные антитела против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения были способны достоверно снижать Gas6-индyциpyeмyю активацию АКТ в клетках рака молочной железы Hs578T (вверху) и клетках рака легких NCI-H292 (внизу), что видно по сниженным уровням фосфорилирования АКТ Ser473 в Gas6-стимулированных клетках по сравнению с соответствующими нестимулированными клетками.

Пример 18.3. Гуманизированные антитела 11В7 против AXL настоящего изобретения ингибируют лиганд-индуцируемое фосфорилирование GSK-3p in vitro

Для изучения способности гуманизированных антител настоящего изобретения оказывать влияние на Gas6-индyциpyeмyю активацию GSK-3β, которая проявляется в повышенных уровнях фосфорилирования этого белка по положению Ser9, был проведен Вестерн-Блот анализ. Для этого клетки рака молочной железы Hs578T в количестве 5×106 или клетки рака легких NCI-H292 в количестве 3×106 были высеяны на 10 см культуральные чашки Петри в день 1. На следующий день среда роста была заменена на бессывороточную среду для того, чтобы клетки голодали в течение 24 часов. В день 3 клетки преинкубировали с 10 мкг/мл контрольного антитела Gammagard (Baxter), химерного mAb chm11B7 против AXL или гуманизированных антител против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 в течение 3 часов при 37°С, и далее обрабатывали или не обрабатывали 400 нг/мл Gas6 (R&D Systems) в течение 15 минут при 37°С. После этого среду удаляли и лизировали клетки в 800 мкл лизирующего буфера (50 мМ HEPES, рН 7,5, 150 мМ NaCl, 1 мМ ЭДТА, 10% глицерин и 1% Тритон X-100) с добавлением ингибиторов фосфатаз и протеаз (10 мМ Na4P2O7, 1 мМ фенилметилсульфонилфторид, 1 мМ ортованадат, 1 мМ NaF и 0,5% апротинин) в течение 30 мин на льду, и удаляли обломки клеток центрифугированием в течение 10 мин при 10000 × g и 4°С. Определяли концентрацию белка в супернатантах и 50 мкг общих лизатов клеток суспендировали и кипятили в 3-кратном буфере для образцов по Леммли, после чего проводили SDS-электрофорез в ПААГ. После переноса белков на нитроцеллюлозную мембрану, мембрану блокировали NET-Желатином и инкубировали с первичным поликлональным антителом кролика против фосфо-GSK-3β (Ser9) (Cell Signaling Technologies, #9336) в течение ночи. На следующий день мембрану промывали 3 раза NET-Желатином, инкубировали с HRP-конъюгированными вторичными анти-кроличьими антителами (Dianova, #111-036-045) в течение 1 часа при комнатной температуре и снова промывали 3 раза NET-Желатином. Далее мембраны экспонировали с пленками (Kodak) с использованием набора для определения хемилюминесценции согласно инструкциям производителя (GE Healthcare). После этого те же самые мембраны были повторно исследованы с использованием антитела против GSK-3β (Becton Dickinson, #610201) и HRP-конъюгированного вторичного анти-мышиного антитела (Dianova, #315-036-045).

Фигура 28С показывает репрезентативные результаты этого эксперимента. По сравнению с контрольным антителом Gammagard, химерное антитело chm11B7 против AXL и гуманизированные антитела против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения были способны достоверно снижать Gas6-индуцируемую активацию GSK-3β в клетках рака молочной железы Hs578T (вверху) и клетках рака легких NCI-H292 (внизу), что видно по сниженным уровням фосфорилирования GSK-3β Ser9 в Gas6-стимулированных клетках по сравнению с соответствующими нестимулированными клетками.

Пример 18.4: Гуманизированные антитела 11В7 против AXL настоящего изобретения ингибируют лиганд-индуцируемое фосфорилирование TSC2 in vitro

Для изучения способности гуманизированных антител настоящего изобретения оказывать влияние на Gas6-индуцируемое РI3K/Gas6-опосредуемое фосфорилирование TSC2 по аминокислотному остатку этого белка Thr1462, был проведен Вестерн-Блот анализ. Фосфорилирование TSC2 по Thr1462 обычно ассоциировано с ингибированием функции супрессора опухолей - комплекса TSC, и, вследствие этого, с активацией лежащего ниже сигнального пути mTOR. Вкратце, клетки рака молочной железы Hs578T в количестве 5×106 или клетки рака легких NCI-H292 в количестве 3×106 были высеяны на 10 см культуральные чашки Петри в день 1. На следующий день среда роста была заменена на бессывороточную среду для того, чтобы клетки голодали в течение 24 часов. В день 3 клетки преинкубировали с 10 мкг/мл контрольного антитела Gammagard (Baxter), химерного mAb chm11B7 против AXL и гуманизированных антител против AXL h#11В7-Т2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 в течение 3 часов при 37°С и далее обрабатывали или не обрабатывали 400 нг/мл Gas6 (R&D Systems) в течение 15 минут при 37°С. После этого среду удаляли и лизировали клетки в 800 мкл лизирующего буфера (50 мМ HEPES, рН 7,5, 150 мМ NaCl, 1 мМ ЭДТА, 10% глицерин и 1% Тритон Х-100) с добавлением ингибиторов фосфатаз и протеаз (10 мМ Na4P2O7, 1 мМ фенилметилсульфонилфторид, 1 мМ ортованадат, 1 мМ NaF и 0,5% апротинин) в течение 30 мин на льду, и удаляли обломки клеток центрифугированием в течение 10 мин при 10000 × g и 4°С. Определяли концентрацию белка в супернатантах и 50 мкг общих лизатов клеток суспендировали и кипятили в 3-кратном буфере для образцов по Леммли, после чего проводили SDS-электрофорез в ПААГ. После переноса белков на нитроцеллюлозную мембрану, мембрану блокировали NET-Желатином и инкубировали с первичными поликлональными антителами кролика против TSC2 (Cell Signaling Technologies, #3612) в течение ночи. На следующий день мембрану промывали 3 раза NET-Желатином, инкубировали с HRP-конъюгированными вторичными анти-кроличьими антителами (Dianova, #111-036-045) в течение 1 часа при комнатной температуре и снова промывали 3 раза NET-Желатином. Далее мембраны экспонировали с пленками (Kodak) с использованием набора для определения хемилюминесценции согласно инструкциям производителя (GE Healthcare). После этого те же самые мембраны были повторно исследованы с использованием антитела против фocфo-TSC2 (Thr1462) (Cell Signaling Technologies, #3617).

Фигура 28D показывает репрезентативные результаты этого эксперимента. По сравнению с контрольным антителом Gammagard, химерное антитело chm11B7 против AXL и гуманизированные антитела против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения были способны достоверно снижать Gas6-индyциpyeмoe фосфорилирование TCS2 по Thr1462 в клетках рака молочной железы Hs578T (вверху) и клетках рака легких NCI-H292 (внизу), что видно по сниженным уровням фосфорилирования этого аминокислотного остатка в Gas6-стимулированных клетках по сравнению с соответствующими нестимулированными клетками.

Пример 18.5: Гуманизированные антитела 11В7 против AXL настоящего изобретения ингибируют лиганд-индуцируемое фосфорилирование mTOR in vitro

Учитывая эффекты на фосфорилирование TSC2, для изучения способности гуманизированных антител настоящего изобретения оказывать влияние на Gas6-индуцируемую активацию mTOR, был проведен Вестерн-Блот анализ. Gas6-опосредуемая активация mTOR проявляется в повышенных уровнях фосфорилирования этого белка по положению Ser2448. С этой целью рака молочной железы Hs578T в количестве 5×106 или клетки рака легких NCI-H292 в количестве 3×106 в день 1 были высеяны на культуральные чашки Петри диаметром 10 см. На следующий день среда роста была заменена на бессывороточную среду для того, чтобы клетки голодали в течение 24 часов. В день 3 клетки преинкубировали с 10 мкг/мл контрольного антитела Gammagard (Baxter), химерного mAb chm11B7 против AXL и гуманизированных антител против AXL h#11В7-Т2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 в течение 3 часов при 37°С, и далее обрабатывали или не обрабатывали 400 нг/мл Gas6 (R&D Systems) в течение 15 минут при 37°С. После этого среду удаляли и лизировали клетки в 800 мкл лизирующего буфера (50 мМ HEPES, рН 7,5, 150 мМ NaCl, 1 мМ ЭДТА, 10% глицерин и 1% Тритон Х-100) с добавлением ингибиторов фосфатаз и протеаз (10 мМ Na4P2O7, 1 мМ фенилметилсульфонилфторид, 1 мМ ортованадат, 1 мМ NaF и 0,5% апротинин) в течение 30 мин на льду, и удаляли обломки клеток центрифугированием в течение 10 мин при 10000 × g и 4°С. Определяли концентрацию белка в супернатантах и 50 мкг общих лизатов клеток суспендировали и кипятили в 3-кратном буфере для образцов по Леммли, после чего проводили SDS-электрофорез в ПААГ. После переноса белков на нитроцеллюлозную мембрану, мембрану блокировали NET-Желатином и инкубировали с первичными поликлональными антителами кролика против фосфо-mTOR (Ser2448) (Cell Signaling Technologies, #2971) в течение ночи. На следующий день мембрану промывали 3 раза NET-Желатином, инкубировали с HRP-конъюгированными вторичными анти-кроличьими антителами (Dianova, #111-036-045) в течение 1 часа при комнатной температуре и снова промывали 3 раза NET-Желатином. Далее мембраны экспонировали с пленками (Kodak) с использованием набора для определения хемилюминесценции согласно инструкциям производителя (GE Healthcare). После этого те же самые мембраны были повторно проанализированы с использованием антитела против mTOR киназы (Cell Signaling Technologies, #2972).

Фигура 28Е показывает репрезентативные результаты этого эксперимента. Ингибиторные эффекты антител против AXL были относительно слабыми в клетках рака молочной железы Hs578T (вверху). Однако, по сравнению с контрольным антителом Gammagard, химерное антитело chm11B7 против AXL и гуманизированные антитела против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения были способны подавлять Gas6-индyциpyeмyю активацию mTOR в клетках рака легких NCI-H292, что видно по сниженным уровням фосфорилирования mTOR Ser2448 в Gas6-стимулированных клетках по сравнению с соответствующими нестимулированными клетками (внизу).

Пример 18.6: Гуманизированные антитела 11В7 против AXL настоящего изобретения ингибируют лиганд-индуцируемое фосфорилирование S6K1 in vitro

Наконец, для изучения способности гуманизированных антител настоящего изобретения оказывать влияние на Gas6-индуцируемую активацию S6K1, был проведен Вестерн-Блот анализ. Gas6-опосредуемая активация S6K1 проявляется в повышенных уровнях фосфорилирования этого белка по положениям Thr421 и Ser424. Для этого клетки рака молочной железы Hs578T в количестве 5×106 или клетки рака легких NCI-H292 в количестве 3×106 в день 1 были высеяны на 10 см культуральные чашки Петри. На следующий день среда роста была заменена на бессывороточную среду для того, чтобы клетки голодали в течение 24 часов. В день 3 клетки проинкубировали с 10 мкг/мл контрольного антитела Gammagard (Baxter), химерного mAb chm11B7 против AXL и гуманизированных антител против AXL h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 в течение 3 часов при 37°С, и далее обрабатывали или не обрабатывали 400 нг/мл Gas6 (R&D Systems) в течение 15 минут при 37°С. После этого среду удаляли и лизировали клетки в 800 мкл лизирующего буфера (50 мМ HEPES, рН 7,5, 150 мМ NaCl, 1 мМ ЭДТА, 10% глицерин и 1% Тритон Х-100) с добавлением ингибиторов фосфатаз и протеаз (10 мМ Nа4Р2O7, 1 мМ фенилметилсульфонилфторид, 1 мМ ортованадат, 1 мМ NaF и 0,5% апротинин) в течение 30 мин на льду, и удаляли обломки клеток центрифугированием в течение 10 мин при 10000 × g и 4°С. Определяли концентрацию белка в супернатантах и 50 мкг общих лизатов клеток суспендировали и кипятили в 3-кратном буфере для образцов по Леммли, после чего проводили SDS-электрофорез в ПААГ. После переноса белков на нитроцеллюлозную мембрану, мембрану блокировали NET-Желатином и инкубировали с первичными поликлональными антителами кролика против фосфо-р70 S6 Киназы 1 (Thr421/Ser424) (Cell Signaling Technologies, #9204) в течение ночи. На следующий день мембрану промывали 3 раза NET-Желатином, инкубировали с HRP-конъюгированными вторичными анти-кроличьими антителами (Dianova, #111-036-045) в течение 1 часа при комнатной температуре и снова промывали 3 раза NET-Желатином. Далее мембраны экспонировали с пленками (Kodak) с использованием набора для определения хемилюминесценции согласно инструкциям производителя (GE Healthcare). После этого те же самые мембраны были повторно исследованы с использованием антитела против β-актина (Cell Signaling Technologies, #4967).

Фигура 28F показывает репрезентативные результаты этого эксперимента. По сравнению с контрольным антителом Gammagard, химерное антитело chm11B7 против AXL и гуманизированные антитела против AXL h#11B7-T2, h#11В7-Т3, h#11B7-T4, h#11B7-T5 и h#11B7-T6 настоящего изобретения показали некоторые ингибиторные эффекты на Gas6-индуцируемую активацию S6K1 в клетках рака молочной железы Hs578T, что видно по сниженным уровням фосфорилирования mTOR S6K1 Thr421/Ser424 в Gаs6-стимулированных клетках по сравнению с соответствующими нестимулированными клетками (вверху). Однако значительно более сильное снижение Gas6-индуцированного фосфорилирования S6K1 Thr421/Ser424, и как следствие, активацию при предварительной обработке химерным антителом chm11B7 против AXL и гуманизированными антителами против AXL h#11B7-T2, h#11B7-T3, h#11В7-Т4, h#11В7-Т5 и h#11B7-T6 настоящего изобретения можно видеть в клетках рака легких NCI-H292 (внизу).

Пример 19: Гуманизированные антитела против AXL 11D5 настоящего изобретения ингибируют лиганд-индуцируемое фосфорилирование AXL in vitro, как показано методом ELISA

Помимо характеристики серии гуманизированных антител mAb h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11В7-Т5 и h#11B7-T6 против AXL, были проведены эксперименты ELISA для исследования способности гуманизированных антител против AXL h#11D5-T2, h#11D5-T3, h#11D5-T4, h#11D5-T5 и h#11D5-T6 настоящего изобретения подавлять Gas6-индуцируемое фосфорилирование и, следовательно, активацию рецепторной тирозинкиназы AXL.

Вкратце, в день 1 клетки рака молочной железы Hs578T в количестве 3×104 были засеяны в нормальную среду роста в плоскодонные 96-луночные планшеты. На следующий день среда роста была заменена на бессывороточную среду для того, чтобы клетки голодали в течение 24 часов. Также на следующий день лунки 96-луночных планшетов Maxi-Sorp 96 (Nunc) были покрыты антителами мыши против фосфотирозина 4G10 в концентрации 2 мкг/мл в PBS при 4°С. В день 3 раствор антител 4G10 был удален, и лунки Maxi-Sorp были заблокированы блокирующим буфером (PBS, 0,5% БСА) в течение, по меньшей мере, 4 часов при комнатной температуре. Параллельно с этим, клетки были преинкубированы с 10 мкг/мл контрольного антитела Gammagard (Baxter), химерного mAb chm11D5 против AXL и гуманизированных антител против AXL h#11D5-T2, h#11D5-T3, h#11D5-T4, h#11D5-T5 и h#11D5-T6 в течение 3 часов при 37°С, после чего были обработаны или не обработаны 400 нг/мл Gas6 (R&D Systems) в течение 15 минут при 37°С. После этого среду удаляли и лизировали клетки в лидирующем буфере в количестве 110 мкл/лунку (50 мМ HEPES, рН 7,5, 150 мМ NaCl, 1 мМ ЭДТА, 10% глицерин и 1% Тритон Х-100) с добавлением ингибиторов фосфатаз и протеаз (10 мМ Na4P2O7, 1 мМ фенилметилсульфонилфторид, 1 мМ ортованадат, 1 мМ NaF и 0,5% апротинин) в течение 30 мин на льду. В это время удаляли блокирующий буфер и планшеты Maxi-Sorp промывали 6 раз буфером для промывки (PBS, 0,05% Tween 20), после чего в лунки вносили 100 мкл клеточных лизатов и инкубировали в течение ночи при 4°С. После того, как планшеты промывали 6 раз буфером для промывки в день 4, лунки инкубировали с биотинилированным антителом крысы 12В7 против AXL в концентрации 0,125 мкг/мл буфера для разведения (20 мМ Tris, 50 мМ NaCl, рН 7,3, 0,05% Tween 20, 0,1% БСА) в течение 2 часов при комнатной температуре. Планшеты промывали 6 раз буфером для промывки и в каждую лунку добавляли АР-конъюгированный стрептавидин (Chemicon #SA110), разведенный 1:20000 в буфере для разведения, и инкубировали 30 минут при комнатной температуре. После этого лунки промывали 6 раз буфером для промывки и добавляли в них раствор субстрата AttoPhos (Roche #11681982). С использованием флуориметра SpectraMax-GeminiEM plate reader (Molecular Devices) регистрировали флуоресценцию в каждой лунке при длине волны возбуждающего света 430 нм и длине волны испускаемого света 580 нм.

Фигура 29 показывает репрезентативные результаты этого эксперимента. По сравнению с контрольным антителом Gammagard, химерное антитело chm11D5 против AXL и гуманизированные антитела против AXL h#11D5-T2, h#11D5-T3, h#11D5-T4, h#11D5-T5 и h#11D5-T6 настоящего изобретения были способны блокировать или достоверно снижать Gas6-опосредуемую активацию, что видно по снижению уровней фосфорилирования тирозина в AXL в Gas6-сттимулированных клетках по сравнению с соответствующими нестимулированными клетками.

Пример 20: Антитела крысы и химерные антитела против AXL настоящего изобретения ингибируют лиганд-индуцируемое фосфорилирование AXL in vitro в одинаковой степени

Химерные производные антител крысы против AXL 11В7 и 11D5 были получены как часть настоящего изобретения (смотри выше). Для изучения вопроса, способны ли антитела крысы против AXL настоящего изобретения и соответствующие химерные антитела против AXL настоящего изобретения ингибировать лиганд Gas6-опосредуемую активацию AXL in vitro в одинаковой степени, были проведены эксперименты ELISA с использованием клеток рака шейки матки CaSki. Опосредуемая Gas6 активация AXL выявлялась по увеличению фосфорилирования тирозина в рецепторе. Вкратце, в первый день клетки в количестве 3×10 были высеяны в нормальной среде роста в плоскодонные 96-луночные планшеты. На следующий день среда роста была заменена на бессывороточную среду для того, чтобы клетки голодали в течение 24 часов. Также на следующий день лунки черных 96-луночных планшетов Maxi-Sorp 96 (Nunc) были покрыты антителами мыши против фосфотирозина 4G10 в концентрации 2 мкг/мл в PBS при 4°С. В день 3 раствор антител 4G10 был удален, и лунки Maxi-Sorp были заблокированы PBS, 0,5% БСА в течение, по меньшей мере, 4 часов при комнатной температуре. Параллельно с этим, клетки были проинкубированы с 50 нг/мл, 100 нг/мл, 300 нг/мл, 750 нг/мл, 1 мкг/мл и 10 мкг/мл антитела крысы AXL 11B7 или химерного антитела против AXL ch11B7 в течение 1 часа при 37°С, после чего были обработаны или не обработаны 400 нг/мл Gas6 (R&D Systems) в течение 10 минут при 37°С. После этого среду удаляли и лизировали клетки в лизирующем буфере в количестве 100 мкл/лунку (50 мМ HEPES, рН 7,5, 150 мМ NaCl, 1 мМ ЭДТА, 10% глицерин и 1% Тритон Х-100) с добавлением ингибиторов фосфатаз и протеаз (10 мМ Na4P2O7, 1 мМ фенилметилсульфонилфторид, 1 мМ ортованадат, 1 мМ NaF и 0,5% апротинин) в течение 30 мин на льду. В это время удаляли блокирующий буфер, и планшеты Maxi-Sorp промывали 6 раз буфером для промывки (PBS, 0,05% Tween 20), после чего вносили в лунки клеточные лизаты и инкубировали в течение ночи при 4°С. После того, как планшеты промыли 6 раз буфером для промывки в день 4, лунки инкубировали с биотинилированным антителом крысы 12В7 против AXL в концентрации 0,5 мкг/мл PBS в течение 2 часов при комнатной температуре. Планшеты промывали 6 раз буфером для промывки и в каждую лунку добавляли АР-конъюгированный стрептавидин (Chemicon #SA110), разведенный 1:4000 в PBS, и инкубировали 30 минут при комнатной температуре. После этого лунки промывали 6 раз буфером для промывки и добавляли в них раствор субстрата AttoPhos (Roche #11681982). С использованием флуориметра Victor plate reader (Perkin Elmer) регистрировали флуоресценцию в каждой лунке при длине волны возбуждающего света 430 нм и длине волны испускаемого света 580 нм.

Фигура 31 показывает репрезентативные результаты этого эксперимента для клеточной линии рака шейки матки CaSki. Как видно из концентрационно-зависимого снижения относительного фосфорилирования AXL, антитело крысы против AXL 11B7 (А) и химерное антитело против AXL ch11B7 (В) настоящего изобретения, были способны блокировать лиганд-индуцируемую активацию рецепторной тирозинкиназы AXL в одинаковой степени. Сравнимые эффекты при использовании аналогичной постановки эксперимента наблюдались для клеточной линии меланомы С-8161.

Пример 21: Получение гена гуманизированного антитела моноклонального антитела крысы #11В7 против AXL человека

a) Конструирование векторов для экспрессии легких цепей #11B7-T15L и h#11B7-T18L

Каждая ДНК, содержащая ген, кодирующий вариабельный участок легкой цепи #11B7-T15L или h#11B7-T18L (Фигура 32А), представленный аминокислотами Nos. от 21 до 129 последовательностей SEQ ID NO: 146 или 147 соответственно, Списка Последовательностей, слитый с сигналом секреции, была синтезирована (MBL Medical & Biological Laboratories Co., Ltd, Artificial Gene Synthesis Service) и расщеплена рестриктазами NheI и BsiWI. Полученные фрагменты ДНК были по отдельности встроены в сайты универсальных векторов для экспрессии легких цепей гуманизированных антител (pEF6KCL), предварительно расщепленных рестриктазами NheI и BsiWI для конструирования векторов для экспрессии легких цепей h#11B7-T15L и h#11B7-T18L. Полученные экспрессионные векторы были обозначены как "pEF6KCL/h#11B7-T15L" или "pEF6KCL/h#11B7-T18L", и вставка каждого экспрессионного вектора представлена нуклеотидной последовательностью SEQ ID NO:144 или 145 из Списка Последовательностей соответственно.

b) Конструирование векторов для экспрессии тяжелых цепей h#11B7-T11H и h#11B7-T12H

Каждая ДНК, содержащая ген, кодирующий вариабельный участок тяжелой цепи h#11B7-T11Н или h#11B7-T12H (Фигура 32В), представленный аминокислотами Nos. от 20 до 132 последовательностей SEQ ID NO: 150 или 151 соответственно, Списка Последовательностей, была синтезирована (MBL Medical & Biological Laboratories Co., Ltd, Artificial Gene Synthesis Service) и расщеплена эндонуклеазой рестрикции BlpI. Полученные фрагменты ДНК были по отдельности встроены в сайты универсальных векторов для экспрессии тяжелых цепей гуманизированных антител (pEF1/FCCU-1), предварительно расщепленных эндонуклеазой рестрикции BlpI для конструирования векторов для экспрессии тяжелых цепей h#11B7-T11H и h#11B7-T12H. Полученные экспрессионные векторы были обозначены как "pEF1/FCCU/h#11B7-T11H" или "pEF1/FCCU/h#11B7-T12H", и вставка каждого экспрессионного вектора представлена нуклеотидной последовательностью SEQ ID NO:148 или 149, из Списка Последовательностей соответственно.

Пример 22: Получение гуманизированного антитела из моноклонального антитела крысы #11В7 против AXL человека

a) Получение гуманизированного антитела

Смотри а) в Примере 10.

b) Очистка гуманизированного антитела

Культуральный супернатант, полученный в предшествующем параграфе а), был очищен аффинной хроматографией на колонке с Протеином А. Культуральный супернатант в количестве 100 мл помещали в колбу с крышкой объемом 500 мл, в которую вносили 1 мл суспензии MabSelect SuRe (GE Healthcare Bio-science Ltd.) (50% суспензия), уравновешенной PBS. Смесь оставляли на ночь при перемешивании при 100 об/мин в инкубаторе при 10°С. Смесь Культуральный супернатант клеток FreeStyle 293-F/суспензия MabSelect SuRe вносили в пустую 5 мл колонку Zeba Spin Column, (PIERCE). После внесения всего носителя в колонку, колонку промывали 10 мл 1 М NaCl. После этого был пропущен 1 мл 1 М раствора аргинина (рН 4,0) для сбора фракций, содержащих антитела. Фракции вносили в центрифужные пробирки Centrifugal Filter Device (Amicon Ultra-4, отсечение по молекулярному весу: 50 кДа, Millipore Corp.), заменяли раствор на цитратный буфер и доводили объем до 200 мкл для получения очищенных образцов.

Гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T15L и pEF1/FCCU/h#11B7-T11H, было обозначено как "h#11B7-Т28"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T18L и pEF1/FCCU/h#11B7-THH, было обозначено как "h#11B7-Т29"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T15L и pEF1/FCCU/h#11B7-T12H, было обозначено как "h#11B7-Т30"; гуманизированное антитело #11В7, полученное комбинацией между pEF6KCL/h#11B7-T18L и pEF1/FCCU/h#11B7-T12H, было обозначено как "h#11B7-Т31".

Таблица 2
h#11B7 плазмида Н плазмида L
h#11B7-T28 pEF1/FCCU/h#11B7-T11H pEF6KCL/h#11B7-T15L
h#11B7-T29 pEF1/FCCU/h#11B7-T11H pEF6KCL/h#11B7-T18L
h#11B7-T30 pEF1/FCCU/h#11B7-T12H pEF6KCL/h#11B7-T15L
h#11B7-T31 pEF1/FCCU/h#11B7-T12H pEF6KCL/h#11B7-T18L

Пример 23: Определение сродства гуманизированного антитела моноклонального антитела крысы #11В7 против AXL человека к слитому белку AXL-Fc человека

Гуманизированные антитела от h#11B7-T28 до h#11B7-T31, полученные из моноклонального антитела крысы #11В7 против AXL человека, были оценены по их сродству к AXL-Fc человека описанным ниже способом. AXL-Fc человека (производство R&D Systems, #154-AL) был растворен в PBS до концентрации 1 мкг/мл. После этого данный раствор вносили по 100 мкл/лунку в планшет Immuno Plate (производство Nalge Nunc International K.K., #437111) и инкубировали в течение ночи при 4°С для адсорбции белка на планшете. На следующий день лунки промывали 5 раз раствором PBS-T (PBS и 0,05% (по объему) Tween 20). После этого добавляли раствор, содержащий обезжиренное молоко (производство Morinaga Milk Industry Co., Ltd.), разведенное до 5% буфером PBS, в количестве 100 мкл/лунку и выдерживали при комнатной температуре в течение 2 часов. Растворы из лунок удаляли и промывали лунки 5 раз раствором PBS-T. После этого очищенные гуманизированные антитела от Т28 до Т31, полученные из моноклонального антитела крысы #11В7 против AXL человека в Примере 10, по отдельности разводили до конечной концентрации от 1 мкг/мл до 0,00256 нг/мл (серии 5-кратных разведений) в растворе PBS, содержащем 0,5% обезжиренного молока. Затем этот раствор вносили в лунки в количестве 100 мкл/лунку и оставляли при комнатной температуре на 2 часа. В данном эксперименте концентрация каждого антитела определялась, как описано в Примере 15. Лунки промывали 5 раз раствором PBS-T. После этого добавляли конъюгированный с щелочной фосфатазой AffiniPure IgG козы против антител человека (производство Jackson ImmunoResearch Laboratories, Inc., #109-055-097), разведенный в 2500 раз раствором TBS-T (TBS и 0,05% (по объему) Tween 20) в количестве 100 мкл/лунку и оставляли при комнатной температуре на 1 час. После этого растворы из лунок удаляли и промывали лунки 5 раз раствором TBS-T. После этого добавляли раствор флуоресцентного субстрата (производство Roche Diagnostics K.K., #11681982001) в количестве 100 мкл/лунку для проведения флуоресцентной реакции. Интенсивность флуоресценции в планшетах с адсорбированным AXL-Fc человека измеряли через 15 минут после добавления раствора флуоресцентного субстрата с использованием прибора SpectraMax M5 (производство Molecular Devices Corp.). В результате было установлено, что гуманизированные моноклональные антитела крысы против AXL человека от #11В7-Т28 до h#11В7-Т31 имеют связывающую активность, которая почти равна таковой химерного антитела человека к белку AXL-Fc человека, зависимым от концентрации антител образом (Фигуры 19 и 33).

Пример 24: Анализ гуманизированных антител, полученных из моноклонального антитела крысы #11В7 против AXL человека, методом ВЭЖХ

Концентрация белка гуманизированных антител от h#11B7-T28 до h#11B7-T31, полученных из моноклонального антитела крысы #11В7 против AXL человека, была определена методом, описанным ниже. Образцы каждого гуманизированного антитела инъецировали в колонку для эксклюзионной хроматографии (Tosoh SW 3000XL) и определяли концентрацию белка по данным ВЭЖХ (Agilent 1200 SL) по площади пика и коэффициенту поглощения для каждого антитела, используя в качестве стандарта образец tigatuzumab, гуманизированного моноклонального антитела типа IgG1 против DR5 человека. Концентрацию стандартного образца антитела tigatuzumab определяли методом прямого измерения поглощения, как описано в Примере 15. Результаты просуммированы на Фигуре 34.

Пример 25: Измерение термостабильности гуманизированных антител с использованием дифференциальной сканирующей калориметрии (differential scanning calorimetry, DSC)

Один из индексов для сравнения свойств антител может включать стабильность антител. Примеры индекса для стабильности антител могут включать термостабильность.

Антитела, имеющие низкую среднюю точку термоденатурации (Тm) с высокой вероятностью будут денатурировать. Денатурированные антитела имеют склонность к агрегации и также, как считается, обладают повышенной антигенностью. Напротив, антитела, имеющие высокую Тm, менее склонны к денатурации (разворачиванию) или инактивации и могут быть приготовлены в виде растворимых композиций, которые могут стабильно храниться в течение длительного времени.

Дифференциальная сканирующая калориметрия (DSC) является методом, который позволяет быстро и аккуратно измерить Тm, которая является хорошим показателем относительной структурной стабильности белков. Значения Тm могут быть измерены с использованием DSC и эти измеренные значения могут сравниваться для определения различий в термостабильности среди данных белков.

Была измерена термостабильность антител: h#11B7-T1, h#11B7-T2, h#11B7-T3, h#11B7-T4, h#11B7-T5, h#11B7-T6, h#11B7-T7, h#11B7-T8, h#11B7-T9, h#11B7-T10, h#11B7-T11, h#11B7-T12, h#11B7-T13, h#11B7-T14, h#11B7-T15, h#11B7-T16, h#11B7-T17, h#11B7-T18, #11B7-T19, h#11B7-T20, h#11B7-T21, h#11B7-T22, h#11B7-T23, h#11B7-T24, h#11B7-T25, h#11B7-T26, h#11B7-T27, h#11B7-T28, h#11B7-T29, h#11B7-Т30, h#11B7-T31 и химерного антитела 11В7.

Концентрация этих образцов была доведена до 0,5 мг/мл (раствор CBS), и аликвоты по 400 мкл были использованы в качестве растворов образцов для измерения DSC. Измерение DSC проводили в следующих условиях: исходная температура: 20°С, конечная температура: 100°С, скорость роста температуры: 60°С/1 час и время фильтрации: 10 секунд. В качестве раствора сравнения использовался раствор CBS. В качестве прибора для проведения DSC использовали VP-Capillary DSC Platform, производство MicroCal Inc., США. Коррекцию базовой линии проводили путем вычитания базовой линии (кривая сканирования раствора сравнения в измерительной ячейке) из кривых сканирования, полученных для растворов образцов.

Фигура 35(1) показывает термограмму h#11B7-T1; Фигура 35(2) показывает термограмму h#11B7-T2; Фигура 35(3) показывает термограмму h#11B7-T3; Фигура 35(4) показывает термограмму h#11B7-T4; Фигура 35(5) показывает термограмму h#11B7-T5; Фигура 35(6) показывает термограмму h#11B7-T6; Фигура 35(7) показывает термограмму h#11B7-T7; Фигура 35(8) показывает термограмму h#11B7-Т8; Фигура 35(9) показывает термограмму h#11B7-T9; Фигура 35(10) показывает термограмму h#11B7-T10; Фигура 35(11) показывает термограмму h#11B7-T11;

Фигура 35(12) показывает термограмму h#11B7-T12; Фигура 35(13) показывает термограмму h#11B7-T13; Фигура 35(14) показывает термограмму h#11B7-T14;

Фигура 35(15) показывает термограмму h#11B7-T15; Фигура 35(16) показывает термограмму h#11B7-T16; Фигура 35(17) показывает термограмму h#11B7-T17;

Фигура 35(18) показывает термограмму h#11B7-T18; Фигура 35(19) показывает термограмму h#11B7-T19; Фигура 35(20) показывает термограмму h#11В7-Т20;

Фигура 35(21) показывает термограмму h#11B7-T21; Фигура 35(22) показывает термограмму h#11B7-T22; Фигура 35(23) показывает термограмму h#11B7-T23;

Фигура 35(24) показывает термограмму h#11B7-T24; Фигура 35(25) показывает термограмму h#11B7-T25; Фигура 35(26) показывает термограмму h#11B7-T26;

Фигура 35(27) показывает термограмму h#11B7-T27; Фигура 35(28) показывает термограмму h#11B7-T28; Фигура 35(29) показывает термограмму h#11B7-T29;

Фигура 35(30) показывает термограмму h#11B7-T30; Фигура 35(31) показывает термограмму h#11B7-T31; и Фигура 35(32) показывает термограмму химерного антитела h#11B7.

В этом контексте значение вершины пика на всей термограмме было определено как средняя точка термоденатурации Тm участка Fab. В результате этого измерения установлено, что h#11B7-T1 имело Тm 71,6°С; h#11B7-T2 имело Тm 77,2°C; h#11B7-T3 имело Tm 73,0°C; h#11B7-T4 имело Tm 70,2°C; h#11B7-T5 имело Tm 73,1°C; h#11B7-T6 имело Tm 79,0°C; h#11B7-T7 имело Tm 76,5°C; h#11B7-T8 имело Tm 83,5°C; h#11B7-T9 имело Tm 82,5°C; h#11B7-T10 имело Tm 77,4°C; h#11В7-Т11 имело Tm 83,5°C; h#11B7-T12 имело Tm 76,6°C; h#11B7-T13 имело Tm 77,6°C; h#11B7-T14 имело Tm 75,8°C; h#11B7-T15 имело Tm 83,1°C; h#11B7-T16 имело Tm 82,2°C; h#11B7-T17 имело Tm 76,6°C; h#11B7-T18 имело Tm 83,0°C; h#11B7-T19 имело Tm 75,9°C; h#11B7-T20 имело Tm 76,9°C; h#11B7-T21 имело Tm 76,6°C; h#11B7-T22 имело Tm 83,6°C; h#11B7-T23 имело Tm 83,0°C; h#11B7-T24 имело Tm 77,6°C; h#11B7-T25 имело Tm 83,9°C; h#11B7-T26 имело Tm 76,9°C; h#11B7-T27 имело Tm 77,9°C; h#11B7-T28 имело Tm 77,4°C; h#11B7-T29 имело Tm 77,4°C; h#11B7-T30 имело Tm 77,8°C; h#11B7-T31 имело Tm 77,9°C; и химерное антитело h#11B7 имело Tm 73,1°C.

Пример 26. Гуманизированные антитела 11В7 против AXL настоящего изобретения ингибируют лиганд-индуцируемое фосфорилирование AXL in vitro, как показано методом ELISA

Белок, кодируемый геном 6 специфической задержки пролиферации, Gas6, представляет собой природный лиганд рецепторной тирозинкиназы AXL. Связывание Gas6 с AXL приводит к активации рецептора, что отражается в увеличенных уровнях фосфорилирования рецепторной тирозинкиназы. Были проведены эксперименты ELISA для оценки способности гуманизированных антител против AXL 11B7-T5 и 11В7-Т6, а также 11В7-Т6-производных - 11В7-Т11, 11В7-Т23 и 11В7-Т25 настоящего изобретения подавлять Gas6-индуцируемое фосфорилирование, и, следовательно, активацию рецепторной тирозинкиназы AXL.

Вкратце, в день 1 клетки в количестве 3×104 на лунку были высеяны в нормальную среду роста в плоскодонные 96-луночные планшеты. На следующий день среда роста была заменена на бессывороточную среду для того, чтобы клетки голодали в течение 24 часов. Также через день черные 96-луночные планшеты Maxi-Sorp (Nunc) были покрыты антителами мыши 4G10 против фосфотирозина в концентрации 2 мкг/мл PBS при 4°С. В день 3 раствор антител 4G10 был удален, и лунки Maxi-Sorp были заблокированы блокирующим буфером (PBS, 0,5% БСА), по меньшей мере, в течение 4 часов при комнатной температуре. Параллельно с этим клетки либо не обрабатывали, либо преинкубировали с 10 мкг/мл контрольного антитела Gammagard (Baxter), а также гуманизированных антител h#11В7-Т5, h#11B7-T6, h#11B7-T11, h#11B7-T23 и h#11B7-Т25 против AXL в течение 1 часа при 37°С, после чего обрабатывали или не обрабатывали 400 нг/мл Gas6 (R&D Systems) в течение 15 минут при 37°С. После этого среду удаляли и лизировали клетки в 110 мкл лизирующего буфера/лунку (50 мМ HEPES, рН 7,5, 150 мМ NaCl, 1 мМ ЭДТА, 10% глицерин и 1% Тритон Х-100) с добавлением ингибиторов фосфатаз и протеаз (10 мМ Nа4Р2O7, 1 мМ фенилметилсульфонилфторид, 1 мМ ортованадат, 1 мМ NaF и 0,5% апротинин) в течение 30 мин на льду. В это время удаляли блокирующий буфер, и планшеты Maxi-Sorp промывали 6 раз буфером для промывки (PBS, 0,05% Tween 20), после чего вносили 100 мкл клеточных лизатов и инкубировали в течение ночи при 4°С. После того, как планшеты промыли 6 раз буфером для промывки в день 4, лунки инкубировали с биотинилированным антителом крысы 12В7 против AXL в концентрации 0,125 мкг/мл в буфере для разведения (20 мМ Tris, 50 мМ NaCl, рН 7,3, 0,05% Tween 20, 0,1% БСА) в течение 2 часов при комнатной температуре. Планшеты промывали 6 раз буфером для промывки и в каждую лунку добавляли АР-конъюгированный стрептавидин (Chemicon #SA110), разведенный 1:20000 в буфере для разведения, и инкубировали 30 минут при комнатной температуре. После этого лунки промывали 6 раз буфером для промывки и добавляли в них раствор субстрата AttoPhos (Roche #11681982). С использованием флуориметра SpectraMax-GeminiEM plate reader (Molecular Devices) регистрировали флуоресценцию в каждой лунке при длине волны возбуждающего света 430 нм и длине волны испускаемого света 580 нм.

Фигура 37 показывает репрезентативные результаты этого эксперимента для клеток рака молочной железы Hs578T (вверху) и клеток рака легких NCI-H292 (внизу). По сравнению с контрольным антителом Gammagard, гуманизированные антитела против AXL 11В7-Т5, 11В7-Т6, 11В7-Т11, 11В7-Т23 и 11В7-Т25 настоящего изобретения достоверно снижают Gas6-опосредуемую активацию AXL в обеих линиях клеток, что видно по сниженным уровням фосфорилирования тирозина AXL в Gas6-стимулированных клетках по сравнению с соответствующими нестимулированными клетками.

Пример 27. Гуманизированные антитела 11В7 против AXL настоящего изобретения ингибируют лиганд-индуцируемое фосфорилирование АКТ in vitro, как показано методом ELISA

Кроме того, были проведены эксперименты ELISA для исследования вопроса, способны ли гуманизированные антитела против AXL 11В7-Т5 и 11В7-Т6, а также 11В7-Т6-производные 11В7-Т11, 11В7-Т23 и 11В7-Т25 настоящего изобретения блокировать лиганд Gas6-опосредуемую активацию АКТ-киназы. Gas6-опосредуемая активация АКТ-киназы определялась по увеличению фосфорилирования белка (Ser473).

Вкратце, в день 1 клетки в количестве 2×104 на лунку высевались в плоскодонные 96-луночные планшеты. На следующий день нормальная среда роста была заменена на бессывороточную среду для того, чтобы клетки голодали в течение 36 часов. После этого клетки либо не обрабатывали, либо проинкубировали с 10 мкг/мл контрольного антитела Gammagard (Baxter), а также гуманизированных антител 11В7-Т5, 11В7-Т6, 11В7-Т11, 11В7-Т23 и 11В7-Т25 против AXL в течение 1 часа при 37°С, после чего обрабатывали или не обрабатывали 400 нг/мл Gas6 (R&D Systems) в течение 15 минут при 37°С. После этого среду удаляли, и клетки фиксировали 4% формальдегидом в PBS (рН 7,5) в течение 30 мин при комнатной температуре. Раствор формальдегида удаляли и клетки дважды промывали буфером для промывки (PBS, 0,1% Tween 20). Клетки тушили 1% H2O2, 0,1% NaN3 в буфере для промывки и инкубировали 20 минут при комнатной температуре. После этого раствор для тушения удаляли, и клетки дважды промывали в буфере для промывки и блокировали PBS, 0,5% БСА в течение 4 часов при комнатной температуре. Были добавлены первичные антитела против фосфо-АКТ (Ser473) (поликлональные кролика, Cell Signaling #9271), разведенные 1:500 в PBS, 0,5% БСА, 5 мМ ЭДТА, и проведена инкубация в течение ночи при 4°С. В день 4 раствор антител удаляли и планшеты промывали 3 раза буфером для промывания. После этого в каждую лунку добавляли HRP-конъюгированные вторичные анти-кроличьи антитела (Dianova #111-036-045), разведенные 1:2500 в PBS, 0,5% БСА, и инкубировали 1,5 часа при комнатной температуре. Планшет промывали 3 раза буфером для промывки и два раза PBS по 5 минут каждый раз. После этого был добавлен тетраметилбензидин (ТМВ, Calbiochem), после чего регистрировали поглощение при 620 нм. Реакцию останавливали добавлением 100 мкл 250 нМ НСl и измеряли поглощение при 450 нм при длине волны сравнения 620 нм с использованием прибора Vmax plate reader (Thermo Lab Systems).

Фигура 38 показывает репрезентативные результаты этого эксперимента для клеток рака молочной железы Hs578T (вверху) и клеток рака легких NCI-H292 (внизу). По сравнению с контрольным антителом Gammagard, гуманизированные антитела против AXL 11В7-Т5, 11В7-Т6, 11В7-Т11, 11В7-Т23 и 11В7-Т25 настоящего изобретения были способны блокировать или снижать Gas6-oпocpeдyeмyю активацию АКТ-киназы в обеих линиях клеток, что видно по сниженным уровням фосфорилирования АКТ (Ser473) в Gas6-стимулированных клетках по сравнению с соответствующими нестимулированными клетками.

Пример 28: Гуманизированные антитела 11В7 против AXL настоящего изобретения индуцируют интернализацию рецептора AXL

AXL идентифицирован как фактор, который может влиять на миграцию и выживание опухолевых клеток через опосредуемый AXL путь передачи сигнала, включающий сигнальный путь АКТ, о котором говорилось выше. Таким образом, если AXL будет эффективно удаляться с поверхности/мембраны клеток за счет интернализации рецептора, клеточный сигнальный путь и, таким образом, сохранение клеток, а также рост опухолей и метастазирование могут быть, в конечном счете, снижены или подавлены.

Для исследования вопроса, способны ли гуманизированные антитела против AXL 11В7-Т5 и 11В7-Т6, а также 11В7-Т6-производные 11В7-Т11, 11В7-Т23 и 11В7-Т25 настоящего изобретения индуцировать ускоренный эндоцитоз AXL, сравнивали относительное количество молекул AXL на клеточной поверхности через 2, 4, 6 и 20 часов инкубации клеток с гуманизированными антителами против AXL настоящего изобретения.

Вкратце, в день 1 клетки в количестве 2×105 высевали в нормальную среду роста в 6-луночные чашки и оставляли расти в течение ночи. На следующий день среду удаляли и клетки промывали бессывороточной средой. После этого клетки либо не обрабатывали, либо инкубировали с 10 мкг/мл контрольного антитела Gammagard (Baxter), а также гуманизированных антител против AXL 11В7-Т5, 11В7-Т6, 11В7-Т11, 11В7-Т23 и 11В7-Т25 в бессывороточной среде, обогащенной 10 мМ HEPES в течение 40 минут при 4°С. После этого клетки выдерживали при 37°С в течение указанных периодов времени для обеспечения протекания интернализации. После этого клетки снимали с подложки 10 мМ ЭДТА и ресуспендировали в 100 мкл буфера для промывки (PBS, 3% FCS). Для последующей фиксации по каплям добавляли 100 мкл 2% параформальдегида в PBS при интенсивном встряхивании клеток. Через 20 минут инкубации при комнатной температуре клетки промывали и ресуспендировали в 100 мкл буфера для промывки для хранения в холодильнике, пока не были собраны все образцы. Для конечного прокрашивания клеток для определения уровней экспрессии AXL образцы переносили в круглодонные 96-луночные планшеты и инкубировали с 3 мкг/мл mAb 2A1 крысы против AXL в буфере для промывки в течение 1 часа при 4°С. Клетки дважды промывали буфером для промывки, инкубировали с вторичными антителами IgG-PE осла против антител крысы (Dianova), разведенными 1:100, в течение 60 минут при 4°С, снова дважды промывали буфером для промывки и анализировали методом FACS (Beckman Coulter EPICS, EXP032).

Репрезентативные данные на Фигуре 38 показывают, что обработка клеток рака молочной железы Hs578T гуманизированными антителами против AXL 11В7-Т5, 11В7-Т6, 11В7-Т11, 11В7-Т23 и 11В7-Т25 приводит к интернализации рецептора AXL, тогда как контрольное антитело Gammagard не обладает таким действием. Показаны относительные уровни экспрессии AXL в %, определенные как средние уровни интенсивности флуоресценции образцов, обработанных mAb против AXL, по отношению к необработанным образцам, за соответствующие периоды обработки.

Пример 29. Гуманизированные антитела 11В7 против AXL настоящего изобретения ингибируют стимулируемый сфероидами клеточный ангиогенез in vitro

AXL представляет собой ключевой регулятор множественного проявления ангиогенеза, включая миграцию и пролиферацию эндотелиальных клеток и формирование сосудов т vitro (Holland et al., Cancer Res: 65, 9294-9303, 2005). Таким образом, гуманизированные антитела против AXL 11В7-Т5 и 11В7-Т6, а также 11В7-Т6-производные - 11В7-Т11, 11В7-Т23 и 11В7-Т25 настоящего изобретения были протестированы на ингибиторное действие на Gas6-индуцируемое прорастание сосудов в сфероидах HUVEC. Эксперименты проводились по модифицированному методу, изначально опубликованному в литературе (Korff and Augustin: J Cell Sci 112: 3249-58, 1999).

Вкратце, сфероиды были приготовлены, как описано (Korff and Augustin: J Cell Biol 143: 1341-52, 1998), путем пипетирования 500 эндотелиальных клеток пупочной вены человека (HUVEC) в комбинации с VEGF-A [25 нг/мл] в висящей капле на пластиковых чашках для обеспечения агрегации сфероидов в течение ночи. После этого сфероиды HUVEC в количестве 50 штук высевали в 0,9 мл раствора коллагена (2 мг/мл) и переносили пипеткой в индивидуальные лунки 24-луночного планшета для обеспечения полимеризации. Через 30 минут снижающиеся концентрации контрольного антитела Gammagard (Baxter) или гуманизированных антител против AXL 11В7-Т5, 11В7-Т6, 11В7-Tll, 11В7-Т23 и 11В7-Т25 (1×10-6 М, 3×10-7 М, 1×10-7 М, 3×10-8 М, 1×10-8 М, 3×10-9 М, 1×10-10 М) вместе с GAS6 человека (R&D Systems) наносили пипеткой по 100 мкл из 10-кратного рабочего разведения на вершину полимеризованного геля (конечная концентрация GAS6 человека составляла 1 мкг/мл). Планшеты инкубировали при 37°С в течение 24 часов и фиксировали добавлением 4% Roti-Histofix (Roth, Karlsruhe, Germany). Интенсивность прорастания сфероидов HUVEC количественно определялась с помощью системы анализа изображений, которая определяет общую длину проростков на один сфероид, с использованием инвертированного микроскопа и программы анализа цифрового изображения Analysis 3.2 (Soft imaging system, Munster, Germany). Среднее значение общей длины проростков в 10 случайным образом выбранных сфероидах было взято в качестве одной экспериментальной точки.

Фигура 39 показывает репрезентативные результаты этого эксперимента.

1. Моноклональное гуманизированное антитело, которое специфически связывает внеклеточный домен AXL и, по меньшей мере, частично ингибирует активность AXL, которое содержит аминокислотную последовательность тяжелой цепи, выбираемую из группы, включающей последовательности от SEQ ID NO: 67 до SEQ ID NO: 72, или, по меньшей мере, вариабельный домен этих последовательностей, или аминокислотную последовательность, имеющую, по меньшей мере, 90% идентичности с этими последовательностями;
или аминокислотную последовательность вариабельного домена тяжелой цепи, выбираемую из группы, включающей последовательности от SEQ ID NO: 114 до SEQ ID NO: 120, или аминокислотную последовательность, имеющую, по меньшей мере, 90% идентичности с этими последовательностями,
и аминокислотную последовательность легкой цепи, выбираемую из группы, включающей последовательности от SEQ ID NO: 55 до SEQ ID NO: 60, или, по меньшей мере, вариабельный домен этих последовательностей, или аминокислотную последовательность, имеющую, по меньшей мере, 90% идентичности с этими последовательностями;
или аминокислотную последовательность вариабельного домена легкой цепи, выбираемую из группы, включающей последовательности от SEQ ID NO: 83 до SEQ ID NO: 113, или аминокислотную последовательность, имеющую, по меньшей мере, 90% идентичности с этими последовательностями;
или фрагмент этих последовательностей, распознающий тот же самый эпитоп на внеклеточном домене AXL.

2. Моноклональное гуманизированное антитело по п. 1, которое снижает и/или блокирует опосредуемую AXL передачу сигнала, фосфорилирование AXL, пролиферацию клеток, ангиогенез, миграцию клеток, метастазирование опухолей и/или опосредуемый AXL анти-апоптоз, лиганд-индуцируемое фосфорилирование сигнальных молекул, находящихся ниже в опосредуемом AXL сигнальном каскаде, таких как ERK1/2, АКТ, GSK-3β, TSC2, mTOR и/или S6K1.

3. Моноклональное гуманизированное антитело по любому одному из пп. 1-2, которое является производным химерного анти-AXL антитела 11D5 (SEQ ID NO: 137, 138) и которое содержит, по меньшей мере, одну мутацию в каркасном участке, по меньшей мере, одного вариабельного домена 11D5.

4. Моноклональное гуманизированное антитело по п. 1, выбираемое из группы гуманизированных антител h#11D5, выбираемых из группы, состоящей из h#11D5-T1, h#11D5-T2, h#11D5-T3, h#11D5-T4, h#11D5-T5 или h#11D5-T6.

5. Молекула изолированной нуклеиновой кислоты, кодирующая антитело, которое связывает внеклеточный домен AXL и, по меньшей мере, частично ингибирует активность AXL, выбираемая из группы, состоящей из:
(a) последовательности нуклеиновой кислоты, кодирующей моноклональное антитело, фрагмент антитела или его производное по любому из пп. 1-4,
(b) последовательности нуклеиновой кислоты, как показано в одной из последовательностей SEQ ID NOs., выбираемой из группы, включающей последовательности от SEQ ID NO: 5 до SEQ ID NO: 17, от SEQ ID NO: 31 до SEQ ID NO: 39, от SEQ ID NO: 49 до SEQ ID NO: 54 и от SEQ ID NO: 61 до SEQ ID NO: 66, и
(c) последовательности нуклеиновой кислоты, кодирующей полипептид, выбираемый из группы, включающей последовательности от SEQ ID NO: 18 до SEQ ID NO: 30, от SEQ ID NO: 40 до SEQ ID NO: 48, от SEQ ID NO: 55 до SEQ ID NO: 60, от SEQ ID NO: 67 до SEQ ID NO: 72, от SEQ ID NO: 73 до SEQ ID NO: 120 и от SEQ ID NO: 121 до SEQ ID NO: 132.

6. Молекула изолированной нуклеиновой кислоты для гибридизации с молекулой нуклеиновой кислоты по п. 5, выбираемая из группы, состоящей из:
(d) нуклеиновой кислоты, комплементарной любой из последовательностей, определенных в п. 5, или
(e) последовательности нуклеиновой кислоты, способной гибридизоваться с молекулой нуклеиновой кислоты по п. 5 или нуклеиновой кислотой (d) в жестких условиях и кодирующей полипептид, где антитело или его функциональный фрагмент, включающие указанный полипептид, связываются с внеклеточным доменом AXL.

7. Экспрессионный вектор, включающий последовательность нуклеиновой кислоты по п. 5 или 6.

8. Клетка-хозяин, продуцирующая антитело по пп. 1-4 и содержащая вектор по п. 7.

9. Способ производства моноклонального гуманизированного антитела по любому одному из пп. 1-4, включающий стадию культивирования клетки-хозяина по п. 8 и извлечения полипептидов антител из культурального супернатанта.

10. Фармацевтическая композиция, включающая моноклональное гуманизированное антитело по любому одному из пп. 1-4, в количестве 1 мкг - 100 мг на кг массы тела, для диагностики гиперпролиферативного заболевания, связанного с экспрессией, сверхэкспрессией и/или гиперактивностью AXL.

11. Фармацевтическая композиция, включающая моноклональное гуманизированное антитело по любому одному из пп. 1-4, в количестве 1 мкг - 100 мг на кг массы тела, для профилактики или лечения гиперпролиферативного заболевания, связанного с экспрессией, сверхэкспрессией и/или гиперактивностью AXL.

12. Фармацевтическая композиция по п. 10 или 11, где указанное гиперпролиферативное заболевание выбирается из группы, состоящей из рака молочной железы, рака легких и других видов рака, сопровождающихся экспрессией или сверхэкспрессией AXL и образованием метастазов опухоли.

13. Применение моноклонального гуманизированного антитела по любому одному из пп. 1-4 для диагностики, профилактики или лечения гиперпролиферативного заболевания, связанного с экспрессией, сверхэкспрессией и/или гиперактивностью AXL.

14. Применение моноклонального гуманизированного антитела по любому одному из пп. 1-4 для производства фармацевтической композиции для диагностики, профилактики или лечения гиперпролиферативного заболевания, связанного с экспрессией, сверхэкспрессией и/или гиперактивностью AXL.

15. Способ для диагностики состояния здоровья, связанного с экспрессией AXL, включающий контактирование образца с моноклональным гуманизированным антителом по любому одному из пп. 1-4, которое связано с метящей группой, и выявление присутствия AXL, где состояние здоровья представляет собой гиперпролиферативное заболевание, связанное с экспрессией, сверхэкспрессией и/или гиперактивностью AXL.

16. Набор для получения медикамента для лечения заболеваний, связанных с экспрессией, сверхэкспрессией и/или гиперактивностью AXL, включающий моноклональное антитело по любому одному из пп. 1-4, молекулу нуклеиновой кислоты по п. 5 или 6 или экспрессирующий вектор по п. 7 и дополнительный антинеопластический агент.

17. Применение гуманизированного антитела против AXL по любому одному из пп. 1-4 для производства фармацевтической композиции для лечения рака, устойчивого к лекарствам.



 

Похожие патенты:

Настоящее изобретение относится к области биотехнологии и раскрывает группу гуманизированных рекомбинантных антител, специфически связывающихся с человеческим CDCP1.

Изобретение относится к области иммунологии. Представлены вариантные выделенные антитела 2.9D10, 2.7A4, 2.14H9 и 2.14H9-opti и их антигенсвязывающие фрагменты, которые специфически связывается с В7-Н1, где каждое антитело или его антигенсвязывающий фрагмент содержит набор из 6 CDR, последовательности которых представлены в описании.

Настоящее изобретение относится к области иммунологии. Предложено антитело и его антигенсвязывающий фрагмент, способные связываться с дельта-подобным лигандом 4 (DLL4) человека, в том числе в форме меченого антитела или его антигенсвязывающего фрагмента, конструкции с константным доменом иммуноглобулина, конъюгата с терапевтическим или цитотоксическим средством и в кристаллизованной форме.

Настоящее изобретение относится к области иммунологии. Предложено антитело против фракталкина (ФКН, CX3CL1) и его фракталкин-связывающий фрагмент, охарактеризованные последовательностями вариабельных доменов.

Изобретение относится к области иммунологии. Предложены выделенное антитело-антагонист против FGFR3 и его функциональный фрагмент, а также полинуклеотид, вектор экспрессии, клетка-хозяин и способ получения антитела против FGFR3 или его функционального фрагмента.

Изобретение относится к области биохимии, в частности к антителам к человеческому CSF-1R, способам их получения, фармацевтическим композициям, содержащим указанные антитела, и вариантам их применения.

Изобретение относится к области иммунологии. Представлено выделенное антитело или его антиген-связывающая часть, содержащие вариабельную область легкой цепи и вариабельную область тяжелой цепи с аминокислотными последовательностями, раскрытыми в описании, или с аминокислотными последовательностями вариабельных областей, по меньшей мере на 90% идентичными указанным последовательностям, где вариабельная область легкой цепи содержит CDR1: RASESVEYYGTSLMQ, CDR2: GASNVES и CDR3: QQSRKLPWT, и вариабельная область тяжелой цепи содержит CDR1: TYGIN, CDR2: WIYPRDGSTNFNENFKD и CDR3: LTGGTFLDY, где антитело или его антиген-связывающая часть специфически связывают внеклеточный домен Toll-подобного рецептора 2 и являются антагонистом функции Toll-подобного рецептора 2.

Изобретение относится к области биотехнологии и иммунологии. Описаны выделенное моноклональное антитело и его антиген-связывающий фрагмент, связывающие hNKG2D и поперечно сшивающие не более двух димеров hNKG2D при добавлении к NK или Т клеткам, экспрессирующим NKG2D, включающие: CDR1 тяжелой цепи, содержащий SYYWS; CDR2 тяжелой цепи, содержащий HISYSGSANYNPSLKS; и CDR3 тяжелой цепи, содержащий WDDAFNI; и CDR1 легкой цепи, содержащий RASQSVSSSYLA; CDR2 легкой цепи, содержащий GASSRAT; и CDR3 легкой цепи, содержащий QQYGSSPWT.

Изобретение относится к биохимии. Раскрыто антитело человека, которое специфично связывается с OX40 человека.

Изобретение относится к биохимии. Описано моноклональное антитело, которое специфически связывает TLR3 полипептид, где указанное антитело представляет собой тетрамер, состоящий из двух идентичных пар полипептидных цепей, причем каждая пара имеет одну легкую и одну тяжелую цепь изотипа IgG, и где указанное антитело ингибирует передачу сигнала TLR3 полипептидом без блокирования связывания дсРНК TLR3 лиганда с TLR3 полипептидом.

Настоящее изобретение относится к области биохимии. Предложены способы скрининга антитела IgG, обладающего повышенной способностью элиминировать антиген в плазме, основанные на отборе IgG, антигенсвязывающая активность которого при рН от 6,7 до 10,0 выше антигенсвязывающей активности при рН от 4,0 до 6,5. Антитела IgG, обладающие более слабой антигенсвязывающей активностью при рН внутри ранних эндосом, чем при рН в плазме, способны к многократному связыванию с антигеном, имеют длительный период полужизни в плазме и увеличенные продолжительности периода времени, в течение которого они могут связываться с антигеном. Таким образом, антитела IgG, полученные способами по данному изобретению, обладают улучшенной фармакокинетикой и увеличенным числом раз связывания с антигеном in vivo. 4 н. и 5 з.п. ф-лы, 29 ил., 17 табл., 18 пр.

Изобретения относятся к области биохимии. Описана группа изобретений, включающая выделенное антитело или его фрагмент, связывающееся с нейропилином 1 (варианты), способ получения антитела или его фрагмента, выделенная нуклеиновая кислота, кодирующая вышеуказанное антитело или его фрагмент, клетка-хозяин для экспрессии вышеуказанного антитела или его фрагмента, иммуноконъюгат, содержащий антитело или его фрагмент, способ обнаружения нейропилина 1. В одном варианте антитело содержит HVR-H1 с аминокислотной последовательностью SEQ ID NO: 3, HVR-H2 с SEQ ID NO: 4, HVR-H3 с SEQ ID NO: 5, HVR-L1 с SEQ ID NO: 8, HVR-L2 с SEQ ID NO: 9, и HVR-L3 с SEQ ID NO: 10. В другом варианте антитело содержит последовательности VH SEQ ID NO: 2 и VL SEQ ID NO: 7. Изобретение расширяет арсенал антител, связывающихся с нейропилином 1 (NRP1). 7 н. и 5 з.п. ф-лы, 2 ил., 1 табл., 2 пр.

Изобретение относится к биотехнологии и иммунологии. Предложены варианты выделенного антитела или его фрагмента, которые специфично связываются с внеклеточным доменом CXCR5 человека. Описаны: фармацевтическая композиция, а также варианты способа лечения пациента, использующие указанные антитело или его фрагмент для лечения заболевания или состояния, вызванного или связанного с CXCR5 человека. Предложена выделенная кодирующая молекула нуклеиновой кислоты, экспрессионный вектор на ее основе и клетка-хозяин для экспрессии антитела или его фрагмента, содержащая указанный вектор. Использование изобретения обеспечивает новые антитела, которые специфично связываются с внеклеточным доменом CXCR5 и блокируют связывание лиганда CXCL13 c CXCR5 человека, что может найти применение в медицине для лечения болезней или нарушений, связанных или вызванных CXCR5. 7 н. и 14 з.п. ф-лы, 2 табл., 19 пр.

Изобретение относится к области биотехнологии и иммунологии и представляет собой способ изготовления биспецифического антитела, которое содержит: а) тяжелую цепь и легкую цепь первого антитела полной длины, которое специфически связывается с первым антигеном; и б) тяжелую цепь и легкую цепь второго антитела полной длины, которое специфически связывается со вторым антигеном, где N-конец тяжелой цепи связан с С-концом легкой цепи через пептидный линкер, причем каждый из СН3-домена тяжелой цепи антитела полной длины а) и СН3-домена тяжелой цепи антитела полной длины б) встречается на контактной поверхности, которая включает изменения в исходной контактной поверхности СН3-доменов антитела; где изменения в СН3-доменах тяжелых цепей представляют собой изменения типа «ключ-замок»; где указанный способ включает этапы: а) трансформации клетки-хозяина векторами, содержащими нуклеиновокислотные молекулы, кодирующие указанную молекулу биспецифического антитела, б) культивирования клетки-хозяина в условиях, обеспечивающих синтез указанной молекулы биспецифического антитела; и в) извлечения указанной молекулы биспецифического антитела из указанной культуры. Изобретение позволяет получать биспецифические антитела с указанной выше структурой с высоким выходом и чистотой. 16 з.п. ф-лы, 10 ил., 6 табл., 11 пр.

Изобретение относится к области иммунологии. Представлены вариантные выделенные анти-CXCR4-антитела 414H5, 515H7 и их антигенсвязывающие фрагменты, способные ингибировать активацию CXCR4, где каждое антитело или его антигенсвязывающий фрагмент содержит набор из 6 CDR, последовательности, которых представлены в описании. Описаны: нуклеиновая кислота, кодирующая указанное антитело, вектор для получения анти-CXCR4-антитела и клетка-хозяин, продуцирующая указанное антитело против CXCR4, трансфицированная указанным вектором. Предложен способ получения анти-CXCR4-антитела или его функционального фрагмента по настоящему изобретению, включающий: культивирование указанной клетки-хозяина в среде в соответствующих культуральных условиях; и выделение указанного антитела или одного из его функциональных фрагментов. Раскрыта фармацевтическая композиция, содержащая в качестве активного ингредиента указанное антитело или его функциональный фрагмент в эффективном количестве, а также эксципиент и/или фармацевтически приемлемый носитель. Изобретение позволяет получить антитела против CXCR4, модулирующие пространственную конформацию димеров CXCR4/CXCR4 и CXCR2/CXCR4 при раковых заболеваниях. 9 н. и 14 з.п. ф-лы, 23 ил., 5 табл., 24 пр.

Предложенное изобретение относится к области иммунологии. Предложено антитело против CXCR4 человека или его функциональный фрагмент, которые характенизуются тем, что содержат легкую и тяжелую цепи, содержащие по 3 соответствующих CDR. Описаны варианты нуклеиновых кислот для экспрессии антитела; вектор для экспрессии антитела на основе указанной НК, клетка-хозяин для получения антитела, содержащая указанный вектор, и способ получения антитела, использующий культивирование клетки. Раскрыта фармацевтическая композиция, способная связывать CXCR4 человека на основе антитела. Описан способ скрининга и/или идентификации молекул в качестве антивирусных средств-антагонистов CXCR4. Использование изобретения обеспечивает антитела, которые могут найти применение в терапии ВИЧ-инфекции. 7 н. и 6 з.п. ф-лы, 22 ил., 11 табл., 16 пр.

Группа изобретений относится к медицине, а именно к онкологии, и может быть использована для получения лекарственного средства для лечения рака. Для этого применяют нефукозилированное анти-CD20 антитело с количеством фукозы 60% или менее от общего количества олигосахаридов (сахаров) в положении Asn297 в комбинации с бендамустином. При этом раком является рак, экспрессирующий CD20, и указанное антитело включает аминокислотную последовательность вариабельной области тяжелой цепи (VH) SEQ ID NO: 7 и аминокислотную последовательность вариабельной области легкой цепи (VL) SEQ ID NO: 20, также предложен способ лечения рака, экспрессирующего CD20. Группа изобретений обеспечивает лечение рака у пациентов за счет синергетического действия комбинации нефукозилированного анти-CD20 антитела с бендамустином. 2 н. и 8 з.п. ф-лы, 3 табл., 1 ил.

Настоящее изобретение относится к области биотехнологии. Предложен способ идентификации антитела, которое специфически связывается с интересующим антигеном на клеточной поверхности, предусматривающий иммунизацию животного вектором экспрессии, кодирующим антиген клеточной поверхности; приведение в контакт клеток, содержащих на своей поверхности антитела и выделенных из животного, подвергнутого иммунизации, причем антитела связаны с первой сортируемой меткой, с клетками, экспрессирующими антиген, связанный со второй сортируемой меткой; определение специфического связывания с использованием клеточного сортера по наличию первой и второй сортируемой метки в клеточном комплексе; а также идентификацию участков, определяющих комплементарность с антигеном (CDR), у идентифицированного антитела и прививку CDR на каркасную область акцепторного антитела. Данное изобретение предполагает скрининг антител, специфичных в отношении мембраносвязанных антигенов, что может найти дальнейшее применение в разработке терапевтических и диагностических средств. 3 з.п. ф-лы, 8 ил., 5 табл., 5 пр.

Данное изобретение относится к области иммунологии. Предложено выделенное антитело или его фрагмент, которые связываются с Axl человека и охарактеризованные последовательностями гипервариабельных участков (CDR). Также рассмотрены: нуклеиновая кислота; клетка-хозяин и способ получения антитела или его фрагмента по изобретению. Кроме того, представлены: иммуноконъюгат, содержащий антитело или его фрагмент по изобретению и цитотоксическое средство; фармацевтический состав для нацеливания на патологические состояния, связанные с экспрессией и/или активностью каскадов передачи сигнала Axl; и применение антитела или его фрагмента по изобретению для получения лекарственных средств для лечения злокачественной опухоли и для ингибирования конститутивной активации Axl. Настоящее изобретение может найти дальнейшее применение в терапии заболеваний, связанных с Axl. 8 н. и 10 з.п. ф-лы, 12 ил., 1 табл.

Изобретение относится к области биотехнологии и иммунологии. Предложены новые противораковые антитела, которые связываются с рецептором “frizzled” человека. Также идентифицированы новые эпитопы в составе рецепторов “frizzled” человека, которые являются подходящими мишенями для противораковых агентов. Кроме того, предложены способы применения антител для ингибирования сигнального пути через Wnt и/или ингибирования роста опухоли. Предложенная группа изобретений может быть использована в медицине. 12 н. и 8 з.п.ф-лы, 46 ил., 15 табл., 25 пр.
Наверх