Антитела против cd20 и их применение



Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение
Антитела против cd20 и их применение

 


Владельцы патента RU 2573994:

ИММЬЮНОДЖЕН, ИНК (US)

Группа изобретений относится к антителам, специфически связывающим CD20, содержащим вариабельную область легкой цепи и вариабельную область тяжелой цепи, где CDR1, CDR2 и CDR3 указанной вариабельной области легкой цепи содержат аминокислотные последовательности SEQ ID NO: 17-19 или SEQ ID NO: 25-27 и где CDR1, CDR2 и CDR3 указанной вариабельной области тяжелой цепи содержат аминокислотные последовательности SEQ ID NO: 20-22 или SEQ ID NO: 28-30, их конъюгатам с цитотоксическими агентами, а также их применению в лечении аутоиммунных и воспалительных заболеваний, злокачественных новообразований. Антитела согласно группе изобретений обладают специфичностью, пониженной токсичностью, стабильностью и улучшенными физическими и функциональными свойствами в сравнении с известными терапевтическими агентами. 5 н. и 11 з.п. ф-лы, 36 ил., 1 табл., 20 пр.

 

Уровень техники

Под CD20 и изоформами CD20 («CD20») в общем понимаются трансмембранные белки группы тетраспанина, которые экспрессируются на поверхности В-клеток (Valentine et al., J. Biol. Chem., 264(19):11282-11287 (1989); Einfeld et al., EMBO J., 7(3):711-717 (1988)). CD20 экспрессируется большей частью В-клеток периферической крови, а также В-клетками различных лимфоидных тканей. Экспрессия CD20, как правило, происходит, начиная с ранних этапов пре-В-клеток и до этапа плазматической дифференциации клетки (Tedder et al., J. Immunol., 135(2):973-979 (1985)). CD20, как правило, не экспрессируется в гемопоэтических стволовых клетках, про-В-клетках, дифференцированных плазматических клетках, нелимфоидных тканях и т.п. Помимо экспрессии в нормальных В-клетках, CD20 экспрессируется в В-клеточных злокачественных опухолях, например, неходжкинской лимфоме (НХЛ) и при В-клеточном хроническом лимфолейкозе (ХЛЛ) (Anderson et al., Blood, 63(6): 1424-1433 (1984)), а также в В-клетках, вовлеченных в иммунные нарушения, аутоиммунные заболевания и воспалительные заболевания.

Хотя точная функция CD20 не ясна, предполагается, что CD20 связан с мобилизацией кальция и может работать как кальциевый канал (Tedder et al., J. Cell Biochem., 14D:195 (1990)). CD20 может быть вовлечен в активацию и дифференциацию В-клеток (Tedder et al., Eur. J. Immunol., 16(8):881-887 (1986)).

Из-за профиля экспрессии CD20 и наличия сведений о существовании антител против CD20, CD20 стал интересным для терапии антителами. В отрасли известно, что в общем антитела против CD20 классифицируются на основании их функциональных характеристик. К примеру, антитела I типа характеризуются способностью перемещать CD20 в компартменты липидных рафтов и, при химеризации, могут обуславливать комплементзависимую цитотоксичность («КЗЦ») (Deans JP, J Biol Chem 1998; 273: 344-8; Cragg MS, Blood 2003;101:1045-52; и Cragg MS Blood. 2004; 103:2738-2743). Антитела I типа, как правило, сами по себе не обладают эффективной про-апоптозной активностью, если они не являются перекрестно-сшитыми. Примерами антител I Типа, требующих перекрестное сшивание, являются ритуксимаб и 2F2 (Cragg et al., Blood, 101(3): 1045-1052 (2003); и Teeling et al., Blood, 104(6):1793-1800 (2004)). Напротив, антитела II типа не способны перемещать CD20 в липидные рафты. При химеризации антитела II типа проявляют ограниченную КЗЦ-активность. Антитела II типа характеризуются выраженной проапоптозной активностью. Примерами антител II типа являются В1 и GA101 (Cragg MS, Blood 2003; 101:1045-52; Cragg MS Blood. 2004; 103:2738-2743); и Umana et al., Blood, 108:72a, Abstract 229 (2006)). Антитела I и II типов могут опосредовать антителозависимую клеточно-опосредованную цитотоксичность (АЗКЦ).

Учитывая экспрессию CD20 в нежелательных клетках, например, В-клеточных лифомах, данный антиген полезен для нацеливания на вредные CD20-положительные клетки (например, клетки лимфомы). В сущности, подобное нацеливание сводится к следующему: антитела, специфические к поверхностному антигену В-клеток CD20 вводятся пациенту. Данные антитела против CD20 специфически связываются с антигеном CD20 нормальных и нежелательных (например, злокачественных и иммунореактивных) В-клеток; антитело, связанное с поверхностным антигеном CD20 может приводить к деструкции и уменьшению численности В-клеток.

Помимо этого, химические агенты или радиоактивные метки, способные разрушать клетки опухолей, экспрессирующие CD20, могут быть конъюгированы с антителом против CD20 для того, чтобы этот агент специфически доставлялся к неопластическим В-клеткам. Независимо от подхода, первичная цель заключается в уничтожении нежелательных клеток; специфический подход может определяться конкретным используемым антителом против CD20, и, таким образом, имеющиеся подходы для воздействия на антиген CD20 могут серьезно различаться. Антитело ритуксимаб (RITUXAN®) является созданным способом генетической инженерии химерным мышино-человеческим моноклональным антителом, направленным против CD20. Ритуксимаб это антитело, называемое «С2В8» в патенте США № 5736137 (Anderson et al.). Ритуксимаб в настоящее время одобрен для лечения рецидивирующей или рефракторной фолликулярной лимфомы (Leget et al., Curr. Opin. Oncol., 10:548-551 (1998)). Согласно отчетам при еженедельных инфузиях ритуксимаба достигается 48% ответ. Тем не менее, многие пациенты не откликаются на терапию ритуксимабом, а у респондентов, принимающих ритуксимаб, впоследствии может развиться рецидив и резистентность к терапии ритуксимабом. Рецидивирование и резистентность, к примеру, к доступным в настоящее время терапевтическим способам, обусловливает необходимость в новых агентах и терапевтических способах, направленных на воздействие на CD20.

Из-за ограничений, свойственных доступным антителам, было разработано новое поколение лекарственных средств на основе антител против CD20, предназначенных для улучшения специфических функциональных аспектов ритуксимаба. К примеру, для офатумумаба, человеческого моноклонального антитела 2F2, сообщалось об увеличении КЗЦ-активности in vitro CDC, особенно в клетках с пониженной плотностью антигена CD20 (Teeling et al., J. Immunol., 177(1):362-371 (2006)). Для афутузумаба или GA101 сообщалось о малозначительном увеличении проапоптозной активности в сравнении с ритуксимабом in vitro, однако, GA101 не обладало КЗЦ-активностью (Umana P, Blood 2006;108:72а, Abstract 229 и WO 2005/044859). Помимо этого, GA101 - гликоинжиниринговое антитело с улучшенной АЗКЦ-активностью (Umana et al., Blood 2006;108:72а, Abstract 229; и WO 2005/044859). Иные соединения на различных этапах разработки, как сообщалось, несущественно улучшали определенные исходные характеристики ритуксимаба или иных известных антител против CD20. Тем не менее, до настоящего времени не было создано новой молекулы, обладающей уникальными физическими и функциональными особенностями, направленными на устранение известных проблем в отрасли.

Также ритуксимаб был утвержден в США для применения совместно с метатрексатом для уменьшения признаков и симптомов у взрослых пациентов с рефракторной анемией, не имеющих адекватного ответа на по меньшей мере один антагонист ФНО. Во множестве исследований изучалось использование ритуксимаба при множестве незлокачественных аутоиммунных или воспалительных заболеваний, включая рефракторную анемию, при которых В-клетки и аутоантитела, вероятно, играют роль в патофизиологии заболевания. Edwards et al., Biochem Soc. Trans. 30:824-828 (2002). Целеуказание на CD20 с использованием антител против CD20, как сообщалось, потенциально ослабляет признаки и симптомы, например, рефракторной анемии (Leandro et al., Ann. Dis. 61:883-888 (2002); Edwards et al., Arthritis Rheum., 46 (Suppl. 9): S46 (2002); Stahl et al., Ann. Rheum. Dis., 62 (Suppl. 1): OP004 (2003); Emery Arthritis Rheum. 48(9): S439 (2003)), волчанки (Eisenberg, Arthritis. Res. Ther. 5:157-159 (2003); Leandro et al. Arthritis Rheum. 46: 2673-2677 (2002); German et al., Lupus, 13: 312-316 (2004)), иммунной тромбоцитопенической пурпуры (D′Arena et al., Leuk. Lymphoma 44:561-562 (2003); Stasi et al., Blood, 98: 952-957 (2001); Saleh et al., Semin. Oncol., 27 (Supp 12):99-103 (2000); Zaja et al., Haematologica, 87:189-195 (2002); Ratanatharathorn et al., Ann. Int. Med., 133:275-279 (2000)), истинной эритроцитарной аплазии (Auner et al., Br. J. Haematol., 116:725-728 (2002)); аутоиммунной анемии(Zaja et al., выше(erratum в Haematologica 87:336 (2002)), болезни холодовых агглютининов (Layios et al., Leukemia, 15:187-8 (2001); Berentsen et al., Blood, 103: 2925-2928 (2004); Berentsen et al., Br. J. Haematol., 115:79-83 (2001); Bauduer, Br. J. Haematol., 112:1083-1090 (2001); Zaja et al., Br. J. Haematol., 115:232-233 (2001)), синдрома тяжелой резистентности к инсулину типа В (Coll et al., N. Engl. J. Med., 350:310-311 (2004), смешанной криоглобулинемии (DeVita et al., Arthritis Rheum. 46 Suppl. 9:S206/S469 (2002)), тяжелой миастении (Zaja et al„ Neurology, 55:1062-1063 (2000); Wylam et al., J. Pediatr., 143:674-677 (2003)), гранулематоза Вегенера (Specks et al., Arthritis & Rheumatism 44:2836-2840 (2001)), рефракторной вульгарной пузырчатки (Dupuy et al., Arch Dermatol., 140:91-96 (2004)), дерматомиозита (Levine, Arthritis Rheum., 46 (Suppl. 9):S1299 (2002)), синдрома Сергена (Somer et al., Arthritis & Rheumatism, 49:394-398 (2003)), смешанной криоглобулинемии активного типа-II (Zaja et al., Blood, 101:3827-3834 (2003)), вульгарной пузырчатки (Dupay et al., Arch. Dermatol., 140:91-95 (2004)), аутоиммунной нейропатии (Pestronk et al., J. Neurol. Neurosurg. Psychiatry 74:485-489 (2003)), паранеопластического опсоклонус-миоклонус синдрома (Pranzatelli et al. Neurology 60 (Suppl. 1) PO5.128:A395 (2003)), а также возвратно-ремиттирующего множественного склероза (RRMS). Cross et al. (обзор) «Preliminary Results from a Phase II Trial of Rituximab in MS» Eighth Annual Meeting of the Americas Committees for Research and Treatment in Multiple Sclerosis, 20-21 (2003).

Патенты и патентные публикации, относящиеся к антителам против CD20, CD20-связывающим молекулам, а также аутоантигенным вакцинам, включают патенты США под номерами 5776456, 5736137, 5843439, 6399061, 6682734, а также US 2002/0197255, US 2003/0021781, US 2003/0082172, US 2003/0095963, US 2003/0147885, US 2005/0186205, WO 1994/11026 (Anderson et al.); патенты США под номерами 6455043, US 2003/0026804, US 2003/0206903, WO 2000/09160 (Grillo-Lopez, A.); WO 2000/27428 (Grillo-Lopez, White); US 2004/0213784 и WO 2000/27433 (Grillo-Lopez, Leonard); WO 2000/44788 (Braslawsky et al.); WO 2001/10462 (Rastetter, W.); WO 2001/10461 (Rastetter, White); WO 2001/10460 (White, Grillo-Lopez); US 2001/0018041, US 2003/0180292, US 2002/0028178, WO 2001/34194 и WO 2002/22212 (Hanna and Hariharan); US 2002/0006404 и WO 2002/04021 (Hanna and Hariharan); US 2002/0012665, US 2005/0180975, WO 2001/74388, патенты США под номерами 6896885В5 (Hanna, N.); US 2002/0058029 (Hanna, N.); US 2003/0103971 (Hariharan and Hanna); US 2005/0123540 (Hanna et al.); US 2002/0009444 и WO 2001/80884 (Grillo-Lopez, A.); WO 2001/97858; US 2005/0112060, US 2002/0039557, патенты США под номерами 6846476 (White, С.); US 2002/0128448 и WO 2002/34790 (Reff, M.); WO 2002/060955 (Braslawsky et al.); WO 2002/096948 (Braslawsky et al.); WO 2002/079255 (Reff and Davies); патенты США под номерами 6171586 и 6991790, WO 1998/56418 (Lam et al.); US 2004/0191256 и WO 1998/58964 (Raju, S.); WO 1999/22764 (Raju, S.); WO 1999/51642, патент США № 6194551, патент США № 6242195, патент США № 6528624 и патент США № 6538124 (Idusogie et al.); патенты США под номерами 7122637, US 2005/0118174, US 2005/0233382, US 2006/0194291, US 2006/0194290, US 2006/0194957 и WO 2000/42072 (Presta, L.); WO 2000/67796 (Curd et al.); WO 2001/03734 (Grillo-Lopezetal.); US 2002/0004587, US 2006/0025576 и WO 2001/77342 (Miller and Presta); US 2002/0197256 и WO 2002/078766 (Grewal, I.); US 2003/0157108 и WO 2003/035835 (Presta, L.); патенты США под номерами 5648267, 5733779, 6017733, 6159730 и WO 1994/11523 (Reff et al.); патенты США под номерами 6565827, 6090365, 6287537, 6015542, 5843398, 5595721 (Kaminski et al.); патенты США под номерами 5500362, 5677180, 5721108, 6120767, 6652852, 6893625, а также WO 1988/04936 (Robinson et al.); патент США № 6410391 (Zelsacher); патент США № 6224866 и WO00/20864 (Barbera-Guillem, E.); WO 2001/13945 (Barbera-Guillem, E.); WO 2000/67795 (Goldenberg); патент США № 7074403 (Goldenberg and Hansen); патент США № 7151164 (Hansen et al.); US 2003/0133930; WO 2000/74718 и US 2005/0191300A1 (Goldenberg and Hansen); US 2003/0219433 и WO 2003/68821 (Hansen et al.); WO 2004/058298 (Goldenberg and Hansen); WO 2000/76542 (Golay et al.); WO 2001/72333 (Wolin and Rosenblatt); патент США № 6368596 (Ghetie et al.); патент США № 6306393 и US 2002/0041847 (Goldenberg, D.); US 2003/0026801 (Weiner and Hartmann); WO 2002/102312 (Engleman, E.); US 2003/0068664 (Albitar et al.); WO 2003/002607 (Leung, S.); WO 2003/049694, US 2002/0009427 и US 2003/0185796 (Wolin et al.); WO 2003/061694 (Sing and Siegall); US 2003/0219818 (Bohen et al.); US 2003/0219433 и WO 2003/068821 (Hansen et al.); US 2003/0219818 (Bohen et al.); US 2002/0136719 (Shenoy et al.); WO 2004/032828 и US 2005/0180972 (Wahl et al.); и WO 2002/56910 (Hayden-Ledbetter). См. также патент США № 5849898 и ЕР 330191 (Seed et al.); EP332865A2 (Meyer and Weiss); патент США № 4861579 (Meyer et al.); US 2001/0056066 (Bugelski et al.); WO 1995/03770 (Bhat et al.); US 2003/0219433 Al (Hansen et al.); WO 2004/035607 и US 2004/167319 (Teeling et al.); WO 2005/103081 (Teeling et al.); US 2006/0034835, US 2006/0024300 и WO 2004/056312 (Lowman et al.); US 2004/0093621 (Shitara et al.); WO 2004/103404 (Watkins et. al.); WO 2005/000901 (Tedder et al.); US 2005/0025764 (Watkins et al.); US 2006/0251652 (Watkins et al.); WO 2005/016969 (Carr et al.); US 2005/0069545 (Carr et al.); WO 2005/014618 (Chang et al.); US 2005/0079174 (Barbera-Guillem and Nelson); US 2005/0106108 (Leung and Hansen); US 2005/0123546 (Umana et al.); US 2004/0072290 (Umana et al.); US 2003/0175884 (Umana et al.); и WO 2005/044859 (Umana et al.); WO 2005/070963 (Allan et al.); US 2005/0186216 (Ledbetter and Hayden-Ledbetter); US 2005/0202534 (Hayden-Ledbetter and Ledbetter); US 2005/136049 (Ledbetter et al.); US 2003/118592 (Ledbetter et al.); US 2003/133939 (Ledbetter and Hayden-Ledbetter); US 2005/0202012 (Ledbetter and Hayden-Ledbetter); US 2005/0175614 (Ledbetter and Hayden-Ledbetter); US 2005/0180970 (Ledbetter and Hayden-Ledbetter); US 2005/0202028 (Hayden-Ledbetter and Ledbetter); US 2005/0202023 (Hayden-Ledbetter and Ledbetter); WO 2005/017148 (Ledbetter et al.); WO 2005/037989 (Ledbetter et al.); патент США № 6183744 (Goldenberg); патент США № 6897044 (Braslawski et al.); WO 2006/005477 (Krause et al.); US 2006/0029543 (Krause et al.); US 2006/0018900 (McLCCormick et al.); US 2006/0051349 (Goldenberg and Hansen); WO 2006/042240 (Iyer and Dunussi-Joannopoulos); US 2006/0121032 (Dahiyat et al.); WO 2006/064121 (Teillaud et al.); US 2006/0153838 (Watkins), CN 1718587 (Chen et al.); WO 2006/084264 (Adams et al.); US 2006/0188495 (Barron et al.); US 2004/0202658 и WO 2004/091657 (Benynes, K.); US 2005/0095243, US 2005/0163775, WO 2005/00351 и WO 2006/068867 (Chan, A.); US 2006/0135430 и WO 2005/005462 (Chan et al.); US 2005/0032130 и WO 2005/017529 (Beresini et al.); US 2005/0053602 и WO 2005/023302 (Brunetta, P.); US 2006/0179501 и WO 2004/060052 (Chan et al.); WO 2004/060053 (Chan et al.); US 2005/0186206 и WO 2005/060999 (Brunetta. P.); US 2005/0191297 и WO 2005/061542 (Brunetta, P.); US 2006/0002930 и WO 2005/115453 (Brunetta et al.); US 2006/0099662 и WO 2005/108989 (Chuntharapai et al.); CN 1420129A (Zhongxin Guojian Pharmaceutical); US 2005/0276803 и WO 2005/113003 (Chan et al.); US 2005/0271658 и WO 2005/117972 (Brunetta et al.); US 2005/0255527 и WO 2005/11428 (Yang, J.); US 2006/0024295 и WO 2005/120437 (Brunetta, P.); US 2006/0051345 и WO 2005/117978 (Frohna, P.); US 2006/0062787 и WO 2006/012508 (Hitraya, E.); US 2006/0067930 и WO 2006/31370 (Lowman et al.); WO 2006/29224 (Ashkenazi, A.); US 2006/0110387 и WO 2006/41680 (Brunetta, P.); US 2006/0134111 и WO 2006/066086 (Agarwal, S.); WO 2006/069403 (Ernst and Yansura); US 2006/0188495 и WO 2006/076651 (Dummer, W.); WO 2006/084264 (Lowman, H.); WO 2006/093923 (Quan and Sewell); WO 2006/106959 (Numazaki et al.); WO 2006/126069 (Morawala); WO 2006/130458 (Gazit-Bornstein et al.); US 2006/0275284 (Hanna, G.); US 2007/0014785 (Golay et al.); US 2007/0014720 (Gazit-Bornstein et al.); и US 2007/0020259 (Hansen et al.); US 2007/0020265 (Goldenberg and Hansen); US 2007/0014797 (Hitraya); US 2007/0224189 (Lazar et al.); и WO 2008/003319 (Parren and Baadsgaard).

Некоторые научные публикации, относящиеся к терапии антителами против CD20, включают: Perotta, Abuel, "Response of chronic relapsing ITP of 10 years duration to rituximab" Abstract #3360 Blood, 10(l)(part 1-2):88B (1998); Perotta et al., "Rituxan in the treatment of chronic idiopathic thrombocytopaenic purpura (ITP)", Blood, 94:49 (abstract) (1999); Matthews, R., "Medical Heretics" New Scientist, (7 Apr., 2001); Leandro et al., "Clinical outcome in 22 patients with rheumatoid arthritis treated with В lymphocyte depletion" Ann Rheum Dis., выше; Leandro et al., "Lymphocyte depletion in rheumatoid arthritis: early evidence for safety, efficacy and dose response" Arthritis and Rheumatism, 44(9):S370 (2001); Leandro et al., "An open study of В lymphocyte depletion in systemic lupus erythematosus" Arthritis and Rheumatism, 46:2673-2677 (2002), где в течение двухнедельного периода каждый пациент получал две инфузии антител CD20 по 500 мг, две инфузии циклофосфамида по 750 мг и кортикостероиды в высоких дозах внутрь, и где у двоих пациентов наблюдался рецидив на седьмом и восьмом месяцах, соответственно, после чего они проходили повторное лечение по разным протоколам; "Successful long-term treatment of systemic lupus erythematosus with rituximab maintenance therapy" Weide et al., Lupus, 12:779-782 (2003), в котором одного пациента лечили антителами против CD20 (375 мг/м2 × 4, еженедельно), с дальнейшими введениями антител каждые пять-шесть месяцев, затем проводили поддерживающую терапию антителами в дозе 375 мг/м2 каждые три месяца, а второго пациента с рефракторной СКВ лечили антителом против CD20 ритуксимабом, а потом он получал поддерживающую терапию каждые три месяца; Edwards, Cambridge, "Sustained improvement in rheumatoid arthritis following a protocol designed to deplete В lymphocytes" Rheumatology, 40:205-211 (2001); Cambridge et al., "B lymphocyte depletion in patients with rheumatoid arthritis: serial studies of immunological parameters" Arthritis Rheum., 46 (Suppl. 9): S1350 (2002); Cambridge et al., "Serologic changes following В lymphocyte depletion therapy for rheumatoid arthritis" Arthritis Rheum., 48:2146-2154 (2003); Edwards et al., "B-lymphocyte depletion therapy in rheumatoid arthritis and other autoimmune disorders" Biochem Soc. Trans., выше; Edwards et al., "Efficacy and safety of rituximab, a B-cell targeted chimeric monoclonal antibody: A randomized, placebo controlled trial in patients with rheumatoid arthritis, "Arthritis and Rheumatism, 46(9):S197 (2002); Edwards et al., "Efficacy of B-cell-targeted therapy with rituximab in patients with rheumatoid arthritis" N Engl. J. Med., 350:2572-2582 (2004); Pavelka et al., Ann. Rheum. Dis., 63:(S1):289-290 (2004); Emery et al., Arthritis Rheum. 50 (S9):S659 (2004); Levine and Pestronk, "IgM antibody-related polyneuropathies: B-cell depletion chemotherapy using Rituximab" Neurology, 52:1701-1704 (1999); Uchida et al., "The innate mononuclear phagocyte network depletes В lymphocytes through Fc receptor-dependent mechanisms during anti-CD20 antibody immunotherapy" J. Exp. Med., 199:1659-1669 (2004); Gong et al., "Importance of cellular microenvironment and circulatory dynamics in В cell immunotherapy" J. Immunol., 174:817-826 (2005); Hamaguchi et al., "The peritoneal cavity provides a protective niche for Bl and conventional В lymphocytes during anti-CD20 immunotherapy in mice" J. Immunol., 174:4389-4399 (2005); Cragg et al. "The biology of CD20 and its potential as a target for mAb therapy" Curr. Dir. Autoimmun., 8:140-174 (2005); Eisenberg, "Mechanisms of autoimmunity" Immunol. Res., 27:203-218 (2003); DeVita et al., "Efficacy of selective В cell blockade in the treatment of rheumatoid arthritis" Arthritis & Rheum, 46:2029-2033 (2002); Higashida et al. "Treatment of DMARD-refractory rheumatoid arthritis with rituximab" Annual Scientific Meeting of the American College of Rheumatology (Abstract #LB11), New Orleans, La. (October, 2002); Tuscano, "Successful treatment of infliximab-refractory rheumatoid arthritis with rituximab" Annual Scientific Meeting of the American College of Rheumatology, New Orleans, La. (October, 2002), опубликованное в Tuscano, Arthritis Rheum. 46:3420 (2002); "Pathogenic roles of В cells in human autoimmunity; insights from the clinic" Martin and Chan, Immunity, 20:517-527 (2004); Silverman and Weisman, "Rituximab therapy and autoimmune disorders, prospects for anti-B cell therapy". Arthritis and Rheumatism, 48:1484-1492 (2003); Kazkaz and Isenberg, "Anti В cell therapy (rituximab) in the treatment of autoimmune diseases" Current Opinion in Pharmacology, 4:398-402 (2004); Virgolini and Vanda, "Rituximab in autoimmune diseases" Biomedicine & Pharmacotherapy, 58: 299-309 (2004); Klemmer et al., "Treatment of antibody mediated autoimmune disorders with an AntiCD20 monoclonal antibody Rituximab" Arthritis And Rheumatism, 48(9) (SEP):S624-S624 (2003); Kneitz et al., "Effective В cell depletion with rituximab in the treatment of autoimmune diseases" Immunobiology, 206:519-527 (2002); Arzoo et al., "Treatment of refractory antibody mediated autoimmune disorders with an anti-CD 20 monoclonal antibody (rituximab)" Annals of the Rheumatic Diseases, 61(10):922-924 (2002) Comment in Ann. Rheum. Dis. 61:863-866 (2002); "Future strategies in immunotherapy" by Lake and Dionne, in Burger′s Medicinal Chemistry and Drug Discovery (John Wiley & Sons, Inc., 2003) (Chapter 2 "Antibody-Directed Immunotherapy"); Liang, Tedder, Wiley Encyclopedia of Molecular Medicine, Section: CD20 as an Immunotherapy Target (2002); Appendix 4A entitled "Monoclonal Antibodies to Human Cell Surface Antigens" by Stockinger et al., eds: Coligan et al., in Current Protocols in Immunology (John Wiley & Sons, Inc., 2003); Penichet and Morrison, "CD Antibodies/molecules: Definition; Antibody Engineering" in Wiley Encyclopedia of Molecular Medicine Section: Chimeric, Humanized and Human Antibodies (2002).

Помимо этого, см. Looney, "В cells as a therapeutic target in autoimmune diseases other than rheumatoid arthritis" Rheumatology, 44 Suppi 2:iil3-iil7 (2005); Chambers and Isenberg, "Anti-B cell therapy (rituximab) in the treatment of autoimmune diseases" Lupus, 14(3):210-214 (2005); Looney et al., "B-cell depletion as a novel treatment for systemic lupus erythematosus: a phase I/II dose-escalating trial of rituximab" Arthritis Rheum., 50:2580-2589 (2004); Looney, "Treating human autoimmune disease by depleting В cells" Ann Rheum. Dis., 61:863-866 (2002); Edelbauer et al., "Rituximab in childhood systemic lupus erythematosus refractory to conventional immunosuppression Case report" Pediatr. Nephrol., 20(6): 811-813 (2005); D′Cruz and Hughes, "The treatment of lupus nephritis" BMJ, 330(7488):377-378 (2005); Looney, "B cell-targeted therapy in diseases other than rheumatoid arthritis" J. Rheumatol. Suppl., 73: 25-28-discussion 29-30 (2005); Sfikakis et al., "Remission of proliferative lupus nephritis following В cell depletion therapy is preceded by down-regulation of the Т cell costimulatory molecule CD40 ligand: an open-label trial" Arthritis Rheum., 52(2):501-513 (2005); Rastetter et al., "Rituximab: expanding role in therapy for lymphomas and autoimmune diseases" Annu. Rev. Med., 55:477- 503 (2004); Silverman, "Anti-CD20 therapy in systemic lupus erythematosus: a step closer to the clinic" Arthritis Rheum., 52(2):371-377 (2005), Erratum in: Arthritis Rheum. 52(4): 1342 (2005); Ahn et al., "Long-term remission from life-threatening hypercoagulable state associated with lupus anticoagulant (LA) following rituximab therapy" Am. J. Hematol., 78(2): 127-129 (2005); Tahir et al., "Humanized anti-CD20 monoclonal antibody in the treatment of severe resistant systemic lupus erythematosus in a patient with antibodies against rituximab" Rheumatology, 44(4):561-562 (2005), Epub 2005, Jan. 11; Looney et al., "Treatment ofSLE with anti CD20 monoclonal antibody" Curr. Dir. Autoimmun., 8:193-205 (2005); Cragg et al., "The biology of CD20 and its potential as a target for mAb therapy" Curr. Dir. Autoimmun., 8:140-174 (2005); Gottenberg et al., "Tolerance and short term efficacy of rituximab in 43 patients with systemic autoimmune diseases" Ann. Rheum. Dis., 64(6):913-920 (2005) Epub 2004 Nov. 18; Tokunaga et al., "Down-regulation of CD40 and CD80 on В cells in patients with life-threatening systemic lupus erythematosus after successful treatment with rituximab" Rheumatology 44(2): 176-182 (2005), Epub 2004 Oct. 19. See also Leandro et al., "B cell repopulation occurs mainly from naive В cells in patient with rheumatoid arthritis and systemic lupus erythematosus" Arthritis Rheum., 48 (Suppl 9): S1160 (2003).

Также, см. Specks et al. "Response of Wegener′s granulomatosis to anti-CD20 chimeric monoclonal antibody therapy" Arthritis & Rheumatism, 44(12):2836-2840 (2001), в которой описано использование четырех инфузий по 375 мг/м2 антител против CD20 и глюкокортикоидов в высоких дозах для терапии гранулематоза Вегенера. Терапия была проведена повторно спустя 11 месяцев, когда вновь появились цАНЦА, однако, повторный курс не содержал глюкокортикоиды. Спустя восемь месяцев после второго курса терапии антителами против CD20, заболевание пациентов оставалось в состоянии полной ремиссии. В другом исследовании сообщалось о ремиссии тяжелого АНЦА-ассоциированного васкулита при использовании антител против CD20 в дозе 375 мг/м2 × 4 совместно с назначением преднизона внутрь по 1 мг/кг/день, с уменьшением до 40 мг/день к четвертой неделе и полной отмене спустя следующие 16 недель. Четверо пациентов были повторно пролечены только антителами против CD20 по поводу возрастания титров АНЦА. В Keogh et al., Kidney Blood Press. Res., 26:293 (2003) сообщалось о том, что у одиннадцати пациентов с рефракторным АНЦА-ассоциированным васкулитом была достигнута ремиссия при лечении четырьмя еженедельными дозами 375 мг/м2 антител против CD20 и глюкокортикоидами в высоких дозировках.

Пациентам с рефракторным АНЦА-ассоциированным васкулитом назначали антитела против CD20 вместе с иммуносупрессивными препаратами, например, внутривенным введением циклофосфамида, микофенолата мофетила, азатиоприна, лефлуномида. Eriksson, "Short-term outcome and safety in 5 patients with ANCA-positive vasculitis treated with rituximab" Kidney and Blood Pressure Research, 26:294 (2003) (пять пациентов с АНЦА-ассоциированным васкулитом получали терапию антителами против CD20 375 мг/м2 раз в неделю в течение четырех недель); Jayne et al., "B-cell depletion with rituximab for refractory vasculitis" Kidney and Blood Pressure Research, 26:294-295 (2003) (у шести пациентов с рефракторным васкулитом, получавших четыре еженедельных инфузии антител против CD20 по 375 мг/м2 с циклофосфамидом и фоновой иммуносупрессией, и назначением преднизолона, отмечались изменения васкулитной активности). Последующий отчет использования антител против CD20 совместно с циклофосфамидом внутривенно в дозировке 375 мг/м2 на дозу, по четыре дозы, при назначении пациентам с рефракторным системным васкулитом, представлен в работе Smith, Jayne, "A prospective, open label trial of B-cell depletion with rituximab in refractory systemic vasculitis" poster 998 (11th International Vasculitis and ANCA workshop), American Society of Nephrology, J. Am. Soc. Nephrol., 14:755A (2003). См. также Eriksson, J. Internal Med., 257:540-548 (2005), где рассматриваются девять пациентов с АНЦА-положительным васкулитом, проходивших лечение двумя или четырьмя недельными дозами по 500 мг антител против CD20; и Keogh et al., Arthritis and Rheumatism, 52:262-268 (2005), где сообщалось, что у 11 пациентов с рефракторным АНЦА-ассоциированным васкулитом терапия или повторная терапия четырьмя недельными дозами по 375 мг/м2 антител против CD20 давала ремиссию с уменьшением количества В-лимфоцитов.

Касательно активности гуманизированных антител против CD20 см., к примеру, Vugmeyster et al., "Depletion of В cells by a humanized anti-CD20 antibody PRO70769 in Macaca fascicularis," J. Immunother., 28:212-219 (2005). Обсуждение человеческих моноклональных антител см. в Baker et al., "Generation and characterization of LymphoStat-B, a human monoclonal antibody that antagonizes the bioactivities of В lymphocyte stimulator," Arthritis Rheum., 48:3253-3265 (2003). Исследование MINT с антителами против CD20 проводилось при терапии агрессивной неходжкинской лимфомы у молодых пациентов. Pfreundschuh et al., Lancet Oncology, 7(5):379-391 (2006).

Конъюгаты антитело-цитотоксический агент (или «АСС»), также называемые конъюгатами антитело-препарат (ADC), являются типом иммуноконъюгатов, состоящим из цитотоксического агента, ковалентно соединенного с антителом через специализированный химический линкер. Использование АСС для местной доставки цитотоксических или цитостатических агентов, например, препаратов, убивающих или ингибирующих опухолевые клетки при лечении рака (см. Syrigos and Epenetos (1999) Anticancer Research 19:605-614; Niculescu-Duvaz and Springer (1997) Adv. Drg Del. Rev. 26:151-172; патент США № 4975278), дает возможность осуществлять нацеленную доставку препаратов в опухоли и накапливать их в межклеточном пространстве, в то время как системное назначение неконъюгированных препаратов может приводить к неприемлемому токсическому воздействию на нормальные клетки, одинаковому с воздействием на нежелательные опухолевые клетки (Baldwin et al., (1986) Lancet pp. (Mar. 15, 1986):603-05; Thorpe, (1985) "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review," in Monoclonal Antibodies ′84: Biological And Clinical Applications, A. Pinchera et al. (ed.s), pp. 475-506). Необходима максимальная эффективность с минимальной токсичностью. Для этой цели сообщалось о пригодности и поликлональных, и моноклональных антител. (См. Rowland et al., (1986) Cancer Immunol. Immunother., 21:183-87). Препараты, используемые с этой целью, включают дауномицин, доксорубицин, метоктрексат, виндезин (Rowland et al., Cancer Immunol. Immunother. 21:183-87 (1986)). Токсины, используемые в конъюгатах антитело-токсин, включают бактериальные токсины, например, дифтерийный токсин, растительные токсины, например, рицин, токсины с небольшими размерами молекул, например, гелданамицин. Kerr et al (1997) Bioconjugate Chem. 8(6):781-784; Mandler et al (2000) Journal of the Nat. Cancer Inst. 92(19):1573-1581; Mandler et al (2000) Bioorganic & Med. Chem. Letters 10: 1025-1028; Mandler et al (2002) Bioconjugate Chem. 13:786-791), майтансиноиды (ЕР 1391213; Liu et al., (1996) Proc. Natl. Acad. Sci. USA 93:8618-8623) и калихеамицин (Lode et al (1998) Cancer Res. 58:2928; Hinman et al (1993) Cancer Res. 53:3336-3342. Токсины могут проявлять цитотоксические и/или цитостатические эффекты посредством различных механизмов, включая связывание тубулина, связывание ДНК, ингибирование топоизомеразы. Meyer, D. L., Senter, P. D. "Recent Advances in Antibody Drug Conjugates for Cancer Therapy" in Annual Reports in Medicinal Chemistry, Vol 38 (2003) Chapter 23, 229-237. Однако, множество цитотоксических препаратов при конъюгировании с крупными антителами или белковыми лигандами рецепторов становятся неактивными или менее активными.

Конъюгаты антитело-майтансиноид состоят из моноклонального антитела, направленного против антигена, экспрессируемого на поверхности клеток и производного майтансиноидов (активных антимитотических препаратов, ингибирующих полимеризацию микротрубочек), ковалентно присоединенного к антителу. Chari RV, Acc. Chem. Res. 2008 Jan; 41(l):98-107. При использовании подходящего линкера конъюгат антитело-майтансиноид (АМС) может быть стабилен in vivo и существенно менее токсичен для клеток, не экспрессирующих антигена-мишени, что увеличивает терапевтический индекс конъюгата. При связывании антигена-мишени на поверхности клетки конъюгат антитело-майтансиноид интернализуется, расщепляется в лизосомах, преимущественно - протеазами, высвобождая активные майтансиноидные метаболиты, которые связываются с микротрубочками и ингибируют их, останавливая клеточный цикл и приводя в конце концов клетку к гибели, наиболее вероятно, апоптотическим путем. Erickson et al, Cancer Res. 2006 Apr 15; 66(8):4426-33. При конъюгировании с майтансиноидом использование моноклональных антител может способствовать улучшению селективности цитолиза in vitro и in vivo.

В настоящее время множество АСС изучаются клинически и проходят доклинические испытания. В идеале иммуноконъюгаты должны легко вводиться пациентам, аналогично антителам. В частности, один АСС, называемый трастузумаб-SMCC-DM1 (T-DM1), как было установлено, эффективен у пациентов с HER2-сверхэкспрессирующим метастазирующим раком молочной железы, не достигших результата при приеме трастузумаба и химиотерапии, а также обладает предпочтительным низким профилем токсичности. См. Vogel CL, ASCO 2009 Abstract #1017.

Клиренс из плазмы конъюгатов антитело-майтансиноид, например, трастузумаб-SMCC-DM1, синтезированных с нерасщепляемым линкером SMCC, очень низок в сравнении с клиренсом антитела самого по себе. US 2005/0169933. Это находится в ярком контрасте с клиренсом из плазмы конъюгатов, синтезированных с относительно лабильными дисульфидными связями, например, huC242-SPP-DM1. К примеру, период полувыведения SMCC-конъюгата приблизительно равен 320 часов, а период полувыведения SPP-конъюгата лежит в интервале 40-50 часов. Однако, клиренс компонента-антитела для каждого типа конъюгата идентичен, что позволяет предположить, что различия скорости клиренса могут быть обусловлены отсоединением майтансиноида от конъюгата антитела (как в случае конъюгата SPP-DM1). Нерасщепляемая SMCC-сшивка гораздо более устойчива к расщеплению связи майтансиноид-линкер in vivo, чем в конъюгате SPP-DM1. Помимо этого, пониженная скорость выведения конъюгатов с линкером SMCC, в сравнении с конъюгатами SPP-DM1, дает примерно 5-кратное увеличение общей экспозиции майтансиноидами у животных, судя по площади под кривой (AuC). Повышенная экспозиция может существенно влиять на эффективность препарата.

Сообщалось о том, что конъюгаты майтансиноидов, приготовленные с нерасщепляемыми линкерами, например, SMCC, обладают неожиданно высокой переносимостью у мышей в сравнении с конъюгатами, приготовленными с расщепляемыми дисульфидными линкерами. US 2005/0169933. К примеру, переносимость конъюгатов huC242-SMCC-DM1 и huC242-SPP-DM1 сравнивалась в тесте острой токсичности с однократным внутривенным введением дозы мышам CD-1. Максимальная переносимая доза (МПД) конъюгата SMCC-DM1 была выше наивысшей проверенной дозы (150 мг/кг), в то время как МПД конъюгата с дисульфидной связью SPP-DM1 лежала в интервале 45-90 мг/кг. При дозе 150 мг/кг все мыши в терапевтической группе SMCC-DM1 выжили, а в группе SPP-DM1 все мыши погибли спустя 96 часов после введения препарата. Помимо этого, конъюгат антитело-майтансиноид с невосстанавливаемой тиоэфирной связью трастузумаб-SMCC-DM1 показывал 2-3-кратно лучшую переносимость у крыс, нежели конъюгат с расщепляемой дисульфидной связью трастузумаб-SPP-DM1. Lewis Phillips GD, Li G, Dugger DL, et al., Targeting HER2-positive breast cancer with trastuzumab-DM1, an antibody-cytotoxic drug conjugate, Cancer Res 2008; 68:9280-90. Таким образом, возможно, что конъюгаты препарат-антитело, изготовленные с нерасщепляемыми линкерами, например, SMCC, могут обладать выгодными параметрами токсичности и фармакокинетики в доклинических моделях.

Хотя CD20 известен в данной области техники, CD20 не является предпочтительной целью для конъюгирования антитело-препарат, поскольку известные антитела против CD20 очень плохо интернализируются. Press OW, Cancer Res. 1989; 49:4906-12 и Vangeepuram N, Cancer 1997; 80 (Suppl.): 2425-30. Конъюгаты CD20-антител были ранее изучены, однако, они не проявляли выраженной активности, особенно - при использовании отличных от дисульфидных или кислотностабильных линкеров.

К примеру, сообщалось о том, что нерасщепляемые конъюгаты SMCC-DM1 с антителом против CD20 обладали такой же эффективностью, что и неконъюгированное антитело, в то время как расщепляемый конъюгат SPP-DM1 такого же антитела обладал слегка повышенной эффективностью в ксенотрансплантатной модели Granta-519 у мышей с ТКИН. Polson et al., Cancer Res., 69(6):2358-2364 (2009). Аналогично сообщалось о том, что конъюгаты калихеамицина с антителом против CD20, сделанные посредством кислотоустойчивого амидного линкера, обладали повышенной эффективностью in vivo в сравнении с ритуксимабом в ксенотрансплантатной модели Ramos на голых мышах. Только конъюгаты калихеамицина и ритуксимаба, сделанные кислотолабильным диметилгидразидным Ac-But линкером, обладали повышенной эффективностью in vivo в данном исследовании. DiJoseph et al., Cancer Immunol. Immunotherapy, 56(7):1107-1117 (2007). В другом исследовании сообщалось о том, что кислотно-лабильные конъюгаты адриамицина с антителом против CD20 были лишь в среднем эффективны в модели ксенотрансплантата Daudi. Кислотно-стабильные конъюгаты адриамицина с тем же антителом были полностью неэффективны. Braslawsky et al., Cancer Immunol Immunotherapy, 33:367-74 (1991). Ритуксимаб, конъюгированный с монометил-ауристатином Е (ММАЕ) через фермент-расщепляемую пептидную связь (ритуксимаб-vcMMAE), был эффективен in vitro и in vivo против клеток лимфомы Ramos. Law et al., Clin. Cancer Res., 10(23):7842-7851 (2004); Erratum: Clin. Cancer Res., 11(10):3969 (2005).

Другой опубликованный подход к повышению эффективности моноклональных антител в лечении расстройств, связанных с В-клетками, заключался в конъюгировании радиоактивной метки с антителом таким образом, чтобы метка располагалась в антигенном сайте. CD20-нацеленные радио-иммуноконъюгаты Bexxar® (131I-тозитумомаб) и Zevalin (90Y-ибритумомаба тиуксетан) были утверждены для применения у пациентов с рецидивирующей или рефракторной неходжкинской В-клеточной лимфомой, включая пациентов, рефракторных к ритуксимабу. В клинических условиях у некоторых ритуксимаб-рефракторных пациентов отмечался ответ на Bexxar®. Horning, J. Clin. Oncol. 2005; 23:712-9. При сравнении Zevalin и ритуксимаба во время лечения рецидивирующей, высокодифференцированной рефракторной или фолликулярной НХЛ, Zevalin давал существенно лучшую скорость достижения общего и полного ответа в сравнении с ритуксимабом. Witzig, J Clin Oncol 2002; 20:2453-2463. Хотя эти клинические данные предполагают, что радиоиммуноконъюгаты против CD20 могут быть более эффективными, нежели ритуксимаб, они не используются широко вследствие токсичности и трудности введения, обусловленной радиоактивными соединениями. Таким образом, присутствует необходимость в разработке эффективных антител против CD20 и конъюгатов, которые могут легко вводиться и имеют низкую токсичность.

Таким образом, сохраняется необходимость в разработке улучшенных и превосходящих нынешние CD20-нацеленных терапевтических агентов, включая антитела или фрагменты антител, которые обладают специфичностью, пониженной токсичностью, стабильностью и улучшенными физическими и функциональными свойствами в сравнении с известными терапевтическими агентами. Настоящее изобретение адресуется к этим потребностям.

Сущность изобретения

Будут представлены детальные ссылки на определенные аспекты изобретения, примеры которых иллюстрированы сопровождающими структурами и формулами. Хотя изобретение будет описано на примере перечисленных аспектов, понятно, что изобретение не ограничивается этими аспектами. Наоборот, изобретение предназначено для того, чтобы охватить все альтернативы, модификации, эквиваленты, которые могут быть включены в охват настоящего изобретения, как определено формулой изобретения. Специалисту в данной области техники понятны способы и материалы, схожие или эквивалентные описанным здесь, которые могут использоваться практически с настоящим изобретением.

В одном аспекте настоящее изобретение является антителом против CD20 и/или его фрагментом. В одном аспекте настоящее изобретение является цитолитическим антителом против CD20 и/или его фрагментом. В одном аспекте изобретения цитолитическое антитело против CD20 и фрагменты полезны для лечения медицинских состояний, при которых В-клетки, экспрессирующие CD20, влияют на течение состояния. В одном аспекте интересующие В-клетки являются нежелательными. В одном аспекте медицинское состояние включает активность нежелательных В-клеток. В одном аспекте медицинское состояние является заболеванием В-клеток. Другой аспект изобретения является антителом или его фрагментом, специфически связывающимися с антигеном CD20, причем упомянутое антитело или фрагмент способны индуцировать апоптоз, антителозависимую клеточноопосредованную цитотоксичность (АЗКЦ) и комплементзависимую цитотоксичность (КЗЦ). В предпочтительном аспекте медицинское состояние - Ходжкинская лимфома.

Один аспект настоящего изобретения является антителом или его фрагментом, специфически связывающимися с CD20, причем упомянутое антитело или фрагмент способны индуцировать апоптоз, антителозависимую клеточноопосредованную цитотоксичность (АЗКЦ) и комплементзависимую цитотоксичность (КЗЦ), причем антитело или фрагмент являются мышиными, нечеловеческими, гуманизированными, химерными, перестроенными или человеческими. Другой аспект изобретения является антителом или его фрагментом, специфически связывающимися с CD20, причем антитело или фрагмент способны индуцировать апоптоз, антителозависимую клеточноопосредованную цитотоксичность (АЗКЦ) и комплементзависимую цитотоксичность (КЗЦ), причем антитело или фрагмент являются моноклональными или одноцепочечными.

Один аспект настоящего изобретения включает антитело или его фрагмент, специфически связывающиеся с CD20, причем упомянутое антитело или фрагмент способны индуцировать апоптоз, антителозависимую клеточноопосредованную цитотоксичность (АЗКЦ) и комплементзависимую цитотоксичность (КЗЦ), причем антитело получено из клеток CHO или NS0. В еще одном аспекте настоящего изобретения антитело или его фрагменты специфически связываются с по меньшей мере одной аминокислотой из аминокислотных остатков, расположенных между третьим и четвертым трансмембранными доменами CD20.

В ином аспекте настоящего изобретения антитело или его фрагменты специфически связываются с по меньшей мере одной аминокислотой из аминокислотных остатков последовательности SEQ ID NO:45 либо последовательности, соответствующей одной из: GI 21330989, GenBank Protein ID 23110989 и т. п. Иной аспект настоящего изобретения является антителом или его фрагментом, причем антитело или фрагмент способны индуцировать гибель клетки, экспрессирующей CD20. В еще одном аспекте изобретения антитело или фрагмент являются антителом III типа, обладающим способностью к выраженной индукции апоптоза в отсутствие перекрестно-сшивающих агентов аналогично антителам II типа, и имеющим способность вызывать перераспределение CD20 в липидный рафт с существенным индуцированном комплементзависимой цитотоксичности (КЗЦ) аналогично антителам I типа.

Один аспект изобретения включает антитело против CD20 или фрагмент, специфически связывающиеся с CD20 при вестерн-блоттинге, анализах ИФА или FACS.

В одном аспекте изобретения антитело против CD20 или его фрагмент содержит Fab, Fab′, F(ab′)2, Fd, одноцепочечный Fv или scFv, дисульфидно-связанный Fv, домен V-NAR, IgNar, интратело, IgGDCH2, минитело, Р(ab′)3, тетратело, триатело, диатело, (scFv)2, однодоменное антитело, DVD-Ig, Fcab, mAb2 или scFv-Fc. Иной аспект настоящего изобретения является антителом или его фрагментом, и/или его конъюгатом, содержащим константный домен тяжелой цепи иммуноглобулина. В одном аспекте изобретения антитело или фрагмент константного домена тяжелой цепи иммуноглобулина выбран из группы, состоящей из константного домена IgG1, константного домена IgG2, константного домена IgG3 и константного домена IgG4. В одном аспекте изобретения антитело против CD20 является CD20-6. В ином аспекте изобретения антитело против CD20 является CD20-7.

В одном аспекте изобретения антитело, фрагмент или конъюгат индуцируют апоптоз клеток лимфомы. В одном аспекте настоящего изобретения антитело, фрагмент или конъюгат включает апоптоз клеток лимфомы Ramos и/или клеток лимфомы Raji, и/или клеток лимфомы WSU-DLCL-2, и/или клеток лимфомы Jeko-1, и/или клеток лимфомы Granta-519. В ином аспекте настоящего изобретения антитело, фрагмент и/или конъюгат, согласно настоящему изобретению, индуцируют апоптоз клеток лимфомы Ramos и/или клеток лимфомы Raji, и/или клеток лимфомы WSU-DLCL-2, и/или клеток лимфомы Jeko-1, и/или клеток лимфомы Granta-519, что определяется по окрашиванию Аннексином-V в отсутствие перекрестно-сшивающих агентов. В одном аспекте настоящего изобретения антитело, фрагмент и/или конъюгат, согласно настоящему изобретению, индуцируют апоптоз по меньшей мере 48% клеток лимфомы Ramos и/или по меньшей мере 53% клеток лимфомы Raji, и/или по меньшей мере 34% клеток лимфомы WSU-DLCL-2, и/или по меньшей мере 12% клеток лимфомы Jeko-1, и/или по меньшей мере 40% клеток лимфомы Granta-519, что определяется по окрашиванию Аннексином-V в отсутствие перекрестно-сшивающих агентов.

В ином аспекте изобретения антитело, фрагмент или его конъюгат способны индуцировать апоптоз клеток лимфомы с ЕС50 примерно 0,2 нМ или ниже в отсутствие перекрестно-сшивающих агентов. В ином аспекте изобретения антитело, фрагмент или его конъюгат способны индуцировать апоптоз по меньшей мере 48% клеток лимфомы с ЕС50 0,2 нМ или ниже в отсутствие перекрестно-сшивающих агентов.

В другом аспекте настоящего изобретения антитело, фрагмент и/или его конъюгат способны к эффективной транслокации CD20 в компартменты липидных рафтов клеточной мембраны, экспрессирующей CD20. В другом аспекте настоящего изобретения антитело, фрагмент и/или его конъюгат по данному изобретению способны к эффективной транслокации CD20 в компартменты липидных рафтов клеточной мембраны клетки лимфомы, экспрессирующей CD20, и/или иммунорегуляторной клетки, экспрессирующей CD20. В одном аспекте настоящего изобретения антитело, фрагмент и/или его конъюгат способны к эффективной транслокации CD20 в компартменты липидных рафтов мембраны клеток лимфомы Ramos.

В одном аспекте настоящего изобретения антитело, фрагмент и/или конъюгат приводят к гибели клетки лимфомы Ramos с ЕС50 около 0,018 мкг/мл и ниже и/или приводят к гибели клетки лимфомы Daudi с ЕС50 около 0,25 мкг/мл или ниже, и/или приводят к гибели клетки лимфомы WSU-DLCL-2 с ЕС50 около 0,58 мкг/мл или ниже посредством КЗЦ в присутствии примерно 5% человеческой сыворотки с комплементом.

В одном аспекте изобретения антитело, фрагмент или конъюгат связываются с эпитопом на CD20, который не содержит или не требует наличия пролина в позиции 170 и/или 172. В одном аспекте изобретения антитело, фрагмент или конъюгат связываются с эпитопом на CD20, который содержит аспарагин в позиции 163 и/или 166. В одном аспекте изобретения антитело, фрагмент или конъюгат связываются с эпитопом на CD20, который не содержит или не требует наличия пролина в позиции 170 и/или 172 и который содержит аспарагин в позиции 163 и/или 166.

В одном аспекте изобретения антитело, фрагмент или конъюгат связываются с эпитопом на CD20, причем эпитоп CD20 не содержит пролина в позиции 170 и/или 172 и содержит аспарагин в позиции 163 и/или 166.

В одном аспекте изобретения антитело или его фрагмент содержат по меньшей мере одну область, определяющую комплементарность с аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NOS:25-30. В одном аспекте изобретения антитело или его фрагмент содержит по меньшей мере одну область, определяющую комплементарность с аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NOS: 17-22. В одном аспекте изобретения антитело или его фрагмент содержат по меньшей мере одну область, определяющую комплементарность с аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NOS:25-30 и 17-22, причем указанное антитело или его фрагмент связывают CD20. В одном аспекте изобретения антитело или его фрагмент содержат по меньшей мере одну тяжелую цепь и по меньшей мере одну легкую цепь, причем упомянутая тяжелая цепь содержит три последовательных области, определяющих комплементарность с аминокислотными последовательностями SEQ ID NOS:20-22 или 28-30, а упомянутая легкая цепь содержит три последовательных области, определяющих комплементарность с аминокислотными последовательностями SEQ ID NOS: 17-19 или 25-27. В одном аспекте изобретения последовательность тяжелой цепи антитела или его фрагмента по меньшей мере на 90% идентична аминокислотной последовательности SEQ ID NO:47, 34, 35 или 36. В одном аспекте изобретения последовательность тяжелой цепи антитела или его фрагмента по меньшей мере на 96% идентична аминокислотной последовательности SEQ ID NO:47, 34, 35 или 36. В одном аспекте изобретения последовательность тяжелой цепи антитела или его фрагмента по меньшей мере на 97% идентична аминокислотной последовательности SEQ ID NO:47, 34, 35 или 36. В одном аспекте изобретения последовательность тяжелой цепи антитела или его фрагмента по меньшей мере на 98% идентична аминокислотной последовательности SEQ ID NO:47, 34, 35 или 36. В одном аспекте изобретения последовательность тяжелой цепи антитела или его фрагмента по меньшей мере на 99% идентична аминокислотной последовательности SEQ ID NO:47, 34, 35 или 36. В одном аспекте изобретения тяжелая цепь антитела или его фрагмента имеет аминокислотную последовательность SEQ ID NO:47, 34, 35 или 36.

Последовательности, служащие секреторными сигнальными последовательностями, не присутствуют в зрелом полипептиде.

В изобретении предлагается перестроенное антитело, которое связывает человеческий CD20, либо его антигенсвязывающий фрагмент и/или его конъюгат, уничтожающий В-клетки in vivo. В еще одном аспекте В-клетки происходят от людей или яванских маклаков. В других аспектах CDR-области содержат аминокислотные замены, в которых остатки не происходят ни от антитела донора, ни от антитела реципиента.

В предпочтительном аспекте антитела по изобретению являются целыми антителами, в которых область VH соединена с константным районом тяжелой цепи человеческого IgG. В некоторых предпочтительных аспектах IgG является человеческим IgG1 или IgG3.

В одном аспекте изобретения последовательность легкой цепи антитела или его фрагмента по меньшей мере на 90% идентична аминокислотной последовательности SEQ ID NO:46, 32 или 33. В одном аспекте изобретения последовательность легкой цепи антитела или его фрагмента по меньшей мере на 95% идентична аминокислотной последовательности SEQ ID NO:46, 32 или 33. В одном аспекте изобретения последовательность легкой цепи антитела или его фрагмента по меньшей мере на 96% идентична аминокислотной последовательности SEQ ID NO:46, 32 или 33. В одном аспекте изобретения последовательность легкой цепи антитела или его фрагмента по меньшей мере на 97% идентична аминокислотной последовательности SEQ ID NO:46, 32 или 33. В одном аспекте изобретения последовательность легкой цепи антитела или его фрагмента по меньшей мере на 98% идентична аминокислотной последовательности SEQ ID NO:46, 32 или 33. В одном аспекте изобретения последовательность легкой цепи. антитела или его фрагмента по меньшей мере на 99% идентична аминокислотной последовательности SEQ ID NO:46, 32 или 33. В одном аспекте изобретения легкой цепи антитела или его фрагмента имеет аминокислотную последовательность SEQ ID NO:46, 32 или 33. В одном аспекте перестроенное антитело против CD20 и/или его конъюгат, являются CD20-7 или его фрагментом.

В одном аспекте изобретения антитело или его фрагмент могут быть улучшенным антителом или фрагментом, специфически связывающимися с CD20, полученными: (а) изготовлением ДНК, кодирующей антитело или его фрагмент, содержащие хотя бы одну последовательность, выбранную из группы, состоящей из SEQ ID NOS:32-36, 46, 47, 17-22, 25-30 и 1-7; (б) введением хотя бы одной нуклеотидной мутации, делеции или вставки в указанную ДНК таким образом, чтобы аминокислотная последовательность указанного антитела или его фрагмента, кодируемого указанной ДНК, изменилась; (в) экспрессированием указанного антитела или его фрагмента; (г) скринингом указанного экспрессированного антитела или его фрагмента для упомянутого улучшения, при котором производится упомянутое улучшение антитела или его фрагмента. В одном аспекте изобретения улучшение заключается в повышении аффинности CD20. В еще одном аспекте изобретения повышение аффинности происходит вследствие хотя бы одной нуклеотидной мутации, делеции, вставки, осуществленной известным способом, например, олигонуклеотид-опосредованным сайт-направленным мутагенезом, кассетным мутагенезом, устойчивой к ошибкам ПЦР, перетасовкой ДНК, использованием мутирующих штаммов E.coli. В другом аспекте изобретения улучшение заключается в повышении авидности CD20. В другом аспекте изобретения улучшение заключается в повышении цитотоксической активности по отношению к клетке, экспрессирующей CD20. В другом аспекте изобретения улучшение заключается в повышении уровня экспрессии. В другом аспекте изобретения улучшение заключается в повышении идиотипической активности.

В другом аспекте изобретения антитело или его фрагмент по изобретению содержат одну или более консервативных замен аминокислотных остатков в сравнении с иным антителом или его фрагментом по изобретению. В некоторых вариантах воплощения подобные замещения наблюдаются в каркасной области и/или области, определяющей комплементарность, и/или в гипервариабельных частях тяжелой и/или легкой цепей антитела или его фрагмента. В некоторых вариантах воплощения подобные замены наблюдаются только в последовательностях областей, определяющих комплементарность. В некоторых вариантах воплощения имеется приблизительно 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50 и более подобных замен. В иных вариантах воплощения имеется 1-20, 1-15, 1-10, 1-5, 1-3, 20, 19, 18, 17, 16, 15, 14,13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 или 1 подобных замен в тяжелой и/или легкой цепях антитела или его фрагмента по изобретению.

Таким образом, в настоящем изобретении предлагаются CD20-связывающие антитела или их функциональные фрагменты, и/или их конъюгаты, а также их использование при терапии заболеваний, ассоциированных с CD20-экспрессирующими клетками. В специфических аспектах антитела, которые связывают CD20, предпочтительно перестроены, гуманизированы или химеризированы. Гуманизированные антитела включают антитела с аминокислотными заменами в каркасных областях (FR) и антитела с созревшей аффинностью с заменами в областях, определяющих комплементарность (CDR). Замещение аминокислот в CDR или FR не ограничено присутствующими в антителе донора или реципиента. В других аспектах, антитела против к CD20 или их функциональные фрагменты, и/или конъюгаты по изобретению, помимо этого, содержат изменения аминокислотных остатков Fc-области, которые приводят к улучшению эффекторной функции, включая повышение КЗЦ и/или АЗКЦ функций, и к уничтожению В-клеток.

Иные антитела против CD20 или их функциональные фрагменты, и/или конъюгаты по изобретению включают те, которые имеют специфические изменения, улучшающие стабильность. В специфическом аспекте гуманизированные CD20-антитела или их функциональные фрагменты имеют повышенную стабильность.

Также представлены антитела с вариациями гликозилирования, обладающие улучшенной АЗКЦ-функцией in vivo.

В одном аспекте изобретения антитело или его фрагмент - средство специфического связывания с CD20, причем указанное средство способно индуцировать апоптоз, АЗКЦ, КЗЦ. В одном аспекте изобретения антитело или его фрагмент содержат хотя бы один полипептид, включающий хотя бы один член, выбранный из группы, состоящей из SEQ ID NOS: 1-7 и 17-36.

В другом аспекте настоящее изобретение является антителом или его фрагментом, производимым гибридомой, соответствующей АТСС Accession No РТА-10486 или гибридомой, соответствующей АТСС Accession No РТА-10487.

Для диагностических целей антитела и их фрагменты по настоящему изобретению, как правило, маркируются детектируемой группой. Детектируемой меткой может выступать любая метка, способная производить детектируемый сигнал прямо или косвенно. К примеру, детектируемая группа может быть радиоактивным изотопом, например, 3H, 14С, 32P, 35S, или 131I; флуоресцентным или хемилюминесцентным соединением, например, флуоресцеин-изотиацинатом, родамином или люциферином; ферментом, например, щелочной фосфатазой, бета-галактозидазой или пероксидазой хрена.

В одном аспекте настоящее изобретение является цитолитическим антителом против CD20 и/или его фрагментом. В одном аспекте изобретения конъюгат CD20-специфического цитолитического антитела полезен для лечения медицинских состояний, при которых В-клетки, экспрессирующие CD20, влияют на течение состояния. В одном аспекте интересующие В-клетки являются нежелательными. В одном аспекте медицинское состояние является заболеванием В-клеток. В одном аспекте медицинское состояние включает активность нежелательных В-клеток. Другой аспект изобретения является конъюгатом антитела, специфически связывающимся с CD20, причем упомянутое антитело или фрагмент способны индуцировать апоптоз, антителозависимую клеточноопосредованную цитотоксичность (АЗКЦ) и комплементзависимую цитотоксичность (КЗЦ) в клетке, экспрессирующей CD20. В одном аспекте медицинское состояние - Неходжкинская лимфома.

Один аспект изобретения - конъюгат антитела против CD20 или его фрагмента, содержащий антитело или фрагмент, соединенные с цитотоксическим агентом. Цитотоксический агент, используемый в конъюгате, может быть майтансиноидом и аналогами майтансиноидов, бензодиазепинами, таксанами, СС-1065 и аналогами СС-1065, дуокармицином и аналогами дуокармицина, энедиинами, например, калихеамицином, доластатином и аналогами доластатина, включая ауристатины, производные томаимицина, производные лептомицина.

Более предпочтительны такие цитотоксические агенты, как майтансиноиды и аналоги майтансиноидов, бензодиазепины, таксаны, СС-1065 и аналоги СС-1065.

Майтансиноиды и аналоги майтансиноидов - предпочтительные цитотоксические агенты. Примеры подходящих майтансиноидов известны специалистам в данной области техники и включают сложные эфиры майтансинола и аналоги майтансинола. Подходящие майтансиноиды описаны, к примеру, в патентах США под номерами 4424219, 4256746, 4294757, 4307016, 4313946, 4315929, 4331598, 4361650, 4362663, 4364866, 4450254, 4322348, 4371533, 6333410, 5475092, 5585499, 5846545, 6444163, 6716821, 7276497, 7473796, а также в публикации US 20050169933.

Таксаны также являются предпочтительными цитотоксическими агентами. Таксаны, пригодные для использования в настоящем изобретении, описаны, например, в патентах США под номерами 6372738, 6340701, 6436931, 6596757, 7441063, 7495114 и 7598290.

Еще одним кандидатом для получения цитотоксических конъюгатов являются аналоги СС-1065, мощного противоопухолевого антибиотика, выделенного из культуры Streptomyceszelensis. СС-1065 примерно в 1000 раз более активен in vitro, чем используемые обычно противоопухолевые препараты, такие как доксорубицин, метотрексат и винкристин (B.K. Bhuyan et al., Cancer Res., 42, 3532-3537 (1982)). Аналоги СС-1065 также являются предпочтительными цитотоксическими препаратами для использования в настоящем изобретении. СС-1065 и его аналоги описаны в патентах США под номерами 6756397, 7049316, 7388026, 6372738, 6340701, 5846545 и 5585499.

Производные бензодиазепина также являются подходящими цитотоксическими препаратами для использования в настоящем изобретении. Пирролобензодиазепины, например, описанные в патентной публикации US 20090036431 и в заявке ЕР 2019104, также являются подходящими цитотоксическими препаратами. Также пригодны производные бензодиазепинов, например, описанные в предварительной заявке США №61/150201.

Такие цитотоксические препараты как метотрексат, цисплатин, карбоплатин, даунорубицин, доксорубицин, винкристин, винбластин, мелфалан, митотмицин С, хлорамбуцил и морфолино-доксорубицин также пригодны для приготовления конъюгатов согласно настоящему изобретению.

Чтобы связать цитотоксический агент с антителом, используется линкерная группа. Подходящие расщепляемые и нерасщепляемые линкерные группы описаны здесь и хорошо известны в данной области техники и включают, к примеру, дисульфидные группы, тиоэфирные группы, кислото-лабильные группы, фотолабильные группы, петидаза-лабильные группы и эстераза-лабильные группы. Предпочтительные линкерные группы - дисульфидные и тиоэфирные, особенно - описанные в патенте США 6913748, патентных публикациях US 20050169933, 20090274713 и WO 2009/0134976. К примеру, конъюгаты могут быть сконструированы с использованием дисульфидной обменной реакции или путем образования тиоэфирной связи между антителом и цитотоксическим агентом. Предпочтительные линкеры для модифицирования антител с целью получения дисульфидно-связанных конъюгатов - N-сукцинимидил 4-(2-пиридилдитио)пентаноат (SPP), N-сукцинимидил 4-(2-пиридилдитио)бутаноат (SPDB) или N-сукцинимидил 4-(2-пиридилдитио)-2-сульфобутаноат(сульфо-SPDB).

Настоящее изобретение включает аспекты, при которых конъюгирование майтансиноидов с антителом через нерасщепляемые линкеры увеличивает его активность, позволяя достижение высоких доз in vivo с сохранением функциональной активности антитела против CD20 или его фрагмента. Предпочтительные нерасщепляемые линкеры для модифицирования антитела или фрагмента антитела с получением тиоэфирной связи с майтансиноидом -N-сукцинимидил 4-(малеимидометил) циклогексанкарбоксилат(SMCC), N-сульфосукцинимидил 4-(малеимидометил) циклогексанкарбоксилат (sulfoSMCC), N-сукцинимидил-4-(иодацетил)-аминобензоат(SIAB).

Настоящее изобретение также включает аспекты, в которых линкеры, описанные здесь, гидрофильны (например, включают ПЭГ) и влияют на увеличение активности препарата. Таким образом, другой аспект изобретения включает улучшенные способы присоединения препарата к антителу против CD20, например, такие, при которых линкер дает конъюгаты, активные против широкого спектра опухолей, особенно с низкой экспрессией антигена или устойчивых к препаратам. Помимо этого, при внедрении данных гидрофильных линкеров возможно конъюгирование вплоть до 15 молекул препарата с молекулой антитела с высоким выходом и без агрегации или преципитации. Данные конъюгаты с гидрофильными линкерами с вплоть до 15 молекул препарата на молекулу антитела с высокой аффинностью связываются с антигеном-мишенью CD20 (аналогично немодифицированному антителу). Предпочтительный гидрофильный линкер для модифицирования антитела - N-сукцинимидил-[(N-малеимидопропионамидо)-тетраэтиленгликолевый] сложный эфир (NHS-PEG4-малеимида).

Настоящее изобретение также включает аспекты, в которых линкеры, описанные здесь, не имеют атома серы, например, линкеры, полученные из двухосновных карбоновых кислот (см. публикацию US 2005016993).

Настоящее изобретение также включает аспекты, в которых описанные здесь линкеры заряжены, причем заряды сохраняются после модифицирования антитела против CD20 или его фрагмента и в полученном конъюгате препарата.

Настоящее изобретение также включает аспекты, в которых к антителу против CD20 или его фрагменту присоединяется 2-8 молекул препарата. Предпочтительный аспект - конъюгат, в котором примерно 2-8 молекул присоединены к антителу против CD20 или его фрагменту, и цитотоксический эффект конъюгата более высок, чем в случае нагрузки препарата меньшим или большим количеством молекул препарата, присоединенных к такому же антителу против CD20.

Следующий аспект настоящего изобретения - способ терапии рака, чувствительного к лечению данным способом, указанный способ, содержащий парентеральное введение нуждающемуся в этом пациенту эффективной дозы композиции, содержащей конъюгат с формулой

CB-[X1-(-CH2-CH2-O-)n-Yp-D]m (формула II)

или D-Yp-(-CH2-CH2-O-)n-X1]m-CB (формула II′),

где СВ обозначает антитело против CD20;

D обозначает препарат;

Х обозначает алифатическую, ароматическую или гетероциклическую единицу, присоединенную к агенту, связывающемуся с клеткой через тиоэфирную связь, амидную связь, карбаматную связь или простую эфирную связь;

Y обозначает алифатическую, ароматическую или гетероциклическую единицу, присоединенную к препарату через ковалентную связь, выбранную из группы, состоящей из тиоэфирной связи, амидной связи, карбаматной связи, простой эфирной связи, аминной связи, углерод-углеродной связи и гидразоновой связи;

1 равно 0 или 1;

р равно 0 или 1;

m является целым числом от 2 до 15; и

n является целым числом от 1 до 2000.

Существенно, что конъюгаты, описанные по изобретению, высокоактивны или эффективны против CD20-экспрессирующих клеток с мультипрепаратной резистентностью (mdr), малочувствительных к терапии цитотоксическими препаратами. К примеру, терапия онкологических заболеваний с трудом преодолевает механизмы резистентности к препаратам, которая часто развивается после нескольких циклов терапии различными химиотерапевтическими препаратами. Один такой механизм, наблюдаемый в раковых клетках, называется мультипрепаратной резистентностью и обусловлен усиленным выведением препаратов АТФ-связывающими кассетными (АВС) транспортерами (С. Drumond, В. I. Sikic, J. din. Oncology, 1999, 17, 1061-1070, G. Szokacs et al., Nature Reviews, 5; 219 - 234, 2006). Весьма ценны терапевтические способы, преодолевающие данные механизмы резистентности к препаратам, например, обусловленные вмешательством в данный путь выведения препаратов, использующийся раковыми клетками.

Один аспект изобретения - композиция, содержащая антитело или его фрагмент, и/или конъюгат. Еще один аспект настоящего изобретения - фармацевтическая композиция, содержащая антитело или его фрагмент, и/или конъюгат, а также фармацевтически приемлемый носитель. В одном аспекте изобретения фармацевтическая композиция с антителом или фрагментом содержит конъюгат и фармацевтически приемлемый носитель. Настоящее изобретение включает композицию (например, фармацевтическую композицию), содержащую конъюгаты антител против CD20 или их фрагментов и носитель (например, фармацевтически приемлемый носитель).

Настоящее изобретение также включает композицию (например, фармацевтическую композицию), содержащую конъюгаты антител против CD20 или их фрагментов и носитель (фармацевтически приемлемый носитель), а также второй терапевтический агент. Настоящие композиции подходят для ингибирования аномального клеточного роста или лечения пролиферативных нарушений у млекопитающих (например, у человека). Настоящие композиции также полезны для лечения депрессии, беспокойства, стрессов, фобий, панических расстройств, дисфории, психиатрических заболеваний, боли, воспалительных заболеваний у млекопитающих (например, у человека).

В одном аспекте изобретения диагностический реактив содержит композицию, включающую антитело или его фрагмент, и/или конъюгат, описанные здесь, отличающиеся тем, что антитело или фрагмент помечены. В одном аспекте изобретения антитело или его фрагмент содержит метку, которая выбрана из группы, состоящей из радиометки, флуорофора, хромофора, визуализирующего средства и иона металла.

В одном аспекте изобретения представлен способ специфического связывания с клетками, экспрессирующими CD20. В одном аспекте изобретения CD20 экспрессируют В-клетки. В одном аспекте изобретения CD20-экспрессирующая клетка является раковой клеткой. В одном аспекте изобретения антитело или его фрагмент связывается с раковой клеткой, выбранной из группы, включающей клетки В-клеточных лимфом, включая НХЛ, прекурсорных В-клеточных лимфобластных лейкемии/лимфомы и неоплазм зрелых В-клеток, например, В-клеточной хронической лимфоцитной лейкемии (ХЛЛ)/мелкоклеточной лимфоцитной лимфомы (МЛЛ), В-клеточной пролимфоцитной лейкемии, лимфоплазмацитной лимфомы, лимфомы из клеток мантии (MCL), фолликулярной лимфомы (ФЛ), включая высокодифференцированную, среднедифференцированную и низкодифференцированную ФЛ, кожной центрально-фолликулярной лимфомы, В-клеточной лимфомы маргинальной зоны (MALT-типа, узлового и селезеночного типа), волосатоклеточного лейкоза, диффузной В-крупноклеточной лимфомы, лимфомы Беркитта, плазмацитомы, плазмаклеточной миеломы, посттрансплантационного лимфопролиферативного расстройства, макроглобулинемии Вальденстрема, а также анапластической крупноклеточной лимфомы (АККЛ).

В ином аспекте изобретения CD20-экспрессирующая клетка вызывает нежелательный иммунный ответ. В другом аспекте изобретения CD20-экспрессирующая клетка вызывает воспаление.

Антитела против CD20 или их конъюгаты, а также содержащие их композиции подходят для лечения или уменьшения тяжести нарушений, например, характеризующихся аномальным ростом клеток (например, онкологических и иммунных заболеваний и нарушений). Иные приложения изобретения включают, не ограничиваясь перечисленным, сопутствующее лечение остеопороза, депрессии, тревожности, стресса, фобий, панических состояний, дисфории, психиатрических заболеваний, боли либо его использование в качестве противоэпилептических, антибактериальных, диуретических, гипотензивных, гиполипидемических средств, а также антидепрессантов.

В одном аспекте изобретения представлен способ ингибирования роста раковой клетки, содержащий контактирование клетки с антителом или фрагментом антитела, и/или их конъюгатом.

В одном аспекте изобретения представлен способ лечения пациента с онкологическим заболеванием, содержащий введение пациенту эффективного количества описанных здесь антител, фрагментов антитела и/или их конъюгатов. В одном аспекте изобретения терапия, помимо этого, содержит введение указанному пациенту терапевтического агента. В одном аспекте изобретения терапевтический агент является цитотоксическим агентом.

В еще одном аспекте изобретение является CD20-специфическим цитолитическим антителом или его фрагментом, либо их конъюгатом, пригодным для терапии воспалительных заболеваний, например, ревматоидного артрита и т.п. В дополнительном аспекте изобретение является CD20-направленным цитолитическим антителом или его фрагментом, либо их конъюгатом, пригодным для терапии ревматоидного артрита в комбинации с метотрексатом. В одном аспекте изобретение является CD20-специфическим цитолитическим антителом или его фрагментом, либо их конъюгатом, пригодным для терапии ревматоидного артрита в комбинации с метотрексатом у пациентов с ревматоидным артритом средней или высокой активности и с неадекватным ответом на один и более терапевтических курсов с агонистом ФНО.

В одном аспекте изобретения антитело или его фрагмент, либо их конъюгаты применяются в способе лечения пациента с онкологическим заболеванием, содержащем введение указанному пациенту эффективного количества конъюгата, описанного здесь. В одном аспекте изобретения онкологическое заболевание, которое подвергается лечению, выбрано из группы, включающей В-клеточные лимфомы, включая НХЛ, прекурсорные В-клеточные лимфобластные лейкемию/лимфому и неоплазмы зрелых В-клеток, например, В-клеточную хроническую лимфоцитную лейкемию (ХЛЛ)/мелкоклеточную лимфоцитарную лимфому (МЛЛ), В-клеточную пролимфоцитную лейкемию, лимфоплазмацитную лимфому, лимфому из клеток мантии (MCL), фолликулярную лимфому (ФЛ), включая высокодифференцированную, среднедифференцированную и низкодифференцированную ФЛ, кожную центрально-фолликулярную лимфому, В-клеточную лимфому маргинальной зоны (MALT-типа, узлового и селезеночного типа), волосатоклеточный лейкоз, диффузную В-крупноклеточную лимфому, лимфому Беркитта, плазмацитому, плазмаклеточную миелому, посттрансплантационное лимфопролиферативное расстройство, макроглобулинемию Вальденстрема, а также анапластическую крупноклеточную лимфому (АККЛ).

В одном аспекте изобретения представлен способ диагностирования субъекта с подозрением на рак, включающий введение субъекту диагностического реагента и детектирование распределения реагента в организме субъекта. В одном аспекте изобретения способ диагностики включает диагностирование заболевания, которое выбрано из группы, включающей В-клеточные лимфомы, включая НХЛ, прекурсорные В-клеточные лимфобластные лейкемию/лимфому и неоплазмы зрелых В-клеток, например, В-клеточную хроническую лимфоцитную лейкемию (ХЛЛ)/мелкоклеточную лимфоцитарную лимфому (МЛЛ), В-клеточную пролимфоцитную лейкемию, лимфоплазмацитную лимфому, лимфому из клеток мантии (MCL), фолликулярную лимфому (ФЛ), включая высокодифференцированную, среднедифференцированную и низкодифференцированную ФЛ, кожную центрально-фолликулярную лимфому, В-клеточную лимфому маргинальной зоны (MALT-типа, узлового и селезеночного типа), волосатоклеточный лейкоз, диффузную В-крупноклеточную лимфому, лимфому Беркитта, плазмацитому, плазмаклеточную миелому, посттрансплантационное лимфопролиферативное расстройство, макроглобулинемию Вальденстрема, а также анапластическую крупноклеточную лимфому (АККЛ).

В другом аспекте изобретения представлен способ диагностирования субъекта с подозрением на иммунное нарушение, включающий введение субъекту диагностического реагента и детектирование распределения реагента в организме субъекта. В одном аспекте изобретения способ диагностирования включает диагностику иммунного нарушения, выбранного из группы, состоящей из ревматоидного артрита, ювенильного ревматоидного артрита, системной красной волчанки (СКВ), болезни Вегенера, воспалительной болезни кишечника, идиопатической тромбоцитопенической пурпуры (ИТП), тромботической тромбоцитопенической пурпуры (ТТП), аутоиммунной тромбоцитопении, множественного склероза, псориаза, IgA-нефропатии, IgM-полинейропатий, тяжелой миастении, васкулита, сахарного диабета, синдрома Рейно, болезни Крона, язвенного колита, гастрита, тиреоидита Хашимото, анкилозирующего спондилита, гепатит С-ассоциированного криоглобулинемического васкулита. Предпочтительный аспект изобретения - способ диагностирования субъекта, у которого предполагается наличие аутоиммунного или воспалительного заболевания, выбранного из группы, состоящей из ревматоидного артрита, ювенильного ревматоидного артрита, системной красной волчанки (СКВ), болезни Вегенера, воспалительной болезни кишечника, идиопатической тромбоцитопенической пурпуры (ИТП), тромботической тромбоцитопенической пурпуры (ТТП), аутоиммунной тромбоцитопении, множественного склероза, псориаза, IgA-нефропатии, IgM-полинейропатий, тяжелой миастении, васкулита, сахарного диабета, синдрома Рейно, болезни Крона, язвенного колита, гастрита, тиреоидита Хашимото, анкилозирующего спондилита, гепатит С-ассоциированного криоглобулинемического васкулита, хронического фокального энцефалита, буллезной пузырчатки, гемофилии А, мембранопролиферативного гломерулонефрита, взрослого и ювенильного дерматомиозита, взрослого полимиозита, хронической крапивницы, первичного билиарного цирроза, нейромиелита зрительного нерва, болезни Грейвса, буллезной пузырчатки, мембранопролиферативного гломерулонефрита, синдрома Чарча-Штраусса, астмы, псориатического артрита, дерматита, респираторного дистресс-синдрома, менингита, энцефалита, увеита, экземы, атеросклероза, недостаточности лейкоцитарной адгезии, ювенильного диабета, болезни Рейтера, болезни Бехчета, гемолитической анемии, атопического дерматита, вульгарной пузырчатки, гранулематоза Вегенера, синдрома Оменна, хронической почечной недостаточности, острого инфекционного мононуклеоза, ВИЧ- и герпес-ассоциированных заболеваний, системного склероза, синдрома Сергена и гломерулонефрита. Если аутоиммунное заболевание является ревматоидным артритом, то антитело, необязательно, может вводиться вместе со вторым терапевтическим агентом, предпочтительно - метотрексатом.

Следующий аспект изобретения - способ индукции апоптоза В-клеток in vivo, включающий контактирование В-клеток с антителом и/или его конъюгатом по настоящему изобретению, убивая В-клетки.

В изобретении также предлагаются способы лечения заболеваний введением млекопитающему, например, болеющему человеку, CD20-связывающих антител или их фрагментов, и/или конъюгатов. В любом способе лечения аутоиммунного заболевания или опухоли, экспрессирующей CD20, в одном аспекте, антитело является CD20-7 или CD20-6. Таким образом, один аспект является способом лечения CD20-положительной опухоли, содержащим введение пациенту с опухолью терапевтически эффективного количества CD20-связывающего антитела и/или его конъюгата по изобретению. В предпочтительном аспекте онкологическим заболеванием с экспрессией CD20 является В-клеточная лимфома или лейкоз, при которых экспрессируется CD20, включая неходжкинскую лимфому (НХЛ) или лимфоцит-предоминантную ходжкинскую болезнь (LPHD), хронический лимфоцитарный лейкоз (ХЛЛ) или мелкоклеточную лимфоцитарную лимфому (МКЛЛ). В одном аспекте способа лечения В-клеточной лимфомы или лейкоза антитело и/или его конъюгат вводят в интервале доз примерно 20-2000 мг/м2. В дополнительных аспектах способ лечения, помимо этого, содержит введение пациенту хотя бы одного химиотерапевтического агента, причем для неходжкинской лимфомы (НХЛ) химиотерапевтический агент выбран из группы, состоящей из доксорубицина, циклофосфамида, винкристина и преднизолона.

Также представлен способ лечения аутоиммунного или воспалительного заболевания, содержащий введение пациенту с аутоиммунным или воспалительным заболеванием терапевтически эффективного количества CD20-связывающего антитела и/или его конъюгата, обсуждающихся здесь. Аутоиммунное или воспалительное заболевания выбрано из группы, состоящей из ревматоидного артрита, ювенильного ревматоидного артрита, системной красной волчанки (СКВ), болезни Вегенера, воспалительной болезни кишечника, идиопатической тромбоцитопенической пурпуры (ИТП), тромботической тромбоцитопенической пурпуры (ТТП), аутоиммунной тромбоцитопении, множественного склероза, псориаза, IgA-нефропатии, IgM-полинейропатий, тяжелой миастении, васкулита, сахарного диабета, синдрома Рейно, болезни Крона, язвенного колита, гастрита, тиреоидита Хашимото, анкилозирующего спондилита, гепатит С-ассоциированного криоглобулинемического васкулита, хронического фокального энцефалита, буллезной пузырчатки, гемофилии А, мембранопролиферативного гломерулонефрита, взрослого и ювенильного дерматомиозита, взрослого полимиозита, хронической крапивницы, первичного билиарного цирроза, нейромиелита зрительного нерва, болезни Грейвса, буллезной пузырчатки, мембранопролиферативного гломерулонефрита, синдрома Чарча-Штраусса, астмы, псориатического артрита, дерматита, респираторного дистресс-синдрома, менингита, энцефалита, увеита, экземы, атеросклероза, недостаточности лейкоцитарной адгезии, ювенильного диабета, болезни Рейтера, болезни Бехчета, гемолитической анемии, атопического дерматита, вульгарной пузырчатки, гранулематоза Вегенера, синдрома Оменна, хронической почечной недостаточности, острого инфекционного мононуклеоза, ВИЧ- и герпес-ассоциированных заболеваний, системного склероза, синдрома Сергена и гломерулонефрита. Если аутоиммунное заболевание является ревматоидным артритом, то антитело, необязательно, может вводиться вместе со вторым терапевтическим агентом, предпочтительно - метотрексатом.

В одном аспекте в изобретении предлагается способ лечения аутоиммунного или воспалительного заболевания, выбранного из группы, состоящей из дерматомиозита, гранулематоза Вегенера, АНЦА, апластической анемии, аутоиммунной гемолитической анемии (АИГА), недостаточности фактора VIII, гемофилии А, аутоиммунной нейтропении, синдрома Каслмана, синдрома Гудпасчера, отторжения трансплантата солидного органа, реакции трансплантат против хозяина (РТПК), IgM-обусловленного, тромботической тромбоцитопенической пурпуры (ТТП), тиреоидита Хашимото, аутоиммунного гепатита, лимфоидной интерстициальной пневмонии (ВИЧ), облитерирующего бронхиолита (нетрансплантатного) против НСИП, синдрома Гийена-Барре, крупнососудистого васкулита, гигантскоклеточного (Такаясу) артериита, среднесосудистого васкулита, болезни Кавасаки, узелкового полиартериита, содержащий введение пациенту, страдающему от этого заболевания, терапевтически эффективного количества CD20-связывающего антитела и/или конъюгата. В одном аспекте данного способа CD20-связывающее антитело является CD20-7 или CD20-6.

По способам лечения, предложенным заявителем, CD20-связывающие антитела и/или их конъюгаты могут вводиться сами по себе либо совместно со вторым лекарственным препаратом, например, вторым антителом, химиотерапевтическим агентом или иммуносупрессивным агентом. Второе антитело или его фрагмент, и/или конъюгат могут быть антителом, связывающимся с CD20, или другим антигеном В-клеток, или антигеном НК-клеток или Т-клеток. В одном аспекте второе антитело или его фрагмент, и/или конъюгат, являются антителом против CD20-7 с радиометкой. В других аспектах CD20-связывающее антитело конъюгировано с цитотоксическим агентом, включая токсин или радиоактивный изотоп.

Настоящее изобретение включает способ ингибирования нежелательных В-клеток и/или аномального клеточного роста, либо лечения пролиферативного нарушения у млекопитающих (например, людей), содержащий введение указанному млекопитающему терапевтически эффективного количество антител против CD20 и/или его конъюгатов (и/или его сольватов и солей), или композиций, по одному или в комбинации со вторым терапевтическим агентом.

Один аспект настоящего изобретения - жидкая композиция, содержащая антитело против CD20 и/или его конъюгат в количестве примерно 20 мг/мл антител, приблизительно 10 мМ гистидина сульфата с рН 5,8, примерно 60 мг/мл сахарозы (6%) и приблизительно 0,2 мг/мл полисорбата-20 (0,02%).

В изобретении также предлагаются различные изолированные нуклеиновые кислоты, кодирующие любое из антител, описанных здесь, включающие вектора экспрессии, экспрессирующие антитело и/или фрагменты антитела. Один аспект настоящего изобретения включает полинуклеотид(ы), кодирующие антитело или фрагмент, описанные здесь.

В одном аспекте изобретения полинуклеотид кодирует легкую или тяжелую цепь антитела или его фрагмента, и/или конъюгата, и полинуклеотид является ДНК или РНК. В одном аспекте изобретения полинуклеотид является вектором. В другом аспекте изобретения вектор является вектором экспрессии, способным экспрессировать указанное антитело или фрагмент.

В изобретении предлагается изолированная нуклеиновая кислота, содержащая нуклеотидную последовательность SEQ ID NO:8-16, либо вырожденный вариант этих последовательностей и тому подобное. Один аспект - изолированная нуклеиновая кислота, содержащая последовательность, кодирующую полипептид с аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO:1-7 и 17-36, необязательно, с консервативными аминокислотными заменами.

Другой аспект - вектор, содержащий нуклеиновую кислоту, описанную здесь, включая вектор экспрессии для экспрессии в клетке-хозяине. Также включены клетки-хозяева, содержащие вектор.

Другой аспект изобретения включает клетки-хозяева, содержащие нуклеиновые кислоты, и клетки-хозяева, продуцирующие антитело или фрагменты. В предпочтительном аспекте последнего клетка-хозяин является клеткой CHO или клеткой NS0.

Представлен способ получения антител и/или их конъюгатов, способ, содержащий культивирование клетки-хозяина, производящей антитело, и выделение антитела из клеточной культуры.

Настоящее изобретение включает способы синтезирования и использования антител против CD20 и/или конъюгатов для диагностики или терапии клеток млекопитающих, организмов или ассоциированных патологических состояний in vitro, in situ и in vivo.

Аспекты настоящего изобретения могут быть представлены в виде описания производства или набора.

Для целей диагностирования и лечения субъекта изделие, помимо этого, содержит инструкцию, поясняющую, что композиция используется для диагностирования или лечения соответствующего заболевания или нарушения.

В наиболее предпочтительном аспекте из всех в антителах, фрагментах антител, конъюгатах, композициях и способах применения изобретения, включающих перестроенное CD20-связывающее антитело, это антитело является CD20-7 и имеет аминокислотные последовательности легкой и тяжелой цепей, определенные здесь.

Краткое описание фигур

На Фигуре 1 представлены гистограммы связывания антитела с нетрансфицированными контрольными клетками 300-19 (слева) и CD20-экспрессирующими клетками 300-19 (справа). Показаны гистограммы окрашивания с 10 нМ muCD20-6 (сверху), muCD20-7 (в центре) и в отсутствии первичного антитела (снизу).

На Фигуре 2 представлено связывание (Фигура 1А) muCD20-7 и (Фигура 1В) muCD20-6 с клетками BJAB по данным проточной цитометрии. Кривая связывания использовалась для определения величины ЕС50 связывания антител, которая соответствует кажущейся Kd антитела.

На Фигуре 3 представлены результаты анализа с Аннексином-V (Фигура 3А) клеток лимфомы Ramos, инкубированных с 10 нМ ритуксимаба, muCD20-2, muCD20-5, muCD20-6 или muCD20-7 и (Фигура 3В) клеток лимфомы Raji, инкубированных с 10 нМ ритуксимаба, В1, muCD20-2, либо muCD20-7. Для сравнения представлены контрольные образцы.

На Фигуре 4 представлены результаты анализа липидных рафтов с использованием клеток Ramos, окрашенных антителами против CD20 или контрольными антителами изотипа muIgG1 в концентрации 10 мкг/мл. СИФ для FL1, определенная для образцов в отсутствие (черные столбцы) и в присутствие (белые столбцы) Triton-X 100; представлены данные для каждого протестированного антитела. Протестированными антителами были:

(Фигура 4А) muCD20-2, muCD20-7, ритуксимаб, muIgG-контрольное антитело и (Фигура 4В) muCD20-2, muCD20-5, muCD20-6, muCD20-7, muIgG-контрольное антитело.

На Фигуре 5 представлены результаты анализа с Аннексином-V клеток лимфомы Ramos, инкубированных с 10 нМ chCD20-2, chCD20-7, ритуксимаба и контроля (без антител).

На Фигуре 6 представлены результаты КЗЦ-анализов клеток Daudi (Фигура 6А) и WSU-DLCL-2 (Фигура 6В), инкубированных с chCD20-2, chCD20-7, ритуксимабом или контрольным антителом huIgG1-изотипа в присутствии 5% человеческой сыворотки, содержащей комплемент.

На Фигуре 7 представлены поверхностные остатки CD20-7 и замещения в перестроенных версиях для CD20-7 VL (Фигура 7А) и CD20-7 VH (Фигура 7В).

На Фигуре 8 представлено выравнивание примерных перестроенных последовательностей вариабельного района CD20-7 в сравнении с эквивалентной мышиной последовательностью. Фигура 8А - вариабельный домен легкой цепи (VL), Фигура 8В - вариабельный домен тяжелой цепи (VH). Черточками «-» показаны идентичные с мышиной последовательностью остатки.

На Фигуре 9 представлено связывание muCD20-7, chCD20-7 и huCD20-7, но без контрольного антитела huIgG1-изотипа с клетками BJAB по данным проточной цитометрии. Кривые связывания использовались для определения величины EC50 связывания антител, которая соответствует кажущейся Kd каждого антитела.

На Фигуре 10 представлено связывание huCD20-7 с мембранным препаратом из клеток лимфомы WSU-DLCL-2 по данным ELISA.

На Фигуре 11 представлены результаты анализа с Аннексином-V клеток лимфомы Ramos, инкубированных с muCD20-7, huCD20-7, либо контрольным антителом huIgG1-изотипа в концентрациях 10 нМ, 1 нМ и 0,1 нМ.

На Фигуре 12 представлены результаты анализа с Аннексином-V клеток лимфомы Ramos, инкубированных с huCD20-7, В1, ритуксимабом, GA101-F и 2F2 в концентрациях 3×10-8М - 1,7×10-13М. Сравниваются контрольные образцы. «В1» соответствует немеченой форме Bexxar® (Beckman Coulter), «GA101-F» соответствует фукозилированной версии афутузумаба или GA101 (Hoffman LaRoche), «2F2» соответствует офатумумабу (Genmab/GSK).

На Фигуре 13 представлены результаты анализов с Аннексином-V клеток лимфомы, инкубированных с 10 нМ huCD20-7, В1 или ритуксимаба. Для сравнения использовались контрольные образцы необработанных клеток. Эксперименты проводились над клетками Ramos (Фигура 13А), клетками Raji (Фигура 13В), клетками WSU-DLCL-2 (Фигура 13 С), клетками Jeko-1 (Фигура 13D) и клетками лимфомы Granta-519 (Фигура 13Е).

На Фигуре 14 представлены результаты анализа липидных рафтов с использованием клеток Ramos и антител huCD20-7, ритуксимаба, 2F2 и GA101-F в концентрации 10 мкг/мл. СИФ для FL1, определенная для образцов в отсутствие (черные столбцы) и в присутствие (белые столбцы) Triton-X 100; представлены данные для каждого протестированного антитела.

На Фигуре 15 представлены результаты КЗЦ-анализов клеток лимфом Daudi (Фигура 15А) и Ramos (Фигура 15В), инкубированных с huCD20-7, ритуксимабом, GA101-F или контрольным антителом huIgG1-изотипа в присутствии 5% человеческой сыворотки, содержащей комплемент.

На Фигуре 16 представлены результаты КЗЦ-анализов клеток лимфом WSU-DLCL-2 (Фигура 16А) и RL (Фигура 16В), инкубированных с huCD20-7, ритуксимабом или контрольным антителом huIgG1-изотипа в присутствии 5% человеческой сыворотки, содержащей комплемент.

На Фигуре 17 представлены результаты АЗКЦ-анализа клеток лимфом Ramos (Фигура 17А) и JVM-13 CLL (Фигура 17В), инкубированных с huCD20-7, ритуксимабом, 2F2 или контрольным антителом huIgG1-изотипа в присутствии очищенных человеческих НК-клеток в качестве эффекторных клеток.

На Фигуре 18 представлено связывание панели CD20-антител с клетками, трансфицированными человеческим CD20, по данным проточной цитометрии с использованием huCD20-7, ритуксимаба, 2F2, GA101-F, В1 (Фигура 18А) и muCD20-6, и muCD20-7 (Фигура 18В).

На Фигуре 19 представлено связывание панели CD20-антител с клетками, трансфицированными человеческим CD20 A179S P172S, по данным проточной цитометрии с использованием huCD20-7, ритуксимаба, 2F2, GA101-F, В1 (Фигура 19А) и muCD20-6, и muCD20-7, ритуксимаба и 2F2 (Фигура 19В).

На Фигуре 20 представлено связывание панели CD20-антител с клетками, трансфицированными человеческим CD20 N163D, по данным проточной цитометрии с использованием huCD20-7, ритуксимаба, 2F2, GA101-F, В1 (Фигура 20А) и muCD20-6, и muCD20-7, ритуксимаба и 2F2 (Фигура 20В).

На Фигуре 21 представлено связывание панели CD20-антител с клетками, трансфицированными человеческим CD20 N163D N166D, по данным проточной цитометрии с использованием huCD20-7, ритуксимаба, 2F2, GA101-F (Фигура 21А) и muCD20-6, и muCD20-7, ритуксимаба и 2F2 (Фигура 21В).

На Фигуре 22 представлено связывание huCD20-7 в сравнении с конъюгатами huCD20-7-SMCC-DM1 и -SPP-DM1 (Фигура 22А) или huCD20-7-sulfbmal-DM4 (Фигура 22В) с мембранным препаратом из клеток лимфомы WSU-DLCL-2 по данным ELISA.

На Фигуре 23 представлены результаты анализа с Аннексином-V клеток лимфомы Ramos, инкубированных с ритуксимабом, huCD20-7, huCD20-7-SMCC-DM1, либо huCD20-7-SPDB-DM4 в концентрациях 3×10-8М - 1×10-11M. Клетки Ramos были обработаны одинаковыми концентрациями несвязывающихся конъюгатов huIgG1-SMCC-DM1 и huIgG1-SPDB-DM4.

На Фигуре 24 представлены результаты КЗЦ-анализов клеток лимфом Daudi (Фигура 24А) и WSU-DLCL-2 (Фигура 24В), инкубированных с huCD20-7, huCD20-7-SPDB-DM4, huCD20-7-PEG4-mal-DM4, ритуксимабом или контрольным антителом huIgG1-изотипа в присутствии 5% человеческой сыворотки, содержащей комплемент.

На Фигуре 25 представлены результаты КЗЦ-анализов клеток лимфом WSU-DLCL-2 (Фигура 25А) и Ramos (Фигура 25В), инкубированных с huCD20-7, huCD20-7-SMCC-DM1, huCD20-7-sulfo-mal-DM4, ритуксимабом или контрольным антителом huIgG1-изотипа в присутствии 5% человеческой сыворотки, содержащей комплемент.

На Фигуре 26 представлены результаты АЗКЦ-анализа клеток лимфом Ramos (Фигура 26А) и Granta-519 (Фигура 26В), инкубированных с huCD20-7, huCD20-7-SMCC-DM1, ритуксимабом, 2F2 или контрольным антителом huIgG1-изотипа в присутствии очищенных человеческих НК-клеток в качестве эффекторных клеток.

На Фигуре 27 представлены результаты анализа цитотоксичности WST-8 клеток лимфомы Ramos (Фигура 27А) и Daudi (Фигура 27В), инкубированных с huCD20-7, huCD20-7-SMCC-DM1, ритуксимабом или контрольным конъюгатом huIgG1-SMCC-DM1 в концентрациях 3×10-8М-1×10-11М в течение 5 дней.

На Фигуре 28 представлены результаты анализа цитотоксичности WST-8 клеток лимфомы Granta-519 (Фигура 28А) и SC-1 (Фигура 28В), инкубированных с huCD20-7, huCD20-7-SMCC-DM1, ритуксимабом или контрольным несвязывающимся конъюгатом huIgG1-SMCC-DM1 в концентрациях 3×10-8М-1×10-11M в течение 5 дней.

На Фигуре 29 представлены результаты анализа цитотоксичности WST-8 клеток лимфомы В-клеток DOHH-2 (Фигура 29А) и лейкоза Т-клеток Molt-4 (Фигура 29В), инкубированных chuCD20-7, huCD20-7-SMCC-DM1, ритуксимабом или контрольным конъюгатом huIgG1-SMCC-DM1 в концентрациях 3×10-8 М - 1×10-11 М в течение 5 дней. Клетки Molt-4 CD20-отрицательны.

На Фигуре 30 представлены результаты анализа цитотоксичности WST-8 клеток лимфомы Ramos (Фигура 30A) и Daudi (Фигура 30B), инкубированных с huCD20-7, huCD20-7-SMCC-DM1, ритуксимабом, ритуксимаб-SMCC-DM1 или несвязывающимся антителом huIgG1 и контрольным конъюгатом huIgG1-SMCC-DM1 в концентрациях 3× 10-8М-1×10-11М в течение 5 дней.

На Фигуре 31 представлено (Фигура 31А) связывание huCD20-7, huCD20-7-SMCC-[H3]DM1, ритуксимаба или ритуксимаб-SMCC-[3H]DM1 с клетками SU-DHL-4 по данным проточной цитометрии. На Фигуре 31В представлены результаты анализа цитотоксичности WST-8 антиген-положительных клеток В-клеточной лимфомы SU-DHL-4 и антиген-отрицательных клеток рака ободочной кишки COL0205, инкубированных с huCD20-7, huCD20-7-SMCC-[3H]DM1, ритуксимабом или ритуксимаб-SMCC-[3Н]DM1 в течение 5 дней.

На Фигуре 32 представлено (Фигура 32А) количество huCD20-7-SMCC-[3H]DM1 иритуксимаб-SMCC-[3H]DM1, связанное на клетку SU-DHL-4 и (Фигура 32В) количество метаболита лизин-SMCC-[3H]DM1, образовавшегося спустя 22 ч после экспозиции клеток SU-DHL-4 к huCD20-7-SMCC-[3H]DM1 или ритуксимаб-SMCC-[3Н]DM1.

На Фигуре 33 представлены показательные результаты анализа цитотоксичности WST-8 на клетках Granta-519, инкубированных с huCD20-7, huCD20-7-SMCC-DM1, huCD20-7-PEG4-mal-DM4 и huCD20-7-SPDB-DM4 (Фигура 33A), и huCD20-7, huCD20-7-SMCC-DM1, huCD20-7-SPP-DM1, huCD20-7-sulfo-mal-DM4, и контрольными конъюгатами huIgG1-SMCC-DM1 и huIgG1-SPP-DM1 (Фигура 33B) в концентрациях в интервале от 3×10-8М до 1×10-11 M в течение 5 дней.

На Фигуре 34 показаны результаты экспериментов с использованием установленной ксенотрансплантатной модели клеток диффузной В-крупноклеточной лимфомы SU-DHL-4, имплантированных подкожно мышам с ТКИН. Мыши получали три раза еженедельно на 14, 21 и 28 дни (стрелки) после инокуляции клеток либо по 10 мг/кг, либо по 1 мг/кг huCD20-7 или ритуксимаба. Построены графики зависимости медианного объема опухоли в различных терапевтических группах от времени после инокуляции опухолевых клеток.

На Фигуре 35 представлены результаты ксенотрансплантатного in vivo исследования с использованием клеток лимфомы Daudi, внутривенно имплантированных мышам с ТКИН. Мыши получали однократно на 7 день после инокуляции клеток либо 10 мг/кг huCD20-7, 10 мг/кг huCD20-7-SMCC-DM1, либо 5 мг/кг huCD20-7-SPP-DM1 (Фигура 35А), либо 10 мг/кг huCD20-7, ритуксимаба, huCD20-7-SMCC-DM1 или huCD20-7-BMPS-DM1 (Фигура 35В). Построены графики зависимости количества выживших мышей в различных терапевтических группах от времени после введения опухолевых клеток.

На Фигуре 36 представлены результаты типического ксенотрансплантатного исследования с использованием клеток фолликулярной лимфомы DOHH-2, внутривенно имплантированных мышам с ТКИН. Мыши получали однократно на 3 день после инокуляции клеток либо 10 мг/кг huCD20-7, 10 мг/кг huCD20-7-SMCC-DM1, либо 5 мг/кг huCD20-7-SPP-DM1. Построены графики зависимости медианного объема опухоли в различных терапевтических группах от времени после инокуляции опухолевых клеток.

Детальное описание изобретения

В настоящем изобретении представлен новый класс антител против CD20 (а именно - тип III), который обладает высокой активностью в следующих трех цитотоксических воздействиях, направленных против CD20-экспрессирующих (например, положительных) клеток: индукции апоптоза, АЗКЦ, КЗЦ. Кроме того, конъюгаты антител против CD20 с SMCC-DM1 неожиданно эффективно приводят к гибели CD20-экспрессирующих клеток, что было продемонстрировано на опухолевых моделях in vivo.

Определения

Во всех аспектах, «алифатическая группа» определяется как алкильная, алкенильная или алкинильная группа. Алкильная группа - алифатическая углеводородная группа, которая может быть прямой или разветвленной, предпочтительно имеющей 1-20 атомов углерода в цепи, либо циклической, предпочтительно имеющей 3-10 атомов углерода. Более предпочтительные алкильные группы имеют 1-12 атомов углерода в цепи. «Разветвленная» обозначает, что одна или более коротких алкильных групп, например, метил, этил, пропил, присоединены к линейной алкильной цепи. Примерами алкильных групп служат метил, этил, н-пропил, и-пропил, н-бутил, трет-бутил, н-пентил, 3-пентил, октил, нонил, децил, циклопентил и циклогексил.

Алкенильная группа - алифатическая углеводородная группа, содержащая двойную связь углерод-углерод и которая может быть прямой или разветвленной, предпочтительно имеющей 2-15 атомов углерода в цепи. Более предпочтительные алкенильные группы имеют 2-12 атомов углерода в цепи, а наиболее предпочтительные - около 2-4 атома углерода в цепи. Примерами алкенильных групп служат этенил, пропенил, н-бутенил, н-бутенил, 3-метилбут-2-енил, н-пентенил, гептенил, октенил, ноненил и деценил.

Алкинильная группа - алифатическая углеводородная группа, содержащая тройную связь углерод-углерод и которая может быть прямой или разветвленной, предпочтительно имеющей 2-15 атомов углерода в цепи. Более предпочтительные алкинильные группы имеют 2-12 атомов углерода в цепи, а наиболее предпочтительные - 2-4 атома углерода в цепи. Примерами алкинильных групп служат этинил, пропинил, н-бутинил, 2-бутинил, 3-метилбутинил, н-пентинил, гептинил, октинил и децинил.

При использовании в данном документе термин «ароматическая группа» обозначает замещенную или незамещенную арильную группу, содержащую ароматическую моноциклическую или многоциклическую углеводородную систему колец из 6-14 атомов углерода, предпочтительно - из 6-10 атомов углерода. Примерами арильных групп служат фенил и нафтил. Заместители включают, не ограничиваясь перечисленным, алкильные группы, галогены, нитро-, амино-, гидроксил и C13 алкокси-группы, например, метокси, этокси и пропокси.

Термины «гетероцикл», «гетероциклил» и «гетероциклическая группа» относятся к насыщенным, частично ненасыщенным или ненасыщенным, неароматическим стабильным 3-14-, предпочтительно - 5-10-членным моно-, би- или многоциклическим кольцам, в которых по меньшей мере один член кольца является гетероатомом, либо ароматическим, предпочтительно - 5-10-членным моно-, би- или многоциклическим кольцам, имеющим по меньшей мере один гетероатом. Как правило, гетероатомы включают, не ограничиваясь перечисленным, атомы кислорода, азота, серы, селена и фосфора. Предпочтительные гетероатомы - кислород, азот, сера. Гетероциклы описаны в работах Paquette, Leo A.; "Principles of Modern Heterocyclic Chemistry" (W. A. Benjamin, Нью-Йорк, 1968), в частности, в главах 1, 3, 4, 6, 7 и 9; "The Chemistry of Heterocyclic Compounds, A series of Monographs" (John Wiley & Sons, Нью-Йорк, 1950-по настоящее время), в частности, в томах 13, 14, 16, 19 и 28; а также J. Am. Chem. Soc. (1960) 82:5566. «Гетероциклил» также включает радикалы, в которых гетероциклические радикалы сочленены с насыщенным, частично ненасыщенным кольцом, либо с ароматическим карбоциклическим или гетероциклическим кольцом.

Алифатические, ароматические, гетероциклические единицы также могут содержать заряженный заместитель. Заряженный заместитель может быть отрицательно заряженной группой, выбранной, не ограничиваясь перечисленным, из карбоксилатной, сульфонатной и фосфатной, либо положительно заряженной группой, выбранной из третичной или четвертичной аминогруппы.

Термин «гетероарил» относится к моновалентному радикалу из 5- или 6-членных колец, включая конденсированные системы колец (с по меньшей мере одним ароматическим) из 5-18 атомов, содержащих один и более гетероатомов, независимо выбранных из азота, кислорода и серы. Примерами гетероарильных групп служат пиридинил (включая, к примеру, 2-гидроксипиридинил), имидазолил, имидазопиридинил, пиримидинил (включая, к примеру, 4-гидроксипиримидинил), пиразолил, триазолил, пиразинил, тетразолил, фурил, тиенил, изоксазолил, тиазолил, оксазолил, изотиазолил, пирролил, хинолинил, изохинолинил, индолил, бензимидазолил, бензофуранил, циннолинил, индазолил, индолизинил, фталазинил, пиридазинил, триазинил, изоиндолил, птеринидил, пуринил, оксадиазолил, триазолил, тиадиазолил, фуразанил, бензофуразанил, бензотиофенил, бензотиазолил, бензоксазолил, хиназолинил, хиноксалинил, нафтиридинил, а также фуропиридинил.

Гетероциклические или гетероарильные группы могут быть присоединены через углерод (углерод-связанными) либо через азот (азот-связанными), где это возможно. В качестве примера, но не в качестве ограничения, углерод-связанные гетероциклы и гетероарилы присоединены через положение 2, 3, 4, 5 или 6 пиридина, положение 3, 4, 5 или 6 пиридазина, положение 2, 4, 5 или 6 пиримидина, положение 2, 3, 5 или 6 пиразина, положение 2, 3, 4 или 5 фурана, тетрагидрофурана, тиофурана, тиофена, пиррола или тетрагидропиррола, положение 2, 4 или 5 оксазола, имидазола или тиазола, положение 3, 4 или 5 изоксазола, пиразола либо изотиазола, положение 2 или 3 азиридина, положение 2, 3 или 4 азетидина, положение 2, 3, 4, 5, 6, 7 или 8 хинолина либо через положение 1, 3, 4, 5, 6, 7 или 8 изохинолина.

В качестве примера, но не в качестве ограничения, азот-связанные гетероциклы и гетероарилы присоединены через положение 1 азиридина, азетидина, пиррола, пирролидина, 2-пирролина, 3-пирролина, имидазола, имидазолидина, 2-имидазолина, 3-имидазолина, пиразола, пиразолина, 2-пиразолина, 3-пиразолина, пиперидина, пиперазина, индола, индолина, 1H-индазола, положение 2 изоиндола или изоиндолина, положение 4 морфолина либо через положение 9 карбазола или O-карболина.

Гетероатомы, присутствующие в гетероарильных и гетероциклильных группах, включают окисленные формы, включая NO, SO и SO2. Заместители гетероарилов или гетероциклилов включают, не ограничиваясь перечисленным, алкильные группы, галогены, нитро-, амино-, гидроксил и C13 алкокси- группы, например, метокси, этокси и пропокси.

«Галогены» включают атомы фтора, хлора, брома и иода. Предпочтительны атомы фтора и хлора.

Термин «конъюгат», при использовании здесь, относится к соединению или производному, которое связано с агентом, соединяющимся с клеткой (например, с антителом против CD20 или его фрагментом), и определяется общей формулой: C-L-CBA, где C=соединение, L=линкер, CBA=агент, соединяющийся с клеткой, либо антитело против CD20 или его фрагмент. В некоторых вариантах воплощения общая формула: D-L-СВА, где D=препарат, L=линкер, CBA=агент, соединяющийся с клеткой, либо антитело против CD20 или его фрагмент, может использоваться таким же образом.

Линкер - любая химическая группа, которая может стабильно, ковалентно связывать соединение, как правило, препарат, например, майтансиноид, с агентом, соединяющимся с клеткой, например, антителом против CD20 или его фрагментом. Линкеры могут быть чувствительны или частично устойчивы к кислотному расщеплению, световому расщеплению, пептидазному расщеплению, эстеразному расщеплению, расщеплению дисульфидных связей, в условиях, при которых соединение или антитело остается активным. Подходящие линкеры хорошо известны в данной области техники и включают, к примеру, дисульфидные группы, тиоэфирные группы, кислото-лабильные группы, фотолабильные группы, петидаза-лабильные группы и эстераза-лабильные группы. Линкеры также включают заряженные линкеры и их гидрофильные формы, согласно описанным здесь и известным в данной области техники.

«Аномальный рост клеток», при использовании здесь, если не указано иное, относится к росту клеток, независимому от нормальных регуляторных механизмов (например, утратившему контактное ингибирование). Это включает, к примеру, аномальный рост: (1) опухолевых клеток (опухолей), которые пролиферируют путем экспрессии мутированной тирозинкиназы или сверхэкспрессии рецептора тирозинкиназы; (2) доброкачественных и злокачественных клеток иных пролиферативных заболеваний, при которых происходит активация искаженной тирозинкиназы; (3) любых опухолей, пролиферирующих через рецепторы тирозинкиназ; (4) любых опухолей, пролиферирующих через активацию искаженной сериновой/треонининовой киназы; и (5) доброкачественных и злокачественных клеток иных пролиферативных заболеваний, при которых происходит активация искаженной сериновой/треонининовой киназы.

Настоящее изобретение может использоваться для лечения и/или профилактики множества заболеваний, при которых клетки экспрессируют CD20, включая онкологические заболевания и иммунные заболевания, в т. ч. аутоиммунные или воспалительные заболевания.

Термины «рак» и «раковый» относятся к или описывают физиологическое состояние у млекопитающих, типично характеризуемое нерегулируемым клеточным ростом. «Опухоль» содержит одну или более раковых клеток. Примеры рака включают, не ограничиваясь перечисленным, карциному, лимфому, бластому, саркому, лейкемию или лимфоидные злокачественные образования. Примеры «опухолегенных» заболеваний, которые могут подвергаться лечению или профилактике, включают В-клеточные лимфомы, включая НХЛ, прекурсорные В-клеточные лимфобластные лейкемию/лимфому и неоплазмы зрелых В-клеток, например, В-клеточную хроническую лимфоцитную лейкемию (ХЛЛ)/мелкоклеточную лимфоцитарную лимфому (МЛЛ), В-клеточную пролимфоцитную лейкемию, лимфоплазмацитную лимфому, лимфому из клеток мантии (MCL), фолликулярную лимфому (ФЛ), включая высокодифференцированную, среднедифференцированную и низкодифференцированную ФЛ, кожную центрально-фолликулярную лимфому, В-клеточную лимфому маргинальной зоны (MALT-типа, узлового и селезеночного типа), волосатоклеточный лейкоз, диффузную В-крупноклеточную лимфому, лимфому Беркитта, плазмацитому, плазмаклеточную миелому, посттрансплантационное лимфопролиферативное расстройство, макроглобулинемию Вальденстрема, а также анапластическую крупноклеточную лимфому (АККЛ).

Примеры «иммунных нарушений» и заболеваний, при которых участвуют В-клетки, экспрессирующие CD20 и которые могут лечиться или профилактироваться, включают псориаз, псориатический артрит, дерматит, системную склеродермию и склероз, воспалительную болезнь кишечника (ВБК), болезнь Крона, язвенный колит, респираторный дистресс-синдром, менингит, энцефалит, увеит, гломерулонефрит, экзему, астму, атеросклероз, нарушение адгезии лейкоцитов, множественный склероз, синдром Рейно, синдром Сергена, ювенильный диабет, болезнь Рейтера, болезнь Бехчета, иммунный комплексный нефрит, IgA-нефропатию, IgM-полинейропатии, иммуно-опосредованные тромбоцитопении, например, острую идиопатическую тромбоцитопеническую пурпуру и хроническую идиопатическую тромбоцитопеническую пурпуру, гемолитическую анемию, тяжелую миастению, волчаночный нефрит, системную красную волчанку, ревматоидный артрит (РА), атопический дерматит, пузырчатку, болезнь Грейвса, тиреоидит Хашимото, гранулематоз Вегенера, синдром Оменна, хроническую почечную недостаточность, острый инфекционный мононуклеоз, HN, заболевания, ассоциированные с герпесом. Дополнительными примерами являются тяжелый острый респираторный дистресс-синдром и хореоретинит. Еще дополнительными примерами являются заболевания и нарушения, вызванные инфицированием В-клеток вирусами, например, вирусом Эпштейна-Барр (EBV).

Понятие «Терапевтический агент» охватывает и биологические агенты, например, антитела, пептиды, белки, ферменты или химиотерапевтические агенты.

«Химиотерапевтический агент» - химическое соединение, полезное при лечении рака. Примерами химиотерапевтических агентов служат эрлотиниб (TARCEVA®, Genentech/OSI Pharm.), бортезомиб (VELCADE®, Millennium Pharm.), фулвестрант (FASLODEX®, AstraZeneca), Sutent (SU11248, Pfizer), летрозол (FEMARA®, Novartis), иматиниба мезилат (GLEEVEC®, Novartis), PTK787/ZK 222584 (Novartis), оксалиплатин (Eloxatin®, Sanofi), 5-FU (5-фторурацил), лейковорин, рапамицин (сиролимус, RAPAMUNE®, Wyeth), лапатиниб (TYKERB®, GSK572016, Glaxo Smith Kline), лонафарниб (SCH 66336), сорафениб (BAY43-9006, Bayer Labs) и гефитиниб (IRESSA®, AstraZeneca), AG1478, AG1571 (SU 5271; Sugen), алкилирующие препараты, например, тиопета и CYTOXAN® циклофосфамид; алкилсульфонаты, например, бусульфан, импросульфан и пипосульфан; азиридины, например, бензодопа, карбоквон, метуредопа и уредопа; этиленимины и метиламеламины, включая алтретамин, триеэтиленмеламин, триэтиленфосфамид, триэтилентиофосфамид и триметиломеламин; ацетогенины (особенно, буллатацин и буллатацинон); камптотецин (включая синтетический аналог топотекан); бриостатин; каллистатин; СС-1065 (включая его синтетические аналоги адоцелезин, карцелезин и бицелезин); криптофицины (в частности, криптофицин 1 и криптофицин 8); доластатин; дуокармицин (включая синтетические аналоги, KW-2189 и СВ1-ТМ1); элеутеробин; панкратистатин; саркодиктиин; спонгистатин; азотистые иприты, например, хлорамбуцил, хлорнафазин, хлорфосфамид, эстрамустин, ифосфамид, мехлоретамин, мехлоретамина оксида гидрохлорид, мелфалан, новэмбихин, фенестрин, преднимустин, трофосфамид, урациловые иприты; нитрозомочевины, например, кармустин, хлорозотоцин, фотемустин, ломустин, нимустин и ранимустин; антибиотики, например, энедииновые антибиотики (например, калихеамицин, особенно калихеамицина гаммалл и калихеамицина омегалл (Angew Chem. Intl. Ed. Engl. (1994) 33:183-186); динемицин, включая динемицин А; бисфосфонаты, например, клодронат; эсперамицин; а также неокарциностатина хромофор и связанные хромопротеиновые энедииновые антибиотиковые хромофоры), аклациномизины, актиномицины, аутрамицин, азасерин, блеомицин, кактиномицин, карабицин, каминомицин, карцинофиллин, хромомицины, дактиномицин, даунорубицин, деторубицин, 6-диазо-5-оксо-L-норлейцин, ADRIAMYCIN® (доксорубицин), морфолино-доксорубицин, цианоморфолино-доксорубицин, 2-пирролино-доксорубицин и деоксидоксорубицин), эпирубицин, эзорубицин, идарубицин, марцелломицин, митомицины, например, митомицин С, микофеноловая кислота, ногаламицин, оливомицины, пепломицин, порфиромицин, пуромицин, квеламицин, родорубицин, стрептонигрин, стрептозоцин, туберцидин, убенимекс, зиностатин, зорубицин; антиметаболиты, например, метотрексат и 5-фторурацил (5-FU); аналоги фолиевой кислоты, например, деноптерин, метотрексат, птероптерин, триметрексат; пуриновые аналоги, например, флурадабин, 6-меркаптопурин, тиамниприн, тиогуанин; пиримидиновые аналоги, например, анцитабин, азацитидин, 6-азауридин, кармофур, цитарабин, дидеоксиуридин, доксифлуридин, эноцитабин, флоксуридин; андрогены, например, калустерон, дромостанолона пропионат, эпитиостанол, мепитиостан, тестолактон; антагонисты гормонов надпочечников, например, аминоглютетимид, митотан, трилостан; возместители фолиевой кислоты, например, фолиниевая кислота; ацеглатон; альдофосфамида гликозид; аминолевулановая кислота; энилурацил; амсакрин; бестрабуцил; бисантрен; эдатрексат; дефофамин; демекольцин; диазиквон; эльформитин; эллиптиния ацетат; эпотилон; этоглюцид; галлия нитрат; гидроксимочевина; лентинан; лонидаинин; майтансиноиды, например, майтансин и ансамитоцины; митогуазон; митоксантрон; мопиндамол; нитраэрин; пентостатин; фенамет; пирарубицин; лозоксантрон; подофиллиниевая кислота; 2-этилгидразид; прокарбазин; PSK® полисахаридный комплекс (JHS Natural Products, Юджин, Орегон); разоксан; ризоксин; сизофуран; спирогерманий; тенуазониевая кислота; триазиквон; 2,2′,2"-трихлортриэтиламин; трихотецены (особенно Т-2 токсин, верракурин А, роридин А и ангуидин); уретан; виндезин; дакарбазин; манномустин; митобронитол; митолактол; пипоброман; гацитозин; арабинозид ("Ara-С"); циклофосфамид; тиотепа; таксоиды, например, TAXOL® (паклитаксел; Bristol-Myers Squibb Oncology, Принстон, Нью-Джерси), ABRAXANE® (без кремофора), альбумин-инжинированные наночастичные составы с паклитакселом (American Pharmaceutical Partners, Шаумберг, Иллинойс) и TAXOTERE® (доксетаксел; Rhone-Poulenc Rorer, Антони, Франция); хлорамбуцил; GEMZAR® (гемцитабин); 6-тиогуанин; меркаптопурин; метотрексат; аналоги платины, например, цисплатин и карбоплатин; винбластин; этопозид (VP-16); ифосфамид; митоксантрон; винкристин; NAVELBINE® (винорелбин); новантрон; тенипозид; эдатрексат; дауномицин; аминоптерин; капецитабин (XELODA®); ибандронат; СРТ-11; ингибитор топоизомеразы RFS 2000; дифторметилорнитин (ДМФО); ретиноид, например, ретиноевая кислота; а также фармацевтически приемлемые соли, кислоты и производные любого из перечисленного выше.

Также в понятие «химиотерапевтический агент» включены: (i) антигормональные агенты, регулирующие или ингибирующие воздействие гормонов на опухоли, например, антиэкстрогены и селективные модуляторы эстрогеновых рецепторов (SERM), включая, к примеру, тамоксифен (включая NOLVADEX®; тамоксифена цитрат), ралоксифен, дролоксифен, 4-гидрокситамоксифен, триоксифен, кеоксифен, LY117018, онапристон и FARESTON® (торемифина цитрат); (ii) ингибиторы ароматазы, ингибирующие фермент ароматазы, регулирующий образование эстрогенов в надпочечниках, например, 4(5)-имидазолы, аминоглютетимид, MEGASE® (мегестрола ацетат), AROMASIN® (эксеместан; Pfizer), форместан, фадрозол, RIVISOR® (ворозол), FEMARA® (летрозол; Novartis) и ARIMIDEX® (анастрозол; AstraZeneca); (iii) антиандрогены, например, флутамид, нилутамид, букалутамид, леупролид и гозерелин; а также троксацитабин (1,3-диоксолан-нуклеозидный аналог цитозина); (iv) ингибиторы протеинкиназ; (v) ингибиторы липидкиназ; (vi) антисмысловые олигонуклеотиды, особенно те, которые ингибируют экспрессию генов сигнальных путей пролиферации мутантных клеток, например, РКС-альфа, Ralf и H-Ras; (vii) рибозимы, например, ингибиторы экспрессии VEGF (например, ANGIOZYME®) и ингибиторы экспрессии HER2; (viii) вакцины, в том числе генно-терапевтические вакцины, например, ALLOVECTIN®, LEUVECTIN®, VAXID®; PROLEUKIN® rIL-2; ингибиторы топоизомеразы-1, например, LURTOTECAN®; ABARELIX® rmRH; (ix) анти-ангиогенные агенты, например, бевацизумаб (AVASTIN®, Genentech); а также (х) фармацевтически приемлемые соли, кислотные и производные перечисленных выше соединений. Примеры ингибиторов матричных металлопротеаз, пригодных для использования в комбинации с настоящими соединениями и композициями, представлены в WO 96/33172, WO 96/27583, ЕР 818442, ЕР 1004578, WO 98/07697, WO 98/03516, WO 98/34918, WO 98/34915, WO 98/33768, WO 98/30566, ЕР 606046, ЕР 931788, WO 90/05719, WO 99/52910, WO 99/52889, WO 99/29667, WO 99/07675, ЕР 945864, патенте США № 5863949, патенте США № 5861510 и ЕР 780386, все из которых включены в настоящую заявку во всей полноте по ссылке. Примерами VEGF-рецепторных ингибиторов тирозинкиназы служат 4-(4-бром-2-фторанилин)-6-метокси-7-(1-метилпиперидин-4-илметокси)хиназолин (ZD6474; пример 2 в WO 01/32651), 4-(4-фтор-2-метилиндол-5-илокси)-6-метокси-7-(3-пирролидин-1-илпропокси)хиназолин (AZD2171; пример 240 в WO 00/47212), ваталаниб (РТК787; WO 98/35985) и SU11248 (сунитиниб; WO 01/60814), а также соединения, описанные в публикациях РСТ под номерами WO 97/22596, WO 97/30035, WO 97/32856 и WO 98/13354).

Иными примерами химиотерапевтических агентов служат ингибиторы PI3K (фосфоинозитид-3 киназы), например, описанные Yaguchi et al (2006) Jour. of the Nat. Cancer Inst. 98(8):545-556; в патенте США № 7173029, патенте США № 7037915, патенте США № 6608056, патенте США № 6608053, патенте США № 6838457, патенте США № 6770641, патенте США № 6653320, патенте США № 6403588, WO 2006/046031, WO 2006/046035, WO 2006/046040, WO 2007/042806, WO 2007/042810, WO 2004/017950, US 2004/092561, WO 2004/007491, WO 2004/006916, WO 2003/037886, US 2003/149074, WO 2003/035618, WO 2003/034997, US 2003/158212, ЕР 1417976, US 2004/053946, JP 2001247477, JP 08175990, JP 08176070, патенте США № 6703414 и WO 97/15658, все из которых включены в настоящую заявку во всей полноте путем ссылки. Специфическими примерами подобных ингибиторов PI3K служат SF-1126 (ингибитор PI3K, Semafore Pharmaceuticals), BEZ-235 (ингибитор PI3K, Novartis), XL-147 (ингибитор PI3K, Exelixis, Inc.).

При использовании здесь термины «CD20» или «антиген CD20» относятся к полипептидам и любым вариантам, изоформам и гомологам CD20, которые экспрессируются натурально или экспрессируются в клетках, трансфицированных геном CD20 и т.д. Человеческий CD20 также известен как MS4A1, что расшифровывается как заполняющие мембрану 4-домены, подсемейство А, член 1. Помимо этого, в отрасли используются такие синонимы CD20 как антиген CD20, рецептор CD20, поверхностный антиген В-лимфоцитов B1, B1, Bp35, LEU-16, MGC3969, MS4A2 и S7. Для человеческого CD20 описано два транскрипционных варианта. Вариант 1 - более длинный транскрипционный вариант, соответствует GenBank ID (GI) 68348720. В варианте 3, в сравнении с вариантом 1, отсутствует часть 5′ UTR, он соответствует GenBank ID (GI) 68348721. Варианты 1 и 3 кодируют один и тот же белок. Основная форма человеческого CD20 содержит 297 аминокислот в белковой цепи и описана GenBank Protein ID 23110989.

Термин «эпитоп» относится к белковой детерминанте, способной к специфическому связыванию с антителом. Эпитопы обычно состоят из химически активных поверхностных групп молекул, например, аминокислот или цепей сахаров и, как правило, обладают специфическими характеристиками трехмерной структуры, а также специфическими характеристиками заряда.

Термин «рафт» относится к микродоменам мембраны, богатым сфинголипидами и холестерином, расположенными на наружном слое плазматической мембраны клетки. Способность определенных белков соединяться в таких доменах может влиять на функцию белка. К примеру, транслокация молекул CD20 в липидные рафты, после связывания антителами или их фрагментами согласно настоящему изобретению, приводит к высокой плотности комплексов CD20 антиген-антитело в плазматических мембранах. Высокая плотность комплексов CD20 антиген-антитело может приводить к эффективному активированию системы комплемента при КЗЦ.

При использовании здесь термин «антитело» или фрагмент и тому подобное включает любую молекулу, содержащую белок или пептид, включающий по меньшей мере часть молекулы иммуноглобулина, например, но не ограничиваясь перечисленным, определяющий комплементарность район (CDR) тяжелой или легкой цепи или его лиганд-связывающую часть, вариабельную область тяжелой или легкой цепи, константную область тяжелой или легкой цепи, каркасную область или ее любую часть, либо по меньшей мере одну часть антигена или антигенсвязывающего рецептора связывающего белка, которые могут быть встроены в антитело против CD20 согласно настоящему изобретению. Подобное антитело, необязательно, помимо этого, воздействует на специфический лиганд, например, но не ограничиваясь перечисленным, такое антитело модулирует, уменьшает, увеличивает, выступает в роли антагониста, выступает в роли агониста, успокаивает, ослабляет, блокирует, ингибирует, нивелирует и/или взаимодействует с по меньшей мере одним воздействием или связыванием антигена, либо с воздействием или связыванием рецептора антигена in vitro, in situ, in vivo и ex vivo. В качестве нелимитирующего примера представлены различные CD20-специфические антитела, определенная часть или вариант которых могут связывать по меньшей мере одну молекулу антигена, либо их определенные части, варианты или домены. Подходящее антиген-специфическое антитело, определенная часть или вариант также могут, необязательно, влиять на по меньшей мере одно воздействие или функцию, например, но не ограничиваясь перечисленным, синтез РНК, ДНК, белков, высвобождение, сигнализацию рецепторов, ассоциацию мембран, связывающую активность, образование и/или синтез белка.

Антитела - гетеротетрамерные гликопротеины, составленные из двух идентичных легких цепей (LC) и двух идентичных тяжелых цепей (НС). Как правило, каждая легкая цепь соединена с тяжелой цепью через одну ковалентную дисульфидную связь, а количество дисульфидных связей между тяжелыми цепями различных изотипов иммуноглобулинов различается. В каждой тяжелой и легкой цепях также присутствуют внутрицепочечные дисульфидные мостики. У каждой тяжелой цепи на одном конце располагается вариабельный домен (VH), за которым следуют константные домены. У каждой легкой цепи на одном конце располагается вариабельный домен (VL), и константный домен - на другом конце; константный домен легкой цепи совмещен с константным доменом тяжелой цепи, вариабельный домен легкой цепи совмещен с вариабельным доменом тяжелой цепи. Легкие цепи антител любых видов позвоночных могут быть отнесены к двум различным типам, а именно - каппа и лямбда, в зависимости от аминокислотных последовательностей их константных доменов. Иммуноглобулины могут быть отнесены к пяти основным классам, а именно - IgA, IgD, IgE, IgG и IgM, в зависимости от аминокислотных последовательностей константных доменов тяжелых цепей. IgA и IgG еще подразделяются на изотипы IgA1, IgA2, IgG1, IgG2, IgG3 и IgG4.

Фрагменты антител включают любую молекулу, содержащую белок или пептид, включающий по меньшей мере часть молекулы иммуноглобулина, например, но не ограничиваясь перечисленным, определяющий комплементарность район (CDR) тяжелой или легкой цепи или его лиганд-связывающую часть, вариабельную область тяжелой или легкой цепи, константную область тяжелой или легкой цепи, каркасную область или ее любую часть, либо по меньшей мере одну часть антигена или антигенсвязывающего рецептора связывающего белка, которые могут быть встроены в антитело против CD20 согласно настоящему изобретению.

Термин «вариабельный» относится к тому факту, что определенные части вариабельных доменов существенно различаются последовательностью среди антител и определяют связывание и специфичность каждого конкретного антитела с конкретным антигеном. Однако, вариабельность различных доменов антитела, как правило, неравномерна. Как правило, наиболее вариабельны три сегмента, называемые областями, определяющими комплементарность (CDR) или гипервариабельными областями, расположенные в вариабельных доменах и легкой, и тяжелой цепей. Более консервативные части вариабельных доменов называют каркасными (FR). Вариабельные домены нативных тяжелой и легкой цепей содержат четыре каркасных области, образующих конфигурацию бета-листов, соединенных тремя областями, определяющими комплементарность, образующими соединительные петли, а иногда - образующими часть структур бета-листов. Области, определяющие комплементарность в каждой цепи держатся близко с каркасными областями и к областям, определяющим комплементарность другой цепи, образуя антиген-связывающий сайт антитела (см., к примеру, Е. A. Kabat et al. Sequences of Proteins of Immunological Interest, пятое издание, National Institute of Health, Вифезда, Мэриленд (1991)). Константные домены непосредственно не вовлечены в связывание антитела с антигеном, но проявляют различные эффекторные функции, например, участвуют в проявлении антителом антителозависимой клеточной цитотоксичности.

Термин «антитело» также включает расщепленные фрагменты, определенные части и их варианты, включая аналоги антител или соединения, содержащие части антител, копирующие структуру и/или функцию антитела или определенного фрагмента, или части, включая одноцепочечные антитела и их фрагменты. Функциональные фрагменты включают антиген-связывающие фрагменты, которые связываются с антигенами млекопитающих, например, CD20, по одиночке или в комбинации с другими антигенами, например, человеческим рецептором фактора роста эпидермиса (HER1), IgE, фактором роста сосудистого эндотелия, ингибиторами димеризации HER, семейством белков Bc1-2, MET, IL-13, альфа-интерфероном, EGFL7, CD40, DR4 и DR5, PI3-киназой, альфа-лимфотоксином, бета-7-интегрином, бета-амилоидом, CRIg, TNF, комплементом (С5), CBL, CD 147, IL-8, gp120, VLA-4, CD11a, CD 18, VEGF, CD40L, Id, ICAM-1, CD2, EGFR, бета-TGF, альфа-TNF, Е-селектином, фактором VII, TNF, Her2/neu, F gp, CD 11/18, CD14, ICAM-3, CD80, CD40L, CD4, CD23, бета2-интегином, альфа4бета7, CD52, HLA DR, CD22, CD64 (FcR), альфа-бета-TCR, CD2, CD3, Hep B, CA 125, EpCAM, gp120, CMV, gpIIbIIIa, IgE, IL-5, IL-4, CD25, CD3, CD33, CD19, CD22, CD28, CD36, CD37. CD44, CD55, CD59. CD70, CD79, CD80, CD103, CD134, CD137, CD138, CD152, CD30, HLA, VNR-интегрином, CD25, IL-23 и IL-12. К примеру, фрагменты антител, способные связываться с антигеном или его частями включают, не ограничиваясь перечисленным, фрагменты Fab (например, при расщеплении папаином). Fab′ (например, при расщеплении пепсином и частичном восстановлении) и F(ab′)2 (например, при расщеплении пепсином), facb (например, при расщеплении плазмином), pFc′ (например, при расщеплении пепсином или плазмином), Fd (например, при расщеплении пепсином, частичном восстановлении и реагрегации), Fv или scFv (например, по техникам молекулярной биологии), которые охватываются настоящим изобретением (см., например, Colligan, Immunology).

Подобные фрагменты могут быть получены ферментативным расщеплением, синтетическими или рекомбинантными техниками, такими, которые известны в данной области техники и/или описаны в здесь. Антитела также могут быть получены в виде ряда усеченных форм с использованием генов антител, в которых один и более стоп-кодонов внедрены перед натуральным стоп-сайтом. К примеру, может быть сконструирован комбинированный ген, кодирующий F(ab′)2 участок тяжелой цепи и включающий ДНК-последовательности, кодирующие CH1-домен и/или шарнирную область тяжелой цепи. Различные части антител могут быть соединены химически при помощи обычных техник, либо они могут быть приготовлены в виде непрерывного белка по техникам генной инженерии.

«Блокирующее» антитело или «антитело-антагонист» - антитело, которое ингибирует или уменьшает биологическую активность антигена, который оно связывает, например, CD20. Предпочтительные блокирующие антитела или антитела-антагонисты частично или полностью ингибируют биологическую активность антигена. Предпочтительно, чтобы биологическая активность уменьшалась на 10%, 20%, 30%, 50%, 70%, 80%, 90%, 95% или даже 100%.

«Антитело-агонист», при использовании здесь, - антитело, имитирующее по меньшей мере одну функциональную активность интересующего референтного полипептида.

«Анти-идиотипическое (anti-Id) антитело» - антитело, распознающее уникальные детерминанты, обычно ассоциирующиеся с антигенсвязывающим сайтом антитела. Id-антитело может быть получено иммунизацией животного того же самого вида и генотипа (например, мышиной линии), что и источник моноклонального антитела, к моноклональному антителу которого изготавливается анти-идиотипическое антитело. Иммунизированное животное распознает и сформирует ответ к идиотипическим детерминантам иммунизирующего антитела путем образования антитела к данным идиотипическим детермининатам (анти-идиотипического антитела). См., к примеру, патент США № 4699880, который включен в настоящую заявку во всей полноте путем ссылки. Анти-идиотипическое антитело также может использоваться в качестве «иммуногена» для индуцирования иммунного ответа у еще одного животного, образуя так называемое анти-анти-идиотипическое антитело. Анти-анти-идиотипическое антитело может быть эпитопно идентичным оригинальному моноклональному антителу, индуцировавшему анти-идиотипическое антитело. Таким образом, используя антитела к идиотипическим детерминантам моноклональных антител, возможно идентифицировать другие клоны, экспрессирующие антитела с идентичной специфичностью.

«Изолированное» антитело = антитело, выделенное и/или восстановленное из его естественного окружения. Загрязняющие компоненты естественного окружения -материалы, которые влияют на диагностическое или терапевтическое использование антитела и могут включать ферменты, гормоны иные белковые и небелковые растворимые вещества. В предпочтительных аспектах антитело очищается (1) более чем до 95% по весу антитела, судя, например, по методу Лоури, а более предпочтительно -более чем до 99% по весу, (2) до степени, достаточной для получения по меньшей мере 15 остатков N-терминальной или внутренней аминокислотной последовательности при использовании секвенатора с вращающимся стаканом, либо (3) до гомогенности по SDS-PAGE (электрофорез в полиакриламидном геле в присутствии додецилсульфата натрия) в восстановительных или невосстановительных условиях с окрашиванием Кумасси голубым или, предпочтительно, серебром. Изолированные антитела включают CD20-антитела in situ в составе рекомбинантных клеток, пока отсутствуют компоненты естественного окружения антитела. Как правило, изолированные антитела готовят с по меньшей мере одним этапом очистки.

Термин «ритуксимаб» или «RITUXAN®» относится к доступному в продаже химерному антителу против CD20, названному «С2В8» в патенте США № 5736137 (Anderson et al.). Термин «2F2» или «офатумумаб» относится к полностью человеческому антителу против CD20, описанному в WO 2004/035607 (Teeling et al. (2004)). Термин «GA101» или «афутузумаб» относится к гуманизированному и гликоинжинированному антителу против CD20, состоящему из тяжелой цепи В-НН6 и легкой цепи B-KV1, как описано в WO 2005/0448959 (Umana, патент США № 5639641 (2005)). Термин «В1» относится к мышиному антителу против CD20 тозитумомабу, соответствующему немаркированному антителу, являющемуся компонентом Bexxar®.

При использовании здесь термин антитело «III типа» включает целое антитело или его фрагмент, связывающиеся с CD20, его эпитопами и/или изоформами, обладающие способностью к выраженному индуцированию апоптоза в отсутствие перекрестно-сшивающих агентов аналогично антителам II типа и имеющие способность вызывать перераспределение CD20 в липидный рафт с существенным индуцированном комплементзависимой цитотоксичности (КЗЦ) аналогично антителам I типа.

При использовании здесь термин «конструированное антитело» или «измененное антитело» включает антитела со значительными человеческими каркасными и константными областями (CL, СН-доменами (например, СН1, СН2, СН2), шарнирными) и определяющими комплементарность областями, полученными из антигенсвязывающих антител, например, антител против CD20 или их фрагментов. Полностью человеческие каркасные области содержат каркасные области, которые соответствуют человеческим зародышевым последовательностям, а также последовательностям с соматическими мутациями. Определяющие комплементарность области могут происходить из одной и более определяющих комплементарность областей, которые ассоциируются или связываются с антигеном в окружении или вне окружения каркасной области любого антитела. К примеру, определяющие комплементарность области конструированного антитела по настоящему изобретению, направленного на CD20, могут происходить из определяющих комплементарность областей, которые связываются с антигеном в окружении мышиных каркасных областей, а затем конструируются таким образом, чтобы связывать антиген в окружении человеческих каркасных областей. Зачастую человеческое конструированное антитело в значительной степени неиммуногенно у людей.

Аналогично антитела, обозначенные как относящиеся к приматам (обезьяне, бабуину, шимпанзе и т.д.), грызунам (мыши, крысе, кролику, морской свинке, хомячку и т. п. ) и другим млекопитающим, обозначают антитела, специфические для этих видов, подродов, родов, подсемейств или семейств. Помимо этого, химерные антитела могут включать любую комбинацию перечисленного выше. Подобные изменения или отклонения необязательно и предпочтительно сохраняют или уменьшают иммуногенность у людей или иных видов в сравнении с немодифицированными антителами. Человеческое конструированное антитело отличается от химерного или гуманизированного антитела.

Конструированное антитело может синтезироваться нечеловеческой животной, прокариотной или эукариотной клеткой, способной к экспрессированию генов функционально реаранжированного или человеческого конструированного иммуноглобулина (например, тяжелой цепи и/или легкой цепи). Помимо этого, если конструированное антитело является одноцепочечным антителом, то оно может содержать линкерный пептид, который не встречается в человеческих или нечеловеческих антителах. К примеру, Fv может содержать линкерный пептид, например, от двух до приблизительно восьми остатков глицина или других аминокислот, соединенный с вариабельной областью тяжелой цепи и вариабельной областью легкой цепи. Подобные линкерные пептиды могут рассматриваться как пептиды человеческого происхождения.

Биспецифические, гетероспецифические, гетероконъюгатные или аналогичные антитела могут также использоваться, будучи моноклональными, предпочтительно человеческими, человеческими конструированными, перестроенными или гуманизированными антителами со специфичностью связывания к по меньшей мере двум различным антигенам, например, CD20 и не CD20. В настоящем случае антитело специфично по меньшей мере к одному антигенному белку и к другому антигенному белку. Способы получения биспецифических антител известны в данной области техники. Традиционно рекомбинантное получение биспецифических антител основывается на совместном экспрессировании двух пар легких и тяжелых цепей иммуноглобулинов, причем тяжелые цепи обладают различными специфичностями (Milstein, Cuello, Nature 305:537 (1983)). Вследствие случайного совмещения тяжелой и легкой цепей получается смесь этих гибридом (квадром), потенциально в количестве примерно 10 различных молекул антител, из которых лишь одна обладает необходимой биспецифической структурой. Выделение нужной молекулы обычно осуществляется аффинной хроматографией или иным способом, описанным здесь. Аналогичные процедуры описаны, например, в WO 93/08829, патентах США под номерами 6210668, 6193967, 6132992, 6106833, 6060285, 6037453, 6010902, 5989530, 5959084, 5959083, 5932448, 5833985, 5821333, 5807706, 5643759, 5601819, 5582996, 5496549, 4676980, WO 91/00360, WO 92/00373, ЕР 03089, Traunecker et al., EMBO J. 10:3655 (1991), Suresh et al„ Methods in Enzymology 121:210 (1986), U.S. 20090258026, U.S. 20060140946 и U.S. 20070298040, каждый из которых включен в настоящую заявку во всей полноте путем ссылки.

«Эффекторные функции» антитела относятся к биологическим эффектам, обусловленным Fc-областью (нативной последовательностью Fc-области или вариантной аминокислотной последовательностью Fc-области) антитела, и варьируются в зависимости от изотипа антитела. Примеры эффекторных функций антител включают: C1q-связывание и комплементзависимую цитотоксичность (КЗЦ); связывание с Fc-рецептором; антитело-зависимую клеточноопосредованную цитотоксичность (АЗКЦ); фагоцитоз; подавление рецепторов на клеточной поверхности (например, В-клеточных рецепторов); и активацию В-клеток.

«Человеческие Эффекторные клетки» - лейкоциты, которые экспрессируют один или более FcRs и выполняют Эффекторные функции. В определенных аспектах клетки экспрессируют по меньшей мере FcyRIII и проявляют АЗКЦ-эффекторную(ые) функцию(и). Примерами человеческих лейкоцитов, опосредующих АЗКЦ, служат мононуклеарные клетки периферической крови (ПКМК), клетки-натуральные киллеры (НК), моноциты, цитотоксические Т-клетки и нейтрофилы. Эффекторные клетки могут быть выделены из природного источника, например, из крови.

Антитела против CD20

Основываясь на открытии Заявителя, inter alia, антитела против CD20 и их фрагменты, конъюгаты, композиции и способы по изобретению, могут быть мутантными антителами и подобным. Антитело против CD20 может быть «сконструированным антителом» или модифицированным антителом, например, вариантом аминокислотной последовательности антитела против CD20, в котором модифицированы один и более аминокислотных остатков антитела против CD20. Модификации в аминокислотной последовательности антитела против CD20 включают модификации в полипептидной и/или полинуклеотидной последовательности для улучшения аффинности или авидности антитела или его фрагмента, и/или модификации в Fc-части антитела для улучшения эффекторной функции, если не показано или не известно противоположное. Модифицированию могут быть подвергнуты любые известные антитела против CD20 или антитела против CD20, идентифицируемые как описанные здесь. Подобные видоизмененные антитела должны иметь менее чем 100% идентичность или схожесть с исходным антителом против CD20. В предпочтительном аспекте измененное антитело имеет аминокислотную последовательность с по меньшей мере 20%, 25%, 35%, 45%, 55%, 65% или 75% идентичности или схожести с аминокислотной последовательностью вариабельного домена тяжелой или легкой цепей антитела против CD20, более предпочтительно - по меньшей мере 80%, более предпочтительно - по меньшей мере 85%, более предпочтительно - по меньшей мере 90%, наиболее предпочтительно - по меньшей мере 95%. В предпочтительном аспекте измененное антитело имеет аминокислотную последовательность с по меньшей мере 25%, 35%, 45%, 55%, 65% или 75% идентичности или схожести с аминокислотной последовательностью CDR1, CDR2 или CDR3 тяжелой цепи антитела против CD20, более предпочтительно - по меньшей мере 80%, более предпочтительно - по меньшей мере 85%, более предпочтительно - по меньшей мере 90%, наиболее предпочтительно - по меньшей мере 95%. В предпочтительном аспекте модифицированное антитело сохраняет способность связываться с человеческим CD20. В определенных аспектах антитело против CD20, согласно изобретению, содержит тяжелую цепь, которая примерно на 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% и более идентична аминокислотным последовательностям SEQ ID NO:47, 34, 35 и 36. В определенных аспектах антитело против CD20, согласно изобретению, содержит легкую цепь, которая примерно на 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% и более идентична аминокислотным последовательностям SEQ ID NO:46, 32 и 33. В предпочтительном аспекте измененное антитело имеет аминокислотную последовательность с по меньшей мере 25%, 35%, 45%, 55%, 65% или 75% идентичности или схожести с аминокислотной последовательностью CDR1, CDR2 или CDR3 легкой цепи антитела против CD20, более предпочтительно - по меньшей мере 80%, более предпочтительно - по меньшей мере 85%, более предпочтительно - по меньшей мере 90%, наиболее предпочтительно - по меньшей мере 95%, 96%, 97%, 98%, 99%.

В некоторых вариантах воплощения изобретения антитело против CD20 может быть «сконструированным антителом» или модифицированным антителом, например, вариантом аминокислотной последовательности антитела против CD20, в котором модифицированы один и более аминокислотных остатков антитела против CD20. Модификации в аминокислотной последовательности антитела против CD20 включают модификации в полипептидной и/или полинуклеотидной последовательности для улучшения аффинности или авидности антитела или его фрагмента, и/или модификации в Fc-части антитела для улучшения эффекторной функции, если не показано или не известно противоположное. Модифицированию могут быть подвергнуты любые известные антитела против CD20 или антитела против CD20, идентифицируемые как описанные здесь. Подобные видоизмененные антитела должны иметь менее чем 100% идентичность или схожесть с исходным антителом против CD20. В предпочтительном аспекте измененное антитело имеет аминокислотную последовательность с по меньшей мере 1-5, 1-3, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45 или 50 консервативными аминокислотными заменами в сравнении с аминокислотной последовательностью вариабельного домена тяжелой или легкой цепей антитела против CD20. В предпочтительном аспекте измененное антитело имеет аминокислотную последовательность с по меньшей мере 1-20, 1-15, 1-10, 1-5, 1-3, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 или 1 консервативными аминокислотными заменами в сравнении с аминокислотной последовательностью CDR1, CDR2 или CDR3 тяжелой цепи антитела против CD20. В предпочтительном аспекте модифицированное антитело сохраняет способность связываться с человеческим CD20. В определенных аспектах антитело анти- CD20 имеет аминокислотную последовательность с по меньшей мере 1-20, 1-15, 1-10, 1-5, 1-3, 1, 2, 3, 4, 5. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45 или 50 консервативными аминокислотными заменами в сравнении с аминокислотными последовательностями SEQ ID NOs:47, 34, 35 и 36. В определенных аспектах антитело анти- CD20 имеет аминокислотную последовательность с по меньшей мере 1-20, 1-15, 1-10, 1-5, 1-3, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45 или 50 консервативными аминокислотными заменами в сравнении с аминокислотными последовательностями SEQ ID NOs:46, 32 или 33. В предпочтительном аспекте измененное антитело имеет аминокислотную последовательность с по меньшей мере 1-20, 1-15, 1-10, 1-5, 1-3, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 или 1 консервативными аминокислотными заменами в сравнении с аминокислотной последовательностью CDR1, CDR2 или CDR3 легкой цепи антитела против CD20.

Гибридомы, продуцирующие антитела против CD20 CD20-7 и CD20-6, депонированы под номерами депозитов АТСС РТА-10487 и РТА-10486.

"% идентичности", как принято в данной области техники, - мера родства двух полинуклеотидов или двух полипептидов, определяемая при сравнении их последовательностей. Идентичность или схожесть последовательности определяется как процентное количество аминокислотных остатков в кандидатной последовательности, идентичных (т. е. одинаковых) или схожих (т.е. аминокислотных остатков, принадлежащих к одной группе на основании характеристик боковой цепи, см. ниже) с остатками антитела против CD20, после выравнивания последовательностей и введения брешей, при необходимости, для достижения максимальной процентной идентичности последовательностей. Никакая из N-терминальных, С-терминальных или внутренних экстенсий, делеций или вставок в последовательность антитела вне вариабельного домена не полагается как влияющая на идентичность или схожесть последовательности. В целом две сравниваемые последовательности выравниваются для получения максимальной корреляции последовательностей. Выравнивание двух последовательностей исследуют, определяют количество позиций с совпадением аминокислот или нуклеотидов, разделяют их на общую длину выравнивания и умножают на 100 для получения % идентичности. Данный процентный показатель идентичности может быть определен для всей длины сравниваемых последовательностей, что особенно подходит для последовательностей одинаковой или почти одинаковой длины, которые высокогомологичны, либо же для длины более короткой последовательности, что подходит для последовательностей разной длины с меньшим уровнем гомологичности.

К примеру, последовательности могут быть выровнены при помощи ПО clustalW под Unix, которое формирует файл с расширением «.aln»; данный файл затем может быть импортирован в программу Bioedit (Hall, Т. А. 1999, BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41:95-98), которая открывает файл.aln. В окне Bioedit можно выбрать индивидуальные последовательности (две за раз) и выравнивать их. Этот способ позволяет сравнивать целые последовательности.

Способы сравнения идентичности двух и более последовательностей хорошо известны в данной области техники. К примеру, такие программы доступны в пакете Wisconsin Sequence Analysis Package, версии 9.1 (Devereux J. et al., Nucleic Acids Res., 12:387-395, 1984, доступно у Genetics Computer Group, Мэдисон, Висконсин, США). Определение процентной идентичности двух последовательностей может быть осуществлено с использованием математического алгоритма. К примеру, программы BESTFIT и GAP могут использоваться для определения процентной идентичности двух полинуклеотидных и процентной идентичности двух полипептидных последовательностей. В BESTFIT используется алгоритм «локальной гомологии» Smith и Waterman (Advances in Applied Mathematics, 2:482-489, 1981), и находится одна наилучшая область сходства между двумя последовательностями. BESTFIT больше подходит для сравнения двух полинуклеотидных или двух полипептидных последовательностей разной длины, программа работает, исходя из предположения, что короткая последовательность является частью большей. Для сравнения, в GAP при выравнивании двух последовательностей находится «максимальная схожесть», следуя алгоритму Neddleman и Wunsch (J. Mol. Biol., 48:443-354, 1970). GAP более подходит для сравнения последовательностей примерно одинаковой длины с ожидаемым выравниванием по всей длине. Предпочтительные параметры «Gap Weight» и «Length Weight», используемые в каждой программе, - 50 и 3 для полинуклеотидов и 12 и 4 для полипептидов, соответственно. Предпочтительно, чтобы процентные идентичность и схожесть определялись тогда, когда две сравниваемые последовательности оптимальным образом выровнены.

Также в отрасли известны и другие программы для определения идентичности и/или схожести последовательностей, например, семейство программ BLAST (Karlin & Altschul, 1990, Proc. Natl. Acad. Sci. USA, 87:2264-2268, с изменениями согласно Karlin & Altschul, 1993, Proc. Natl. Acad. Sci. USA, 90:5873-5877, доступная в National Center for Biotechnology Information (NCB), Вифезда, Мэриленд, США, с доступом через домашнюю страницу NCBI: www.ncbi.nlm.nih.gov). Данные программы служат предпочтительным нелимитирующим примером математического алгоритма, используемого для сравнения двух последовательностей. Подобный алгоритм используется в программах NBLAST и XBLAST авторства Altschul et а1„ 1990, J. Mol. Biol., 215:403-410. Нуклеотидные поиски BLAST могут проводиться при помощи программы NBLAST с параметрами score=100, wordlength=12 для того, чтобы получить нуклеотидные последовательности, гомологичные молекуле нуклеиновой кислоты, кодирующей все антитело против CD20 по изобретению или его часть. Протеиновые поиски BLAST могут проводиться при помощи программы XBLAST с параметрами score=50, wordlength=3 для того, чтобы получить аминокислотные последовательности, гомологичные белковой молекуле по изобретению. Для получения выравнивания с брешами в целях сравнения может использоваться Gapped BLAST согласно Altschul et al., 1997, Nucleic Acids Res., 25:3389-3402. Альтернативно для итерационного поиска, в котором определяется дальнее родство между молекулами, может применяться PSI-Blast (Id.). При использовании программ BLAST, Gapped BLAST и PSI-Blast могут использоваться параметры по умолчанию, установленные в соответствующих программах (например, XBLAST и NBLAST). См. http://www.ncbi.nlm.nih.gov. Другим предпочтительным нелимитирующим примером математического алгоритма, используемого для сравнения двух последовательностей служит алгоритм Myers и Miller, 1988, CABIOS 4:11-17. Подобный алгоритм применяется в программе ALIGN (версия 2.0), которая является частью пакета программ выравнивания последовательностей GCG. При использовании программы ALIGN для сравнения аминокислотных последовательностей могут использоваться таблица весов остатков РАМ 120, параметры gap length penalty - 12 и gap penalty - 4.

Другой нелимитирующий пример программы для определения идентичности и/или схожести последовательностей, известный в данной области техники, - FASTA (Pearson W. R., Lipman D. J., Proc. Nat. Acad. Sci. USA, 85:2444-2448, 1988, доступна в составе пакета Wisconsin Sequence Analysis Package). Для сравнения полипептидных последовательностей, при условии того, что нуклеотидные последовательности предварительно транслируются в аминокислотные, предпочтительно использовать матрицу замещения аминокислот BLOSUM62 (HenikoffS., HenikoffJ. G., Proc. Nat. Acad. Sci. USA, 89:10915-10919, 1992).

Еще одним нелимитирущим примером программы, используемой в данной области техники для определения идентичности и/или схожести аминокислотных последовательностей, служит SeqWeb Software (веб-интерфейс для программы GCG Wisconsin Package: Gap), которая используется с параметрами и алгоритмом по умолчанию: blosum62, gap weight 8, length weight 2.

Процентная идентичность двух последовательностей может быть определена способами, аналогичными описанным выше, с разрешением брешей и без этого. При расчете процентной идентичности, как правило, считаются точные совпадения.

Программа BESTFIT может использоваться для определения процентной идентичности поисковой полинуклеотидной или полипептидной последовательности с полинуклеотидной или полипептидной последовательностью по настоящему изобретению, при условии оптимального выравнивания поисковой и референтной последовательностей и использования параметров программы по умолчанию.

Для получения измененного антитела в его гипервариабельные области внедряют одно и более аминокислотных изменений (например, замену). Альтернативно или дополнительно в антитело против CD20 может быть внедрено одно и более изменений (например, замен) остатков каркасной области, приводящих к улучшению связывающей способности мутантного антитела с антигеном. Примерами остатков каркасной области, которые могут быть модифицированы, служат те, которые нековалентно связывают непосредственно антиген (Amit et al., Science, 233:747-753 (1986)), взаимодействуют или влияют на конформацию области, определяющей комплементарность (Chothia et al., J. Mol. Biol., 196:901-917 (1987)), и/или участвуют в сопряжении VL VH. В определенных аспектах модифицирование одного и более таких остатков каркасной области приводит к увеличению связывающей активности антитела по отношению к антигену. К примеру, в данном аспекте изобретения может быть изменено примерно 1-5 остатков в каркасной области (например, 1, 2, 3, 4 или 5). Иногда этого может быть достаточно для того, чтобы получить антитело с повышенной связывающей способностью, даже без изменения остатков гипервариабельной области. Тем не менее, как правило, в измененном антителе присутствует(ют) и модификация(и) гипервариабельной области.

Изменяемые остатки гипервариабельной области могут изменяться случайным образом, особенно, если начальная связывающая способность антитела против CD20 такова, что измененные случайным образом антитела могут быть легко отслежены.

Процедура, пригодная для получения подобных модифицированных антител, называется «мутагенезом со сканированием аланина» (Cunningham, Wells; Science, 244:1081-1085 (1989)). Один и более остатков гипервариабельной области замещаются на аланин или полиаланиновые остатки для того, чтобы воздействовать на взаимодействие аминокислот с антигеном. Тот(те) остаток(ки) гипервариабельной области, которые проявляют функциональную чувствительность к замещению, затем выделяют путем введения дополнительных или иных мутаций в другие сайты замещения. Таким образом, хотя сайт внедрения вариации аминокислотной последовательности предопределен, сущность самой мутации не нуждается в предопределенности. Ala-мутанты, полученные данным образом, подвергаются скринингу на их биологическую активность, так, как описано здесь и/или как известно в данной области техники.

Другая процедура получения подобных измененных антител заключается в созревании аффинности с использованием фагового дисплея (Hawkins et al., J. Mol. Biol., 254:889-896 (1992) и Lowman et al„ Biochemistry, 30(45):10832-10837 (1991)). Вкратце говоря, несколько сайтов гипервариабельной области (например, 6-7 сайтов) подвергаются мутированию с образованием всех возможных аминокислотных замещений в каждом сайте. Мутанты антител, полученные таким образом, моновалентно отображаются на частицах нитевидных фагов в виде сплавок с продуктом гена III фага М13, упакованных в каждой частице. Фаг-дисплейные мутанты затем подвергаются скринингу на их биологическую активность (например, связывающую способность), так, как описано здесь и/или как известно в данной области техники.

Мутации в последовательностях антител могут включать замещения, делеции, включая внутренние делеции, вставки, включая вставки, приводящие к образованию слитых белков, либо консервативные замещения аминокислотных остатков в аминокислотной последовательности и/или рядом с ней, приводящие к незаметному изменению, то есть к получению функционально эквивалентного антитела против CD20 или фрагмента. Консервативные замещения аминокислот могут производиться на основании схожести в полярности, заряде, растворимости, гидрофобности, гидрофильности и/или амфипатической природы участвующих остатков. К примеру, неполярные (гидрофобные) аминокислоты включают аланин, лейцин, изолейцин, валин, пролин, фенилаланин, триптофан и метионин; полярно нейтральные аминокислоты включают глицин, серии, треонин, цистеин, тирозин, аспарагин и глутамин; положительно заряженные (основные) аминокислоты включают аргинин, лизин и гистидин; отрицательно заряженные (кислые) аминокислоты включают аспарагиновую кислоту и глутаминовую кислоту. Помимо этого, глицин и пролин могут влиять на ориентацию цепи. Неконсервативные замещения влекут за собой обмен члена одного из этих классов на член другого класса. Кроме того, при желании, неклассические аминокислоты или химические аналоги аминокислот могут вводиться как замена или добавление к аминокислотной последовательности. Неклассические аминокислоты включают, не ограничиваясь перечисленным, D-изомеры обычных аминокислот, α-аминоизомасляную кислоту, 4-аминомасляную кислоту, Abu, 2-аминомасляную кислоту, γ-Abu, ε-Ahx, 6-аминокапроновую кислоту, Aib, 2-аминоизомасляную кислоту, 3-аминопропионовую кислоту, орнитин, норлейцин, норвалин, гидроксипролин, саркозин, цитруллин, цистеиновую кислоту, трет-бутилглицин, трет-бутилаланин, фенилглицин, циклогексилаланин, β-аланин, фтораминокислоты, дизайнерские аминокислоты, например, β-метиламинокислоты, С α-метиламинокислоты, N α-метиламинокислоты и совокупно аналоги аминокислот.

В другом аспекте сайты, выбранные для модифицирования, проходят созревание аффинности с использованием фагового дисплея (см. выше).

Для модифицирования индивидуальных нуклеотидов в ДНК-последовательности, для целей внедрения аминокислотных(ой) замен(ы) в последовательность антитела, а также для создания и удаления сайтов рестрикции с целью облегчения дальнейших манипуляций, может применяться любая техника мутагенеза, известная в данной области техники. Подобные техники включают, не ограничиваясь перечисленным, химический мутагенез, сайт-направленный мутагенез in vitro (Kunkel, Proc. Natl. Acad. Sci. USA, 82:488 (1985); Hutchinson, С. et al., J. Biol. Chem., 253:6551 (1978)), олигонуклеотид-направленный мутагенез (Smith, Ann. Rev. Genet., 19:423-463 (1985); Hill et al., Methods Enzymol., 155:558-568 (1987)), перекрывающуюся ПЦР (Но et al., Gene, 77:51-59 (1989)), ПЦР-мутагенез с мегапраймерами (Sarkar et al., Biotechniques, 8:404-407 (1990)) и т.д. Модификации могут быть подтверждены двухцепочечным секвенированием дидезокси-ДНК.

Изолированные нуклеиновые кислоты по настоящему изобретению могут использоваться для получения по меньшей мере одного CD20-специфического антитела или фрагмента, или указанного варианта, который может использоваться для измерения или воздействия на клетку, ткань, орган или животное (включая млекопитающих и людей), для диагностирования, мониторинга, модулирования, лечения, ослабления, профилактики, уменьшения симптомов по меньшей мере одного состояния, выбранного из, не ограничиваясь перечисленным, по меньшей мере одного иммунного нарушения или заболевания, сердечно-сосудистого нарушения или заболевания, инфекционного, злокачественного и/или неврологического нарушения или заболевания, либо иного известного связью с антигеном состояния.

Существенное количество человеческих конструированных антител, специфических к человеческим белкам или их фрагментам, например, CD20, может быть сконструировано для других иммуногенных антигенов или изоформ, например, белка CD20 и/или его порции (включая синтетические молекулы, например, синтетические пептиды), или любого антигена или их комбинации, например, CD56, человеческого рецептора фактора роста эпидермиса (HER1), IgE, фактора роста сосудистого эндотелия, ингибиторов димеризации HER, семейства белков Bcl-2, MET, IL-13, альфа-интерферона, EGFL7, CD40, DR4 и DR5, PI3-киназы, альфа-лимфотоксина, бета-7-интегрина, бета-амилоида, CRIg, TNF, комплемента (С5), CBL, CD147, IL-8, gp120, VLA-4, CD11a, CD18, VEGF, CD40L, Id, ICAM-1, CD2, EGFR, бета-TGF, альфа-TNF, Е-селектина, фактора VII, TNF, Her2/neu, F gp, CD11/18, CD14, ICAM-3, CD80, CD40L, CD4, CD23. бета2-интегина, альфа4бета7, CD52, HLA DR, CD22, CD64 (FcR), альфа-бета-TCR, CD2, CD3, Hep B, CA 125, EpCAM, gp120, CMV, gpIIbIIIa, IgE, IL-5, IL-4, CD25, CDS, CD33, CD30, CD19, CD22, CD28, CD36, CD37, CD44, CD55, CD59, CD70, CD79, CD80, CD103, CD134, CD137, CD138, CD152, HLA, VNR-интегрина, CD25, IL-23 и IL-12.

Получение антител

По меньшей мере одно антиген-специфическое антитело по настоящему изобретению, например, антитело против CD20, может, необязательно, производиться клеточной линией, смешанной клеточной линией, бессмертной клеткой или популяцией клона бессмертных клеток, известных в данной области техники. См., к примеру, Ausubel, et al., ed. Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, N.Y. (1987-2001); Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2 издание. Cold Spring Harbor, N.Y. (1989); Harlow, Lane, Antibodies, a Laboratory Manual, Cold Spring Harbor, N.Y. (1989); Colligan, et al., eds. Current Protocols in Immunology, John Wiley & Sons, Inc., NY (1994-2001); Colligan et al., Current Protocols in Protein Science, John Wiley & Sons, NY, N.Y., (1997-2001).

В одном подходе гибридому продуцируют соединением подходящей бессмертной клеточной линии (например, линии клеток миеломы, например, но не ограничиваясь перечисленным, Sp2/0, Sp2/0-AG14, NS0, NS1, NS2, AE-1, L.5, L243, P3X63Ag8.653, Sp2 SA3, Sp2 MAI, Sp2 SS1, Sp2 SA5, U937, MLA 144, ACT IV, MOLT4, DA-1, JURKAT, WEHI, K-562, COS, RAJI, NIH 3T3, HL-60, MLA 144, NAMALWA, NEURO 2A и т. п., или гетеромиеломы, ее продуктов соединения, любой клетки или слитой клетки, полученных из них, либо иной подходящей клетки, известной в данной области техники) (см, например, www.atcc.org, www.lifetech.com и т. п. ) с антитело-продуцирующими клетками, например, не ограничиваясь перечисленным, изолированными или клонированными клетками селезенки, периферической крови, лимфы, миндалин, иными иммунными или В-клетками, иными клетками, экспрессирующими последовательности константной, вариабельной, каркасной, определяющей комплементарность областей тяжелой или легкой цепей, в том числе в виде эндогенных или гетерологических нуклеиновых кислот, в виде рекомбинантной или эндогенной, вирусной, бактериальной ДНК, ДНК водорослей, прокариотов, амфибий, насекомых, пресмыкающихся, рыб, млекопитающих, грызунов, лошадей, овец, коз, овец, приматов, эукариотов, геномной ДНК, кДНК, рДНК, митохондриальной ДНК или РНК, ДНК или РНК хлоропластов, гяРНК, мРНК, тРНК, одно-, дву- и трехцепочечных, гибридизованных и т.п. либо любой их комбинации. См., например, Ausubel, выше, и Colligan, Immunology, выше, глава 2, включенных в настоящую заявку во всей полноте путем ссылки.

Антитело-продуцирующие клетки также могут быть получены из периферической крови либо, предпочтительно, из лимфоузлов или селезенки людей и иных подходящих животных, иммунизированных интересующим антигеном. Любая другая подходящая клетка-хозяин также может использоваться для экспрессирования гетерологической или эндогенной нуклеиновой кислоты, кодирующей антитело, указанный фрагмент или его вариант по настоящему изобретению. Слитые клетки (гибридомы) или рекомбинантные клетки могут быть выделены в селективных культуральных условиях или иными подходящими способами и клонированы ограниченным разбавлением или сортировкой клеток или иными известными способами. Клетки, продуцирующие антитела с желаемой специфичностью могут быть селектированы подходящим анализом (например, ELISA, в частности, - CD20 ELISA).

Также человеческое антиген-специфическое антитело может быть получено иммунизацией трансгенного животного (например, мыши, крысы, хомячка, нечеловекообразного примата и т.д.), способного образовывать репертуар человеческих антител, как описано здесь или известно в данной области техники. Клетки, продуцирующие антиген-специфическое антитело, могут быть выделены от таких животных и могут быть сделаны бессмертными известными способами, например, описанным здесь.

Трансгенные мыши, которые могут производить репертуар человеческих антител, способных связываться с человеческими антигенами, например, CD20, могут быть получены известными способами (например, не ограничиваясь перечисленным, патенты США под номерами 5770428, 5569825, 5545806, 5625126, 5625825, 5633425, 5661016 и 5789650, выданные Lonberg et al.; Jakobovits et al. WO 98/50433, Jakobovits et al. WO 98/24893, Lonberg et al. WO 98/24884, Lonberg et al. WO 97/13852, Lonberg et al. WO 94/25585, Kucherlapate et al. WO 96/34096, Kucherlapate et al. EP 0463 151 Bl, Kucherlapate et al. EP 0710 719 Al, Swani et al. Патент США № 5545807, Bruggemann et al. WO 90/04036, Bruggemann et al. EP 0438 474 Bl, Lonberg et al. EP 0814 259 A2, Lonberg et al. GB 2 272 440 A, Lonberg et al. Nature 368:856-859 (1994), Taylor et al., Int. Immunol. 6(4)579-591 (1994), Green et al. Nature Genetics 7:13-21 (1994), Mendez et al., Nature Genetics 15:146-156 (1997), Taylor et al., Nucleic Acids Research 20(23):6287-6295 (1992), Tuaillon et al., Proc Natl Acad Sci USA 90(8)3720-3724 (1993), Lonberg et al., Int Rev Immunol 13(1):65-93 (1995) и Fishwald et al„ Nat Biotechnol 14(7):845-851 (1996), каждый из которых включен в настоящую заявку во всей полноте путем ссылки). Как правило, у данных мышей имеется по меньшей мере один трансген, содержащий ДНК по меньшей мере одного реаранжированного функционально человеческого локуса иммуноглобулина или локуса, способного к функциональной реаранжировке. Эндогенные локусы иммуноглобулинов у таких мышей могут быть разрушены или удалены для того, чтобы животные не могли продуцировать антитела, кодируемые эндогенными генами.

Скрининг антител на специфическое связывание со схожими белками или фрагментами удобно проводить с использованием дисплейной библиотеки пептидов, фагового дисплея и иных известных способов. Способ пептидного дисплея заключается в скрининге больших коллекций пептидов на предмет индивидуальных членов, обладающих желаемой функцией или структурой. Скрининг с антителами пептидных дисплейных библиотек хорошо известен в данной области техники. Дисплейные пептидные последовательности могут иметь от 3 до 5000 аминокислот в длину, зачастую -5-100 аминокислот, чаще всего - примерно 8-25 аминокислот. Помимо прямых химических способов синтеза пептидных библиотек, описано несколько способов с использованием рекомбинантной ДНК. Один тип заключается в представлении пептидной последовательности на поверхности бактериофага или клетки. Каждый бактериофаг или клетка содержат нуклеотидную последовательность, кодирующую конкретную представляемую пептидную последовательность. Подобные способы описаны в патентных публикациях под номерами РСТ 91/17271, 91/18980, 91/19818 и 93/08278.

Иные системы получения пептидных библиотек включают аспекты как химического синтеза in vitro, так и рекомбинантных способов. Примеры таких систем описаны в патентных публикациях под номерами РСТ 92/05258, 92/14843 и 96/19256. Также см. патенты США под номерами 5658754 и 5643768. Пептидные дисплейные библиотеки, векторы, наборы для скрининга доступны в продаже у таких поставщиков как Invitrogen (Карлсбад, Калифорния), Cambridge Antibody Technologies (Кембриджшир, Соединенное Королевство). Примеры таких систем описаны, к примеру, в патентах США под номерами 4704692, 4939666, 4946778, 5260203, 5455030, 5518889, 5534621, 5656730, 5763733, 5767260, 5856456, выданных Enzon; патентах США под номерами 5223409, 5403484, 5571698, 5837500, выданных Dyax; патентах США под номерами 5427908, 5580717, выданных Affymax; патенте США № 5885793, выданном Cambridge Antibody Technologies; патенте США № 5750373, выданном Genentech; патентах США под номерами 5618920, 5595898, 5576195, 5698435, 5693493, 5698417, выданных Xoma, et al.; и Sambrook, выше. СВ20-антитела по настоящему изобретению также могут быть изготовлены с использованием по меньшей мере одной нуклеиновой кислоты, кодирующей антиген-специфическое антитело для получения трансгенных животных или млекопитающих, например, коз, коров, лошадей, овец, кроликов и т. п., выделяющих такие антитела с молоком. Подобные животные могут быть созданы известными способами. Примеры этих способов описаны, например, не ограничиваясь перечисленным, в патентах США под номерами 5827690, 5849992, 4873316, 5849992, 5994616, 5565362, 5304489 и т. п. Каждый источник включен в настоящий документ во всей полноте путем ссылки.

Антитела против CD20 по настоящему изобретению, помимо этого, могут быть изготовлены с использованием по меньшей мере одной нуклеиновой кислоты, кодирующей антиген-специфическое антитело для получения трансгенных растений и культур растительных клеток (например, не ограничиваясь перечисленным, табака и кукурузы), продуцирующих такие антитела, определенные части или варианты в частях растений или в культивируемых клетках. В качестве нелимитирующего примера, листья трансгенного табака, экспрессирующего рекомбинантные белки, с успехом используются для получения больших количеств рекомбинантных белков, например, с применением индуцируемого промотора. См., к примеру, Cramer et al., Curr. Top. Microbol. Immunol. 240:95-118 (1999) и ссылки, упомянутые в этом источнике. Также трансгенная кукуруза используется для экспрессирования белков млекопитающих в коммерческих количествах с биологической активностью, эквивалентной иным рекомбинантным системам или выделению из природных источников. См., к примеру. Hood et al., Adv. Exp. Med. Biol. 464:127-147 (1999) и ссылки, упомянутые в этом источнике. Антитела (включая фрагменты антител, например, одноцепочечные антитела (ScFvs)) производятся в больших количествах из семян трансгенных растений, включая семена табака, а также из клубней картофеля. См., к примеру, Conrad et al., Plant Mol. Biol. 38:101-109 (1998) и ссылки, упомянутые в этом источнике. Таким образом, СВ20-антитела по настоящему изобретению получаются из трансгенных растений известными способами. См. также, например, Fischer et al., Biotechnol. Appl. Biochem. 30:99-108 (October, 1999), Ma et al., Trends Biotechnol. 13:522-7 (1995); Ma et al., Plant Physiol. 109:341-6 (1995); Whitelam et al., Biochem. Soc. Trans. 22:940-944 (1994) и ссылки, упомянутые в этих источниках.

Конструирование, гуманизация и перестройка антител

Также могут применяться способы конструирования, гуманизации и перестройки нечеловеческих и человеческих антител, которые хорошо известны в данной области техники. Гуманизированное, перестроенное или аналогичным образом конструированное антитело может иметь один или более аминокислотных остатков нечеловеческого происхождения, например, не ограничиваясь перечисленным, от мыши, крысы, кролика, нечеловекообразных обезьян или иных млекопитающих. Эти нечеловеческие аминокислотные остатки заменяются остатками, часто называемыми «импортными» остатками, которые обычно берутся из «импортного» вариабельного, константного или иного домена известной человеческой последовательности.

Известные человеческие Ig-последовательности описаны, например, в www.ncbi.nlm.nih.gov/entrez/query.fcgi; http://www.ncbi.nih.gov/igblast; www.atcc.org/phage/hdb.html; www.mrc-cpe.cam.ac.uk/ALIGNMENTS.php;

www.kabatdatabase.com/top.html; ftp.ncbi.nih.gov/repository/kabat; www.sciquest.com; www.abcam.com; www.antibodyresource.com/onlinecomp.html; www.public.iastate.edu/.about.pedro/research_tools.html; www.whfreeman.com/immunology/CH05/kuby05.htm; www.hhmi.org/grants/lectures/1996/vlab; www.path.cam.ac.uk/.about.mrc7/mikeimages.html; mcb.harvard.edu/BioLinks/Immunology.html; www.immunologylink.com; pathbox.wustl.edu/.about.hcenter/index.html; www.appliedbiosystems.com; www.nal.usda.gov/awic/pubs/antibody; www.m.ehime-u.ac.jp/.about.yasuhito/Elisa.html; www.biodesign.com; www.cancerresearchuk.org; www.biotech.ufl.edu; www.isac-net.org; baserv.uci.kun.nl/.about.jraats/links 1.html; www.recab.uni-hd.de/immuno.bme.nwu.edu; www.mrc-cpe.cam.ac.uk; www.ibt.unam.mx/vir/V_mice.html; http://www.bioinf.org.uk/abs; antibody.bath.ac.uk; www.unizh.ch; www.cryst.bbk.ac.uk/.about.ubcg07s; www.nimr.mrc.ac.uk/CC/ccaewg/ccaewg.html; www.path.cam.ac.uk/.about.mrc7/humanisation/TAHHP.html; www.ibt.unam.mx/vir/structure/stat_aim.html; www.biosci.missouri.edu/smithgp/index.html; www.jerini.de; Kabat et al., Sequences of Proteins of Immunological Interest, U.S. Dept. Health (1983), при этом каждый источник включен в настоящий документ путем ссылки во всей полноте.

Подобные импортированные последовательности могут использоваться для уменьшения иммуногенности, уменьшения, усиления или изменения связывания, аффинности, скорости ассоциации, скорости диссоциации, авидности, специфичности, периода полувыведения и иных подходящих характеристик, известных в данной области техники. Как правило, остатки областей, определяющих комплементарность, прямо и наиболее существенно влияют на CD20-связывание. Соответственно, часть всех нечеловеческих или человеческих последовательностей областей, определяющих комплементарность, сохраняется, в то время как нечеловеческие последовательности вариабельных и константных областей могут быть заменены на человеческие или иные аминокислоты.

Антитела, необязательно, могут быть гуманизированы, перестроены, конструированы в человеческие антитела с высокой аффинностью к антигену CD20 и иными предпочтительными биологическими свойствами. Для достижения этой цели гуманизированные (или человеческие) или сконструированные антитела против CD20 и перестроенные антитела, необязательно, могут быть изготовлены в процессе анализа родительских последовательностей и различных концептуальных гуманизированных и сконструированных продуктов с применением трехмерных моделей родительских, конструированных и гуманизированных последовательностей. Трехмерные модели иммуноглобулинов широкодоступны и известны специалистам в данной области техники. Имеются компьютерные программы, которые иллюстрируют и показывают вероятные трехмерные конформационные структуры выбранных кандидатных последовательностей иммуноглобулинов. Изучение этих проявлений позволяет провести анализ вероятной роли остатков в функционировании кандидатной иммуноглобулиновой последовательности, то есть анализ остатков, влияющих на способность кандидатного иммуноглобулина связываться с его антигеном, например, CD20. Таким образом, каркасные остатки (FR) могут быть выбраны и скомбинированы из консенсусных и импортных последовательностей, так, чтобы получить желаемые характеристики антитела, например, повышенную аффинность к целевому(ым) антигену(ам).

Гуманизирование, перестраивание и конструирование антител по настоящему изобретению могут осуществляться в соответствии с любым известным способом, например, не ограничиваясь перечисленным, способом, описанным в Winter (Jones et al., Nature 321:522 (1986); Riechmann et al., Nature 332:323 (1988); Verhoeyen et al., Science 239:1534 (1988)), Sims et al., J. Immunol. 151: 2296 (1993); Chothia and Lesk, J. Mol. Biol. 196:901 (1987), Carter et al., Proc. Natl. Acad. Sci. U.S.A. 89:4285 (1992); Presta et al., J. Immunol. 151:2623 (1993), Патентах США под номерами 5639641, 5723323, 5976862, 5824514, 5817483, 5814476, 5763192, 5723323, 5766886, 5714352, 6204023, 6180370, 5693762, 5530101, 5585089, 5225539, 4816567, PCT/: US98/16280, US96/18978, US91/09630, US91/05939, US94/01234, GB89/01334, GB91/01134, GB92/01755, W090/14443, W090/14424, W090/14430, ЕР 229246, 7557189, 7538195 и 7342110, причем каждый источник включен в настоящий документ путем ссылки во всей полноте, включая упомянутые в них источники.

Fc-области

В определенных аспектах антитело содержит измененную (например, мутированный) Fc-область. К примеру, в некоторых аспектах, Fc-область изменена так, чтобы были уменьшены или усилены эффекторные функции антитела. В некоторых аспектах Fc-область принадлежит к изотипу, выбранному из IgM, IgA, IgG, IgE, либо к иному изотипу.

Альтернативно или дополнительно может быть полезным комбинировать аминокислотные модификации с одной и более дополнительных аминокислотных модификаций, изменяющих C1q-связывание и/или функцию комплементзависимой цитотоксичности (КЗЦ) Fc-области антиген-связывающей молекулы. Начальным, особенно интересующим полипептидом может быть полипептид, который связывается с C1q и проявляет комплементзависимую цитотоксичность. Полипептиды, уже обладающие C1q-связывающей активностью, необязательно, способные опосредовать КЗЦ, могут быть модифицированы для усиления одной или обеих этих активностей. Аминокислотные модификации, изменяющие C1q и/или модифицирующие его функцию комплементзависимой цитотоксичности, описаны, к примеру, в заявке WO0042072, которая включена в настоящий документ во всей полноте путем ссылки.

Можно разработать Fc-область антитела по настоящему изобретению с измененной эффекторной функцией, например, модифицированием C1q-связывания и/или FcγR-связывания и изменения КЗЦ-активности и/или АЗКЦ-активности. «Эффекторные функции» ответственны за активацию или уменьшение биологической активности (например, у субъекта). Примеры эффекторных функций включают, не ограничиваясь перечисленным: C1q-связывание, комплементзависимую цитотоксичность (КЗЦ), связывание с Fc-рецептором, антитело-зависимую клеточноопосредованную цитотоксичность (АЗКЦ), фагоцитоз, подавление рецепторов на клеточной поверхности (например, В-клеточных рецепторов, BCR) и т. д. Для подобных эффекторных функций может требоваться, чтобы Fc-область была скомбинирована со связывающим доменом (например, вариабельным доменом антитела); они могут быть оценены в различных анализах (например, анализе Fc-связывания, анализах АЗКЦ, анализах КЗЦ и т.д.).

К примеру, можно создать вариантную Fc-область конструированного антитела против CD20 с повышенным C1q-связыванием и повышенным FcγRIII-связыванием (т.е. с повышенной АЗКЦ-активностью и с повышенной КЗЦ-активностью). Альтернативно, если желательно уменьшить или убрать эффекторную функцию, вариантная Fc-область может быть сконструирована с пониженной КЗЦ-активностью и/или пониженной АЗКЦ-активностью. В иных аспектах только одна из данных активностей может быть повышена, а другая, необязательно, может быть понижена (например, для получения Fc-области с повышенной АЗКЦ-активностью, но пониженной КЗЦ-активностью и наоборот). Примером Fc-мутанта служит область с изменением трех остатков: S239D, A330L и I332D (система нумерации EU), у которой АЗКЦ повышена, а КЗЦ понижена. Неограничивающие способы получения таких мутантов приведены, например, в Lazar et al. (2006, Proc. Natl. Acad. Sci. U.S.A. 103(11): 4005-4010) и Okazaki et al. (2004, J. Mol. Biol. 336(5): 1239-49). См. также WO 03/074679, WO 2004/029207, WO 2004/099249, WO 2006/047350, WO 2006/019447, WO 2006/105338, WO 2007/041635.

Fc-мутации также могут быть внедрены в конструированные антитела для изменения их взаимодействия с неонатальным Fc-рецептором (FcRn) и для улучшения их фармакокинетических характеристик. Был описан ряд человеческих Fc-вариантов с улучшенным связыванием к FcRn, например, см. Shields et al., 2001. Картирование с высоким разрешением сайта связывания человеческого IgGl, проведенное для FcγRI, FcγRII, FcγRIII и FcRn, и разработка вариантов IgGI с повышенным связыванием с FcγR, J. Biol. Chem. 276:6591-6604), данный источник включен в настоящую заявку во всей полноте путем ссылки.

Другой тип аминокислотных замен служит для изменения схемы гликозилирования Fc-области антитела. Гликозилирование Fc-области обычно происходит либо через N-связывание, либо через O-связывание. N-связывание, как правило, относится к присоединению углеводородного фрагмента к боковой цепи остатка аспарагина. Последовательности, распознаваемые при ферментном присоединение углеводородного фрагмента к боковой цепи аспарагина, - это аспарагин-Х-серин и аспарагин-Х-треонин, где Х - любая аминокислота, за исключением пролина. Таким образом, при наличии любой из этих пептидных последовательностей возникает потенциальный сайт гликозилирования. Гликозилирование через O-связывание, как правило, относится к присоединению одного из сахаров N-ацетилгалактозамина, галактозы или ксилозы к гидроксиаминокислоте, обычно - к серину или треонину, хотя также они могут присоединяться к 5-гидроксипролину или 5-гидроксилизину.

Схема гликозилирования антитела или его фрагмента может быть изменена, к примеру, путем удаления одного и более сайтов гликозилирования, находящихся в полипептиде и/или добавлением одного и более сайтов гликозилирования, отсутствующих в полипептиде. Удаление сайтов гликозилирования в Fc-области антитела или фрагменте антитела в целях удобства выполняется изменением аминокислотной последовательности, при котором удаляется одна и более из описанных выше трипептидных последовательностей (для сайтов гликозилирования через N-связывание). Примерный вариант гликозилирования имеет аминокислотную замену остатка N297 на А297 (система нумерации EU) тяжелой цепи. Удаление сайта гликозилирования через O-связывание достигается замещением одного и более гликозилированных остатков серина или треонина на любые аминокислоты, помимо серина или треонина.

Также могут быть изменены углеводородные остатки, присоединенные к Fc-областям антител. К примеру, антитела со зрелой углеводородной структурой без фукозы, присоединенной к Fc-области антитела, описаны, к примеру, в патентных заявках под номерами US 2003/0157108 (Presta, L.) и US 2004/0093621 (Kyowa Hakko Kogyo Co., Ltd).

Антитела с рассекающим N-ацетилглюкозамином (GlcNAc) в углеводородном фрагменте, присоединенном к Fc-области, описаны, к примеру, в WO 2003/011878, Jean-Mairet et al. и патенте США № 6602684, Umana et al. Антитела с по меньшей мере одним остатком галактозы в олигосахариде, присоединенном к Fc-области, описаны, к примеру, в WO 1997/30087, Patel et al. См. также, WO 1998/58964 и WO 1999/22764 (Raju, S.), где рассмотрены антитела с изменением углеводородов, присоединенных к Fc-области. См. также, к примеру, US 2005/0123546 (Umana et al.), где рассматриваются антиген-связывающие молекулы с модифицированием гликозилирования.

В определенных аспектах вариант гликозилирования содержит Fc-область, в которой углеводородная структура, присоединенная к Fc-области, не содержит фукозы. Подобные варианты обладают повышенной АЗКЦ-функцией. Примерами публикаций, относящихся к «дефукозилированным» или «фукоза-дефицитным» антителам, служат: US 2003/0157108, WO 2000/61739, WO 2001/29246, US 2003/0115614, US 2002/0164328, US 2004/0093621, US 2004/0132140, US 2004/0110704, US 2004/0110282, US 2004/0109865, WO 2003/085119, WO 2003/084570, WO 2005/035586, WO 2005/035778, WO 2005/053742, Okazaki et al., J. Mol. Biol, 336:1239-1249 (2004); Yamane Ohnuki et al., Biotech. Bioeng., 87:614 (2004). Нелимитирующими примерами клеточных линий, продуцирующих дефукозилированные антитела, являются клетки Lec13 СНО, дефицитные в фукозилировании белков (Ripka et al. Arch. Biochem. Biophys. 249:533-545 (1986); Патентная заявка US 2003/0157108 Al, Presta, L; и WO 2004/056312 Al, Adams et al., особенно в Примере 11), нокаутные клеточные линии, например, по гену альфа-1,6-фукозилтрансферазы, FUT8, нокаутные клетки СНО (Yamane-Ohnuki et al., Biotech. Bioeng., 87: 614 (2004)); также, в клеточных линиях могут применяться ингибиторы пути фукозилирования, например, кастаноспермин (Патентная заявка US 2009/0041765).

В определенных аспектах антитело по настоящему изобретению экспрессируется в клетках, которые экспрессируют бета (1,4)-N-ацетилглюкозаминилтрансферазу III (GnT III), поскольку присоединяет GlcNAc к человеческому конструированному антиген-специфическому антителу. Способы получения антител таким путем представлены в WO/9954342, WO/03011878, патентной публикации 20030003097А1 и Umana et al., Nature Biotechnology, 17:176-180, February 1999.

Аффинность антител

Антитела по изобретению связываются с человеческим CD20 в широком интервале аффинности (KD). В предпочтительном аспекте по меньшей мере одно моноклональное антитело по настоящему изобретению может, необязательно, связываться с человеческим антигеном с высокой аффинностью. К примеру, человеческое или человеческое конструированное или гуманизированное, или перестроенное моноклональное антитело может связываться с человеческим антигеном с KD, равной или меньшей примерно 10-7 М, например, но не ограничиваясь этим, 0,1-9,9 (или любой интервал или величина в этих пределах)×10-7. 10-8, 10-9, 10-10, 10-11, 10-12, 10-13, 10-14, 11-15 или любой интервал или величина в этих пределах, по данным энзим-связанного иммуносорбентного метода исследования (ELISA), поверхностного плазменного резонанса (SPR) по способу KinExA®, как практикуют специалисты в данной области техники. Антитела против CD20 связываются с Kd примерно 10-9 М и менее, в частности, примерно 10-9 -10-10 М.

Аффинность или авидность антитела к антигену определяется экспериментально при помощи любого способа, хорошо известного в данной области техники, например, энзим-связанного иммуносорбентного метода исследования (ELISA), радиоиммунного анализа (RIA) либо кинетического анализа (например, анализа BIACORE™). Анализы в формате прямого связывания, а также конкурентного связывания могут быть легко выполнены. (См., к примеру, Berzofsky, et al., "Antibody-Antigen Interactions," In Fundamental Immunology, Paul, W. E., Ed., Raven Press: New York, N.Y. (1984); Kuby, Janis Immunology, W. H. Freeman and Company: New York, N.Y. (1992); и способы, описанные в настоящем документе. Измеренная аффинность конкретного взаимодействия антитело-антиген может варьироваться при выполнении измерений в различных условиях (концентрации соли, рН, температуре). По этой причине измерения аффинности и других антигенсвязывающих параметров (например, KD или Kd, Kon, Koff) предпочтительно делать со стандартизированными растворами антитела и антигена в стандартизированном буфере, как принято в данной области техники, например, можно использовать буфер, описанный здесь.

В одном аспекте анализы связывания могут проводиться при помощи энзим-связанного иммуносорбентного метода исследования (ELISA) с антигеном CD20. К примеру, в качестве источника антигена CD20 могут использоваться неочищенные клеточные лизаты, приготовленные из клеточных линий CD20-экспрессирующих В-клеток, либо рекомбинантные белки, как описано здесь. Подобными препаратами антигена CD20 покрывают планшеты 2НВ в 50 мМ натрия карбоната (рН 9,6) в концентрации 100 мкл/лунку приблизительно на 18-24 ч при 4°С. Планшеты промывают промывочным буфером (0,1% Твин-20 в TBS, рН 7,4). Затем планшеты блокируют при помощи раствора 1% казеина в TBS (рН 7,4) 1 час при комнатной температуре. Серийные разбавления антител добавляют на планшеты и инкубируют их 3 часа при комнатной температуре, а затем промывают так, как описано ранее. Для детектирования добавляют HRP-конъюгированные козьи античеловеческие или антимышиные антитела в качестве вторичного антитела и инкубируют 1 час при комнатной температуре. Планшеты промывают так, как описано ранее, затем добавляют по 100 мкл/лунку субстрата ТМВ1 для проявления. Спустя приблизительно 20 минут реакцию останавливают, добавляя 100 мкл/лунку 450 нм стоп-реактива (BioFX). Измеряют абсорбцию на 450 нм, строят график ее зависимости от концентрации антитела для каждого антитела. Сигмовидную кривую дозовой зависимости сопоставляют с кривыми связывания при помощи GraphPad Prism v4 (GraphPad software, Сан-Диего, Калифорния) с параметрами по умолчанию и рассчитывают величины ЕС50. Величины ЕС50 могут использоваться для измерения кажущейся константы диссоциации «Kd» или «KD» для каждого антитела.

Процентная (%) идентичность аминокислотной последовательности пептидной или полипептидной последовательности также определяется как процентное количество аминокислотных остатков в кандидатной последовательности, идентичных аминокислотным остаткам конкретного пептида или полипептидной последовательности после выравнивания последовательностей и введения брешей, при необходимости, для достижения максимальной процентной идентичности последовательностей и не считая консервативные замены идентичными. Выравнивание для целей определения процентной идентичности аминокислотных последовательностей может быть достигнуто различными способами, известными в данной области техники, например, обсуждавшимися здесь, например, используя доступное публично программное обеспечение, например, BLAST, BLAST-2, ALIGN или Megalign (DNASTAR). Специалисты в данной области техники могут определить необходимые параметры для измерения выравнивания, включая любые алгоритмы, которые нужны для достижения максимального выравнивания по всей длине сравниваемых последовательностей. Если ALIGN-2 доступно и может быть использовано для сравнения аминокислотных последовательностей, то процентная идентичность аминокислотной последовательности А с или относительно заданной аминокислотной последовательности В (что иначе может быть сформулировано как содержание заданной аминокислотной последовательностью А определенного процентного количества идентичности аминокислотной последовательности к В) рассчитывается таким образом:

100-кратное отношение X/Y, где Х - количество аминокислотных остатков, признанных идентичными программой выравнивания ALIGN-2 во время выравнивания А и В, a Y -общее количество аминокислотных остатков в В. Следует принять во внимание, что если длина последовательности А не равна длине последовательности В, то процентная идентичность последовательности А в сравнении с В не будет равна процентной идентичности последовательности В в сравнении с А.

Желательно, чтобы две или более аминокислотных последовательностей были идентичны по меньшей мере на 50%, 60%, 70%, 80% либо 90%. Более предпочтительно, чтобы две или более аминокислотных последовательностей были идентичны по меньшей мере на 95%, 96%, 97%, 98%, 99% или даже 100%. Если специально не указано иное, все величины процентной идентичности аминокислотной последовательности, используемые здесь, получены так, как описано в предшествующем абзаце, используя, к примеру, компьютерные программы ALIGN-2 или BLAST.

Применение антител

В общем случае некоторые формы антиген-специфических антител, применимые в способах и композициях по настоящему изобретению, необязательно могут характеризоваться высокой связывающей способностью с антигеном и, необязательно и предпочтительно, низкой токсичностью и малой выраженностью нежелательных эффектов у реципиента. В частности, антитело, определенный фрагмент или вариант по изобретению, в котором индивидуальные компоненты, например, вариабельная область, константная область и каркасная область, индивидуально и/или коллективно, необязательно и предпочтительно проявляют низкую иммуногенность, полезны в настоящем изобретении. Антитела, которые могут использоваться по изобретению, необязательно характеризуются их терапевтической способностью в течение длительных периодов с измеряемым ослаблением симптомов и низкой и/или приемлемой токсичностью. Низкая или приемлемая иммуногенность и/или высокая аффинность, а также иные подходящие свойства могут вносить вклад в достигаемые терапевтические результаты. «Низкая иммуногенность» определяется здесь как наличие по данным титрования антител к антигену у пациентов, получавших антитело, с частотой менее 25% из проходивших терапию пациентов, предпочтительно - менее 10% из пациентов, проходивших терапию с рекомендованной дозой по рекомендованному курсу терапии в течение периода лечения.

Изолированные нуклеиновые кислоты по настоящему изобретению могут использоваться для получения по меньшей мере одного CD20-специфического антитела или его фрагмента, или указанного варианта, который может использоваться для измерения или воздействия на клетку, ткань, орган или животное (включая млекопитающих и людей), для диагностирования, мониторинга, модулирования, лечения, ослабления, профилактики, уменьшения симптомов по меньшей мере одного состояния, выбранного из, но не ограничиваясь перечисленным, по меньшей мере одного иммунного нарушения или заболевания, сердечно-сосудистого нарушения или заболевания, инфекционного, злокачественного и/или неврологического нарушения или заболевания, либо иного известного связью с антигеном состояния.

Такой способ может содержать введение эффективного количества композиции или фармацевтической композиции, содержащей по меньшей мере одно антиген-специфическое антитело, например, антитело против CD20 или фрагмент, в клетку, ткань, орган, животному или пациенту, нуждающимся в подобной модуляции, лечении, ослаблении, профилактике, уменьшении симптомов, эффектов или механизмов. Эффективное количество может содержать количество приблизительно 0,001-500 мг/кг на однократное (например, болюсное), многократное или непрерывное введение, либо такое количество, чтобы достичь концентрации приблизительно 0,01-5000 мкг/мл сыворотки за однократное, многократное или непрерывное введение, либо любое эффективное количество или интервал, которое выполняется и определяется известными способами, как описано здесь или как известно в данной области техники.

Примерные антитела

Предпочтительные антиген-специфические CD20 антитела по изобретению обладают показанными последовательностями. К примеру, антиген-специфическое антитело по изобретению включает антитела с последовательностями CDR легкой цепи, показанными в Таблице 1 (например, CDRL1, CDRL2, а также CDRL3), и/или антитела с последовательностями CDR тяжелой цепи, показанными в Таблице 1 (например, CDRH1, CDRH2 и CDRH3). В частности, антитело против CD20-6 имеет CDRL1 с SEQ ID NO:25, CDRL2 с SEQ ID NO: 26, CDRL3 с SEQ ID NO: 27, CDRH1 с SEQ ID NO: 28, CDRH2 с SEQ ID NO: 29, CDRH3 с SEQ ID NO: 30. А антитело против CD20-7 имеет CDRL1 с SEQ ID NO: 17, CDRL2 с SEQ ID NO: 18, CDRL3 с SEQ ID NO: 19, CDRH1 с SEQ ID NO: 20, CDRH2 с SEQ ID NO: 21, CDRH3 с SEQ ID NO: 22.

Примерными аспектами настоящего изобретения служат:

Обычному специалисту в данной области техники понятно, что последовательности в настоящей заявке являются неограничивающими примерами.

Функциональные эквиваленты, варианты антител и производные

Функциональные эквиваленты дополнительно включают фрагменты антител, которые обладают такими же или сравнимыми характеристиками связывания, что и целое антитело. Подобные фрагменты могут содержать одну или обе Fab-области F(ab′)2-фрагмента. Предпочтительно, чтобы фрагменты антител содержали все шесть областей, определяющих комплементарность, целого антитела, хотя фрагменты, содержащие меньшее количество этих областей, например, одну, две, три, четыре или пять областей, определяющих комплементарность, также функциональны. Дополнительно функциональные эквиваленты могут являться членами любого из следующих классов иммуноглобулинов: IgG, IgM, IgA, IgD или IgE и их подклассов или могут комбинировать их.

В определенных вариантах воплощения изобретения антитела против CD20 могут быть модифицированы для получения слитых белков, например, антитела или его фрагмента, слитых с гетерологическим белком, полипептидом или пептидом. В определенных аспектах белок, слитый с частью антитела против CD20, является энзимным компонентом ADEPT. Примерами иных белков или полипептидов, которые могут быть реализованы в виде слитых белков с антителом против CD20, являются, не ограничиваясь перечисленным, токсины, например, рицин, абрин, рибонуклеазы, дезоксирибонуклеаза I, стафилококковый энтеротоксин-А, антивирусный протеин лаконоса, гелонин, дифтериновый токсин, псевдомонадный экзотоксин и псевдомонадный эндотоксин. См., к примеру, Pastan et al., Cell, 47:641 (1986); Goldenberg et al., Cancer Journal for Clinicians, 44:43 (1994). Токсины с ферментной активностью и их фрагменты, которые могут использоваться, включают цепь А дифтерийного токсина, несвязывающиеся активные фрагменты дифтерийного токсина, цепь А экзотоксина (из Pseudomonas aeruginosa), цепь Арицина, цепь Аабрина, цепь Амодеццина, альфа-сарцин, белки Aleurites fordii, белки диантина, белки Phytolaca americana (PAPI, PAPII и РАР-S), ингибитор momordica charantia, курцин, кротин, ингибитор sapaonaria officinalis, гелонин, митогеллин, рестриктоцин, феномицин, эномицинитрикотецины. Неограничивающие примеры включены, например, в публикацию WO 93/21232, опубликованную 28 октября 1993 и включенную в настоящую заявку в полном объеме путем ссылки.

Дополнительные слитые белки могут быть получены техниками перетасовки генов, перетасовки мотивов, перетасовки экзонов и/или перетасовки кодонов (совокупно называемых «перетасовкой ДНК»). Перетасовка ДНК может применяться для изменения активности антител или их фрагментов (например, для получения антитела или его фрагмента с большей аффинностью и меньшей скоростью диссоциации). См. в общем патенты США под номерами 5605793, 5811238, 5830721, 5834252, 5837458, а также Patten et al., 1997, Curr. Opinion Biotechnol, 8:724-33; Harayama, 1998, Trends Biotechnol, 16(2):76-82; Hansson et al., 1999, J. Mol. Biol., 287:265-76; и Lorenzo and Blasco, 1998, Biotechniques, 24(2):308-313, каждая из которых включена во всей полноте путем ссылки. Антитело, помимо этого, может быть домен-связывающим иммуноглобулином, слитым с белком, согласно публикациям U.S. 20030118592, U.S. 200330133939 и публикации РСТ WO 02/056910, все от Ledbetter et al., которые включены во всей полноте путем ссылки.

Доменные антитела. Антитела против CD20 в композициях и способах по изобретению могут быть доменными антителами, например, антителами, содержащими небольшие функциональные связывающие единицы антител, соответствующие вариабельным областям тяжелой (VH) или легкой (VL) цепей человеческих антител. Примером доменных антител служат, не ограничиваясь перечисленным, те, которые доступны в продаже у Domantis Limited (Кембридж, UK) и Domantis Inc. (Кембридж, Массачусетс, США), специфические к терапевтическим мишеням (см., к примеру, WO 04/058821, WO 04/003019, патенты США под номерами 6291158, 6582915, 6696245, 6593081). Доступные в продаже библиотеки доменных антител могут использоваться для идентификации доменных антител против CD20. В определенных аспектах антитела против CD20 согласно изобретению содержат CD20 функциональную связывающую единицу и функциональную связывающую единицу Fc гамма рецептора.

Диатела. Термин «диатела» относится к небольшим фрагментам антител с двумя антигенсвязывающими сайтами, причем фрагменты содержат вариабельную область тяжелой цепи (VH), соединенную с вариабельной областью легкой цепи (VL), в одной полипептидной цепи (VH-VL). Используя линкер, который слишком короток для того, чтобы было возможно спаривание двух доменов на одной цепи, домены заставляют спариваться с комплементарными доменами другой цепи с получением двух антигенсвязывающих сайтов. Диатела более подробно описаны, например, в ЕР 404097, WO 93/11161 и Hollinger et al„ Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993).

Вакцитела. В определенных аспектах изобретения антитела против CD20 являются вакцителами. Вакцитела - димерные полипептиды. Каждый мономер вакцитела состоит из региона scFv со специфичностью к поверхностной молекуле на антиген-презентирующей клетке, соединенной через шарнирный участок и домен Cg3 со вторым scFv. В иных аспектах изобретения вакцитела, содержащие по меньшей мере одну область scFv антитела против CD20, могут использоваться для совмещения устраняемых В-клеток и эффекторных клеток, медиирующих АЗКЦ. К примеру, см. Bogen et al., патентная заявка США № 20040253238.

Линейные антитела. В определенных аспектах изобретения антитела против CD20 являются линейными антителами. Линейные антитела содержат пару тандемных сегментов Fd (VH-CH1-VH-CH1), образующих пару антигенсвязывающих областей. Линейные антитела могут быть биспецифическими или моноспецифическими. Неограничивающие примеры линейных антител приведены, к примеру, в Zapata et al., Protein Eng., 8(10):1057-1062 (1995).

Родительское антитело. В определенных аспектах изобретения антитела против CD20 являются родительскими антителами. «Родительское антитело» - антитело, содержащее аминокислотную последовательность, в которой отсутствует один и более аминокислотных остатков в или рядом с его гипервариабельной областью в сравнении с модифицированным/мутантным антителом, описанным здесь. Таким образом, родительское антитело обладает более короткой гипервариабельной областью в сравнении с гипервариабельной областью мутантного антитела, описанного здесь. Родительский полипептид может содержать нативную последовательность (например, встречающуюся в природе) антитела (включая природные аллельные варианты) или антитела с заранее внедренными модификациями последовательности (такими, как инсерции, делеции или замещения) встречающейся в природе последовательности. Предпочтительно, чтобы родительское антитело являлось гуманизированным антителом или человеческим антителом.

Фрагменты антител. «Фрагменты антител» содержат часть антитела полной длины, обычно, антигенсвязывающую или вариабельную область. Примерами фрагментов антител служат фрагменты Fab, Fab′, F(ab′)2 и Fv, диатела, линейные антитела, молекулы одноцепочечных антител, мультиспецифические антитела, образованные из фрагментов антител, среди прочих.

Традиционно фрагменты получали посредством протеолитического расщепления целых антител (см, например, Morimoto et al., Journal of Biochemical and Biophysical Methods, 24:107-117 (1992) и Brennan et al., Science, 229:81 (1985)). Тем не менее, в настоящее время фрагменты могут быть получены непосредственно из рекомбинантных клеток-хозяев. К примеру, фрагменты антител могут быть выделены из библиотек антител фагов, обсуждавшихся здесь. Альтернативно фрагменты Fab′-SH могут быть прямым образом восстановлены из Е. coli и химически спарены с образованием фрагментов F(ab′)2 (Carter et al., Bio Technology, 10:163-167 (1992)). Согласно другому подходу фрагменты F(ab′)2 могут быть выделены непосредственно из рекомбинантной клеточной культуры. Иные техники получения фрагментов антител очевидны опытному специалисту с учетом подробных рекомендаций, приведенных в настоящей спецификации. В других аспектах антитело выбора является одноцепочечным Fv фрагментом (scFv). См., к примеру, WO 93/16185. В определенных аспектах антитело не является Fab-фрагментом.

Биспецифические антитела. Биспецифические антитела - антитела, обладающие специфичностью к связыванию с по меньшей мере двумя различными эпитопами. Примерные биспецифические антитела могут связываться с двумя различными эпитопами CD20. Другие подобные антитела могут связываться с CD20, а также со вторым антигеном. Альтернативно CD20-связывающее плечо может быть скомбинировано с плечом, связывающимся с триггерной молекулой лейкоцита, например, Т-клеточной рецепторной молекулой (например, CD2 или CD3), либо с Fc-рецепторами к IgG (FcγR), так, чтобы оказывать направленное действие на механизмы клеточной защиты мишени. Биспецифические антитела также могут использоваться для локализации цитотоксических агентов у мишени. Данные антитела обладают плечом, связывающим клеточный маркер, и плечом, соединенным с цитотоксическим агентом (например, сапорином, антиинтерферона, алкалоидом барвинка, А-цепью рицина, метола-экзатом или гаптеном с радиоактивным изотопом). Биспецифические антитела могут быть получены в виде целых антител или их фрагментов (например, F(ab′): биспецифические антитела).

Способы получения биспецифических антител известны в данной области техники. См., к примеру, Millstein et al., Nature, 305:537-539 (1983); Traunecker et al., EMBO J., 10:3655-3659 (1991); Suresh et al., Methods in Enzymology, 121:210 (1986); Kostelny et al., J. Immunol., 148(5):1547-1553 (1992); Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993); Gruber et al., J. Immunol., 152:5368 (1994); патенты США под номерами 4474893, 4714681, 4925648, 5573920, 560181, 95731168, 4676980 и 4676980, WO 94/04690, WO 91/00360, WO 92/200373, WO 93/17715, WO 92/08802, ЕР 03089 и US 2009/0048122.

В определенных аспектах изобретения композиции и способы включают биспецифическое мышиное антитело или его фрагмент, и/или его конъюгаты со специфичностью к человеческим CD20 и эпсилон-цепи CD3 рецептора Т-клеток, подобно биспецифическому антителу, описанному Daniel et al., Blood, 92:4750-4757 (1998). В предпочтительных аспектах, в которых антитела против CD20 или их фрагменты, или конъюгаты, согласно композициям и способам по изобретению, биспецифичны, антитела против CD20 человеческие или гуманизированы, и обладают специфичностью к человеческому CD20 и эпитопу на Т-клетке либо способны к связыванию с человеческой эффекторной клеткой, например, моноцитом/макрофагом и/или клеткой-натуральным киллером, для запуска гибели клеток.

Связывающая способность антител

В определенных аспектах изобретения антитела против CD20 могут быть модифицированы с изменением их связывающей способности к CD20 и его антигенным фрагментам. Связывающие свойства могут быть определены множеством анализов in vitro, известных в данной области техники, например, иммуноферментным анализом (ИФА, ELISA), радиоиммунным анализом (RIA) либо кинетическим анализом (например, анализом BIACORE™). Понятно, что связывающая молекула с низкой KD предпочтительна.

В одном аспекте настоящего изобретения антитела или фрагменты антител специфически связывают CD20 и его антигенные фрагменты с константой диссоциации KD или Kd (koff/kon) менее чем 10-5 М или менее чем 10-6 М, или менее чем 10-7 М, или менее чем 10-8 М, или менее чем 10-9 М, или менее чем 10-10 М, или менее чем 10-11 М, или менее чем 10-12 М, или менее чем 10-13 М.

В ином аспекте антитело или фрагмент по изобретению связывается с CD20 и/или его антигенным фрагментом с Koff менее чем 1×10-3 с-1 или менее чем 3×10-3 с-1. В других аспектах антитело связывается с CD20 и его антигенными фрагментами с Koff менее чем 10-3 с-1, менее чем 5×10-3 с-1, менее чем 10-4 с-1, менее чем 5×10-4 с-1, менее чем 10-5 с-1, менее чем 5×10-5 с-1, менее чем 10-6 с-1, менее чем 5×10-6 с-1, менее чем 10-7 с-1, менее чем 5×10-7 с-1, менее чем 10-8 с-1, менее чем 5×10-8 с-1, менее чем 10-9 с-1, менее чем 5×10-9 с-1 либо менее чем 10-10 с-1.

В другом аспекте антитело или фрагмент, согласно изобретению, связывается с CD20 и/или его антигенными фрагментами с константой скорости ассоциации kon по меньшей мере 105 М-1 с-1, по меньшей мере 5×105 М-1 с-1, по меньшей мере 106 М-1 с-1, по меньшей мере 5×106 М-1 с-1, по меньшей мере 107 М-1 с-1, по меньшей мере 5×107 М-1 с-1, по меньшей мере 108 М-1 с-1 или по меньшей мере 109 М-1 с-1.

Специалисту понятно, что конъюгаты согласно изобретению обладают такими же свойствами, что и описанные здесь соединения.

pI и Tm антитела

В определенных аспектах изобретения антитела против CD20 могут быть модифицированы с изменением их изоэлектрической точки (р1). Антитела, как и все полипептиды, обладают р1, которая понимается как рН, при которой полипептид не несет заряда. В данной области техники известно, что растворимость белка, как правило, наиболее низка при рН раствора, равном изоэлектрической точке (р1) белка. При использовании здесь величина pI определяется как pI преобладающей заряженной формы. pI белка может быть определена множеством способов, включая, но не ограничиваясь перечисленным, изоэлектрическое фокусирование и различные компьютерные алгоритмы (см., например, Bjellqvist et al., 1993, Electrophoresis, 14:1023). Помимо этого, термические температуры расплавления (Tm) Fab-домена антитела могут быть хорошим показателем термической стабильности антитела и могут дополнительно свидетельствовать о сроке его хранения. Меньшая Tm свидетельствует о большей агрегации и меньшей стабильности, в то время как большая Tm свидетельствует о меньшей агрегации и большей стабильности. Таким образом, в определенных аспектах предпочтительны антитела с большей Tm. Tm домена белка (например, Fab-домена) может быть измерена с использованием любого стандартного способа, известного в данной области техники, например, дифференциальной сканирующей калориметрии (см., например, Vermeer et al., 2000, Biophys. J. 78:394-404; Vermeer et al., 2000, Biophys. J. 79: 2150-2154).

Соответственно, дополнительный неисключающий аспект настоящего изобретения включает модифицированные антитела, обладающие определенными предпочтительными биохимическими характеристиками, например, конкретной изоэлектрической точкой (pI) или температурой плавления (Tm).

В частности, в одном аспекте модифицированные антитела, согласно настоящему изобретению, имеют pI в интервале 5,5-9,5. В еще одном специфическом аспекте модифицированные антитела, согласно настоящему изобретению, обладают pI в интервале приблизительно 5,5-6,0 или приблизительно 6,0-6,5, или приблизительно 6,5-7,0, или приблизительно 7,0-7,5, или приблизительно 7,5-8,0, или приблизительно 8,0-8,5, или приблизительно 8,5-9,0, или приблизительно 9,0-9,5. В иных специфических аспектах модифицированные антитела, согласно настоящему изобретению, имеют pI в интервале 5,5-6,0 либо 6,0-6,5, либо 6,5-7,0, либо 7,0-7,5, либо 7,5-8,0, либо 8,0-8,5, либо 8,5-9,0, либо 9,0-9,5. В частности, модифицированные антитела, согласно настоящему изобретению, обладают pI по меньшей мере 5,5, по меньшей мере 6,0, по меньшей мере 6,3, по меньшей мере 6,5, по меньшей мере 6,7, по меньшей мере 6,9, по меньшей мере 7,1, по меньшей мере 7,3, по меньшей мере 7,5, по меньшей мере 7,7, по меньшей мере 7,9, по меньшей мере 8,1, по меньшей мере 8,3, по меньшей мере 8,5, по меньшей мере 8,7, по меньшей мере 8,9, по меньшей мере 9,1, по меньшей мере 9,3, по меньшей мере 9,5. В иных специфических аспектах модифицированные антитела, согласно настоящему изобретению, обладают pI по меньшей мере приблизительно 5,5, по меньшей мере приблизительно 6,0, по меньшей мере приблизительно 6,3, по меньшей мере приблизительно 6,5, по меньшей мере приблизительно 6,7, по меньшей мере приблизительно 6,9, по меньшей мере приблизительно 7,1, по меньшей мере приблизительно 7,3, по меньшей мере приблизительно 7,5, по меньшей мере приблизительно 7,7, по меньшей мере приблизительно 7,9, по меньшей мере приблизительно 8,1, по меньшей мере приблизительно 8,3, по меньшей мере приблизительно 8,5, по меньшей мере приблизительно 8,7, по меньшей мере приблизительно 8,9, по меньшей мере приблизительно 9,1, по меньшей мере приблизительно 9,3, по меньшей мере приблизительно 9,5.

Возможно оптимизировать растворимость, изменяя количество и расположение ионизируемых остатков в антителе для корректировки р1. К примеру, pI полипептида может быть изменена замещением аминокислот (например, замещением заряженной аминокислоты, такой как лизин, на незаряженную аминокислоту, такую как аланин). Без привязки к какой-либо конкретной теории аминокислотные замены антител, которые приводят к изменению pI указанных антител, могут повышать растворимость и/или стабильность антител. Специалистам в данной области техники понятно, какие именно аминокислотные замены надо сделать в конкретном антителе для получения желаемой pI. В одном аспекте в антителе по изобретению производится замена для изменения pI. Специфически предполагается, что замещение(я) Fc-области, которые приводят к изменению связывания с FcγR (описано выше), помимо этого могут приводить к изменению р1. В другом аспекте замещение(я) Fc-области специфически выбраны так, чтобы влить и на изменение связывания с FcγR, и на изменение р1.

В одном аспекте модифицированные антитела, согласно настоящему изобретению, имеют Tm в интервале 65°C-120°C. В специфических аспектах модифицированные антитела по настоящему изобретению имеют Tm в интервале приблизительно 75°С-120°С либо приблизительно 75°С-85°С, либо приблизительно 85°С-95°С, либо приблизительно 950C-1050C, либо приблизительно 105°С-115°С, либо приблизительно 115°С-120°С. В других специфических аспектах модифицированные антитела по настоящему изобретению имеют Tm в интервале 75°С-120°С либо 75°С-85°С, либо 85°С-95°С, либо 95°C-105°C, либо 105°С-115°С, либо 115°C-120°C. В специфических аспектах модифицированные антитела по настоящему изобретению имеют Tm по меньшей мере приблизительно 65°С либо по меньшей мере приблизительно 70°С, либо по меньшей мере приблизительно 75°С, либо по меньшей мере приблизительно 80°С, либо по меньшей мере приблизительно 85°С, либо по меньшей мере приблизительно 90°С, либо по меньшей мере приблизительно 95°С, либо по меньшей мере приблизительно 100°С, либо по меньшей мере приблизительно 105°С, либо по меньшей мере приблизительно 110°С, либо по меньшей мере приблизительно 115°С, либо по меньшей мере приблизительно 120°С. В других специфических аспектах модифицированные антитела по настоящему изобретению имеют Tm по меньшей мере б5°С либо по меньшей мере 70°С, либо по меньшей мере 75°С, либо по меньшей мере 80°С, либо по меньшей мере 85°С, либо по меньшей мере 90°С, либо по меньшей мере 95°С, либо по меньшей мере 100°С, либо по меньшей мере 105°С, либо по меньшей мере 110°С, либо по меньшей мере 115°С, либо по меньшей мере 120°С.

Конструированная Эффекторная Функция

Может быть желательным модифицировать эффекторную функцию антитела против CD20 по изобретению, например, для увеличения эффективности антитела при терапии заболеваний, ассоциированных с В-клетками, рака, РТПХ или отторжения. К примеру, в область Fc могут быть внедрены цистеиновые остатки, что позволит образовываться внутрицепочечным дисульфидным связям в данной области. Гомодимерные антитела, полученные таким способом, могут обладать улучшенной способностью к интернализации и/или повышенной способностью вызывать комплементобусловленную гибель клеток и/или антителозависимую клеточную цитотоксичность (АЗКЦ). См. Caron et al., J. Exp Med., 176:1191-1195 (1992) и Shopes, В., J. Immunol., 148:2918-2922 (1992). Гомодимерные антитела с повышенной активностью также могут быть получены с использованием гетеробифункциональных перекрестно-сшивающих линкеров, как описано в Wolff et al., Cancer Research, 53:2560-2565 (1993). Альтернативно может быть сконструировано антитело с дуальными Fc-областями, как следствие, обладающее повышенной способностью к лизису комплементом и к АЗКЦ. См. Stevenson et al., Anti-Cancer Drug Design, 3:219-230 (1989).

В отрасли известны и другие способы конструирования Fc-областей антител для изменения эффекторных функций (например. Патентная публикация США № US 20040185045 и публикация РСТ № WO 2004/016750, обе - авторства Koenig et al., в которых описано модифицирование Fc-области для усиления связывающей способности FcγRIIB в сравнении с FcγRIIA; см. также публикации РСТ под номерами WO 99/58572 Armour et al., WO 99/51642 Idusogie et al. и патент США 6395272 Deo et al., сущность которых включена в настоящую заявку во всей полноте). В данной области техники известны и способы модифицирования Fc-областей антител для уменьшения связывающей способности с Fc γRIIB (например. Патентная публикация США № US 20010036459 и публикация РСТ № WO 01/79299, обе - авторства Ravetch et al., сущность которых включена в настоящую заявку во всей полноте). Известны модифицированные антитела с вариантными Fc-области, обладающими повышенной связывающей активностью с FcγRIIIA и/или FcγRIIA в сравнении с Fc-областью дикого типа (например, публикация РСТ № WO 2004/063351 Stavenhagen et al., сущность которой включена в настоящую заявку во всей полноте).

Анализы in vitro, известные в данной области техники, могут использоваться для определения того, способны ли, например, антитела против CD20, композиции, конъюгаты или способы согласно изощрению обуславливать АЗКЦ, такие, как описанные здесь.

Вариантные Fc-области. Настоящее изобретение представляет приготовление белков, содержащих вариантную Fc-область. Вариантная Fc-область - Fc-область, не встречающаяся в природе, например, такая, которая содержит одну или более не встречающихся в природе аминокислот. Также, вариантные Fc-области по настоящему изобретению охватывают Fc-области, содержащие делеции, вставки, замены аминокислот.

Необходимо понимать, что Fc-область, при использовании здесь, включает полипептиды, содержащие константную область антитела, за исключением первой константной области иммуноглобулинового домена. Таким образом, Fc относится к двум последним константным областям иммуноглобулиновых доменов IgA, IgD и IgG, а также к трем последним константным областям иммуноглобулиновых доменов IgE и IgM, и к гибкому шарнирному N-концу данных доменов. В случае IgA и IgM Fc может включать J-цепь. В случае IgG Fc содержит иммуноглобулиновые домены Сγ2 и Сγ3 (Сγ2 и Сγ3) и шарнирную область между Cγ1 (Cγ1) и Сγ2 (Сγ2). Хотя края Fc-области могут варьироваться, Fc-область тяжелой цепи человеческого IgG, как правило, определяется как содержащий остатки от С226 или Р230 до его карбоксильного конца, где нумерация приводится согласно EU индексу, описанному Kabat et al. (1991, NIH Publication 91-3242, National Technical Information Service, Спрингфилд, Вирджиния). Термин «EU индекс, определенный Kabat» относится к нумерации остатков человеческого IgG1 EU антитела, таким образом, как это описано у Kabat et al., выше. Fc может относиться к изолированной области, области как части антитела, фрагмента антитела либо Fc-слитого белка. Fc-вариантный белок может быть антителом, Fc-слитым белком либо иным белком или доменом, содержащим Fc-область. Особенно предпочтительны белки, содержащие вариантные Fc-области, которые являются не встречающимися в природе вариантами Fc. В ряде позиций Fc наблюдается полиморфизм, включая, но не ограничиваясь перечисленным, Kabat 270, 272, 312, 315, 356 и 358, и подобные несущественные различия между представленной последовательностью и последовательностями, известными в данной области техники, могут существовать и быть известными специалистам в данной области техники, основываясь на данных рекомендациях.

Настоящее изобретение охватывает Fc-вариантные белки, обладающие модифицированными характеристиками связывания Fc-лиганда (например, Fc-рецептора, C1q) относительно сравниваемой молекулы (например, белка с такой же аминокислотной последовательностью, за исключением наличия Fc-области дикого типа). Примеры характеристик связывания включают, не ограничиваясь перечисленным, специфичность связывания, равновесную константу (KD), скорости диссоциации и ассоциации (Koff и Kon), связывающую способность (аффинность) и/или авидность. В общем понятно, что связывающая молекула (например, Fc-вариантный белок, например, антитело) с низкой KD более предпочтительна, нежели связывающая молекула с высокой KD. Однако, в некоторых случаях величина Kon или Koff может иметь более существенное значение, нежели величина KD. Специалист в данной области техники может определить, какой кинетический параметр наиболее важен для конкретного применения антитела.

Аффинность и связывающие свойства Fc-домена с его лигандом могут быть определены множеством анализов in vitro (биохимических или иммунологических), известных в данной области техники и предназначенных для определения Fc-FcγR взаимодействий, например, специфического связывания Fc-области с FcγR, включая, но не ограничиваясь перечисленным, равновесные способы (например, ИФА ELISA), радиоиммунный анализ (RIA)) либо кинетические способы (например, анализ BIACORE™) и другие способы, например, непрямые анализы связывания, конкурентные анализы ингибирования, флуоресцентно-резонансный перенос энергии (FRET), гель-электрофорез и хроматографию (например, гель-фильтрацию). В этих и других способах может использоваться метка одного и более исследуемых компонентов и/или множество способов детектирования, включая, но не ограничиваясь перечисленным, хромогенные, флуоресцентные, люминесцентные, изотопные метки. Детальное описание связывающей способности и кинетики приведено, к примеру, в Paul, W. E., ed., Fundamental Immunology, 4th Ed., Lippincott-Raven, Philadelphia (1999).

К примеру, модификация, усиливающая связывание Fc с одним и более положительных регуляторов (например, FcγRIIIA), с сохранением или даже уменьшением связывания Fc с отрицательным регулятором FcγRIIB более предпочтительна для увеличения АЗКЦ-активности. Альтернативно модификация, уменьшающая связывание с одним и более положительных регуляторов и/или усиливающая связывание с FcγRIIB, была бы предпочтительна для увеличения АЗКЦ-активности. Соответственно, соотношение связывающих способностей (например, равновесных констант диссоциации (KD)) может показать, была ли АЗКЦ-активность Fc-варианта увеличена или уменьшена. К примеру, уменьшение соотношения равновесных констант диссоциации FcγRIIIA/FcγRIIB (KD) будет коррелировать с повышением АЗКЦ-активности, а увеличение соотношения будет коррелировать с понижением АЗКЦ-активности. Дополнительно модификации, усиливающие связывание с C1q были бы предпочтительны для усиления КЗЦ-активности, в то время как модификации, ослабляющие связывание с C1q, были бы предпочтительны для уменьшения или устранения КЗЦ-активности.

В одном аспекте Fc-варианты по изобретению связывают FcγRIIIA с большей аффинностью относительно сравниваемой молекулы. В одном аспекте Fc-варианты по изобретению связывают FcγRIIIA с большей аффинностью и связывают FcγRIIB с такой же аффинностью, как и у сравниваемой молекулы. В еще одном аспекте Fc-варианты по изобретению связывают FcγRIIIA с большей аффинностью и связывают FcγRIIB с меньшей аффинностью относительно сравниваемой молекулы. В еще одном аспекте Fc-варианты по изобретению имеют соотношение равновесных констант диссоциации (KD) FcγRIIIA/FcγRIIB, меньшее или большее относительно сравниваемой молекулы.

В одном аспекте Fc-вариантный белок обладает повышенным связыванием с одним или более Fc-лигандов относительно сравниваемой молекулы. В другом аспекте Fc-вариантный белок обладает аффинностью к Fc-лиганду по меньшей мере в 2 раза или по меньшей мере в 3 раза, или по меньшей мере в 5 раз, или по меньшей мере в 7 раз, или по меньшей мере в 10 раз, или по меньшей мере в 20 раз, или по меньшей мере в 30 раз, или по меньшей мере в 40 раз, или по меньшей мере в 50 раз, или по меньшей мере в 60 раз, или по меньшей мере в 70 раз, или по меньшей мере в 80 раз, или по меньшей мере в 90 раз, или по меньшей мере в 100 раз, или по меньшей мере в 200 раз выше, чем у сравниваемой молекулы. В специфическом аспекте Fc-вариантный белок обладает повышенным связыванием с Fc-рецептором. В ином специфическом аспекте Fc-вариантный белок обладает повышенным связыванием с Fc-рецептором FcγRIIIA. В еще одном специфическом аспекте Fc-вариантный белок обладает повышенным связыванием с Fc-рецептором FcRn. В еще одном специфическом аспекте Fc-вариантный белок обладает повышенным связыванием с C1q относительно сравниваемой молекулы.

В другом аспекте Fc-вариант по изобретению имеет равновесную константу диссоциации (KD), уменьшенную примерно в 2-10 раз или уменьшенную примерно в 5-50 раз, или уменьшенную примерно в 25-250 раз, или уменьшенную примерно в 100-500 раз, или уменьшенную примерно в 250-1000 раз относительно сравниваемой молекулы. В другом аспекте Fc-вариант по изобретению имеет равновесную константу диссоциации (KD), уменьшенную в 2-10 раз или уменьшенную в 5-50 раз, или уменьшенную в 25-250 раз, или уменьшенную в 100-500 раз, или уменьшенную в 250-1000 раз относительно сравниваемой молекулы. В специфическом аспекте Fc-варианты обладают равновесными константами диссоциации (KD) с FcγRIIIA по меньшей мере в 2 раза или по меньшей мере в 3 раза, или по меньшей мере в 5 раз, или по меньшей мере в 7 раз, или по меньшей мере в 10 раз, или по меньшей мере в 20 раз, или по меньшей мере в 30 раз, или по меньшей мере в 40 раз, или по меньшей мере в 50 раз, или по меньшей мере в 60 раз, или по меньшей мере в 70 раз, или по меньшей мере в 80 раз, или по меньшей мере в 90 раз, или по меньшей мере в 100 раз, или по меньшей мере в 200 раз, или по меньшей мере в 400 раз, или по меньшей мере в 600 раз ниже, чем у сравниваемой молекулы.

Периоды полувыведения в сыворотке белков, содержащих Fc-области, могут быть увеличены путем увеличения связывающей способности Fc-области с FcRn. В одном аспекте Fc-вариантный белок обладает увеличенным периодом полувыведения в сыворотке относительно сравниваемой молекулы.

«Антителозависимая клеточноопосредованная цитотоксичность» или «АЗКЦ» относится к типу цитотоксичности, при котором секретируемый Ig связывается с рецепторами Fc (FcRs), присутствующими на определенных цитотоксических клетках (например, клетках-натуральных киллерах (NK), нейтрофилах, макрофагах), позволяя данным цитотоксическим эффекторным клеткам специфически связываться с антиген-несущей клеткой-мишенью и, впоследствии, убивать клетку-мишень цитотоксинами. Высокоаффинные IgG-антитела, к примеру, присоединенные к поверхности клеток-мишеней, активируют цитотоксические клетки и обеспечивают гибель клеток. Лизис клеток-мишеней является внеклеточным, требует прямого контакта клетка-клетка и не вовлекает комплемента. Предполагается, что, помимо антител, иные белки, содержащие Fc-области, особенно Fc-слитые белки, обладающие способностью к специфическому связыванию с антиген-несущей клеткой-мишенью, смогут проявлять клеточнозависимую цитотоксичность. В целях простоты клеточно-зависимая цитотоксичность, происходящая вследствие активности Fc-слитого белка, в настоящем документе также называется АЗКЦ-активностью.

Способность любого конкретного Fc-вариантного белка вызывать лизис клетки-мишени через АЗКЦ может быть измерена. Чтобы оценить АЗКЦ-активность, интересующий Fc-вариантный белок добавляют к клеткам-мишеням в комбинации с иммунными эффекторными клетками, которые могут быть активированы комплексами антиген-антитело, приводя к лизису клеток-мишеней. Как правило, цитолиз определяют по высвобождению метки (например, радиоактивного субстрата, флуоресцентного красителя или натуральных внутриклеточных белков) из лизированных клеток. Для подобных анализов пригодны такие эффекторные клетки как мононуклеарные клетки периферической крови (ПКМК) и клетки-натуральные киллеры (НК). Конкретные примеры АЗКЦ-анализов in vitro описаны в Wisecarver et al., 1985, 79:277-282; Bruggemann et al., 1987, J Exp Med, 166:1351-1361; Wilkinson et al., 2001, J Immunol Methods, 258:183-191; а также Patel et al., 1995, J Immunol Methods, 184:29-38. Альтернативно или дополнительно АЗКЦ-активность интересующего Fc-вариантного белка может быть оценена in vivo, например, в животной модели, к примеру, описанной Clynes et al., 1998, PNAS USA, 95:652-656.

В одном аспекте Fc-вариантный белок обладает повышенной АЗКЦ-активностью относительно сравниваемой молекулы. В другом аспекте Fc-вариантный белок обладает АЗКЦ-активностью по меньшей мере в 2 раза или по меньшей мере в 3 раза, или по меньшей мере в 5 раз, или по меньшей мере в 10 раз, или по меньшей мере в 50 раз, или по меньшей мере в 100 раз выше, чем у сравниваемой молекулы. В ином специфическом аспекте Fc-вариантный белок обладает повышенным связыванием с Fc-рецептором FcγRIIIA и повышенной АЗКЦ-активностью относительно сравниваемой молекулы. В других аспектах Fc-вариантный белок обладает и повышенной АЗКЦ-активностью, и более длинным периодом полувыведения в сыворотке относительно сравниваемой молекулы.

«Комплементзависимая цитотоксичность» и «КЗЦ» относятся к лизису клетки-мишени в присутствии комплемента. Путь активации комплемента инициируется при связывании первого компонента системы комплемента (C1q) с молекулой, например, антителом, находящегося в комплексе с родственным антигеном. Чтобы оценить активацию комплемента, может быть проведен анализ КЗЦ, например, как описано в Gazzano-Santoro et al., 1996, J. Immunol. Methods, 202:163. В одном аспекте Fc-вариантный белок обладает повышенной КЗЦ-активностью относительно сравниваемой молекулы. В конкретном аспекте Fc-вариантный белок обладает КЗЦ-активностью по меньшей мере в 2 раза или по меньшей мере в 3 раза, или по меньшей мере в 5 раз, или по меньшей мере в 10 раз, или по меньшей мере в 50 раз, или по меньшей мере в 100 раз выше, чем у сравниваемой молекулы. В других аспектах Fc-вариантный белок обладает и повышенной КЗЦ-активностью, и более длинным периодом полувыведения в сыворотке относительно сравниваемой молекулы.

В одном аспекте в настоящем изобретении предлагаются составы, в которых Fc-область содержит не встречающуюся в природе аминокислоту в одной и более позиций, выбранных из группы, состоящей из 234, 235, 236, 239, 240, 241, 243, 244, 245, 247, 252, 254,256,262, 263,264, 265, 266, 267, 269, 296, 297, 298, 299, 313.325,326,327,328, 329. 330, 332, 333 и 334 позиций, согласно нумерации по индексу EU, определенному Kabat. Необязательно Fc-область может содержать не встречающуюся в природе аминокислоту в дополнительных и/или альтернативных положениях, известных специалисту (см., например, патенты США под номерами 5624821, 6277375, 6737056, патентные публикации РСТ WO 01/58957, WO 02/06919, WO 04/016750, WO 04/029207, WO 04/035752 и WO 05/040217), либо в положениях, определенных здесь.

В специфическом аспекте в настоящем изобретении предлагается композиция Fc-вариантного белка, где Fc-область содержит по меньшей мере одну не встречающуюся в природе аминокислоту в положении, выбранном из группы, состоящей из 234D, 234Е, 234N, 234Q, 234Т, 234Н, 234Y, 2341, 234V, 234F, 235А, 235D, 235R, 235W, 235Р, 235S, 235N, 235Q, 235Т, 235Н, 235Y, 2351, 235V, 235F, 236Е, 239D, 239Е, 239N, 239Q, 239F, 239Т, 239Н, 239Y, 2401, 240A, 240T, 240M, 241W, 241L, 241Y, 241E, 241R, 243W, 243L 243Y, 243R, 243Q, 244H, 245A, 247V, 247G, 252Y, 254T, 256E, 2621, 262A, 262T, 262E, 2631, 263A, 263T, 263M, 264L, 2641, 264W, 264T, 264R, 264F, 264M, 264Y, 264E, 265G, 265N, 265Q, 265Y, 265F, 265V, 2651, 265L, 265H, 265T, 2661, 266A, 266T, 266M, 2670, 267L, 269H, 269Y. 269F, 269R, 296E, 296Q, 296D, 296N, 296S, 296T, 296L, 2961, 296H,-269G, 297S, 297D, 297E, 298H, 2981, 298T, 298F, 2991, 299L, 299A, 299S, 299V, 299H, 299F, 299E, 313F, 325Q, 325L, 3251, 325D, 325E, 325A, 325T, 325V, 325H, 327G, 327W, 327N, 327L, 328S, 328M, 328D, 328E, 328N, 328Q, 328F, 3281, 328V, 328T, 328H, 328A, 329F, 329H, 329Q, 330K, 330G, ЗЗОТ, ЗЗОС, 330L, 330Y, 330V, 3301, 330F, 330R, 330H, 332D, 332S, 332W, 332F, 332E, 332N, 332Q, 332T, 332H, 332Y и 332А, согласно нумерации по индексу EU, определенному Kabat. Необязательно Fc-область может содержать дополнительные и/или альтернативные не встречающиеся в природе аминокислотные остатки, известные специалисту в данной области техники (см., например, патенты США под номерами 5624821, 6277375, 6737056, патентные публикации РСТ WO 01/58957, WO 02/06919, WO 04/016750, WO 04/029207, WO 04/035752 и WO 05/040217).

В другом аспекте в настоящем изобретении предлагается состав Fc-вариантного белка, в котором Fc-область содержит не встречающуюся в природе аминокислоту по меньшей мере в одной позиции и более, выбранных из группы, состоящей из 239, 330 и 332 позиций, согласно нумерации по индексу EU, определенному Kabat. В конкретном аспекте в настоящем изобретении предлагается состав Fc-вариантного белка, в котором Fc-область содержит не встречающуюся в природе аминокислоту по меньшей мере в одной позиции, выбранной из группы, состоящей из 239D, 330L и 332Е позиций, согласно нумерации по индексу EU, определенному Kabat. Необязательно Fc-область может, помимо этого, содержать дополнительную не встречающуюся в природе аминокислоту в одной позиции и более, выбранных из группы, состоящей из 252, 254 и 256 позиций, согласно нумерации по индексу EU, определенному Kabat. В конкретном аспекте в настоящем изобретении предлагается состав Fc-вариантного белка, в котором Fc-область содержит не встречающуюся в природе аминокислоту по меньшей мере в одной позиции, выбранной из группы, состоящей из 239D, 330L и 332Е позиций, согласно нумерации по индексу EU, определенному Kabat, и не встречающуюся в природе аминокислоту по меньшей мере в одной позиции и более, выбранных из группы, состоящей из 252Y, 254Т и 256Е позиций, согласно нумерации по индексу EU, определенному Kabat.

В одном аспекте Fc-варианты по настоящему изобретению могут быть скомбинированы с другими известными Fc-вариантами, например, описанными в Ghetie et al., 1997, Nat. Biotech. 15:637-40; Duncan et al, 1988, Nature 332:563-564; Lund et al., 1991, J. Immunol., 147:2657-2662; Lund et al, 1992, Mol. Immunol, 29:53-59; Alegre et al, 1994, Transplantation 57:1537-1543; Hutchins et al., 1995, Proc Natl. Acad Sci USA, 92:11980-11984; Jefferis et al, 1995, Immunol Lett., 44:111-117; Lund et al., 1995, Faseb J., 9:115-119; Jefferis et al, 1996, Immunol Lett., 54:101-104; Lund et al, 1996, J. Immunol., 157:4963-4969; Armour et al., 1999, Eur J Immunol 29:2613-2624; Idusogie et al, 2000, J. Immunol., 164:4178-4184; Reddy et al, 2000, J. Immunol., 164:1925-1933; Xu et al., 2000, Cell Immunol., 200:16-26; Idusogie et al., 2001, J. Immunol., 166:2571-2575; Shields et al„ 2001, J Biol. Chem., 276:6591-6604; Jefferis et al, 2002, Immunol Lett., 82:57-65; Presta et al., 2002, Biochem Soc Trans., 30:487-490); патентах США под номерами 5624821, 5885573, 5677425, 6165745, 6277375, 5869046, 6121022, 5624821, 5648260, 6528624, 6194551, 6737056, 6821505, 6277375, патентной публикации США № US 2004/0002587, публикациях РСТ WO 94/29351, WO 99/58572, WO 00/42072, WO 02/060919, WO 04/029207, WO 04/099249, WO 04/063351, в которых описаны примеры вариантов Fc. Также настоящим изобретением охватываются Fc-области, содержащие делеции, вставки и/или замены. Иные модификации/замены/вставки/делеции в Fe-домене очевидны специалисту в данной области техники.

Способы получения не встречающихся в природе Fc-областей известны в данной области техники. К примеру, аминокислотные замены и/или делеции могут быть получены способами мутагенеза, включая, но не ограничиваясь перечисленным, сайт- направленный мутагенез (например, Kunkel, Proc. Natl. Acad. Sci. USA, 82:488-492 (1985)), ПЦР-мутагенез (например, Higuchi, в "PCR Protocols: A Guide to Methods and Applications", Academic Press, San Diego, pp. 177-183 (1990)), а также кассетный мутагенез (например. Wells et al., Gene, 34:315-323 (1985)). Предпочтительно, чтобы сайт-направленный мутагенез проводился способом ПЦР с перекрывающимися праймерами (например, Higuchi, в "PCR Technology: Principles and Applications for DNA Amplification", Stockton Press, New York, pp. 61-70 (1989)). Альтернативно техника ПЦР с перекрывающимися праймерами (например, Higuchi, выше.) может использовать для введения любой(ых) желаемой(ых) мутации(й) в последовательность-мишень (начальную ДНК). К примеру, первый раунд ПЦР в способе ПЦР с перекрывающимися праймерами включает амплификацию целевой последовательности с внешним праймером (праймером 1) и внутренним праймером мутагенеза (праймером 3), и, отдельно, со вторым внешним праймером (праймером 4), и внутренним праймером (праймером 2), образуя два ПЦР-сегмента (сегменты А и В). Внутренний праймер мутагенеза (праймер 3) составлен таким образом, чтобы содержать несоответствия с последовательностью-мишенью, определяющие желаемую(ые) мутацию(и). Во втором раунде ПЦР продукты первого раунда ПЦР (сегменты А и В) амплифицируются способом ПЦР с использованием двух внешних праймеров (праймеров 1 и 4). Полученный ПЦР-сегмент полной длины (сегмент С) расщепляют рестриктазами, полученный после рестрикции фрагмент клонируют в нужный вектор. В качестве первого этапа мутагенеза исходную ДНК (например, кодирующую Fc-слитый белок, антитело или просто Fc-область) функционально клонируют в вектор мутагенеза. Праймеры составляют таким образом, чтобы отражать желаемые аминокислотные замены. Иные примерные способы, подходящие для получения вариантных Fc-областей, известны в данной области техники (см., например, патенты США под номерами 5624821, 5885573, 5677425, 6165745, 6277375, 5869046, 6121022, 5624821, 5648260, 6528624, 6194551, 6737056, 6821505, 6277375, патентную публикацию US 2004/0002587 и публикации РСТ WO 94/29351, WO 99/58572, WO 00/42072, WO 02/060919, WO 04/029207, WO 04/099249, WO 04/063351, содержимое которых включено в настоящую заявку во всей полноте путем ссылки).

В некоторых аспектах Fc-вариантный белок содержит одну и более конструированных гликоформ, например, углеводородную композицию, которая ковалентно связана с молекулой, содержащей Fc-область. Конструированные гликоформы могут использоваться для множества целей, включая, но не ограничиваясь указанным, увеличение или уменьшение эффекторных функций. Конструированные гликоформы могут быть получены способами, описанными здесь или любым способом, известным специалисту в данной области техники, к примеру, с использованием конструированных или вариантных штаммов экспрессии, использованием условий роста или среды, приводящих к гликозилированию, либо совместной экспрессией одного и более ферментов, к примеру, DI N-ацетилглюкозаминилтрансферазы III (GnTI11), экспрессией молекулы, содержащей Fc-область в различных организмах или клеточных линиях различных организмов, либо модифицированием углеводорода(ов) после экспрессии молекулы, содержащей Fc-область. Способы получения конструированных гликоформ известны в данной области техники и включают, не ограничиваясь перечисленным, те, которые описаны в Umana et al., 1999, Nat. Biotechnol, 17:176-180; Davies et al., 20017 Biotechnol Bioeng., 74:288-294; Shields et al., 2002, J Biol. Chem., 277:26733-26740; Shinkawa et al., 2003, J Biol. Chem., 278:3466-3473), патенте США № 6602684, заявках US 10/277370, US 10/113929, PCT WO 00/61739A1, РСТ WO 01/292246 A1, РСТ WO 02/311140 А1, РСТ WO 02/30954 A1, технологии Potillegent™ (Biowa, Inc., Принстон, Нью-Джерси), технологии гликозилирования GlycoMAb™ (GLYCART™ biotechnology AG, Цюрих, Швейцария). См. также WO 00061739, ЕА01229125, US 20030115614, Okazaki et al., 2004, JMB, 336: 1239-49.

Полинуклеотиды, векторы, клетки-хозяева и рекомбинантные способы

В настоящем изобретении также предлагаются полинуклеотиды, содержащие нуклеотидную последовательность, кодирующую антитело по изобретению или его эпитоп-связывающие фрагменты.

Настоящее изобретение также охватывает полинуклеотиды, кодирующие полипептид, который может связывать CD20 и который гибридизирует в жестких условиях гибридизации полинуклеотиды, кодирующие антитело согласно настоящему изобретению, причем указанные жесткие условия гибридизации таковы: пре-гибридизация 2 часа при 60°С в 6x SSC, 0,5% SDS, 5х раствора Денхардта, 100 мкг/мл ДНК молок лосося, денатурированной нагревом, гибридизация 18 часов при 60°С с двойной промывкой в 4х SSC, 0,5% SDS, 0,1% натрия пирофосфата, 30 минут при 60°С и дважды в 2x SSC, 0,1% SDS в течение 30 минут при 60°С.

Полинуклеотиды могут быть получены, а нуклеотидная последовательность полинуклеотидов может быть определена по способам, известным в данной области техники. К примеру, если нуклеотидная последовательность антитела известна, то полинуклеотид, кодирующий антитело, может быть собран из химически синтезированных олигонуклеотидов (например, как описано в Kutmeier et al., 1994, BioTechniques 17:242), что, вкратце, заключается в синтезе перекрывающихся олигонуклеотидов, содержащих части последовательности, кодирующей антитело, отжиге и связывании данных олигонуклеотидов, а затем в амплификации сшитых олигонуклеотидов при помощи ПЦР.

Способы конструирования рекомбинантных векторов, содержащих последовательности, кодирующие антитела и соответствующие транскрипционные и трансляционные контрольные сигналы, хорошо известны в данной области техники. Данные способы включают, к примеру, рекомбинантные ДНК-методики in vitro, синтетические методики и генетическую рекомбинацию in vivo. В изобретении, таким образом, предлагаются реплицируемые векторы, содержащие нуклеотидную последовательность, кодирующую молекулу антитела по настоящему изобретению, его легкую или тяжелую цепь, либо вариабельный домен легкой или тяжелой цепи, либо эпитоп-связывающий фрагмент любого из перечисленного, функционально связанный с промотором.

Рекомбинантный вектор переносят в клетку-хозяина обычными методиками, трансфицированные клетки затем культивируют обычными методиками для получения антител по изобретению. Таким образом, изобретение включает клетки-хозяева, содержащие полинуклеотиды, кодирующие антитело по изобретению, либо их эпитоп-связывающий фрагмент, функционально связанный с гетерологическим промотором. В предпочтительных аспектах векторы, кодирующие и тяжелую, и легкую цепи, могут совместно экспрессироваться в клетке-хозяине для экспрессии целой молекулы иммуноглобулина.

Для экспрессирования молекул антител по изобретению могут использоваться различные системы хозяин-вектор экспрессии. Подобные системы хозяин-экспрессия предоставляют носители, посредством которых интересующие кодирующие последовательности могут быть получены и, впоследствии, очищены, а также предоставляют клетки которые могут после трансформации или трансфекции соответствующими кодирующими последовательностями нуклеотидов экспрессировать молекулу антитела по изобретению in situ. К ним относятся, не ограничиваясь перечисленным, микроорганизмы, например, бактерии (например, Е. coli и В. subtilis), трансформированные рекомбинантной бактериофаговой ДНК, плазмидной ДНК или космидной ДНК с векторами экспрессии, содержащими последовательности, кодирующие антитела; дрожжи (например, Saccharomyces и Pichid), трансформированные рекомбинантными векторами дрожжей, содержащими последовательности, кодирующие антитела; системы клеток насекомых, инфицированные рекомбинантными вирусными векторами экспрессии (например, бакуловирусом), содержащими последовательности, кодирующие антитела; системы клеток растений, инфицированные рекомбинантными вирусными векторами экспрессии (например, вирусом мозаики цветной капусты (CaMV), вирусом мозаики табака (TMV)) или трансформированные рекомбинантными плазмидными векторами экспрессии (например, плазмидой Ti), содержащими последовательности, кодирующие антитела; или системы клеток млекопитающих (например, клеток COS, СНО, ВНК, 293, 3T3) с внедренной конструкцией экспрессией, содержащей промоторы, происходящие из генома клеток млекопитающих (например, промотор металлотионеина) или из вирусов млекопитающих (например, поздний промотор аденовируса, 7,5К промотор вируса осповакцины).

Предпочтительно для экспрессии молекулы рекомбинантного антитела используются бактериальные клетки, например, Escherichia coli, и, более предпочтительно - эукариотные клетки, особенно для экспрессии целых молекул рекомбинантных антител. К примеру, клетки млекопитающих, например, клетки яичника китайского хомячка (СНО), совместно с вектором, например, главным промежуточным ранним генным промотором человеческого цитомегаловируса, являются эффективной системой экспрессии антител (к примеру, как описано в Foecking et al., 1986, Gene 45:101; Cockett et al., 1990, Bio/Technology 8:2).

Для долгосрочного и высокопродуктивного получения рекомбинантных белков предпочтительна стабильная экспрессия. К примеру, могут быть сконструированы клеточные линии, которые стабильно экспрессируют молекулу антитела. Вместо использования векторов экспрессии, содержащих вирусные источники репликации, клетки-хозяева могут быть трансформированы при помощи ДНК, контролируемой соответствующими элементами контроля экспрессии (например, промоторами, энхансерами, терминаторами транскрипции, сайтами полиаденилирования и т.д.) и маркером селекции. После внедрения чужеродной ДНК конструированные клетки могут доращиваться 1-2 дня на обогащенной среде, а затем их переносят на селективную среду. Маркер селекции в рекомбинантной плазмиде придает устойчивость против селекции и позволяет клеткам стабильно интегрировать плазмиду в их хромосомы, а также образовывать фокусы, которые, в свою очередь, могут быть клонированы и подвергнуты экспансии в клеточные линии. Способ может с выгодой использоваться для конструирования клеточных линий, экспрессирующих молекулы антител. Подобные конструированные клеточные линии могут быть особенно полезны при скрининге и оценивании компонентов, прямо или косвенно взаимодействующих с молекулой антитела.

После того, как молекула антитела по изобретению была рекомбинантно экспрессирована, она может быть очищена любым способом, известным в данной области техники, для очистки молекулы иммуноглобулина, к примеру, хроматографией (например, ионообменной, аффинной, аффинной к специфическому антигену, помимо Протеина А, эксклюзионной хроматографией), центрифугированием, способом дифференциальной растворимости или по любой иной стандартной технике, предназначенной для очистки белков. В этой связи дается ссылка на патент США № 7538195, рекомендации которого включены в настоящую заявку во всей полноте путем ссылки.

В другом аспекте различные антитела и фрагменты антител, а также аналоги антител легко могут быть получены мутированием, добавлением делеции или вставки в последовательности вариабельной и константной областей, фланкирующих конкретный набор областей, определяющих комплементарность. Так, к примеру, для заданного набора определяющих комплементарность областей могут существовать различные классы антител при замещении различных тяжелых цепей, например, могут быть получены типы антител и изотипы IgG1-4, IgM, IgA1-2, IgD, IgE. Аналогично искусственные антитела, охватываемые изобретением, могут производиться внедрением заданного набора областей, определяющих комплементарность, в полностью синтетическую каркасную область. Термин «вариабельный» используется здесь для описания определенных частей вариабельных доменов, различающихся последовательностью среди антител и определяющих связывание и специфичность каждого конкретного антитела с его антигеном. Однако, вариабельность различных доменов антитела, как правило, неравномерна. Как правило, наиболее вариабельны три сегмента, называемые областями, определяющими комплементарность (CDR), или гипервариабельными областями, расположенные в вариабельных доменах и легкой, и тяжелой цепей. Более консервативные части вариабельных доменов называют каркасными (FR). Вариабельные домены тяжелой и легкой цепей содержат четыре каркасных области, образующих конфигурацию бета-листов, соединенных тремя областями, определяющими комплементарность, образующими соединительные петли, а иногда - образующими часть структур бета-листов. Области, определяющие комплементарность, в каждой цепи держатся близко с каркасными областями и с областями, определяющими комплементарность другой цепи, образуя антигенсвязывающий сайт антитела (см., к примеру, Е. A. Kabat et al. Sequences of Proteins of Immunological Interest, пятое издание, 1991, NIH). Константные домены непосредственно не вовлечены в связывание антитела с антигеном, но проявляют различные эффекторные функции, например, участвуют в проявлении антителом антителозависимой клеточной цитотоксичности.

Гуманизированные антитела или антитела, адаптированные к неотторжению другими млекопитающими, могут быть изготовлены по нескольким технологиям, например, перестройке и CDR-имплантации. По технологии перестраивания в комбинации применяются молекулярное моделирование, статистический анализ и мутагенез для корректирования не-CDR поверхностей вариабельных областей, чтобы сделать поверхности известных антител соответствующими мишеням. Стратегии и способы перестраивания антител, а также другие способы уменьшения иммуногенности антител у различных хозяев описаны, к примеру, в патенте США 5639641, который включен в настоящий документ во всей полноте путем ссылки. По технологии CDR-имплантации мышиные области легкой и тяжелой цепей, определяющие комплементарность, пересаживаются в полностью человеческую каркасную последовательность.

Изобретение также включает функциональные эквиваленты антител, описанных в данной спецификации. Функциональные эквиваленты имеют характеристики связывания, сравнимые с характеристиками антител, и включают, к примеру, химеризированные, гуманизированные и одноцепочечные антитела, а также их фрагменты. Примерные способы получения подобных функциональных эквивалентов описаны в заявке РСТ WO 93/21319, Европейской патентной заявке № 239400, заявке РСТ WO 89/09622, Европейской патентной заявке 338745 и Европейской патентной заявке ЕР332424, которые включены в настоящий документ во всей полноте путем ссылки.

Функциональные эквиваленты включают полипептиды с аминокислотными последовательностями, практически такими же, как аминокислотные последовательности вариабельных или гипервариабельных областей антител по изобретению. Термин «практически такой же» в приложении к аминокислотной последовательности определяется здесь как последовательность по меньшей мере с 90%, а более предпочтительно - по меньшей мере с 95%, 96%, 97%, 98% или 99% идентичностью последовательности с другой аминокислотной последовательностью по данным поиска FASTA в соответствии с Pearson, Lipman, Proc. Natl. Acad. Sci. USA 85, 2444-2448 (1988).

Химеризированные антитела предпочтительно обладают константными областями, происходящими по большей части или полностью из константных областей человеческих антител, и вариабельными областями, происходящими по большей части или полностью из вариабельных областей млекопитающих, отличных от человека. Гуманизированные формы антител изготовлены путем замены областей, определяющих комплементарность, в человеческой каркасной области на области, к примеру, мышиного антитела, например, как описано в публикации РСТ № WO 92/22653. Гуманизированные антитела, предпочтительно, обладают константными областями и вариабельными областями, отличными от областей, определяющих комплементарность (CDR), и происходящими по большей части или полностью из соответствующих областей человеческих антител, и областями, определяющими комплементарность, происходящими по большей части или полностью от млекопитающих, отличных от человека.

Функциональные эквиваленты также включают одноцепочечные фрагменты антител, также известных как одноцепочечные антитела (scFvs). Данные фрагменты содержат по меньшей мере один фрагмент аминокислотной последовательности вариабельной области тяжелой цепи (VH), связанный с по меньшей мере одним фрагментом аминокислотной последовательности вариабельной области легкой цепи (VL) через один линкер и более либо без них. Подобный линкер может быть коротким гибким пептидом, выбранным таким образом, чтобы обеспечить правильное трехмерное скручивание доменов (VL) и (VH) при их связывании для поддержания специфичности связывания, такой же, как у целого антитела, из которого был получен одноцепочечный фрагмент антитела. Карбоксильный конец последовательности (VL) или (VH) может быть ковалентно связан подобным пептидным линкером с аминным концом комплементарной последовательности (VL) и (VH). Одноцепочечные фрагменты могут быть получены молекулярным клонированием, использованием фаговой библиотеки антител или аналогичными техниками. Данные белки могут производиться либо эукариотными клетками, либо прокариотными клетками, включая бактерии.

Одноцепочечные фрагменты антител содержат аминокислотные последовательности с по меньшей мере одной вариабельной или определяющей комплементарность областью (CDR) целого антитела, описанной в данной спецификации, но не содержат некоторых или всех константных доменов данных антител. Константные домены не нужны для связывания антигена, однако, дают существенный вклад в структуру целого антитела. Одноцепочечные фрагменты антител могут решить ряд проблем, связанных с использованием антител, содержащих часть или все константные домены. К примеру, одноцепочечные фрагменты антител обычно не участвуют в нежелательных взаимодействиях между биологическими молекулами и константной областью тяжелой цепи и не оказывают иной нежелательной биологической активности. Помимо этого, одноцепочечные фрагменты существенно меньше, чем целые или неизмененные антитела и, таким образом, могут лучше проникать в капилляры, чем неизмененные антитела, позволяя одноцепочечным фрагментам локализоваться и связываться с антигенсвязывающими сайтами более эффективно. Также фрагменты антител могут быть в большом количестве получены в прокариотных клетках, что упрощает их производство. Помимо этого, благодаря относительно малому размеру одноцепочечных фрагментов антител, они с меньшей вероятностью вызывают иммунный ответ у реципиентов, нежели неизмененные антитела.

Знание аминокислотной и нуклеиновой последовательностей антитела против CD20 и его перестроенных или гуманизированных вариантов, описанных в здесь, может использоваться для разработки множества антител, которые также связываются с человеческим CD20. В ряде исследований было изучено влияние одной и более аминокислотных замен в различных позициях последовательности антитела, основываясь на сведениях о первичной структуре антитела, его свойствах, например, связывании и уровне экспрессии (например, Yang, W. P. et al., 1995, J. Mol. Biol., 254, 392-403; Rader, С. et al., 1998, Proc. Natl. Acad. Sci. USA, 95, 8910-8915; Vaughan, Т. J. et al., 1998, Nature Biotechnology, 16, 535-539).

В данных исследованиях были получены варианты первичного антитела путем изменения последовательностей в генах тяжелой и легкой цепей в CDR1, CDR2, CDR3 или каркасных областях с использованием таких способов, как олигонуклеотид-опосредованный сайт-направленный мутагенез, кассетный мутагенез, устойчивой к ошибкам ПЦР, перестановок ДНК либо с использованием мутирующих штаммов Е. coli (Vaughan, Т. J. et al., 1998, Nature Biotechnology, 16, 535-539; Adey, N. В. et al., 1996, Chapter 16, pp. 277-291, в "Phage Display of Peptides and Proteins", Eds. Kay, B. K. et al., Academic Press). Данные способы изменения последовательности первичного антитела привели к улучшению аффинности вторичных антител (например. Gram, H. et al., 1992, Proc. Natl. Acad. Sci. USA, 89, 3576-3580; Boder, Е. Т. et al., 2000, Proc. Natl. Acad. Sci. USA, 97, 10701-10705; Davies, J. and Riechmann, L., 1996, Immunotechnolgy, 2, 169-179; Thompson, J. et al., 1996, J. Mol. Biol., 256, 77-88; Short, M. K. et al., 2002, J. Biol. Chem., 277,16365-16370; Furukawa, K. et al., 2001, J. Biol. Chem., 276, 27622-27628).

При помощи аналогичной управляемой стратегии изменения одного и более аминокислотных остатков антитела, последовательности антител, описанных в изобретении, могут использоваться для разработки антител против CD20 с улучшенной функцией, например, способами, описанными в патентной заявке 20090246195, содержимое которой включено в настоящую заявку во всей полноте путем ссылки.

Иммуноконъюгаты

Настоящее изобретение также направлено на конъюгаты (также называемые иммуноконъюгатами), содержащие антитела против CD20, фрагменты антител, функциональные эквиваленты, улучшенные антитела и их аспекты, описанные здесь, связанные или конъюгированные с препаратом или его предшественником. Подходящие препараты и их предшественники известны в данной области техники. Предпочтительными препаратами и их предшественниками являются цитотоксические препараты. Цитотоксический агент, используемый в цитотоксическом конъюгате, согласно настоящему изобретению, может быть любым соединением, приводящим клетку к гибели или индуцирующим гибель клетки, или некоторым образом уменьшающим жизнеспособность клетки и может являться, к примеру, майтансиноидами и аналогами майтансиноидов, бензодиазепинами, таксоидами, СС-1065 и аналогами СС-1065, дуокармицином и аналогами дуокармицина, энедиинами, например, калихеамицинами, доластатином и аналогами доластатина, включая ауристатины, производными томаимицина, производными лептомицина, метотрексатом, цисплатином, карбоплатином, даунорубицином, доксорубицином, винкристином, винбластином, мелфаланом, митомицином С, хлорамбуцилом и морфолино-доксорубицином. Более предпочтительны такие цитотоксические агенты, как майтансиноиды и аналоги майтансиноидов, бензодиазепины, таксаны, СС-1065 и аналоги СС-1065. Особенно предпочтительны майтансиноиды и аналоги майтансиноидов, многие из которых описаны в патентных публикациях США под номерами 20070048314, 20060233814, 20080003652, 20060155110, 20060128970, 20090182038, 20090042837, 20080233618, 20080119558, 20060099235, 20050272727, 20050203174, 20050112726, 20060182750, 20090202536, 20090142361, 20080249085, 20080226659, 20080171865, 20080171856, 20080171040, 20080145374, 20080114153, 20070270585, 20070269447, 20070264266, 20070009541, 20070009540, 20070009539, 20060167245, 20060127407, 20060084141, 20050276812, 20050169933, 20050152913, 20050113571, 20050003513, 20040241174, 20040235840, 20040120949, 20040014980, 20030157694, 20020156318, 20020156274, 20020001587, содержимое которых включено в настоящий документ во всей полноте путем ссылки.

Такие конъюгаты могут быть получены, используя сшивающую группу, чтобы соединить препарат либо его предшественник с антителом или его функциональным эквивалентом. Подходящие сшивающие группы хорошо известны в данной области техники и включают, к примеру, дисульфидные группы, тиоэфирные группы, кислото-лабильные группы, фотолабильные группы, пептидаза-лабильные группы и эстераза-лабильные группы.

Препарат или его предшественник могут быть, например, соединены с антителом против CD20 или его фрагментом через дисульфидную связь. Сшивающая молекула или перекрестно-сшивающий агент содержат реактивную химическую группу, которая может взаимодействовать с антителом против CD20 или его фрагментом. Предпочтительными реактивными химическими группами для взаимодействия с агентом, связывающимся с клеткой, являются N-сукцинимидиловые сложные эфиры и N-сульфосукцинимидиловые сложные эфиры. Дополнительно сшивающая молекула содержит реактивную химическую группу, предпочтительно дитиопиридильную, которая может взаимодействовать с препаратом с образованием дисульфидной связи. Наиболее предпочтительные сшивающие молекулы включают, к примеру, N-сукцинимидил 3-(2-пиридилдитио) пропионат (SPDP) (см., например, Carlsson et al., Biochem. J., 173: 723-737 (1978)), N-сукцинимидил 4-(2-пиридилдитио)бутаноат (SPDB) (см., например, патент США № 4563304), N-сукцинимидил 4-(2-пиридилдитио)2-сульфобутаноат (sulfo-SPDB) (см. публикацию США № 20090274713), N-сукцинимидил 4-(2-пиридилдитио) пентаноат (SPP) (см., например, CAS 341498-08-6), 2-иминотиолан, ацетилянтарный ангидрид и иные реактивные перекрестные линкеры, например, описанные в патенте США № 6913748, который включен в настоящий документ во всей полноте посредством ссылки, с использованием известных способов. См., к примеру, патент США № 4563304; Carlsson et al, Biochem. J., 173:723-737 (1978); Blattler et al, Biochem., 24:1517-1524 (1985); Lambert et al, Biochem., 22:3913-3920 (1983); Klotz et al. Arch. Biochem. Biophys., 96:605 (1962); и Liu et al, Biochem., 18:690 (1979), Blakey and Thorpe, Antibody, Immunoconjugates and Radiopharmaceuticals, 1:1-16 (1988); Worrell et al, Anti-Cancer Drug Design, 1:179-184 (1986), содержание которых включено в настоящий документ во всей полноте посредством ссылки. К примеру, антитело или агент, связывающий клетку, может быть модифицирован перекрестно-сшивающими реагентами и антитело или агент, связывающий клетку, содержащий свободные или защищенные тиоловые группы, затем взаимодействует с дисульфид- или тиол-содержащим майтансиноидом с образованием конъюгатов. Конъюгаты могут быть очищены хроматографией, включая, но не ограничиваясь перечисленным, ВЭЖХ, эксклюзионную, адсорбционную, ионообменную и аффинную хроматографию, фильтрацию либо диализом в тангенциальном потоке.

В ином аспекте настоящего изобретения антитело против CD20 соединено с цитотоксическими препаратами через дисульфидные связи и полиэтиленгликолевый спейсер для увеличения активности, растворимости или эффективности иммуноконъюгата. Подобные расщепляемые гидрофильные линкеры описаны в WO 2009/0134976. Дополнительным преимуществом такого типа линкеров является желаемое высокое количество мономеров и минимальная агрегация конъюгатов антитело-препарат. В данном аспекте специфически рассматриваются конъюгаты агентов, связывающих клетки, и препаратов, соединенных через дисульфидную группу (-S-S-), несущие полиэтиленгликолевые спейсеры ((CH2CH2O)n=1-14) с узким интервалом нагрузки препаратом 2-8, которые обладают относительной высокой активностью против опухолевых клеток и обладают желаемыми биохимическими свойствами - высоким выходом конъюгации и высоким содержанием мономера с минимальной агрегацией белка.

В данном аспекте специфически рассматривается конъюгат антитела против CD20 и препарата формулы (I) или конъюгат формулы (I′):

где:

СВ обозначает антитело против CD20 или его фрагмент;

D обозначает препарат;

Х обозначает алифатическую, ароматическую или гетероциклическую единицу, присоединенную к агенту, связывающемуся с клеткой через тиоэфирную связь, амидную связь, карбаматную связь или простую эфирную связь;

Y обозначает алифатическую, ароматическую или гетероциклическую единицу, присоединенную к препарату через дисульфидную связь;

l равно 0 или 1;

m является целым числом от 2 до 8; и

n является целым числом от 1 до 24.

Более предпочтительно, чтобы m являлось целым числом от 2 до 6.

Также еще более предпочтительно, чтобы m являлось целым числом от 3 до 5.

Также более предпочтительно, чтобы n являлось целым числом от 2 до 8. Альтернативно, как показано, например, в патентах США под номерами 6441163 и 7368565, препарат вначале может быть модифицирован с внедрением реактивной сложноэфирной группы, способной взаимодействовать с агентом, связывающимся с клеткой. Взаимодействие данных препаратов, содержащих активированный сшивающий фрагмент, с агентом, связывающимся с клеткой, - еще один способ получения конъюгата агента, связывающегося с клеткой препарата. Майтансиноиды также могут быть сшиты с антителом против CD20 или его фрагментом при помощи сшивающих групп ПЭГ, как описано, например, в патенте США 6716821. Данные ПЭГ нерасщепляемые группы растворимы в воде и неводных растворителях и могут использоваться для соединения одного и более цитотоксических агентов с агентом, связывающимся с клеткой. Примерами ПЭГ-связывающих групп служат гетеробифункциональные ПЭГ-линкеры, реагирующие с цитотоксическими агентами и агентами, связывающимися с клеткой на противоположных концах линкеров - через функциональную сульфгидрильную или дисульфидную группу на одном конце и активную сложноэфирную группу на другом конце. В качестве общего примера синтеза цитотоксического конъюгата с использованием ПЭГ-линкерных групп, дается ссылка на патент США 6716821, который включен в настоящий документ во всей полноте посредством ссылки. Синтез начинается с взаимодействия одного и более цитотоксических агентов, несущих реактивный ПЭГ-фрагмент, с агентом, связывающимся с клеткой, что приводит к замещению терминальной активной сложноэфирной группы каждого реактивного ПЭГ-фрагмента на аминокислотный остаток агента, связывающегося с клеткой, с образованием цитотоксического конъюгата, содержащего один и более цитотоксических агентов, ковалентно связанных с агентом, связывающимся с клеткой через ПЭГ-линкерную группу. Альтернативно клеточное связывание может быть модифицировано бифункциональным ПЭГ-перекрестносшивающим агентом для введения реактивного дисульфидного фрагмента (например, пиридилдисульфида), который затем может быть обработан тиол-содержащим майтансиноидом с образованием конъюгата. В ином способе клеточное связывание может быть модифицировано бифункциональным ПЭГ-перекрестносшивающим агентом для введения тиолового фрагмента, который затем может быть обработан реактивным дисульфид-содержащим (например, пиридилдисульфид-содержащим) майтансиноидом с образованием конъюгата.

Также могут быть получены конъюгаты антитело-препарат с нерасщепляемыми связями. Подобные перекрестносшивающие линкеры описаны в данной области техники (см., например, ThermoScientific Pierce Crosslinking Technical Handbook и публикацию США № US 20050169933, которые включены в настоящий документ путем ссылки) и включают, не ограничиваясь перечисленным, N-сукцинимидил 4-(малеидометил) циклогексанкарбоксилат (SMCC), N-сукцинимидил -4-(N-малеидометил)-циклогексан-1-карбокси-(6-амидокапроат), который является «длинноцепочечным» аналогом SMCC (LC-SMCC), к-малеимидоундекановой кислоты N-сукцинимидиловый сложный эфир (KMUA), β-малеимидопропановой кислоты N-сукцинимидиловый сложный эфир (BMPS), γ-малеимидобутановой кислоты N-сукцинимидиловый сложный эфир (GMBS), ε-малеимидокапроновой кислоты N-гидроксисукцинимидиловый сложный эфир (EMCS), m-малеимидобензоил-N-гидроксисукцинимидный сложный эфир (MBS), N-(α-малеимидоацетокси)-сукцинимидный сложный эфир (AMAS), сукцинимидил-6-(β-малеимидопропионамидо)гексаноат (SMPH), N-сукцинимидил 4-(р-малеимидофенил)-бутират (SMPB) и N-(p-малеимидофенил)изоцианат (PMPI), N-сукцинимидил -4-(иодоацетил)-аминобензоат (SIAB), N-сукцинимидил иодоацетат (SIA), N-сукцинимидил бромацетат (SBA) и N-сукцинимидил 3-(бромацетамидо)пропионат (SBAP). Предпочтительно, чтобы антитело было модифицировано перекрестно-сшивающими реагентами, например, сукцинимидил 4-(N-малеимидометил)-циклогексан-1-кабоксилатом (SMCC), сульфо-SMCC, малеимидобензоил-N-гидроксисукцинимидным сложным эфиром (MBS), сульфо-MBS или сукцинимидил-иодоацетатом, как описано в литературе, для внедрения 1-10 реактивных групп (Yoshitake et al, Eur. J. Biochem., 101:395-399 (1979); Hashida et al, J. Applied Biochem., 56-63 (1984); и Liu et al, Biochem., 18:690-697 (1979)). Модифицированное антитело затем взаимодействует с тиол-содержащим производным майтансиноида с получением конъюгата. Конъюгат может быть очищен путем гель-фильтрации через колонку Sephadex G25 или диализом, или фильтрацией в тангенциальном потоке. Модифицированные антитела обрабатывают тиол-содержащим майтансиноидом (1-2 молярных эквивалента/малеимидную группу), конъюгаты антитело-майтансиноид очищают гель-фильтрацией через колонку G-25, хроматографией на керамической колонке с гидроксиапатитом, диализом или фильтрацией в тангенциальном потоке, либо при помощи комбинации способов. В среднем к одному антителу присоединяется 1-10 майтансиноидов. Предпочтителен способ модификации антител с сукцинимидил 4-(N-малеимидометил)-циклогексан-1-карбоксилатом (SMCC) для внедрения малеимидных групп с последующим взаимодействием модифицированного антитела с тиол-содержащим майтансиноидом с образованием тиоэфир-связанного конъюгата. Вновь получаются конъюгаты, содержащие 1-10 молекул препарата на одну молекулу антитела. Конъюгаты майтансиноидов с антителами, фрагментами антител, белковыми гормонами, белковыми факторами роста и другими белками получают аналогичным образом.

В другом аспекте изобретения антитело CD20 соединено с препаратом через нерасщепляемую связь, посредством ПЭГ-спейсера. Подходящие перекрестно-сшивающие реактивы, содержащие гидрофильные цепи ПЭГ, образующие сшивки между препаратом и антителом против CD20, хорошо известны в данной области техники или доступны в продаже (к примеру, у Quanta Biodesign, Пауэлл, Огайо). Подходящие перекрестно-сшивающие реактивы, содержащие ПЭГ, также могут быть синтезированы из доступных в продаже ПЭГ с использованием стандартных техник химического синтеза, известных специалистам в данной области техники. Препараты могут взаимодействовать с бифункциональными ПЭГ-содержащими линкерами с образованием соединений формулы Z-X1-(-CH2-CH2-O-)n-Yp-D способами, подробно описанными в патентной публикации США US 20090274713 и в WO 2009/0134976, которые затем могут взаимодействовать с агентом, связывающимся с клеткой с образованием конъюгата. Альтернативно клеточное связывание может быть модифицировано бифункциональным ПЭГ-перекрестносшивающим агентом для введения тиол-реактивной группы (например, малеимидной или галоацетамидной), который затем может быть обработан тиол-содержащим майтансиноидом с образованием конъюгата. В ином способе клеточное связывание может быть модифицировано бифункциональным ПЭГ-перекрестносшивающим агентом для введения тиол-реактивного майтансиноида (например, майтансиноида, несущего малеимидную или галоацетамидную группу) с образованием конъюгата.

Соответственно, иной аспект настоящего изобретения - конъюгат антитела против CD20 препарата формулы (II) или формулы (II′):

где СВ обозначает антитело против CD20 или его фрагмент;

D обозначает препарат;

Х обозначает алифатическую, ароматическую или гетероциклическую единицу, присоединенную к агенту, связывающемуся с клеткой через тиоэфирную связь, амидную связь, карбаматную связь или простую эфирную связь;

Y обозначает алифатическую, ароматическую или гетероциклическую единицу, присоединенную к препарату через ковалентную связь, выбранную из группы, состоящей из тиоэфирной связи, амидной связи, карбаматной связи, простой эфирной связи, аминной связи, углерод-углеродной связи и гидразоновой связи;

l равно 0 или 1;

р равно 0 или 1;

m является целым числом от 2 до 15; и

n является целым числом от 1 до 2000.

Предпочтительно m является целым числом от 2 до 8; и

Предпочтительно n является целым числом от 1 до 24.

Более предпочтительно, чтобы m являлось целым числом от 2 до 6.

Также еще более предпочтительно, чтобы m являлось целым числом от 3 до 5.

Также более предпочтительно чтобы n являлось целым числом от 2 до 8. Примерами подходящих ПЭГ-содержащих линкеров служат линкеры, обладающие N-сукцинимидил сложноэфирным или N-сульфосукцинимидил сложноэфирным фрагментом, способные взаимодействовать с антителом против CD20 или с его фрагментом, а также малеимидный или галоацетиловый фрагмент, взаимодействующий с соединением. ПЭГ-спейсер может быть внедрен в любой перекрестно-сшивающий агент, известный в данной области техники, способами, описанным здесь. Перекрестносшивающие реагенты, содержащие малеимидный фрагмент и в которые может быть внедрен ПЭГ-пейсер, включают, не ограничиваясь перечисленным, N-сукцинимидил 4-(малеидометил) циклогексанкарбоксилат (SMCC), N-сукцинимидил -4- (N-малеидометил)-циклогексан-1-карбокси-(6-амидокапроат), который является «длинноцепочечным» аналогом SMCC (LC-SMCC), к-малеимидоундекановой кислоты N-сукцинимидиловый сложный эфир (KMUA), γ-малеимидобутановой кислоты N-сукцинимидиловый сложный эфир (GMBS), ε-малеимидокапроновой кислоты N-гидроксисукцинимидиловый сложный эфир (EMCS), m-малеимидобензоил-N-гидроксисукцинимидный сложный эфир (MBS), N-(α-малеимидоацетокси)-сукцинимидный сложный эфир (AMAS), сукцинимидил-6-(β-малеимидопропионамидо)гексаноат (SMPH), N-сукцинимидил 4-(р-малеимидофенил)-бутират (SMPB) и N-(р-малеимидофенил)изоцианат (PMPI). Перекрестносшивающие реагенты, содержащие галоацетиловую группу, включают N-сукцинимидил-4-(иодацетил)-аминобензоат (SIAB), N-сукцинимидил иодацетат (SIA), N-сукцинимидил бромацетат (SBA) и N-сукцинимидил 3-(бромацетамидо)пропионат (SBAP).

Также могут использоваться и другие перекрестно-сшивающие реагенты, не содержащие атома серы. Подобные линкеры могут происходить от фрагментов, основанных на двухосновных карбоновых кислотах. Подходящие фрагменты, основанные на двухосновных карбоновых кислотах, включают, не ограничиваясь этим, α,ω - двухосновные кислоты общей формулы:

где А′ - необязательная линейная или разветвленная алкильная, алкенильная или алкинильная группа с 2-20 углеродными атомами, Е′ - опциональная циклоалкильная или циклоалкенильная группа с 3-10 углеродными атомами, G′ - необязательная замещенная или незамещенная ароматическая группа с 6-10 углеродными атомами либо замещенная или незамещенная гетероциклическая группа, в которой гетероатом выбран из N, О или S и в которой p, q и r каждое равно 0 или 1, причем p, q и r не могут быть равны нулю одновременно, а n - целое число от 1 до 2000.

Множество линкеров подробно описаны в патентных публикациях США под номерами 20050169933 и 20090274713, а также в WO 2009/0134976, содержимое которых включено в настоящий документ во всей полноте путем ссылки.

В настоящем изобретении также предлагаются заряженные линкеры, причем их заряды сохраняются после модифицирования антитела против CD20 или его фрагмента и в полученном конъюгате препарата. В частности, настоящее изобретение относится к использованию заряженных линкеров для связывания препаратов с антителом против CD20. В одном аспекте изобретения заряженные линкеры используются для модифицирования агентов, связывающих клетки для соединения их с препаратами. В ином аспекте изобретения заряженные линкеры используются для модифицирования препаратов для соединения их с антителами против CD20 или их фрагментами. В еще одном аспекте изобретения заряженные линкеры используются для одновременного связывания препаратов и агентов, соединяющихся с клетками. Во всех случаях предпочтительный конечный результат - конъюгат препарата, несущего заряд, с агентом, соединяющимся с клеткой через линкер, который может быть представлен формулой СВ-(-Lc-D]q, где СВ - агент, соединяющийся с клеткой, который является антителом против CD20 или его фрагментом, Lc - заряженный линкер, D - молекула препарата, q - целое число от 1 до 20. Присутствие заряженных(ой) групп(ы) в линкере конъюгата препарата и агента, связывающего клетку, дает ряд преимуществ, например i) большую растворимость конечного продукта в воде, ii) возможность работать с более высокими концентрациями водных растворов, iii) возможность связывать большее количество молекул препарата на молекулу агента, соединяющегося с клеткой, обеспечивая большую активность, iv) способность заряженных типов конъюгатов удерживаться в клетке-мишени, обеспечивая большую активность, и v) повышенную чувствительность клеток, резистентных ко многим препаратам, не способных к выведению заряженных препаратов из клетки. В изобретении также описаны линкеры, которые могут быть спарены с препаратом и агентом, соединяющимся с клеткой, с образованием конъюгата, который может быть метаболизирован клеткой с образованием метаболита препарата, содержащего одну или более заряженных групп. Данные линкеры будут называться про-заряженными линкерами. Фрагменты линкеров, которые становятся заряженными после процессинга в клетке, также будут называться про-заряженными фрагментами.

В одном аспекте настоящего изобретения заряженный или про-заряженный перекрестный линкер представлен формулой (III), где Y′ может взаимодействовать с агентом, связывающимся с клеткой, а Q может взаимодействовать с цитотоксическим препаратом:

где:

Y′ обозначает функциональную группу, способную к взаимодействию в антителом против CD20 или его фрагментом;

Q обозначает функциональную группу, способную к связыванию с цитотоксическим препаратом через дисульфидную, сложную тиоэфирную, простую тиоэфирную, пептидную, гидразоновую, простую эфирную, сложную эфирную, карбаматную или амидную связи;

R1, R2, R3, R4, R5, R6, R7, R8, R9 и R10 одинаковы или различны и являются Н, линейным алкилом с 1-6 углеродных атомов, разветвленным или циклическим алкилом с 3-6 углеродных атомов, линейным, разветвленным или циклическим алкенилом или алкинилом с 2-6 углеродных атомов, анионами, например, но не ограничиваясь перечисленным, SO3-, Х-SO3-, ОРО32-, Х-ОРО32-, РО32-, Х-РО32-, СО2-, и катионами, например, но не ограничиваясь перечисленным, азотсодержащими гетероциклами, N+R11R12R13 или X-N+R11R12R13, или фенилом, где:

R11, R12 и R13 одинаковы или различны и являются Н, линейным алкилом с 1-6 углеродных атомов, разветвленным или циклическим алкилом с 3-6 углеродных атомов, а Х обозначает фенил или линейный алкил с 1-6 углеродных атомов, разветвленный или циклический алкил с 3-6 углеродных атомов;

l, m и n равны 0 или являются целым числом от 1 до 4; и

А является фенилом или замещенным фенилом, причем заместитель является линейным алкилом с 1-6 углеродных атомов, разветвленным или циклическим алкилом с 3-6 углеродных атомов, либо заряженным заместителем, выбранным из анионов, например, но не ограничиваясь перечисленным, SO3-, Х-SO3-, ОРО32-, Х-ОРО32-, РО32-, X-РО32- СО2-, и катионов, например, но не ограничиваясь перечисленным, азотсодержащих гетероциклов, N+R11R12R13 или Х-N+R11R12P13, где Х имеет такое же значение, как определено выше, a g равно 0 или 1;

Z - необязательная полиэтиленокси-единица с формулой (ОСН2СН2)p, где р равно 0 или целому числу от 2 до приблизительно 1000, либо единица F1-E1-P-E2-F2, в которой Е1 и Е2 одинаковы или различны и являются С=O, О либо NR14, где R14 является Н, линейным алкилом с 1-6 углеродных атомов, разветвленным или циклическим алкилом с 3-6 углеродных атомов, линейным, разветвленным или циклическим алкенилом или алкинилом с 2-6 углеродных атомов; Р является пептидной единицей с 2-20 аминокислотами, причем Е1 или Е2 могут быть связаны с пептидом через терминальный азот, терминальный углерод или через боковую цепь одной из аминокислот пептида; F1 и F2 одинаковы или различны и являются необязательными полиоксиэтиленовыми единицами с формулой (ОСН2СН2)р, где р равно 0 или целому числу от 2 до приблизительно 1000, причем, если Z не является F1-E1-P-E2-F2, по меньшей мере один из R1, R2, R3, R4, R5, R6, R7, R8, R9 и R10 является заряженным заместителем, или, если g равно 1, по меньшей мере один из А, R1, R2, R3, R4, R5, R6, R7, R7, R9 и R10 является заряженным заместителем. Это одно примерное воплощение конъюгата с заряженным линкером. Иные примеры описаны в патентной заявке США № 12/433604, опубликованной как 2009-0274713 (Ravi, et al.), содержимое которой включено в настоящую во всей полноте путем ссылки. Подходящие заряженные линкеры хорошо известны в данной области техники и включают те, которые описаны, например, в 20090274713, содержимое которой включено в настоящую заявку во всей полноте посредством ссылки.

Настоящее изобретение включает аспекты, в которых от примерно 2 до примерно 8 молекул препарата («нагрузка препарата»), к примеру, майтансиноида, присоединены к антителу против CD20 или его фрагменту, причем противоопухолевый эффект конъюгата гораздо более высок, чем в случае нагрузки препарата меньшим или большим количеством молекул препарата, присоединенных к такому же агенту, соединяющемуся с клеткой. «Нагрузка препарата», при использовании здесь, относится к количеству молекул препарата (например, майтансиноида), которые могут быть присоединены к агенту, связывающемуся с клеткой (например, с антителом против CD20 или его фрагментом). В одном аспекте количество молекул препарата, которые могут быть присоединены к агенту, связывающемуся с клеткой, может быть равно в среднем от приблизительно 2 до приблизительно 8 (например, 1,9, 2,0, 2,1, 2,2, 2,3, 2,4, 2,5, 2,6, 2,7, 2,8, 2,9, 3,0, 3,1, 3,2, 3,3, 3,4, 3,5, 3,6, 3,7, 3,8, 3,9, 4,0, 4,1, 4,2, 4,3, 4,4, 4,5, 4,6, 4,7, 4,8, 4,9, 5,0, 5,1, 5,2, 5,3, 5,4, 5,5, 5,6, 5,7, 5,8, 5,9, 6,0, 6,1, 6,2, 6,3, 6,4, 6,5, 6,6, 6,7, 6,8, 6,9, 7,0, 7,1, 7,2, 7,3, 7,4, 7,5, 7,6, 7,7, 7,8, 7,9, 8,0, 8,1). В предпочтительном аспекте количество молекул препарата, которые могут быть присоединены к агенту, связывающемуся с клеткой, может быть равно в среднем от приблизительно 2 до приблизительно 7 (например, 1,9, 2,0, 2,1, 2,2, 2,3, 2,4, 2,5, 2,6, 2,7, 2,8, 2,9, 3,0, 3,1, 3,2, 3,3, 3,4, 3,5, 3,6, 3,7, 3,8, 3,9, 4,0, 4,1, 4,2, 4,3, 4,4, 4,5, 4,6, 4,7, 4,8, 4,9, 5,0, 5,1, 5,2, 5,3, 5,4, 5,5, 5,6, 5,7, 5,8, 5,9, 6,0, 6,1, 6,2, 6,3, 6,4, 6,5, 6,6, 6,7, 6,8, 6,9, 7,0, 7,1). В еще более предпочтительном аспекте количество молекул препарата, которые могут быть присоединены к агенту, связывающемуся с клеткой, может быть равно в среднем от приблизительно 2 до приблизительно 6 (например, 1,9, 2,0, 2,1, 2,2, 2,3, 2,4, 2,5, 2,6, 2,7, 2,8, 2,9, 3,0, 3,1, 3,2, 3,3, 3,4, 3,5, 3,6, 3,7, 3,8, 3,9. 4,0, 4,1, 4,2, 4,3, 4,4, 4,5, 4,6, 4,7, 4,8, 4,9, 5,0, 5,1, 5,2, 5,3, 5,4, 5,5, 5,6, 5,7, 5,8, 5,9. 6,0, 6,1). В наиболее предпочтительном аспекте количество молекул препарата, которые могут быть присоединены к агенту, связывающемуся с клеткой, может быть равно в среднем от приблизительно 2 до приблизительно 5 (например, 1,9, 2,0, 2,1, 2,2, 2,3, 2,4, 2,5, 2,6, 2,7, 2,8, 2,9, 3,0, 3,1, 3,2, 3,3, 3,4. 3,5, 3,6, 3,7, 3,8, 3,9, 4,0, 4,1, 4,2, 4,3, 4,4, 4,5, 4,6, 4,7, 4,8, 4,9, 5, 5,1). Термин «в среднем», при использовании здесь, определятся по спектрофотометрической абсорбции антител против CD20 или их фрагментов и препарата, присоединенного к ним. В другом аспекте конъюгат препарата и антитела против CD20 или его фрагмента имеет формулу (D)приблизительно 2- приблизительно 8-L-Anti-CD20Ab, где D - препарат (например, майтансиноид, таксан или аналог СС1065), L - линкер, причем линкер выбран из расщепляемых линкеров (например, линкеров, расщепляемых посредством дисульфидного обмена) или линкеров, преимущественно устойчивых к расщеплению (например, линкеров с N-сукцинимидил-эфирным или N-сульфосукцинимидил-эфирным фрагментами для взаимодействия с агентом, связывающим клетку, а также с малеимидо- или галоцетиловым фрагментами), a Anti-CD20Ab - антитело или его фрагмент, связывающее CD20, как описано здесь. В предпочтительном элементе конъюгат агента препарата, соединяющегося с клеткой (например, иммуноконъюгат) представлен формулой (Мау)примерно 2-примерно 8-L-Anti-CD20Ab, где May - майтансиноид, L - линкер, причем указанный линкер - расщепляемый линкер или устойчивый к расщеплению; a Anti-CD20Ab - антитело или его фрагмент, связывающее CD20, как описано здесь. Препараты, подходящие для использования в данном изобретении, - цитотоксические препараты, способные к соединению с агентом, связывающимся с клеткой, как описано здесь. Один аспект изобретения - подходящий аналог майтансинола, имеющий модифицированное ароматическое кольцо, включая: (1) С-19-дехлор (патент США № 4256746) (полученный восстановлением с помощью LAH ансамитоцина Р2); (2) С-20-гидрокси (или С-20-деметил) +/-С-19-дехлор (патенты США под номерами 4361650 и 4307016) (полученный деметилированием с использованием Streptomyces или Actinomyces либо дехлорированием с использованием LAH); и (3) С-20-деметокси, С-20-ацилокси (-OCOR), +/-дехлор (патент США № 4294757) (полученный ацилированием при помощи ацилхлоридов). Специфическими примерами подходящих аналогов майтансинола с модифицированием позиций служат: (1) C-9-SH (патент США № 4424219) (полученный взаимодействием майтансинола с H2S или P2S5); (2) С-14-алкоксиметил (деметокси/CH2OR) (патент США № 4331598); (3) С-14-гидроксиметил или ацилоксиметил (CH2OH или СН2ОАс) (патент США № 4450254) (полученный из Nocardia); (4) С-15-гидрокси/ацилокси (патент США № 4364866) (полученный конверсией майтансинола при помощи Streptomyces), (5) С-15-метокси (патенты США под номерами 4313946 и 4315929) (выделенный из Trewia nudiflora); (6) С-18-N-деметил (патенты США под номерами 4362663 и 4322348) (полученный деметилированием майтансинола при помощи Streptomyces); и (7) 4,5-дезокси (патент США № 4371533) (полученный восстановлением майтансинола с трихлоридом титана/LAH). Синтез тиолсодержащих майтансиноидов, подходящих для использования в настоящем изобретении, полностью описан в патентах США под номерами 5208020, 5416064 и 7276497. Подходят для использования и майтансиноиды с тиоловой группой в положении С-3, положении С-14, положении С-15 или положении С-20. Положение С-3 предпочтительно, положение С-3 майтансинола особенно предпочтительно. Также предпочтительны N-метил-аланин-содержащий С-3-тиоловый майтансиноид и N-метил-цистеин-содержащий С-3-тиоловый майтансиноид, а также их аналоги. Предпочтительные майтансиноиды описаны в патентах США под номерами 5208020, 5416064, 6333410, 6441163, 6716821, RE39151 и 7276497. Из них предпочтительны N2′-деацетил-N2′-(3-меркапто-1-оксопропил)-майтансин (DM1) и N2′-деацетил-N2′-меркапто-4-метил-1-оксопентил) майтансин (DM4). В настоящем аспекте изобретения могут использоваться и иные препараты, например, описанные здесь. Иные примеры описаны в предварительной патентной заявке США № 61/049296 и в патентной заявке США № 12/574430, содержимое которых включено в настоящую заявку во всей полноте посредством ссылки.

Антитело против CD20 или его фрагмент могут быть модифицированы при взаимодействии с бифункциональным перекрестно-сшивающим реагентом, давая ковалентно связанную молекулу линкера с антителом против CD20 или его фрагментом. При использовании здесь термин «бифункциональный перекрестносшивающий реагент» - любой химический фрагмент, который ковалентно соединяет агент, соединяющийся с клеткой, с препаратом, например, препаратом, описанным здесь. В другом способе часть связывающего фрагмента предоставляется препаратом. В этой связи, препарат содержит связывающий фрагмент, являющийся частью большей молекулы линкера, который используется для сочленения агента, соединяющегося с клеткой, с препаратом. К примеру, для образования майтансиноида DM1, боковая цепь С-3-гидроксильной группы майтансина модифицируется таким образом, чтобы в ней содержалась свободная сульфгидрильная группа (SH). Данная тиолированная форма майтансина может взаимодействовать с модифицированным агентом, связывающимся с клеткой с образованием конъюгата. Таким образом, в итоге линкер состоит из двух компонентов: одного, предоставленного перекрестносшивающим реактивом, и второго, предоставленного боковой цепью DM1.

Молекулы препаратов также могут быть связаны с молекулами антител через промежуточную молекулу носителя, например, альбумина сыворотки.

При использовании здесь выражение «связанный с агентом, соединяющимся с клеткой» или «связанный с антителом против CD20 или его фрагментом» относится к конъюгатной молекуле, содержащей по меньшей мере одно производное препарата, связанное с агентом, соединяющимся с клеткой, антителом против CD20 или его фрагментом через подходящую сшивающую группу или ее прекурсор. Предпочтительная сшивающая группа - SMCC.

Особенно предпочтительные в настоящем изобретении цитотоксические агенты - майтансиноиды и аналоги майтансиноидов. Примеры подходящих майтансиноидов включают сложные эфиры майтансинола и аналоги майтансинола. Также включены любые препараты, ингибирующие образование микротрубочек, высокотоксичные для клеток млекопитающих, как майтансинол и его аналоги.

Примерами подходящих сложных эфиров майтансинола служат эфиры с модифицированным ароматическим кольцом и эфиры с модификациями в других позициях. Такие подходящие майтансиноиды описаны в патентах США под номерами 4424219, 4256746, 4294757, 4307016, 4313946, 4315929, 4331598, 4361650, 4362663, 4364866, 4450254, 4322348, 4371533, 5208020, 5416064, 5475092, 5585499, 5846545, 6333410,7276497 и 7473796.

Специфическими примерами подходящих аналогов майтансинола с модифицированным ароматическим кольцом служат:

(1) С-19-дехлор (патент США № 4256746) (полученный восстановлением с помощью LAH ансамитоцина Р2);

(2) С-20-гидрокси (или С-20-деметил) +/-С-19-дехлор (патенты США под номерами 4361650 и 4307016) (полученный деметилированием с использованием Streptomyces или Actinomyces либо дехлорированием с использованием LAH); и

(3) С-20-деметокси, С-20-ацилокси (-OCOR), +/-дехлор (патент США № 4294757) (полученный ацилированием при помощи ацилхлоридов).

Специфическими примерами подходящих аналогов майтансинола с модифицированием позиций служат:

(1) C-9-SH (патент США № 4424219) (полученный взаимодействием майтансинола с H2S или P2S5);

(2) С-14-алкоксиметил (деметокси/CH2OR) (патент США № 4331598);

(3) С-14-гидроксиметил или ацилоксиметил (CH2OH или CH2OAc) (патент США № 4450254) (полученный из Nocardia);

(4) С-15-гидрокси/ацилокси (патент США № 4364866) (полученный конверсией майтансинола при помощи Streptomyces);

(5) С-15-метокси (патенты США под номерами 4313946 и 4315929) (выделенный из Trewia nudiflora);

(6) С-18-М-деметил (патенты США под номерами 4362663 и 4322348) (полученный деметилированием майтансинола при помощи Streptomyces); и

(7) 4,5-дезокси (патент США № 4371533) (полученный восстановлением майтансинола с трихлоридом титана/LAH).

В предпочтительном аспекте в конъюгатах по настоящему изобретению в качестве цитотоксического агента используется тиолсодержащий майтансиноид (DM1), который по номенклатуре называется N2′-деацетил-N2′-(3-меркапто-1-оксопропил)-майтансином. DM1 имеет следующую структурную формулу (IV):

В предпочтительном аспекте в конъюгатах по настоящему изобретению в качестве цитотоксического агента используется N2′-деацетил-N2′ (4-метт-4-меркато-1-оксопентил)-майтансин (DM4). DM4 имеет следующую структурную формулу (V):

Иным предпочтительным майтансиноидом, содержащим боковую цепь со стерической тиоловой связью, является N2′-деацетил-N-2′(4-меркапто-1-оксопентил)-майтансин (называемый DM3), обладающий следующей структурной формулой (VI):

Дополнительные майтансиноиды включают соединения формул (VII-L), (VII-D) и (VII-D,L):

где:

Y обозначает (CR7R8)1(CR5R5)m(CR3R4)nCR1R2SZ,

где:

R1 и R2, независимо, являются линейным алкилом или алкенилом с 1-10 атомами углерода, разветвленным или циклическим алкилом или алкенилом с 3-10 атомами углерода, фенилом, замещенным фенилом или гетероциклической группой, либо R1 и R2 могут являться Н;

R3, R4, R5, R6, R7 и R8, независимо, являются Н, линейным алкилом или алкенилом с 1-10 атомами углерода, разветвленным или циклическим алкилом или алкенилом с 3-10 атомами углерода, фенилом, замещенным фенилом или гетероциклическим ароматическим или гетероциклоалкильным радикалами;

l, m и n, независимо, являются целым числом от 1 до 5, также n может быть равно 0;

Z является Н, SR или -COR, где R является линейным алкилом или алкенилом с 1-10 атомами углерода, циклическим алкилом или алкенилом с 3-10 атомами углерода, незамещенным или замещенным арилом или гетероциклической группой; и

May обозначает майтансиноид с боковой цепью в положении С-3, С-14 гидроксиметил. С-15 гидрокси или С-20 десметил.

Предпочтительные аспекты формул (VII-L), (VII-D) и (VII-D,L) включают соединения формул (VIII-L), (VII-D) и (VII-D,L), в которых:

R1 - Н, R2 - метил, R5, Re, R7 и R8, каждый, - Н, l и m, каждое равно 1, n равно 0,Z - H.

R1 и R2 - метил, R5, R6, R7 и R8, каждый, - Н, l и m равно 1, n равно 0, Z - Н.

R1 - Н, R2 - метил, R5, R6, R7 и R8, каждый, - Н, l и m, каждое, равно 1, n равно 0, Z - -SCH3.

R1 и R2 - метил, R5, R6, R7 и R8, каждый, - Н, l и m равно 1, n равно 0, Z - -SCH3.

Дополнительные майтансиноиды включают соединения формулы (VIII):

где Y определен так же, как и для формулы (VII).

Предпочтительные аспекты формулы (VIII) включают соединения формулы (VIII), в которых:

R1 - Н, R2 - метил, R5, R6, R7 и R8, каждый, - Н, l и m, каждое, равно 1; n равно 0; Z-H.

R1 и R2 - метил, R5, R6, R7 и R8, каждый, - Н, l и m равно 1; n равно 0; Z - Н.

R1 - Н, R2 - метил, R5, R6, R7 и R8, каждый, - Н, l и m, каждое, равно 1; n равно 0;Z--SCH3.

R1 и R2 - метил, R5, R6, R7 и R8, каждый, - Н, l и m равно 1; n равно 0; Z - SCH3.

Дополнительные майтансины, помимо этого, включают соединения формул (IX-L), (IX-D) или (IX-D,L):

где: Y2 представляет собой

где:

R1 и R2, независимо, являются линейным алкилом или алкенилом с 1-10 атомами углерода, разветвленным или циклическим алкилом или алкенилом с 3-10 атомами углерода, фенилом, замещенным фенилом или гетероциклической группой, либо R1 и R2 могут являться Н;

А, В и D, каждый независимо, является циклоалкилом или циклоалкенилом с 3-10 атомами углерода, простым или замещенным арилом, либо гетероциклическим ароматическим или гетероциклоалкильным радикалом;

R3, R4, R5, R6, R7, R8, R9, R10, R11 и R12, независимо, являются Н, линейным алкилом или алкенилом с 1-10 атомами углерода, разветвленным или циклическим алкилом, или алкенилом с 3-10 атомами углерода, фенилом, замещенным фенилом или гетероциклической группой;

l, m, n, о, р, q, r, s и t, каждый независимо, равен 0 или целому числу в интервале 1-5, причем по меньшей мере два из l, m, n, o, p, q, r, s и t не равны нулю одновременно; и

Z2 является SR или -COR, где R является линейным алкилом или алкенилом с 1-10 атомами углерода, разветвленным или циклическим алкилом или алкенилом с 3-10 атомами углерода, незамещенным или замещенным арилом, или гетероциклическим ароматическим или гетероциклоалкильным радикалом; и

May - майтансиноид.

Предпочтительные аспекты соединений формулы (IX) включают соединения, у которых R1 - Н, R2 - метил либо R1 - метил, R2 - метил.

Следующие майтансиноиды включают соединения формулы (X):

где Y2′ определен так же, как и Y2 для формулы (IX).

Любой майтансиноид, описанный в патентах США под номерами 5208020 и 7276497 может использоваться в конъюгате по настоящему изобретению. В этой связи, сущность 5208020 и 7276697 полностью включена в настоящий документ посредством ссылки.

Множество положений в майтансиноидах могут служить для химического связывания с линкером. К примеру, ожидается, что будут подходящими положение С-3 с гидроксильной группой, положение С-14, модифицированное гидроксиметильной группой, положение С-15, модифицированное гидроксильной группой, и положение С-20 с гидроксильной группой. Тем не менее, положение С-3 предпочтительно, положение С-3 майтансинола особенно предпочтительно.

Структуры предпочтительных конъюгатов показаны ниже:

Ряд описаний получения подобных конъюгатов антитело-майтансиноид представлен в патенте США № 6333410, заявках US 09/867598, 10/161651 и 10/024290, каждая из которых включена в настоящий документ во всей полноте.

Как правило, раствор антитела в водном буфере может быть инкубирован с молярным избытком майтансиноидов с дисульфидной группой, несущей реактивную группу. Реакция может быть остановлена добавлением избытка амина (например, этаноламина, таурина и т.д.). Конъюгат майтансиноид-антитело затем может быть очищен гель-фильтрацией.

Число молекул майтансиноида, связавшихся с молекулой антитела может быть определено спектрофотометрическим измерением соотношения абсорбции на 252 нм и 280 нм. В среднем предпочтительны 1-10 молекул майтансиноида на молекулу антитела, и в среднем более предпочтительны 2-5 молекул.

Конъюгаты антител с майтансиноидными препаратами могут быть оценены на их способность подавлять пролиферацию различных нежелательных клеток in vitro. К примеру, для оценивания цитотоксичности данных соединений с легкостью могут использоваться клеточная линия человеческой лимфомы Daudi и клеточная линия человеческой лимфомы Ramos. Исследуемые клетки могут быть подвергнуты воздействию веществ в течение 4-5 дней, выжившие фракции клеток измеряют прямым анализом известными способами. Затем по данным анализов могут быть вычислены величины IC50.

Также для получения конъюгатов с антителами против CD20 могут применяться бензодиазепиновые соединения, описанные в предварительной заявке US 61/150201 (например, индолинобензодиазепины или оксазолиндолинобензодиазепины), их производные и интермедиаты.

Подходящие бензодиазепины включают соединения формул (XIX), (XX) и (XXI), в которых димерные соединения, необязательно, несут связывающую группу, позволяющую связывание с агентами, связывающимися с клетками.

где двойная линия между N и С обозначает одинарную связь или двойную связь, причем, если она двойная, Х отсутствует, а Y является Н, а если она одинарная, Х-Н или аминная защитная группа, превращающая соединение в неактивную форму;

Y выбран из -OR, сложного эфира вида -OCOR′, карбоната вида -OCOOR′, карбамата вида -OCONR′R", амина или гидроксиламина вида NR′R", амида вида -NRCOR′, пептида вида NRCOP, где Р - амиинокислота или полипептид, содержащий 2-20 аминокислотных остатков, тиоэфира вида SR′, сульфоксида вида SOR′, сульфона вида -SO2R′, сульфита -SO3, бисульфита -OSO3, галогена, циано-, азидо-, тиоловой группы, где R, R′ и R" - одинаковы или различны и выбраны из Н, замещенного или незамещенного линейного, разветвленного или циклического алкила, алкенила или алкинила с 1-10 атомами углерода, полиэтиленгликолевой единицы (-OCH2CH2)n, где n - целое число от 1 до 2000, арила с 6-10 атомами углерода, гетероциклического кольца с 3-10 атомами углерода, в котором заместитель выбран из галогена, OR7, NR8R9, NO2, NRCOR′, SR10, сульфоксида вида SOR′, сульфона вида -SO2R′, сульфита -SO3, бисульфита -OSO3, сульфонамида вида SO2NRR′, циано-, азидо-, -COR11, OCOR11 или OCONR11R12, в которых R7, R8, R9, R10, R11 и R12 таковы, как определено выше, необязательно R" - ОН;

W - С=O, C=S, CH2, ВН, SO или SO2;

R1, R2, R3, R4, R1′, R2′, R3′ и R4′, каждый независимо, выбраны из Н, замещенного или незамещенного линейного, разветвленного или циклического алкила, алкенила или алкинила с 1-10 атомами углерода, полиэтиленгликолевой единицы (-ОСН2СН2)n, где n - целое число от 1 до 2000, или заместителя, выбранного из галогена, гуанидия [- NH(C=NH)NH2], OR7, NR8R9, NO2, NRCOR′, SR10, сульфоксида вида SOR′, сульфона вида -SO2R′, сульфита -SO3, бисульфита -OSO3, сульфонамида вида SO2NRR′, циано-, азидо-, -COR11, OCOR11 или OCONR11R12, в которых R7, R8, R9, R10, R11 и R12, каждый независимо, выбраны из Н, линейного, разветвленного или циклического алкила, алкенила или алкинила с 1-10 атомами углерода, полиэтиленгликолевой единицы (-ОСН2СН2)n, где n - целое число от 1 до 2000, арила с 6-10 атомами углерода, гетероциклического кольца с 3- 10 атомами углерода, необязательно R10-SR13 или COR13, где R13 выбран из линейного, разветвленного или циклического алкила, алкенила или алкинила с 1-10 атомами углерода, полиэтиленгликолевой единицы (-ОСН2СН2)n, где n - целое число от 1 до 2000, арила с 6-10 атомами углерода, гетероциклического кольца с 3-10 атомами углерода, необязательно R11 - OR14, где R14 имеет такое же значение, как и R, необязательно, любой из R1, R2, R3, R4, R1′, R2′, R3′ или R4′ является сшивающей группой, позволяющей связать агент, соединяющийся с клеткой через ковалентную связь, или выбран из полипирроло, полииндолил, полиимидазолил, полипирролол-имидазолил, полипирроло-индолил или полиимидазоло-индолил единиц, необязательно несущих сшивающую группу, позволяющую связывание с агентом, соединяющимся с клеткой;

Z выбран из (СН2)n, где n - 1,2 или 3, CR15R16, NR17, О или S, где R15, R16 и R17, каждый независимо, выбран из Н, линейного, разветвленного или циклического алкила с 1-10 атомами углерода, полиэтиленгликолевой единицы (-ОСН2СН2)n, где n - целое число от 1 до 2000;

Re - OR, SR или NRR′, где R и R′ имеют такое же значение, как определено выше;

X′ выбран из CH2, NR, CO, BH, SO ил SO2, где R имеет такое же значение, как определено выше;

Y′ - О, СН2, NR или S, где R имеет такое же значение, как определено выше;

Z′ - СН2 или (СН2)n, где n равно 2, 3 или 4, причем X′, Y′ и Z′ не являются СН2 одновременно;

А и А′ одинаковы или различны и выбраны из О, -CRR′O, S, -CRR′S, -NR15 или CRR′NHR15, где R и R′ имеют такое же значение, как определено выше, и где R15 имеет такое же значение, как определено выше для R;

D и D′ - одинаковы или различны и независимо выбраны из линейного, разветвленного или циклического алкила, алкенила или алкинила с 1-10 атомами углерода, необязательно замещенного галогеном, OR7, NR8R9, NO2, NRCOR′, SR10, сульфоксида вида SOR′, сульфона вида -SO2R′, сульфита -SO3, бисульфита -OSO3, сульфонамида вида SO2NRR′, циано-, азидо-, -COR11, OCOR11 или OCONR11R12, в которых R7, R8, R9, R10, R11 и R12 таковы, как определено выше, полиэтиленгликолевой единицы (- ОСН2СН2)n, где n - целое число от 1 до 2000;

L - необязательная фенильная группа, или гетероциклическое кольцо с 3-10 атомами углерода, необязательно замещенные, где заместитель представляет собой связывающую группу, позволяющую связывание с агентом, соединяющимся с клеткой через ковалентную связь, либо выбраны из линейного, разветвленного или циклического алкила, алкенила или алкинила с 1-10 атомами углерода, необязательно замещенного галогеном, OR7, NR8R9, NO2, NRCOR′, SR10, сульфоксида вида SOR′, сульфона вида -SO2R′, сульфита -SO3, бисульфита -OSO3, сульфонамида вида SO2NRR′, циано-, азидо-, -COR11, OCOR11 или OCONR11R12, в которых R7, R8, R9, R10, R11 и R12 таковы, как определено выше, полиэтиленгликолевой единицы (-ОСН2СН2)n, где n - целое число от 1 до 2000; необязательно L само по себе является связывающей группой, позволяющей связывание с агентом, соединяющимся с клеткой через ковалентную связь; либо их фармацевтически приемлемыми сольватами, солями, гидратами или гидратированными солями, их оптическими изомерами, рацематами, диастереомерами, энантиомерами или полиморфными кристаллическими структурами этих соединений, причем соединение имеет не более одной связывающей группы, позволяющей связывание с агентом, соединяющимся с клеткой через ковалентную связь.

В одном предпочтительном аспекте двойная линия между N и С обозначает одинарную связь или двойную связь, причем, если она двойная, Х отсутствует, a Y является Н, а если она одинарная, Х-Н или аминная защитная группа, превращающая соединение в неактивную форму;

Y выбран из -OR, NR′R", сульфита -SO3 или бисульфита -OSO3, причем R выбран из Н, линейного, разветвленного или циклического алкила с 1-10 атомами углерода, полиэтиленгликолевой единицы (-ОСН2СН2)n, где n - целое число от 1 до 2000, арила с 6-10 атомами углерода, гетероциклического кольца с 3-10 атомами углерода;

W-C=O, CH2 или SO2;

R1, R2, R3, R4, R1′, R2′, R3′ и R4′, каждый независимо, выбраны из Н, NO2 или связывающей группы, позволяющей связывание с агентом, соединяющимся с клеткой через ковалентную связь;

R6-OR18, где R18 имеет такое же значение, как R;

Z выбран из (CH2)n, где n-1, 2 или 3, CR15R16, NR17, О или S, где R15, R16 и R17, каждый независимо, выбраны из Н, линейного, разветвленного или циклического алкила с 1-10 атомами углерода, полиэтиленгликолевой единицы (-ОСН2СН2)n, где n - целое число от 1 до 2000;

X′ выбран из СН2 или С=O;

Y′-O, NR или S, где R имеет такое же значение, как определено выше;

7′--СН2 или (СН2)2;

А и А′ оба - О;

D и D′ одинаковы или различны и независимо выбраны из линейного, разветвленного или циклического алкила, алкенила или алкенила с 1-10 атомами углерода;

L - необязательная фенильная группа или гетероциклическое кольцо с 3-10 атомами углерода, необязательно замещенные, где заместитель представляет собой связывающую группу, позволяющую связывание с агентом, соединяющимся с клеткой через ковалентную связь, либо выбраны из линейного, разветвленного или циклического алкила, алкенила или алкинила с 1-10 атомами углерода, необязательно замещенного галогеном, OR7, NR8R9, NO2, NRCOR′, SR10, сульфоксида вида SOR′, сульфона вида -SO2R′, сульфита -SO3, бисульфита -OSO3, сульфонамида вида SO2NRR′, циано-, азидо-, -COR11, OCOR11 или OCONR11R12, полиэтиленгликолевой единицы (-ОСН2СН2)n, где n - целое число от 1 до 2000; необязательно L само по себе является связывающей группой, позволяющей связывание с агентом, соединяющимся с клеткой через ковалентную связь; либо их фармацевтически приемлемыми сольватами, солями, гидратами или гидратированными солями, их оптическими изомерами, рацематами, диастереомерами, энантиомерами или полиморфными кристаллическими структурами этих соединений.

В другом предпочтительном аспекте соединение описывается формулой (XXII):

где двойная линия между N и С обозначает одинарную связь или двойную связь, причем, если она двойная, Х отсутствует, а Y является Н, а если она одинарная, - Х - Н или аминная защитная группа, превращающая соединение в неактивную форму, а Y выбран из ОН, простого эфира формулы -OR, сульфита -SO3, бисульфита -OSO3, где R выбран из линейного, разветвленного или циклического алкила, алкенила или алкинила с 1-10 атомами углерода;

один из R2, R3 является связывающей группой, позволяющей связывание с агентом, соединяющимся с клеткой через ковалентную связь, а другой является Н;

один из L′, L" или L′" является связывающей группой, позволяющей связывание с агентом, соединяющимся с клеткой, а остальные являются Н; предпочтительно L′ является связывающей группой, a G-СН или N. Иные примеры описаны в патентной заявке США № 61/150201, которая включена в настоящий документ в полном объеме посредством ссылки.

Цитотоксический агент, используемый в цитотоксических конъюгатах по настоящему изобретению, также может быть таксаном или его производным. Таксаны - семейство соединений, включающее паклитаксел (Таксол), природный цитотоксический препарат, и доцетаксел (Таксотер) - полусинтетическое производное. Эти два соединения широко используются при терапии рака. Таксаны токсичны по отношению к митотическому веретену, ингибируя деполимеризацию тубулина, что приводит клетку к смерти. Хотя доцетаксел и паклитаксел находят применение при лечении рака, их противоопухолевая активность ограничена из-за неспецифической токсичности против нормальных клеток. Помимо этого, соединения, подобные паклитакселу и доцетакселу, сами по себе недостаточно активны для использования в конъюгатах с агентами, связывающимися с клетками, например, антителами против CD20 и их фрагментами по настоящему изобретению. Таксаны, пригодные для использования в настоящем изобретении описаны, например, в патентах США под номерами 6372738 и 6340701. Конъюгаты таксанов по изобретению и агента, связывающегося с клеткой, могут быть получены по любой технике, известной в настоящее время или разработанной впоследствии. Множество способов конъюгирования описано в патентах USP 5416064 и USP 5475092. Таксаны также описаны в 7598290, 20090099336, 20070031402, 20060233814, 20060233811, 20050123549, 20050085513, 20040039176, каждый из которых включен в настоящий документ во всей полноте посредством ссылки.

СС-1065 и его аналоги также являются предпочтительными цитотоксическими препаратами для использования в настоящем изобретении. СС-1065 и его аналоги описаны в патентах США под номерами 6372738, 6340701, 5846545 и 5585499. СС-1065 - мощный противоопухолевый антибиотик, выделенный из культуральной жидкости Streptomyceszelensis. СС-1065 примерно в 1000 раз более активен in vitro, чем используемые обычно противоопухолевые препараты, такие как доксорубицин, метотрексат и винкристин (В.К. Bhuyan et al., Cancer Res., 42,3532-3537 (1982)).

Дуокармицины - цитотоксические препараты, подходящие для использования в настоящем изобретении и описаны в настоящей заявке и выданной области техники, к примеру, в патентах США под номерами 6281354, 6066742, 5703080, 4994578 и 4923990. Каждый литературный источник включен в настоящий документ посредством ссылки во всей полноте.

Энедиины, например, калихеамицины, - цитотоксические препараты, пригодные для использования в настоящем изобретении и описаны в настоящей заявке и в данной области техники, к примеру, в патентах США под номерами 5436361, 5053394 и 20090105461. Каждый литературный источник включен в настоящий документ посредством ссылки во всей полноте.

Доластатины и аналоги доластатина, включая ауристатины - цитотоксические препараты, пригодные для использования в настоящем изобретении и описаны в настоящей заявке и в области техники, к примеру, в патентах США под номерами 7084110, 6737409, 6686445, 6632795, 6458765, 6323315, 6248865, 6239104, 6143721, 6103698, 6034065, 5985837, 5965537, 5886147, 5554725, 5138036, 5076973, 4986988, 4978744 и 4879278. Каждый литературный источник включен в настоящий документ посредством ссылки во всей полноте.

Производные томаимицина - цитотоксические препараты, пригодные для использования в настоящем изобретении и описаны в настоящей заявке и в данной области техники, к примеру, в патенте США № 4427588, Arima et al., "J. Antibiotics", vol. 25, № 8, pp. 437-444, (1972); Kariyone et al„ "Chem. Pharm. Bull.", vol. 19, № 11, pp. 2289-2293, (1971); и Leimgruber et al„ "J. Am. Chem. Soc.", vol. 90, pp. 5641-5643, (1968). Каждый литературный источник включен в настоящий документ посредством ссылки во всей полноте.

Производные лептомицина - цитотоксические препараты, пригодные для использования в настоящем изобретении и описаны в настоящей заявке и в данной области техники, к примеру, в патенте США № 7446196; Kudo et al. Experimental Cell Research, 1998, 242(2), 54-546; Kuhnt et al., Applied Environmental Microbiology, 1998, 64(2), 714-720; заявке US 10/856 703; Carl et al., J. Med. Chem. 1981, 24 (3), 479-480, "A Novel Connector Linkage Applicable in Prodrug Design"; Chemical Abstracts № 105:102629 (abstract ofJP 61-109717 A2 (1986)); Doherty et al., J. Nat. Cancer Inst. 2003, 95(24), 1859-1868, "Cell Cycle Checkpoint Function in Bladder Cancer"; Fukuda et al., Nature 1997, 390, 308-311, "CRM1 is responsible for intracellular transport mediated by the nuclear export signal"; Hamamoto et al., J. Antibiotics 1983, 36 (6), 639-645, "Leptomycins A and В, New Antifungal Antibiotics I. Taxonomy of the Producing Strain and Their Fermentation, Purification and Characterization"; Hayakawa et al., J. Antibiotics 1987, 40 (9), 1349-1352, "New Antitumor Antibiotics, Anguinomycins A and B"; Inoue et al., J. Biol. Chem. 2002, 277 (17), 15053-15060, "Nuclear Import and Export Signals in Control of the p53-related Protein p73"; Kobayashi et al., Ensho, Saisei 2004, 24(5), 578-583, "Role of matrix metalloproteinase-9 expression on cutaneous inflammation: possible treatment by leptomycin В application" (abstract); Komiyama et al., J. Antibiotics 1985, 38 (2), 220-223, "Structural Study of a New Antitumor Antibiotic, Kazusamycin"; Komiyama et al., J. Antibiotics 1985, 38 (2), 224-229, "Antitumor Activity of a New Antibiotic, Kazusamycin"; Komiyama et al., J. Antibiotics 1985, 38 (3), 427-429, "Antitumor activity of leptomycin В"; Kudo et al., Exp. Cell Res. 1998, 242, 540-547, "Lepto-mycin В Inhibition of Signal Mediated Nuclear Export by Direct Binding to CRM1"; Kudo et al., Proc. Nat′l Acad. Sci. (USA) 1999, 96 (3), 9112-9117, "Leptomycin B inactivates CRMl/exportin 1 by covalent modification at a cysteine residue in the central conserved region"; Kuhnt et al., Applied Environ. Microbiol. 1998, 64 (2), 714-720, "Microbial Conversion Products of Leptomycin B"; Lane et al., Proc. Nat′l Acad. Sci. (USA) 2000, 97, 8501-8506, "Activation of p53 in cervical carcinoma cells by small molecules"; Marabese et al., Nucleic Acids Res. 2003 31 (22), 6624-6632, "DNA damage induces transcriptional activation ofp73 by removing C-EBPa repression on E2F1"; Meissner et al„ FEBS Letters 2004, 576(1-2), 27-30, "Ratjadone and leptomycin B block CRM1-dependent nuclear export by identical mechanisms" (abstract); Nishi et al., J. Biol. Chem. 1994, 269 (9), 6320-6324, "Leptomycin B Targets a Regulatory Cascade of crm1, a Fission Yeast Nuclear Protein, Involved in Control of Higher Order Chromosome Structure and Gene Expression"; Peehl et al., Prostate 2003, 54, 258-267, "Leptomycin B Stabilizes and Activates p53 in Primary Prostatic Epithelial Cells and Induces Apoptosis in the LNCaP Cell Line"; на сайте University of Dundee, Dept. Surgery & Molecular Oncology, Lain Group Website, по ссылке http://www.dundee.ac.uk/surgery/Non-Genotoxic.htm, доступной 6 декабря 2004, "Non-genotoxic activation of the p53 tumor suppressor function". Каждый литературный источник включен в настоящий документ путем ссылки во всей полноте.

В другом аспекте изобретения вместо лекарственного препарата с антителами по настоящему изобретению могут быть связаны молекулы миРНК. миРНК может быть связана с антителами по настоящему изобретению способами, обычно используемыми для модифицирования олигонуклеотидов (см., к примеру, патентные публикации US 20050107325 и 20070213292). Таким образом, миРНК в 3′- или 5′-фосфорамидитных формах может взаимодействовать с одним концом перекрестносшивающего линкера, несущим гидроксильную группу, с образованием сложноэфирной связи между миРНК и перекрестносшивающим линкером. Аналогично взаимодействие миРНК в фосфорамидитной форме с перекрестносшивающим линкером с терминальной аминогруппой приводит к связыванию перекрестносшивающего линкера с миРНК через аминную связь. Альтернативно миРНК может быть замещена стандартными химическими способами с введением тиоловой группы. Подобная тиол-содержащая миРНК может взаимодействовать с антителом, которое было модифицировано введением активного дисульфидного или малеимидного фрагмента, с образованием расщепляемого или нерасщепляемого конъюгата. Данным способом с антителом может связаться 1-20 молекул миРНК.

Диагностические и исследовательские приложения

Помимо терапевтического использования обсуждавшихся здесь антител, антитела и/или их фрагменты по настоящему изобретению могут применяться во множестве диагностических и исследовательских работ. Антитела или фрагменты по настоящему изобретению могут использоваться, например, для очистки, детектирования, нацеливания на CD20 в диагностических способах in vitro и in vivo. К примеру, антитела и/или фрагменты могут использоваться в иммуноанализах для качественного и количественного определения уровней CD20, экспрессируемого клетками биологических образцов. См., например, Harlow et al., Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 2nd ed. 1988), включенный в настоящий документ во всей полноте путем ссылки.

Антитела по настоящему изобретению могут использоваться, например, в анализах конкурентного связывания, прямых и непрямых сэндвич-анализах и анализах способом иммунопреципитации (Zola, Monoclonal Antibodies: A Manual of Techniques, pp. 147-158 (CRC Press, Inc., 1987)).

К примеру, настоящее исследование также предоставляет вышеуказанные пептиды и антитела против CD20 с детектируемыми метками, как описано ниже, для использования в диагностических способах детектирования CD20 у пациентов с установленным или подозреваемым CD20-обусловленным состоянием. Пептиды и/или антитела против CD20 по настоящему изобретению подходят для иммуноанализов, детектирующих или определяющих количественно CD20 или антитела против CD20 в образце. Иммуноанализ на CD20, как правило, включает инкубирование биологического образца в присутствии детектируемым образом меченного высокоаффинного пептида против CD20 и/или антитела согласно настоящему изобретению, способному к селективному связыванию с CD20, а также включает детектирование меченого пептида или антитела, соединившегося с образцом. Различные процедуры клинических анализов хорошо известны в данной области техники, например, описанные в Immunoassays for the 80′s, A. Voller et al., eds., University Park, 1981. Пептид, антитело или его фрагмент против CD20 могут быть добавлены к нитроцеллюлозе или иной твердой подложке, способной иммобилизировать клетки, клеточные частицы или растворимые белки. Подложка затем может быть промыта подходящими буферами с последующей обработкой детектируемым меченым CD20-специфическим пептидом, антителом или его фрагментом. Твердофазная подложка затем может быть второй раз промыта буфером для удаления несвязанного пептида, антитела или его фрагмента. Количество связавшейся с твердой подложкой метки может затем быть определено известными способами.

Под «твердофазной подложкой» или «носителем» понимается любой носитель, способный связываться с пептидом, антигеном, антителом или его фрагментом. Хорошо известны такие подложки или носители как стекло, полистирол, полипропилен, полиэтилен, декстран, нейлон, амилазы, натуральные и модифицированные целлюлозы, полиакриламиды, агарозы, магнетит. Носитель может быть в определенной степени растворим либо не растворим, в зависимости от целей настоящего изобретения. Материал подложки может иметь практически любую возможную структурную конфигурацию, способную при спаривании с молекулой к связыванию с CD20, антителом против CD20 или его фрагментом. Конфигурация подложки может быть сферической, например, типа гранулы, либо цилиндрической, например, она может быть нанесена на внутреннюю поверхность пробирки или на внешнюю поверхность стержня. Альтернативно поверхность может быть плоской, например, иметь форму листа, культуральной чашки, тест-полоски и т.д. Предпочтительные подложки - полистироловые гранулы. Специалистам в данной области техники известно множество других подходящих носителей для связывания антител или их фрагментов, пептидов или антигенов либо они могут выяснить, какой носитель подходит путем обычных экспериментов.

Хорошо установленные поэтапные способы позволяют установить связывающую активность конкретной партии пептида против CD20, антитела или его фрагмента. Специалисты в данной области техники могут определить рабочие и оптимальные условия для рутинного экспериментирования.

Детектируемое мечение CD20-специфического пептида и/или антитела или его фрагмента может быть достигнуто связыванием фермента, использующегося в иммуноферментном анализе (EIA), или фермент-связанном иммуносорбентном методе исследования (ELISA). Связанный фермент реагирует с экспонированным субстратом с образованием химического фрагмента, который может быть детектирован, к примеру, спектрофотометрически, флуорометрически или визуально. Ферменты, которые могут использоваться для детектируемого мечения CD20-специфических антител или их фрагментов по настоящему изобретению включают, не ограничиваясь перечисленным, малатдегидрогеназу, стафилококковую нуклеазу, дельта-5-стероидизомеразу, алкогольдегидрогеназу дрожжей, альфа-глицерофосфатдегидрогеназу, триозофосфатизомеразу, пероксидазу хрена, щелочную фосфатазу, аспарагиназу, глюкозооксидазу, бета-галактозидазу, рибонуклеазу, уреазу, каталазу, глюкозо-6-фосфатдегидрогеназу, глюкоамилазу и ацетилхолинэстеразу.

Радиоактивным мечением CD20-специфических антител и/или их фрагментов возможно детектировать CD20 посредством радиоиммунологического анализа (RIA) (см., к примеру. Work, et al., Laboratory Techniques and Biochemistry in Molecular Biology, North Holland Publishing Company, N.Y. (1978)). Радиоактивный изотоп может быть детектирован гамма-счетчиком, сцинтилляционным счетчиком или авторадиографией. Изотопы, особенно подходящие для использования в настоящем изобретении: 3H, 125I,131I, 35S, 14C, а предпочтительно - 125I.

СВ20-специфические антитела и/или их фрагменты также можно метить флуоресцентными соединениями. Если антитело с флуоресцентной меткой подвергается свету с нужной длиной волны, то его присутствие может затем быть обнаружено по флуоресценции. Наиболее часто используемыми в качестве меток флуоресцентными соединениями являются флуоресцеин-изотиоцианат, родамин, фикоэритрин, фикоцианин, аллофикоцианин, о-фталальдегид и флуоресцамин.

CD20-специфические антитела и их фрагменты также могут быть детектируемо помечены флуоресцентными эмиттирующими металлами, например, 125Eu или иными лантаноидами. Эти металлы могут быть присоединены к CD20-специфическом антителу или его фрагменту с использованием хелатирующих групп, например, диэтилентриаминпентауксусной кислоты (DTPA) или этилендиаминтетрауксусной кислоты (EDTA).

CD20-специфические антитела и их фрагменты также могут быть детектируемо помечены связывание с хемилюминесцентным соединением. Присутствие антитела с хемилюминесцентной меткой затем выявляется по детектированию наличия люминесценции, возникающей во время химической реакции. Примерами особенно подходящих соединений, используемых в качестве хемилюминесцентных меток, являются люминол, изолюминол, тероматический сложный эфир акридиния, имидазол, соли акридиния и оксалатный сложный эфир. Аналогично, чтобы пометить CD20-специфическое антитело, его фрагмент или производное по настоящему изобретению, может использоваться биолюминесцентное соединение. Биолюминесценция - тип хемилюминесценции, наблюдающийся в биологических системах, в которых каталитический белок увеличивает эффективность хемилюминесцентной реакции. Присутствие биолюминесцентного белка выявляется по детектированию наличия люминесценции. Важные биолюминесцентные соединения для целей мечения - люциферин, люцифераза и экворин.

Детектирование CD20-специфического антитела, фрагмента или его производного может осуществляться сцинтилляционным счетчиком, к примеру, если детектируемая метка является радиоактивным гамма-излучателем, либо флуорометром, к примеру, если метка является флуоресцентным материалом. В случае ферментной метки детектирование может осуществляться колориметрическими способами с участием субстрата фермента. Детектирование также может осуществляться визуальным сравнением ослабления ферментативной реакции субстрата в сравнении с аналогично приготовленными эталонами.

Для целей настоящего изобретения детектируемый CD20 может присутствовать в биологическом образце. Может использоваться любой образец, содержащий CD20. Предпочтительно образец является биологической жидкостью, например, кровью, сывороткой, лимфой, мочой, воспалительным экссудатом, цереброспинальной жидкостью, амниотической жидкостью, тканевым экстрактом или гомогенатом и т.п. Тем не менее, изобретение не ограничено анализами с использованием только этих образцов, обычный специалист в данной области техники может определить подходящие условия, позволяющие использовать другие образцы.

Детектирование in situ может осуществляться при взятии гистологического образца у пациента с последующим воздействием на него комбинации меченых антител по настоящему изобретению. Антитело или его фрагмент, предпочтительно, предоставляются путем приложения или накладывания меченого антитела или его фрагмента на биологический образец. При использовании такой процедуры возможно определить не только присутствие CD20, но также и распределение CD20 в исследуемой ткани. Используя настоящее изобретение, обычный специалист в данной области техники с легкостью поймет, что любой из множества гистологических способов (например, процедуры окрашивания) может быть модифицированы для достижения детектирования in situ.

Антитело или его фрагмент по настоящему изобретению может быть адаптирован для использования в иммунометрическом анализе, также известном как «двухслойный» или «сандвич-» анализ. В типичном иммунометрическом анализе количество немеченого антитела или его фрагмента связано с твердой подложкой, нерастворимой в тестируемой жидкости, и количество детектируемого меченого растворимого антитела добавляют для последующего детектирования и/или количественного определения тройного комплекса между твердофазным антителом, антигеном и меченым антителом.

Типичные и предпочтительные иммунометрические анализы включают «прямые» анализы, при которых антитело, связанное с твердой фазой, вначале контактирует с испытываемым образцом для экстрагирования CD20 из образца путем образования бинарного комплекса твердофазное антитело-CD20. После достаточного инкубационного периода твердую подложку промывают для удаления остатков жидкого образца, включая непрореагировавший CD20, если он остался, а затем приводят ее в контакт с раствором, содержащим известное количество меченого антитела (которое выступает в качестве «репортерной молекулы»). После второго инкубационного периода для образования комплекса меченого антитела с CD20, связавшегося с твердой подложкой через немеченое антитело или его фрагмент, твердую подложку промывают второй раз для удаления непрореагировавшего меченого антитела или его фрагмента. Этот тип прямого сандвич-анализа может выступать простым анализом типа «да/нет» для выявления присутствия CD20 или же может выполняться количественно путем сравнения с измерением, полученным для меченого антитела или его фрагмента с использованием стандартного образца, содержащего известное количество CD20. Эти «двухсторонние» или «сандвич»-анализы были описаны Wide (Radioimmune Assay Method, Kirkham, ed., Livingstone, Edinburgh, 1970, pp. 199-206).

Другие типы «сандвич»-анализов, которые также могут использоваться для CD20, называются «одновременным» и «обратным» анализами. Одновременный анализ заключается в одном этапе инкубирования, во время которого антитело, связанное с твердой подложкой, и меченое антитело добавляются к тестируемому образцу одновременно. По завершении инкубирования твердую подложку промывают для удаления остатков жидкого образца и несвязанного меченого антитела. Затем, аналогично «прямому» сандвич-анализу, определяют присутствие меченого антитела, связавшегося с твердой подложкой.

В «обратном» анализе поочередно добавляется меченое антитело к жидкому образцу, а спустя достаточный инкубационный период, добавляется немеченое антитело, связанное с твердой подложкой. После второго инкубирования твердую фазу промывают обычным способом, чтобы освободить ее от остатков анализируемого образца и раствора непровзаимодействовавшего меченого антитела. Затем, аналогично «прямому» и «одновременному» сандвич-анализам, определяют присутствие меченого антитела, ассоцировавшегося с твердой подложкой. В одном аспекте комбинация антител по настоящему изобретению специфическая к различным эпитопам, может использоваться для создания чувствительного трех-сайтного иммунорадиометрического анализа.

Антитела и их фрагменты по изобретению также пригодны для визуализационных исследований in vivo, при которых антитела и их фрагменты, меченные детектируемым фрагментом, например, рентгеноконтрастным веществом или радиоизотопом, вводятся субъекту, предпочтительно, в кровоток, после чего исследуется наличие и локализация антител в организме. Данная технология визуализации пригодна для определения стадии заболевания и прогресса лечения. Антитело и его фрагмент может быть помечено любой группой, детектируемой в организме посредством ядерного магнитного резонанса, радиологическим и иными способами, известными в данной области техники.

Меткой может выступать любая детектируемая группа, способная производить детектируемый сигнал прямо или косвенно. К примеру, метка может быть биотиновой меткой, ферментной меткой (например, люциферазой, щелочной фосфатазой, бета-галактозидазой и пероксидазой хрена), радиоактивной меткой (например, 3H, 14С, 32Р, 35S и 123I), флюорофором, например, флуоресцентным или хемилюминесцентным соединением (например, флуоресцеин-изотиацинатом, родамином), визуализирующим препаратом (например, Тс-т99 или индием (111In)) и ионом металла (например, галлия или европия).

Для внедрения метки может использоваться любой способ конъюгирования антитела или его фрагмента, включая примеры способов, описанные Hunter, et al., 1962, Nature 144:945; David et al., 1974, Biochemistry 13:1014; Pain et al., 1981, J. Immunol. Meth. 40:219; Nygren, J., 1982, Histochem. andCytochem. 30:407.

Антитела и их фрагменты по изобретению также могут использоваться в качестве реактивов в биологических исследованиях, основанных на оказываемом ими ингибировании функции CD20 в клетках.

Антитела и их фрагменты по изобретению также могут использоваться в качестве реактивов для аффинной очистки. При этой процедуре антитела, к примеру, иммобилизуются на подходящей подложке, например, смоле Sephadex или фильтровальной бумаге, с использованием хорошо известных в данной области техники способов. Таким образом, CD20 может быть выделено из биологического образца и очищено.

В настоящем изобретении также предлагаются полинуклеотиды, содержащие нуклеотидную последовательность, кодирующую антитело или его фрагмент по изобретению или его эпитоп-связывающие фрагменты.

Настоящее изобретение также охватывает полинуклеотиды, кодирующие полипептид, который может связывать CD20 и который гибридизирует в жестких условиях гибридизации полинуклеотиды, кодирующие антитело или его фрагмент, согласно настоящему изобретению, причем указанные жесткие условия гибридизации таковы: пре-гибридизация 2 часа при 60°С в 6х SSC, 0,5% SDS, 5х раствора Денхардта, 100 мкг/мл ДНК молок лосося, денатурированной нагреванием; гибридизация 18 часов при 60°С, с двойной промывкой в 4х SSC, 0,5% SDS, 0,1% натрия пирофосфата, 30 минут при 60°С и дважды в 2× SSC, 0,1% SDS в течение 30 минут при 60°С.

Полинуклеотиды могут быть получены, а нуклеотидная последовательность полинуклеотидов может быть определена способами, известными в данной области техники. К примеру, используя нуклеотидную последовательность антитела или его фрагмента, описанные здесь полинуклеотид, кодирующий антитело, может быть собран из химически синтезированных олигонуклеотидов (например, как описано в Kutmeier et al., 1994, BioTechniques 17:242), что, вкратце, заключается в синтезе перекрывающихся олигонуклеотидов, содержащих части последовательности, кодирующей антитело, и заключается в отжиге и связывании данных олигонуклеотидов, а затем в амплификации сшитых олигонуклеотидов при помощи ПЦР.

Способы конструирования рекомбинантных векторов, содержащих последовательности, кодирующие антитела против CD20 или их фрагменты, и соответствующие транскрипционные и трансляционные контрольные сигналы, хорошо известны в данной области техники. Данные способы включают, к примеру, рекомбинантные ДНК-методики in vitro, синтетические методики и генетическую рекомбинацию in vivo. В изобретении, таким образом, предлагаются реплицируемые векторы, содержащие нуклеотидную последовательность, кодирующую молекулу антитела по настоящему изобретению, его легкую или тяжелую цепь, либо вариабельный домен легкой или тяжелой цепи, либо эпитоп-связывающий фрагмент любого из перечисленного, функционально связанный с промотором.

Рекомбинантный вектор переносят в клетку-хозяина обычными методиками, трансфицированные клетки затем культивируют обычными методиками для получения антител по изобретению. Таким образом, изобретение включает клетки-хозяева, содержащие полинуклеотиды, кодирующие антитело по изобретению, либо их эпитоп-связывающий фрагмент, функционально связанный с гетерологическим промотором. В предпочтительных аспектах векторы, кодирующие и тяжелую, и легкую цепи, могут совместно экспрессироваться в клетке-хозяине для экспрессии целой молекулы иммуноглобулина.

Для экспрессирования молекул антител против CD20 и их фрагментов по изобретению могут использоваться различные системы хозяин-вектор экспрессии. Подобные системы хозяин-экспрессия предоставляют носители, посредством которых интересующие кодирующие последовательности могут быть получены и, впоследствии, очищены, а также предоставляют клетки, которые могут после трансформации или трансфекции соответствующими кодирующими последовательностями нуклеотидов экспрессировать молекулу антитела по изобретению in situ. К ним относятся, не ограничиваясь перечисленным, микроорганизмы, например, бактерии (например, Е. coli и В. subtilis), трансформированные рекомбинантной бактериофаговой ДНК, плазмидной ДНК или космидной ДНК с векторами экспрессии, содержащими последовательности, кодирующие антитела; дрожжи (например, Saccharomyces и Pichia), трансформированные рекомбинантными векторами дрожжей, содержащими последовательности, кодирующие антитела; системы клеток насекомых, инфицированные рекомбинантными вирусными векторами экспрессии (например, бакуловирусом), содержащими последовательности, кодирующие антитела; системы клеток растений, инфицированные рекомбинантными вирусными векторами экспрессии (например, вирусом мозаики цветной капусты, CaMV, вирусом мозаики табака, TMV) или трансформированные рекомбинантными плазмидными векторами экспрессии (например, плазмидой Ti), содержащими последовательности, кодирующие антитела; или системы клеток млекопитающих (например, клеток COS, CHO, BHK, 293, 3Т3) с внедренной конструкцией экспрессией, содержащей промоторы, происходящие из генома клеток млекопитающих (например, промотор металлотионеина) или из вирусов млекопитающих (например, поздний промотор аденовируса, 7,5К промотор вируса осповакцины).

Предпочтительно для экспрессии молекулы рекомбинантного антитела используются бактериальные клетки, например, Escherichia coli, и, более предпочтительно, эукариотные клетки, особенно для экспрессии целых молекул рекомбинантных антител. К примеру, клетки млекопитающих, например, клетки яичника китайского хомячка (CHO), совместно с вектором, например, главным промежуточным ранним генным промотором человеческого цитомегаловируса, являются эффективной системой экспрессии антител (Foecking et al., 1986, Gene 45:101; Cockett et al., 1990, Bio/Technology 8:2).

Для долгосрочного и высокопродуктивного получения рекомбинантных белков предпочтительна стабильная экспрессия. К примеру, могут быть сконструированы клеточные линии, которые стабильно экспрессируют молекулу антитела. Вместо использования векторов экспрессии, содержащих вирусные источники репликации, клетки-хозяева могут быть трансформированы при помощи ДНК, контролируемой соответствующими элементами контроля экспрессии (например, промоторами, энхансерами, последовательностями, терминаторами транскрипции, сайтами полиаденилирования и т.д.) и маркером селекции. После внедрения чужеродной ДНК конструированные клетки могут доращиваться 1-2 дня на обогащенной среде, а затем их переносят на селективную среду. Маркер селекции в рекомбинантной плазмиде придает устойчивость против селекции и позволяет клеткам стабильно интегрировать плазмиду в их хромосомы, а также образовывать фокусы, которые, в свою очередь, могут быть клонированы и подвергнуты экспансии в клеточные линии. Способ может с выгодой использоваться для конструирования клеточных линий, экспрессирующих молекулы антител. Подобные конструированные клеточные линии могут быть особенно полезны при скрининге и оценивании компонентов, прямо или косвенно взаимодействующих с молекулой антитела.

После того как молекула антитела по изобретению была рекомбинантно экспрессирована, она может быть очищена любым способом, известным в данной области техники, для очистки молекулы иммуноглобулина, к примеру, хроматографией (например, ионообменной, аффинной, аффинной к специфическому антигену, помимо Протеина А, эксклюзионной хроматографией), центрифугированием, способом дифференциальной растворимости или по любой иной стандартной технике, предназначенной для очистки белков. В этой связи, дается ссылка на патент США № 7538195, рекомендации которого включены в настоящую заявку во всей полноте путем ссылки.

В другом аспекте различные антитела и фрагменты антител, а также аналоги антител легко могут быть получены мутированием, добавлением делеции или вставки в последовательности вариабельной и константной областей, фланкирующих конкретный набор областей, определяющих комплементарность, с использованием способов, описанных здесь или известных в данной области техники. Так, к примеру, для заданного набора определяющих комплементарность областей могут существовать различные классы антител при замещении различных тяжелых цепей, например, могут быть получены типы антител и изотипы IgGl-4, IgM, IgAl-2, IgD, IgE. Аналогично искусственные антитела, охватываемые изобретением, могут производиться внедрением заданного набора областей, определяющих комплементарность, в полностью синтетическую каркасную область. Термин «вариабельный» используется здесь для описания определенных частей вариабельных доменов, различающихся последовательностью среди антител и определяющих связывание и специфичность каждого конкретного антитела с его антигеном. Однако, вариабельность различных доменов антитела, как правило, неравномерна. Как правило, наиболее вариабельны три сегмента, называемые областями, определяющими комплементарность (CDR), или гипервариабельными областями, расположенные в вариабельных доменах и легкой, и тяжелой цепей. Более консервативные части вариабельных доменов называют каркасными (FR). Вариабельные домены тяжелой и легкой цепей содержат четыре каркасных области, образующих конфигурацию бета-листов, соединенные тремя областями, определяющими комплементарность, образующими соединительные петли, а иногда - образующими часть структур бета-листов. Области, определяющие комплементарность, в каждой цепи держатся близко с каркасными областями и к областям, определяющим комплементарность, другой цепи, образуя антиген-связывающий сайт антитела (Е. A. Rabat et al. Sequences of Proteins of Immunological Interest, пятое издание, 1991, NIH). Константные домены непосредственно не вовлечены в связывание антитела с антигеном, но проявляют различные эффекторные функции, например, участвуют в проявлении антителом антителозависимой клеточной цитотоксичности.

Гуманизированные антитела или антитела, адаптированные к неотторжению другими млекопитающими, могут быть изготовлены по нескольким технологиям, например, путем перестройки и CDR-имплантации. По технологии перестраивания в комбинации применяются молекулярное моделирование, статистический анализ и мутагенез для корректирования не-CDR поверхностей вариабельных областей, чтобы сделать поверхности известных антител соответствующими мишеням. Стратегии и способы перестраивания антител, а также другие способы уменьшения иммуногенности антител у различных хозяев описаны в патенте США 5639641, который включен в настоящий документ во всей полноте путем ссылки. По технологии CDR-имплантации мышиные регионы легкой и тяжелой цепей, определяющие комплементарность, пересаживаются в полностью человеческую каркасную последовательность.

Изобретение также включает функциональные эквиваленты антител, описанных в данной спецификации. Функциональные эквиваленты имеют характеристики связывания, сравнимые с характеристиками антител, и включают, к примеру, химеризированные, гуманизированные и одноцепочечные антитела, а также их фрагменты. Способы получения подобных функциональных эквивалентов описаны в заявке РСТ WO 93/21319, Европейской патентной заявке № 239400, заявке РСТ WO 89/09622, Европейской патентной заявке 338745 и Европейской патентной заявке ЕР332424, которые включены в настоящий документ во всей полноте путем ссылки.

Функциональные эквиваленты включают полипептиды с аминокислотными последовательностями, практически такими же, как аминокислотные последовательности вариабельных или гипервариабельных областей антител по изобретению. Термин «практически такой же», в применении к аминокислотной последовательности, определяется здесь как последовательность по меньшей мере с 90%, а более предпочтительно - по меньшей мере с 95% идентичностью последовательности с другой аминокислотной последовательностью по данным поиска FASTA в соответствии с Pearson, Lipman, Proc. Natl. Acad. Sci. USA 85,2444-2448 (1988).

Химеризованные антитела предпочтительно обладают константными областями, происходящими по большей части или полностью из константных областей человеческих антител, и вариабельными областями, происходящими по большей части или полностью из вариабельных областей млекопитающих, отличных от человека. Гуманизированные формы антител изготовлены путем замены областей, определяющих комплементарность, в человеческой каркасной области на области, к примеру, мышиного антитела, например, как описано в публикации РСТ № WO92/22653. Гуманизированные антитела предпочтительно обладают константными областями и вариабельными областями, отличными от областей, определяющих комплементарность (CRD), и происходящими по большей части или полностью из соответствующих областей человеческих антител, и областями, определяющими комплементарность, происходящими по большей части или полностью от млекопитающих, отличных от человека.

Функциональные эквиваленты также включают одноцепочечные фрагменты антител, также известных как одноцепочечные антитела (scFvs). Данные фрагменты содержат по меньшей мере один фрагмент аминокислотной последовательности вариабельной области тяжелой цепи (VH), связанный по меньшей мере с одним фрагментом аминокислотной последовательности вариабельной области легкой цепи (VL) через один линкер и более либо без них. Подобный линкер может быть коротким гибким пептидом, выбранным таким образом, чтобы обеспечить правильное трехмерное скручивание доменов (VL) и (VH) при их связывании для поддержания специфичности связывания, такой же, как у целого антитела, из которого был получен одноцепочечный фрагмент антитела. Карбоксильный конец последовательности (VL) или (VH) может быть ковалентно связан подобным пептидным линкером с аминным концом комплементарной последовательности (VL) и (VH). Одноцепочечные фрагменты могут быть получены молекулярным клонированном, использованием фаговой библиотеки антител или аналогичными техниками. Данные белки могут производиться либо эукариотными клетками, либо прокариотными клетками, включая бактерии.

Одноцепочечные фрагменты антител содержат аминокислотные последовательности по меньшей мере с одной вариабельной или определяющей комплементарность областью (CDR) целого антитела, описанного в данной спецификации, но не содержат некоторых или всех константных доменов данных антител. Константные домены не нужны для связывания антигена, однако, дают существенный вклад в структуру целого антитела. Одноцепочечные фрагменты антител могут решить ряд проблем, связанных с использованием антител, содержащих часть или все константные домены. К примеру, одноцепочечные фрагменты антител обычно не участвуют в нежелательных взаимодействиях между биологическими молекулами и константной областью тяжелой цепи и не оказывают иной нежелательной биологической активности. Помимо этого, одноцепочечные фрагменты существенно меньше, чем целые антитела и, таким образом, могут лучше проникать в капилляры, чем целые антитела, позволяя одноцепочечным фрагментам локализоваться и связываться с антиген-связывающими сайтами более эффективно. Также фрагменты антител могут быть в большом количестве получены в прокариотных клетках, что упрощает их производство. Помимо этого, благодаря относительно малому размеру одноцепочечных фрагментов антител, они с меньшей вероятностью вызывают иммунный ответ у реципиентов, нежели целые антитела.

Знание аминокислотной и нуклеиновой последовательностей антитела против CD20 и его гуманизированных вариантов, описанных здесь, может использоваться для разработки иных антител, которые также связываются с человеческим CD20. В ряде исследований было изучено влияние одной и более аминокислотных замен в различных позициях последовательности антитела, основываясь на сведениях о первичной структуре антитела, его свойствах, например, связывании и уровне экспрессии (например, Yang, W. Р. et al., 1995, J. Mol. Biol., 254, 392-403; Rader, С. et al„ 1998, Proc. Natl. Acad. Sci. USA, 95, 8910-8915; Vaughan, Т. J. et al., 1998, Nature Biotechnology, 16, 535-539).

В данных исследованиях были получены варианты первичного антитела путем изменения последовательностей в генах тяжелой и легкой цепей в CDR1, CDR2, CDR3 или каркасных областях с использованием таких способов как олигонуклеотид-опосредованный сайт-направленный мутагенез, кассетный мутагенез, ПЦР, устойчивой к ошибкам, перестановок ДНК либо с использованием мутирующих штаммов Е. coli (Vaughan, Т. J. et al., 1998, Nature Biotechnology, 16, 535-539; Adey, N. В. et al., 1996, Chapter 16, pp. 277-291, в "Phage Display of Peptides and Proteins", Eds. Kay, B. K. et al., Academic Press). Данные способы изменения последовательности первичного антитела дали улучшение аффинности вторичных антител (Gram, H. Et al., 1992, Proc. Natl. Acad. Sci. USA, 89, 3576-3580; Boder, Е. Т. et al., 2000, Proc. Natl. Acad. Sci. USA, 97, 10701-10705; Davies, J. and Riechmann, L., 1996, Immunotechnolgy, 2, 169-179; Thompson, J. et al., 1996, J. Mol. Biol., 256, 77-88; Short, M. K. et al., 2002, J. Biol. Chem., 277, 16365-16370; Furukawa, К. et al., 2001, J. Biol. Chem., 216, 27622-27628).

При помощи аналогичной управляемой стратегии изменения одного и более аминокислотных остатков антитела, последовательности антител, описанные в изобретении, могут использоваться для разработки антител против CD20 с улучшенной функцией, например, способами, описанными в патентной заявке 20090246195, содержимое которой включено в настоящую заявку во всей полноте путем ссылки.

Для внедрения детектируемой метки может использоваться любой способ конъюгирования антитела или его фрагмента, включая примеры способов, описанные Hunter, et al., Nature 144:945 (1962); David, et al., Biochemistry 13:1014 (1974); Pain, et al., J. Immunol. Meth. 40:219 (1981); andNygren, J. Histochem. and Cytochem. 30:407 (1982).

Антитела по настоящему изобретению могут использоваться в любом известном способе анализа, например, в анализах конкурентного связывания, прямых и непрямых сэндвич-анализах и анализах способом иммунопреципитации (Zola, Monoclonal Antibodies: A Manual of Techniques, pp. 147-158 (CRC Press, Inc., 1987)).

Антитела по изобретению также подходят для визуализационных исследований in vivo, при которых антитела, меченные детектируемым фрагментом, например, рентгеноконтрастным веществом или радиоизотопом, вводятся субъекту, предпочтительно, в кровоток, после чего исследуется наличие и локализация антител в организме. Данная технология визуализации пригодна для определения стадии заболевания и прогресса лечения. Антитело может быть помечено любой группой, детектируемой в организме посредством ядерного магнитного резонанса, радиологическим или иными способами, известными в данной области техники.

Антитела по изобретению также могут использоваться в качестве реактивов для аффинной очистки. При этой процедуре антитела иммобилизуются на подходящей подложке, например, смоле Sephadex или фильтровальной бумаге, с использованием хорошо известных в данной области техники способов.

Терапевтические приложения

Также, в настоящее изобретение включены способы ингибирования роста клеток, экспрессирующих CD20. В данных способах используются антитела или фрагменты, или конъюгаты по настоящему изобретению, а также антитела, фрагменты, иммуноконъюгаты по настоящему изобретению совместно с одним терапевтическим агентом и более. Подходящие терапевтические агенты включают те, которые прямо или косвенно ингибируют рост клеток, экспрессирующих CD20.

При использовании здесь термины «ингибировать» и «ингибирующий» должны пониматься как включающие любые ингибирующие эффекты на клеточный рост, включая гибель клеток. Ингибиторные эффекты включают временные эффекты, поддерживаемые эффекты и постоянные эффекты.

Терапевтические приложения настоящего изобретения включают способы лечения субъекта с заболеванием. Заболевания, которые лечатся способами настоящего изобретения - те, которые характеризуются экспрессией CD20. Подобные заболевания включают В-клеточные злокачественные новообразования, например, неходжкинскую лимфому, В-клеточный лимфоцитарный лейкоз и острый В-клеточный лимфобластный лейкоз, а также незлокачественные аутоиммунные или воспалительные заболевания, включая РА, в патофизиологии которого играют свою роль CD20-положительные В-клетки. Опытному специалисту в данной области техники понятно, что способы по настоящему изобретению также могут использоваться для лечения иных заболеваний, которые еще не описаны, как характеризующиеся экспрессией CD20.

Терапевтические применения настоящего изобретения могут также использоваться на практике in vitro и ex vivo.

Примером использования in vitro служит очистка клеточных популяций, контаминированных CD20-положительными клетками, например клетками В-клеточной линии. Способ содержит культивирование клеточных популяций в присутствии цитотоксического конъюгата huCD20-7 с последующим удалением мертвых CD20-положительных клеток. Условия для неклинического использования in vitro хорошо известны (см., к примеру, Uckun et al., 1986, JExp. Med. 163, 347-368; Uckun et al., 1985, J. Immunol. 134,3504-3515; Ramakrishnan et al., 1985, J. Immunol. 135,3616-3622).

Антитела, фрагменты и области, фрагменты или производные по настоящему изобретению, присоединенные к твердой подложке, также могут использоваться для удаления CD20 из жидкостей, тканей или клеточных экстрактов. В предпочтительном аспекте они используются для удаления CD20 из крови или продуктов плазмы крови. В другом предпочтительном аспекте мышиные и химерные антитела, фрагменты и области используются в экстракорпоральных иммуносорбентных устройствах, известных в данной области техники (см., к примеру. Seminars in Hematology, 26 (2 Suppl. 1) (1989)). Кровь пациента или иная биологическая жидкость подвергается воздействию закрепленного антитела, что приводит к частичному или полному удалению циркулирующего CD20 (свободного или в иммунных комплексах), после чего жидкость возвращается в организм. Подобная иммуноадсорбция может выполняться в режиме непрерывного потока с центрифугированием клеток или без этого. См., к примеру, Terman, et al., J. Immunol. 11 7:1971-1975(1976).

Настоящее изобретение также включает терапевтические применения антител или конъюгатов по настоящему изобретению, при которых антитела или конъюгаты могут быть введены субъекту в фармацевтически приемлемых дозированных формах. Они могут вводиться внутривенно, например, болюсно или непрерывным переливанием в течение периода времени, внутримышечно, подкожно, внутрисуставно, интрасиновиально, интратекально, перорально, местно, ингаляцией. Также они могут вводиться внутрь опухоли, рядом с опухолью, внутрь поражения, рядом с поражением, чтобы оказать как местные, так и системные терапевтические эффекты.

Фармацевтические композиции

Для терапевтических применений антитела или конъюгаты по изобретению вводят субъекту в фармацевтически приемлемых дозированных формах. Они могут вводиться внутривенно, например, болюсно или непрерывным переливанием в течение периода времени, внутримышечно, подкожно, внутрисуставно, интрасиновиально, интратекально, перорально, местно, ингаляцией. Антитела или конъюгаты также могут вводиться внутрь опухоли, рядом с опухолью, внутрь поражения, рядом с поражением, чтобы оказать как местные, так и системные терапевтические эффекты. Подходящие фармацевтически приемлемые носители, разбавители и вспомогательные соединения хорошо известны и могут быть определены специалистами в данной области техники в зависимости от клинической ситуации. Примерами подходящих носителей, растворителей и вспомогательных веществ служат: (1) фосфатно-солевой буфер Дульбекко с рН примерно 7,4, содержащий приблизительно 1-25 мг/мл человеческого альбумина сыворотки, (2) 0,9% физиологический раствор (0,9% масса/объем NaCl), (3) 5% (масса/объем) раствор декстрозы и (4) 10 мМ раствора гистидина сульфата, рН 5,8, 6% сахарозы, 0,02% полисорбата-20.

В случае водной формы, а не лиофилизата, антитело или конъюгат, как правило, присутствуют в концентрации примерно 0,1 мг/мл - 100 мг/мл, хотя допускается значительное отклонение от этого интервала. При лечении заболевания нужная доза антитела или его фрагмента, или конъюгата будет зависеть от типа заболевания, как определено выше, от тяжести и течения заболевания, от того, вводятся ли антитела или конъюгаты в профилактических или терапевтических целях, от предыдущего терапевтического курса, анамнеза пациента и ответа на лечение, а также от суждений лечащего врача. Антитело, фрагмент или конъюгат могут вводиться одномоментно или в виде серии.

В зависимости от типа и тяжести заболевания начальная доза может составлять приблизительно 0,015-25 мг антитела или конъюгата на кг веса пациента в виде однократного или большего количества раздельных введений либо в виде длительного переливания. При повторных введениях в течение нескольких дней и более, в зависимости от состояния, терапию повторяют до достижения желаемого подавления симптомов заболевания. Тем не менее, не исключаются другие терапевтические режимы, которые тоже могут быть пригодными для использования.

Для введения в легкие по меньшей мере одно антитело против CD20, его фрагмент или конъюгат в композиции доставляются в частицах с размером, способным достичь нижних дыхательных путей легких или синусов. В соответствии с изобретением по меньшей мере одно антитело против CD20, его фрагмент или конъюгат в композиции может доставляться любым из множества способов ингаляции и назальных приспособлений, известных в данной области техники и предназначенных для введения терапевтического агента ингаляцией. Данные устройства, способные доставлять аэрозольные композиции в синусы или альвеолы пациентов, включают дозированные ингаляторы, небулайзеры, порошковые ингаляторы, распылители и т.п. В данной области техники известны и другие устройства для направленного легочного или назального введения антител. Все подобные устройства могут использовать композиции, подходящие для введения антител в виде аэрозоля. Такие аэрозоли могут быть либо растворами (как водными, так и неводными), либо состоять из твердых частиц. В дозированных ингаляторах, например, дозированных ингаляторах Ventolin™, как правило, используется пропеллент, а во время вдоха требуется сделать нажатие на ингалятор (см., к примеру, WO 94/16970, WO 98/35888). В порошковых ингаляторах Turbuhaler™ (Astra), Rotahaler™ (Glaxo), Diskus™ (Glaxo), ингаляторе Spiros™ (Dura), устройствах производства Inhale Therapeutics, в порошковом ингаляторе Spinhaler™ (Fisons) используется вдыхание смешанного порошка при нажатии на ингалятор (Патент США № 4668218 Astra, ЕР 237507 Astra, WO 97/25086 Glaxo, WO 94/08552 Dura, Патент США № 5458135 Inhale, WO 94/06498 Fisons, включенные в настоящую заявку в полном объеме путем ссылки). Небулайзеры, как AERxTM Aradigin, небулайзер UltraventTM (Mallinckrodt), небулайзер Acorn IITM (Marquest Medical Products) (Патент США № 5404871 Aradigm, WO 97/22376), перечисленные ссылки включены в настоящую заявку путем ссылки, продуцируют аэрозоли из растворов, в то время как дозированные ингаляторы, порошковые ингаляторы и т.п., образуют аэрозоли с малыми частицами. Данные специфические примеры доступных в продаже ингалирующих устройств представляют репрезентативную выборку специфических устройств, подходящих для использования по настоящему изобретению и не ограничивают охват изобретения. Предпочтительно композиция, содержащая по меньшей мере одно антитело против CD20 или его фрагмент, или конъюгат, доставляется порошковым ингалятором или распылителем. Ингалирующие устройства обладают рядом характеристик, выгодных для введения по меньшей мере одного антитела по настоящему изобретению. К примеру, доставка при помощи ингалирующего устройства надежна, воспроизводима, точна. Ингалирующее устройство, необязательно, может доставлять малые сухие частицы, например, менее 10 мкм, предпочтительно 1-5 мкм, для хорошей вдыхаемости.

Для абсорбции через слизистые поверхности композиции и способы введения по меньшей мере одного антитела против CD20 или фрагмента, или конъюгата включают эмульсию, содержащую множество субмикронных частиц, мукоадгезивную макромолекулу, биоактивный пептид, водную непрерывную фазу, которые ускоряют абсорбцию через слизистую поверхность, делая возможным мукоадгезию частиц эмульсии (Патент США № 5514670). Слизистые поверхности, подходящие для введения эмульсий по настоящему изобретению, могут включать корнеальный, конъюктивальный, буккальный, сублингвальный, назальный, вагинальный, легочный, желудочный, кишечный, ректальный пути введения. Составы для вагинального или ректального введения, например суппозитории, могут содержать вспомогательные вещества, например, полиалкиленгликоли, вазелин, какао-масло и т.п. Составы для интраназального введения могут быть твердыми и содержать в качестве вспомогательных веществ, к примеру, лактозу, либо могут являться водными или масляными каплями в нос. Для буккального введения в качестве вспомогательных веществ могут использоваться сахара, кальция стеарат, магния стеарат, прежелатированный крахмал и т.п. (патент США № 5849695).

Для трансдермального введения по меньшей мере одно антитело против CD20 или конъюгат инкапсулированы в средстве доставки, например, липосомных или полимерных наночастицах, микрочастице, микрокапсуле, микросферах (совокупно называемых микрочастицами, если не определено иное). Имеется некоторое количество подходящих средств, включая микрочастицы, изготовленные из синтетических =полимеров, например, полигидроксикислот, например, полимолочной кислоты, полигликолевой и их кополимеров, полиортоэфиров, полиангидридов, полифосфазенов, натуральных полимеров типа коллагена, полиаминокислот, альбумина и других белков, альгината и других полисахаридов, а также их комбинаций (патент США № 5814599).

Все публикации или патенты, упомянутые здесь, включены сюда во всей полноте путем ссылки и являются наглядным свидетельством текущего уровня техники. К публикациям относятся любые научные или патентные публикации, а также любая другая информация, доступная на любых носителях, включая все форматы записи, электронные и печатные форматы. Следующие источники включены в настоящую заявку во всей полноте путем ссылки: Ausubel, et al., ed. Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, N.Y. (1987-2001); Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd Edition, Cold Spring Harbor, N.Y. (1989); Harlow and Lane, antibodies, a Laboratory Manual, Cold Spring Harbor, N.Y. (1989); Colligan, et al., eds. Current Protocols in Immunology, John Wiley & Sons, Inc., N.Y. (1994-2001); Colligan et al., Current Protocols in Protein Science, John Wiley & Sons, NY, N.Y., (1997-2001), особенно содержимое, относящееся к изготовлению антител против CD20, фрагментов, конъюгатов, агентов, композиций и т.п., как описано здесь. Специалисту в данной области техники очевидно, что различные ссылки на антитела и их фрагменты также касаются, к примеру, и конъюгатов, не отступая от их сущности и охвата. После представленного общего описания изобретения то же самое будет далее пониматься посредством ссылки на определенные специфические примеры, которые включены в настоящую заявку для целей иллюстрирования и не ограничивают ее, если не указано иное.

Примеры

Клеточные линии были выращены в подходящей среде, например, среде RPMI-1640, с добавкой 10% фетальной бычьей сыворотки, 2 мМ глутамина и 1% пенициллин-стрептомицина (все реактивы от Invitrogen) при 37°С в инкубаторе с увлажненным 5% CO2, если не указано иное. Клетки были пассированы разбавлением в свежую среду два раза в неделю, их численность поддерживали на уровне 0,2-1×106 клеток/мл.

Пример 1

Получение мышиных антител против CD20

Была сконструирована плазмида экспрессии pSRa-CD20, содержащая целую кодирующую последовательность CD20 (CDS), фланкированную сайтами рестрикции Xbal и BamHI, позволяющими экспрессию человеческого CD20 (GI 23110989). Клетки 300-19 - пре-В-клеточная линия, полученная от мышей Balb/c (Rethet al., Nature, 317:353-355 (1985)), - были подвергнуты трансфекции данной плазмидой экспрессии для стабильного экспрессирования высоких уровней человеческого CD20 на клеточной поверхности и использовались для иммунизации мышей Balb/c VAF. Мыши были иммунизированы подкожно - примерно 5×106 CD20-экспрессирующих клеток 300-19 на мышь каждые 2-3 недели согласно стандартным протоколам иммунизации, известным в данной области техники, например, таким, которые используются в ImmunoGen, Inc. Иммунизированные мыши были подвергнуты бустингу антигеном за три дня до умерщвления для получения гибридомы. Селезенки мышей были собраны согласно стандартным протоколам по работе с животными, например, они были перетерты между двумя стерильными замороженными микроскопными стеклами до получения раздельноклеточной суспензии в среде RPMI-1640. Клетки селезенки были центрифугированы, осадок был отделен, промыт и соединен с клетками миеломы мыши, например, P3X63Ag8.653 (Kearney et al., J. Immunol., 123:1548-1550 (1979)) с использованием полиэтиленгликоля-1500 (Roche 783 641). Слитые клетки были ресуспендированы в селекционной среде RPMI-1640, содержащей гипоксантин-аминоптерин-тимидин (HAT) (Sigma Н-0262), и селектированы по росту в 96-луночных культуральных планшетах с плоским дном (Coming-Costar 3596, 200 мкл клеточной суспензии на лунку) при 37°С с 5% CO2. Спустя 5 дней инкубации 100 мкл супернатанта культуры были извлечены из каждой лунки и заменены на 100 мкл среды RPMI-1640, содержащей добавку гипоксантина-тимидина (НТ) (Sigma H-0137). Инкубирование при 37°С с 5% CO2 продолжалось до тех пор, пока клоны гибридомы не были готовы для скрининга антител. Также могут использоваться иные методики иммунизации и получения антител, включая те, которые описаны у Langone et al. (Eds., "Immunochemical Techniques, Part I", Methods in Enzymology, Academic Press, volume 121, Florida) и Harlow et al. ("Antibodies: A Laboratory Manual"; Cold Spring Harbor Laboratory Press, New York (1988)).

Скрининг и селекция гибридом

Супернатанты культур гибридомы были подвергнуты скринингу способом проточной цитометрии на предмет секреции мышиных моноклональных антител, связывающихся с CD20-экспрессирующими клетками, например, CD20-экспрессирующими клетками 300-19, но не с нетрансфицированными клетками 300-19. 100 мкл супернатанта гибридомы было инкубировано 3 ч либо с CD20-экспрессирующими клетками 300-19, либо с нетрансфицированными клетками 300-19 (1×105 клеток в образце) в 100 мкл буфера FACS (среда RPMI-1640 с добавкой 2% нормальной козьей сыворотки). Затем клетки были центрифугированы, осаждены, промыты и инкубированы 1 ч с 100 мкл РЕ-конъюгированных козьих анти-мышиных IgG-антител (например, доступны в продаже у Jackson Laboratory, 6 мкг/мл в буфере FACS). Клетки были центрифугированы, вновь осаждены, промыты буфером FACS и ресуспендированы в 200 мкл фосфатно-солевого буфера, содержащего 1% формальдегид. Клетки были собраны при помощи проточного цитометра FACSCalibur с многолуночным самплером HTS или при помощи матричного проточного цитометра FACS и проанализированы при помощи CellQuest Pro (все оборудование от BD Biosciences, Сан-Диего, США).

Клоны, положительные по гибридоме, были субклонированы ограниченным разведением. Один субклон каждой гибридомы, обладавший такой же реактивностью против CD20, как и родительские клетки согласно проточной цитометрии, был выбран для последующего анализа. Стабильные субклоны были культивированы, изотип каждого секретируемого антитела против CD20 определялся при помощи изотипирующих реагентов, доступных в продаже (Roche 1493027).

Выделение антител

Антитела были выделены из субклоновых супернатантов гибридомы с использованием стандартных способов, например, хроматографии с протеином А или G (HiTrap Белок А или G HP, 1 мл, Amersham Biosciences). Вкратце, супернатант был подготовлен для хроматографии путем добавления 1/10 объема 1 М Трис/HCl буфера, рН 8,0. рН-скорректированный супернатант был профильтрован через фильтровальную мембрану 0,22 мкм и загружен в колонку, уравновешенную связывающим буфером (фосфатно-солевой буфер, рН 7,3). Колонка была промыта связывающим буфером до достижения стабильного уровня фона без абсорбции на 280 нм. Антитела были элюированы 0,1 М буфером с уксусной кислотой, содержащим 0,15 М NaCl, рН 2,8, при скорости потока 0,5 мл/мин. Фракции объемом приблизительно 0,25 мл были собраны и нейтрализованы путем добавления 1/10 объема 1М Трис/HCl, рН 8,0. Пиковая(ые) фракция(и) была диализирована в течение ночи дважды относительно 1x фосфатно-солевого буфера и стерилизована фильтрованием через 0,2 мкм фильтровальную мембрану. Количество антител определяли, судя по абсорбции на А280.

Фракции, очищенные с протеином А, были потом доочищены способами ионообменной хроматографии (IEX) и хроматографии с четвертичным аммонием (Q) для мышиных антител. Вкратце, образцы, очищенные с протеином А были обменены в связывающем буфере (10 мМ Трис, 10 мМ натрия хлорида, рН 8,0) и профильтрованы через фильтр калибра 0,22 мкм. Подготовленный образец был затем загружен на смолу Q (GE Lifesciences), уравновешенную со связывающим буфером на потоке 120 см/ч. Размер колонки подбирался таким образом, чтобы связывать все моноклональные антитела в образце. Затем колонка была промыта связывающим буфером до достижения стабильного уровня фона без абсорбции на 280 нм. Антитела элюировали градиентом от 10 мМ до 500 мМ натрия хлорида в количестве 20 объемов колонки (ОК). Пиковые фракции собирали, основываясь на измерениях абсорбции на 280 нм (А280). Процентное количество мономера оценивалось эксклюзионной хроматографией (SEC) на геле TSK G3000SWXL в колонке 7,8х300 мм с предохранительной колонкой SWXL, 6,0×40 мм (Tosoh Bioscience, Монтгомеривилль, Пенсильвания) с использованием ВЭЖХ-системы Agilent HPLC 1100 (Agilent, Санта-Клара, Калифорния). Фракции с содержанием мономера выше 95% были объединены, буфер был заменен на фосфатно-солевой буфер (рН 7,4), используя систему TFF, а затем стерилизованы фильтрованием через фильтр с мембраной 0,2 мкм. Содержание IgG в очищенных антителах определяли измерением абсорбции на А280 с коэффициентом затухания 1,47. Для доочистки антител также, с хорошей селективностью, применились альтернативные способы, например, очистка с керамическим гидроксиапатитом (СНТ). Смола СНТ II типа с размером частиц 40 мкм (Bio-Rad Laboratories) использовалась по методикам, аналогичным тем, которые описаны для ионообменной хроматографии. Связывающий буфер для СНТ содержит 20 мМ натрия фосфата, имеет рН 7,0, а антитела элюировали градиентом 20-160 мМ натрия фосфата количеством в 20 ОК.

Пример 2

Определение характеристик связывания способом проточной цитометрии

Специфичность связывания определялась способом проточной цитометрии с использованием очищенных антител. Диаграммы FACS, демонстрирующие связывание muCD20-7 и muCD20-6 с CD20-экспрессирующими клетками 300-19 в отсутствие связывания с родительскими клетками 300-19, показаны на Фигуре 1. Либо антитело muCD20-7, либо muCD20-6 было инкубировано 3 ч либо CD20- экспрессирующими клетками 300-19, либо с нетрансфицированными клетками 300-19 (1×105 клеток в образце) в 100 мкл буфера FACS (среда RPMI-1640 с добавкой 2% нормальной козьей сыворотки). Затем клетки были осаждены, промыты и инкубированы 1 ч с 100 мкл FITC-конъюгированных козьих анти-мышиных IgG-антител (например, доступны в продаже у Jackson Laboratory, 6 мкг/мл в буфере FACS). Клетки были вновь осаждены, промыты буфером FACS и ресуспендированы в 200 мкл фосфатно-солевого буфера, содержащего 1% формальдегида. Образцы были собраны при помощи проточного цитометра FACSCalibur с многолуночным самплером HTS или при помощи матричного проточного цитометра FACS и проанализированы при помощи CellQuest Pro (все оборудование от BD Biosciences, Сан-Диего, США).

FACS-диаграммы CD20- экспрессирующих клеток 300-19, инкубированных с muCD20-7 или muCD20-6, показали сдвиг флуоресценции, а родительские клетки 300-19 его не показали (Фигура 1). Также не наблюдалось существенного сдвига флуоресценции при инкубировании любой из этих клеточных линий только с FITC-конъюгированным козьим анти-мышиным IgG-антителом (Фигура 1, внизу).

Сдвиг флуоресценции также наблюдался при инкубировании клеток лимфомы BJAB с muCD20-7 или muCD20-6 (Фигура 2). Клетки BJAB были инкубированы с различными концентрациями антител muCD20-7 или muCD20-6 и обработаны так, как описано выше для анализа способом проточной цитометрии. Анализ данных проводился с использованием CellQuest Pro (BD Biosciences, Сан-Диего, США), для каждого образца снималась средняя интенсивность флуоресценции для FL1 (MFI), после чего строился полулогарифмический график ее зависимости от концентрации антитела. Кривая зависимости эффекта от дозы была построена нелинейной регрессией, величины кажущейся константы диссоциации (Kd) muCD20-7 или muCD20-6 при связывании с клетками BJAB были рассчитаны при помощи GraphPad Prism v4 (GraphPad software, Сан-Диего, Калифорния) и равнялись 0,3 нМ или 0,4 нМ, соответственно.

Пример 3

Проапоптозная активность мышиных антител против CD20

Антитела против CD20 muCD20-2, muCD20-6 и muCD20-7 индуцировали апоптоз клеточных линий лимфомы. Степень апоптоза измерялась проточной цитометрией после окрашивания FITC-конъюгатами Аннексина-V (Invitrogen) и TO-PRO®-3 (Invitrogen). В нормальных здоровых клетках фосфатидилсерин находится на внутренней стороне мембранного бислоя, переход фосфатидилсерина из внутреннего в наружный слой плазматической мембраны - один из самых ранних детектируемых сигналов апопотоза. Аннексин-V связывает фосфатидилсерин наружного слоя, но не внутреннего слоя мембраны целых клеток. Таким образом, степень связывания Аннексина-V - показатель индукции апоптоза. TO-PRO®-3 - мономерный цианиновый краситель для нуклеиновых кислот, который может проникать через плазматическую мембрану только при нарушении ее целостности, что происходит на поздних стадиях апоптоза. На двухцветной проточной цитометрии различимы три популяции клеток: неапоптозные клетки (Аннексин-V отрицательные и TO-PRO®-3 отрицательные), клетки на ранней стадии апоптоза (Аннексин-V положительные и TO-PRO®-3 отрицательные) и некротические клетки, или клетки на поздней стадии апоптоза (Аннексин-V положительные и TO-PRO®-3 положительные).

Экспоненциально растущие клетки были высеяны по примерно 2×105 клеток/мл на 24-луночные планшеты в среду RMPI-1640 с добавками 10% фетальной телячьей сыворотки (FBS), 2 мМ L-глутамина и 50 мкг/мл гентамицина (далее называемую полной средой RMPI-1640). Клетки выращивались в полной среде RMPI-1640, если не указано иное. Клетки были инкубированы с 10 нМ антител против CD20 20-24 ч при 37°С в инкубаторе с увлажненным 5% CO2. Затем клетки были осаждены, дважды промыты 500 мкл фосфатно-солевого буфера, ресуспендированы в 100 мкл связывающего буфера (10 мМ Hepes-NaOH, pH 7,4, 140 мМ NaCl, 2,5 мМ CaCl2) и окрашены 5 мкл Аннексин-V-FITC в течение 15 минут на льду. Затем к смеси было добавлено 400 мкл связывающего буфера и 1 мкМ TO-PRO®-3, сразу же после этого была измерена клеточно-ассоциированная флуоресценция FITC и TO-PRO®-3 способом проточной цитометрии. Для каждого образца собирались пять тысяч наблюдений. При помощи ПО BD CellQuest были построены точечные графики флуоресценции TO-PRO®-3 (FL4-H; ось у) и флуоресценции Аннексина-V-FITC (FL1-H; ось x).

Процентное содержание Аннексин-V положительных клеток (включая TO-PRO®-3 положительные и отрицательные клетки) определялось для каждого образца, исходя из данных графиков и представленных на Фигуре 3. Ряд антител, выделенных при скрининге антител, был проверен на проапоптозную активность в сравнении с ритуксимабом. Примечательно, что muCD20-2, muCD20-6 и muCD20-7 проявляли очень сильную проапоптозную активность. Более 70 % клеток Ramos, подвергнутых воздействию muCD20-6, muCD20-7 или muCD20-2 были Аннексин-V положительными в сравнении с только около 5 % необработанных клеток. Обработка антитела против CD20 ритуксимабом приводила лишь к 13% Аннексин-V положительных клеток. Аналогично обработка антителом muCD20-5 дала 12% Аннексин-V положительных клеток.

Аналогично более 60 % клеток Raji, подвергнутых воздействию muCD20-7 или muCD20-2, были Аннексин-V положительными в сравнении с только около 5% необработанных клеток. Данная неожиданная активность даже более выражена, чем у В 1 - ранее выделенного антитела II типа, дающего 42% Аннексин-V положительных клеток. Инкубирование с ритуксимабом давало 14% Аннексин-V положительных клеток. Антитело muCD20-5 не индуцировало большего процентного количества Аннексин-V положительных клеток в сравнении с необработанными клетками.

Пример 4

Липидные рафты

Перераспределение CD20 в липидные рафты после связывания с антителом коррелирует со способностью антитела активировать факторы комплемента и проявлять КЗЦ-активность. Для определения индуцированного антителами перераспределения CD20 в липидные рафты исследователи применяли способ, основанный на проточной цитометрии, разработанный на основе Cragg et al. (2003), выше). Данный способ основывается на нерастворимости TritonX-100 в компартментах липидных рафтов при низких температурах.

Клетки были собраны центрифугированием, промыты и ресуспендированы в RPMI-1640 с 1% бычьего сывороточного альбумином. 0,2 мл клеточной взвеси с 2,5×106 клеток использовалось в каждом анализе в двух повторениях. Антитела против CD20 добавляли до уровня 10 мкг/мл, а образцы инкубировали 15 минут при 37°С. Образцы были центрифугированы, дважды промыты и ресуспендированы в 0,2 мл буфера FACS (1x фосфатно-солевого буфера, 1% альбумина бычьей сыворотки, 20 мМ азида натрия). Образцы были охлаждены на льду и с этого момента сохранялись в охлажденном состоянии. Для определения фракции антигена, ассоциированного с липидными рафтами в ответ на обработку антителом, образцы были инкубированы с 0,5% TritonX-100 15 минут на льду. Для определения общего количества присоединенного антитела образцы оставляли на 15 минут на льду без каких-либо добавок. Образцы дважды промывали буфером FACS и окрашивали в течение 1 часа на льду FITC-спаренным козьим антимышиным антителом, разбавленным до 1:200. Образцы были центрифугированы, два раза промыты буфером FACS и ресуспендированы в 200 мкл фосфатно-солевого буфера, содержащего 1% формальдегид для фиксации. Образцы были подвергнуты проточной цитометрии для определения связывания антител против CD20 в виде средней величины FL-1. Для каждого образца строили среднюю интенсивность флуоресценции (MFI) в отсутствие (без обработки) и в присутствии (с обработкой Triton) TritonX-100-инкубирования, см. Фигуру 4.

В качестве контроля использовали ритуксимаб - антитело I типа, которое, как ранее было показано, эффективно перемещает CD20 в TritonX-100-нерастворимые липидные рафты. Как и ожидалось, ритуксимаб-обработанные клетки проявляли одинаковую флуоресценцию с обработкой TritonX-100 и без таковой. Наоборот, MFI клеток, окрашенных muCD20-2, была гораздо ниже при обработке TritonX-100, чем без нее. Это согласуется с неспособностью muCD20-2 перераспределять CD20 в липидные рафты, что характерно для описанных ранее антител против CD20 II типа. Примечательно, что MFI клеток, окрашенных muCD20-7, была одинакова при обработке TritonX-100 и без таковой. Помимо этого, была проверена активность антител muCD20-5 и muCD20-6 на перемещение в липидные рафты. Как наблюдалось для muCD20-7, MFI клеток, окрашенных muCD20-5 или muCD20-6, была одинакова при обработке TritonX-100 и без таковой. Эти данные показывают, что muCD20-5, muCD20-6 и muCD20-7, подобно ритуксимабу, могут эффективно перемещать CD20 в компартменты липидных рафтов мембран клеток лимфомы. Учитывая результаты анализов с Аннексином-V, это показывает, что muCD20-2 обладает характеристиками антитела II типа. Оно может выражено индуцировать апоптоз, но не может перераспределять CD20 в липидные рафты.

Наоборот, muCD20-5 обладает характеристиками антитела I типа. Оно может перераспределять CD20 в липидные рафты, но не обладает проапоптозной активностью.

Этот неожиданный результат показывает, что muCD20-6 и muCD20-7 обладают уникальной неожиданной комбинацией функциональных характеристик: они обладают как активностью по отношению к липидным рафтам, свойственной для антител I типа, так и выраженной проапоптозной активностью, характерной для антител II типа.

Пример 5

Клонирование и секвенирование VL и VH областей CD20-7 и CD20-6 антител

Тотальная клеточная РНК была приготовлена из 5×106 клеток CD20-7 и CD20-6 гибридомы с использованием набора RNeasy (QIAgen) согласно рекомендациям производителя. кДНК затем была синтезирована из тотальной РНК с использованием набора для синтеза кДНК Superscript II (Invitrogen).

Процедура первого этапа ПЦР с вырожденными праймерами на кДНК, происходящей из клеток гибридомы, основывалась на способах, описанных Wang et al. ((2000) J Immunol Methods. Jan 13; 233(1-2):167-77) и Co et al. ((1992) J Immunol. Feb 15; 148(4): 1149-54). VH-последовательности были амплифицированы ПЦР с использованием следующих вырожденных праймеров: ЕсоМН1 CTTCCGGAATTCSARGTNMAGCTGSAGSAGTC (SEQ ID NO: 37), EcoMH2 CTTCCGGAATTCSARGTNMAGCTGSAGSAGTCWGG (SEQ ID NO: 48) и BamIgGI GGAGGATCCATAGACAGATGGGGGTGTCGTTTTGGC (SEQ ID NO: 38). VL-последовательности были амплифицированы ПЦР с использованием следующих вырожденных праймеров: SacIMK GGAGCTCGAYATTGTGMTSACMCARWCTMCA (SEQ ID NO: 39) и HindKL TATAGAGCTCAAGCTTGGATGGTGGGAAGATGGATACAGTTGGTGC (SEQ ID NO: 40). (Смешанные основания обозначаются следующим образом: N=G+A+T+C, S=G+C, Y=C+T, M=A+C, R=A+G, W-A+T).

ПЦР-реакционные смеси были затем выдержаны на 1% легкоплавком агарозном геле, цепочки с 300-400 парами оснований были вырезаны, выделены с использованием мини колонок Zymo DNA, а затем направлены в Agencourt Biosciences для секвенирования. Соответствующие 5′ и 3′ ПЦР-праймеры использовались как секвенирующие праймеры для получения вариабельной области кДНК с обоих направлений. Аминокислотные последовательности VH и VL областей были выведены из результатов ДНК-секвенирования.

Предварительные последовательности кДНК использовались для поиска по сайту NCBI IgBlast (www.ncbi.nlm.nih.gov/igblast/) для выявления зародышевых мышиных последовательностей, от которых происходили антитела. Затем были разработаны ПЦР-праймеры для отжига с зародышевой лидерной последовательностью мышиного антитела таким образом, чтобы новая ПЦР-реакция давала полную вариабельную область последовательности кДНК, не измененную ПЦР-праймерами. Помимо этого, для секвенирования полной последовательности вариабельной области тяжелой цепи CD20-7 применялся способ ПЦР с быстрой амплификацией концов кДНК согласно Со et al., выше. ПЦР-реакции, зональная очистка и секвенирование проводились так, как описано выше.

Определение массы для подтверждения последовательности

Информация о последовательности кДНК для вариабельной области комбинировалась с зародышевой последовательностью константной области для того, чтобы получить полные последовательности кДНК антител. Затем рассчитывались молекулярные массы легкой и тяжелой цепей, которые затем сравнивались с молекулярными массами мышиных антител CD20-7 и CD20-6 по данным ЖХ/МС. Измерения молекулярных масс согласовывались с последовательностями кДНК для тяжелой и легкой цепей CD20-7 и CD20-6.

Химеризация

Вариабельную последовательность вариабельной области легкой цепи клонируют в сайты EcoRI и BsWI плазмиды pchCD20-7LCZ. Вариабельную область тяжелой цепи клонируют в сайты HindIII и Apa1 плазмиды pchCD20-7HCN. Эквивалентные плазмиды были сконструированы для chCD20-2, chCD20-9. Данные плазмиды использовались для экспрессирования химерных антител в клетках НЕК-293Т с использованием стандартной кальций-фосфатной процедуры (BD Biosciences, CalPhos Mammalian Transfection Kit, Cat № 631312). Супернатант был очищен по стандартным процедурам хроматографии с протеином А таким образом, как это описано выше, с этапом доочистки, проводившимся с использованием карбоксиметильной (СМ) смолы для ионного обмена на быстром потоке (IEX) (GE Lifesciences) и связывающего буфера с 10 мМ калия фосфата и 10 мМ натрия хлорида (рН 7,5), либо с альтернативными способами хроматографии, описанными выше.

Пример 6

Проапоптозная активность химерного CD20-7

Способность химерных антител индуцировать апоптоз клеток Ramos была определена при помощи Аннексин-V-FITC и TO-PRO®-3 окрашивания, как это описано для мышиных антител в примере выше. 10 нМ каждого химерного антитела инкубировали с клетками Ramos 20 ч с последующим окрашиванием Аннексином-V и анализом способом проточной цитометрии, результаты представлены на Фигуре 5. При обработке chCD20-7 наблюдалось 59% Аннексин-V положительных клеток в сравнении лишь с 11% для необработанных образцов. При обработке chCD20-2 индуцировалось 43% Аннексин-V положительных клеток, в то время как при обработке ритуксимабом наблюдался примерно такой же уровень окрашивания Аннкесином-V, как и для необработанных клеток. Таким образом, после химеризации CD20-7 сохраняет выраженную способность индуцировать апоптоз клеток Ramos.

КЗЦ-активность химерного CD20-7

Для оценивания активности комплементзависимой цитотоксичности (КЗЦ) химерных антител против CD20 проводились клеточные анализы согласно опубликованному способу (Gazzano-Santoro, J. Immunol. Methods, 202(2):163-171)1997)). Антитела были аликвотированы в двух повторениях по 50 мкл/лунку в 96-луночный планшет культивирования тканей с плоским дном в различных концентрациях от 5 мкг/мл (=3,3× 10-8 М) до 2,3 нг/мл (= 1,5×10-11 М) в среде RHBP (RPMI-1640, 20 мМ HEPES, 0,1% альбумина бычьей сыворотки, 1% пенициллина-стрептомицина). Клетки-мишени были добавлены к антителам в количестве 5×104 клеток в 100 мкл среды RHBP на лунку. Лиофилизированный человеческий комплемент (Sigma-Aldrich, Сент-Луис, США) был восстановлен 1 мл стерильной очищенной воды на флакон и разбавлен в 5 раз до 20% базового раствора средой RHBP непосредственно перед использованием. В каждую лунку было добавлено 50 мкл/лунку раствора комплемента до получения конечной концентрации в 5%. Планшеты были инкубированы 2 ч при 37°С в инкубаторе с увлажненным 5% CO2 для комплементобусловленного лизиса. По истечении данного времени инкубирования в каждую лунку добавляли реактив Alamar Blue (Invitrogen) до конечной концентрации в 10% для измерения жизнеспособности оставшихся клеток. Планшет был инкубирован 16-20 часов при 37°С до измерения флуоресценции (в относительных единицах флуоресценции, RFU) на ЕХ540/ЕМ590 нм. Контроль включал лунки в трех повторениях со средой и комплементом, но без клеток (только среда, 0% жизнеспособность), и лунки с клетками и комплементом, но без антитела (только клетки, 100% жизнеспособность). Процентная специфическая клеточная жизнеспособность для каждого образца определялась по следующей формуле: Процентная жизнеспособность=(образец-только среда)/(только клетки-только среда).

Неожиданным было то, что антитело chCD20-7 обладало такой же КЗЦ-активностью, что и ритуксимаб против клеток лимфомы Daudi и WSU-DLCL-2, что продемонстрировано на Фигуре 6. chCD20-7 полностью уменьшало клеточную жизнеспособность в обеих клеточных линиях с ЕС50 1,0 нМ для клеток Daudi и 2,2 нМ для клеток WSU-DLCL-2. Ритуксимаб обладал КЗЦ-активностью с ЕС50 1,1 нМ для клеток Daudi и 2,8 нМ для клеток WSU-DLCL-2. Как и ожидалось для типичного антитела II типа, chCD20-2 не обладало КЗЦ-активностью против клеток Daudi или WSU-DLCL-2.

Пример 7

Гуманизация антител

Антитело CD20-7 было гуманизировано согласно способам перестраивания, описанным ранее, например, в Roguska et al., Proc. Natl. Acad. Sci., USA, 91(3):969-973 (1994) и Roguska et al., Protein Eng. 9(10):895-904 (1996), которые включены в настоящий документ во всей полноте путем ссылки. Перестраивание, как правило, включает идентификацию поверхностных остатков вариабельных областей легкой и тяжелой цепей и их замену на человеческие эквиваленты. Примерные CDR определены так, как показано в Таблице 1.

CDR легкой и тяжелой цепей CD20-7, как определено для перестраивания, приведены в качестве примера в Таблице 1. Определения Kabat тяжелой цепи CDR2 также приведены для мышиного и человеческого CD20-7. Подчеркнутые последовательности обозначают части Kabat тяжелой цепи CDR2, не рассматриваемые для перестраивания CDR.

Позиции поверхностных остатков понимались как позиции с относительной доступностью в 30% и выше (Pedersen et al., J. Mol. Biol., 235(3):959-973 (1994)). Поверхностные остатки выровнены с человеческими зародышевыми поверхностными позициями, чтобы идентифицировать наиболее гомологичную человеческую поверхностную последовательность. В случае CD20-7 для перестраивания VL и VH использовались человеческие зародышевые последовательности IGKV7-3*01 и IGHV3-15*04, соответственно. Как видно из перечня на Фигуре 7, все 4 поверхностных остатка в легкой цепи и 9 - в тяжелой были замещены на человеческие. Остаток S28 тяжелой цепи находится в тесной близости с CDR-H1, поэтому его замена на человеческий Т28 могла привести к уменьшению связывающей способности, поэтому была получена вторая перестроенная версия с сохраненным мышиным остатком S28. На Фигуре 8 показано выравнивание перестроенных последовательностей вариабельных доменов легкой и тяжелой цепей CD20-7 с их мышиными эквивалентами.

Рекомбинантная экспрессия антитела huCD20-7

Последовательности вариабельных областей huCD20-7 были кодон-оптимизированы и синтезированы Blue Heron Biotechnology. Последовательности фланкированы сайтами ферментативной рестрикции для клонирования внутри рамки считывания с соответствующими константными последовательностями в одноцепочечных плазмидах экспрессии млекопитающих. Вариабельную область легкой цепи клонируют в сайты EcoRI и BsiWI плазмиды phCD20-7LCZ. Вариабельную область тяжелой цепи клонируют в сайты HindIII и Ара1 плазмиды phCD20-7HCN. Данные плазмиды могут использоваться для экспрессирования huCD20-7 как с временной, так и с постоянной трансфекцией клеток млекопитающих. Временная трансфекция для экспрессирования huCD20-7 клетками HEK-293Т проводилась с использованием модифицированной процедуры PEI (Durocher, Y. et al., Nucleic Acids Res. 30(2):E9 (2002)). Супернатант был очищен на Протеине А с последующей доочисткой хроматографией с использованием стандартных процедур, описанных выше для химерных антител.

Экспрессия референтных антител

Для сравнения активности huCD20-7 были клонированы и экспрессированы ранее идентифицированные антитела против CD20. Аминокислотная последовательность вариабельных областей НС и LC антитела 2F2 (офатумумаб) была взята из WO 2004/035607 (Teeling et al. (2004), выше) с использованием SEQ ID NO: 2 из WO 2004/035607 для вариабельной области НС и SEQ ID NO:4 из WO 2004/035607 для вариабельной области LC. Аналогично аминокислотная последовательность вариабельных областей НС и LC антитела GA101 (основной компонент афутузумаба) была взята из WO 2005/0448959 (Umana, патент США № 5639641 (2005)). SEQ ID NO: 40 из WO 2005/0448959, соответствующая описанной конструкции B-HH6, использовалась для вариабельной области НС, a SEQ ID 76 из WO 2005/0448959, соответствующая описанной конструкции B-KV1, использовалась для вариабельной области LC.

Последовательности вариабельных областей обоих антител были кодон-оптимизированы и синтезированы Blue Heron Biotechnology. Последовательности фланкированы сайтами ферментативной рестрикции для клонирования внутри рамки считывания с соответствующими константными последовательностями в одноцепочечных плазмидах экспрессии млекопитающих. Клонирование, экспрессирование и очистка проводились так же, как описано для huCD20-7 выше. Полученное антитело GA101-F обладает типичным фукозилированием константной области и, таким образом, не является дефукозилированной версией, использующейся в афутузумабе.

Пример 8

Связывающая способность huCD20-7

Были проведены тесты связывания способом проточной цитометрии с использованием клеток BJAB и антител muCD20-7, chCD20-7 или huCD20-7, результаты были проанализированы так, как описано в Примере 2. На Фигуре 9 представлены кривые доза-ответ, полученные при использовании нелинейной регрессии для каждого антитела. Величина кажущейся константы диссоциации (Kd) каждого антитела была рассчитана при помощи GraphPad Prism v4 (GraphPad software, Сан-Диего, Калифорния). Химеризация и гуманизация не влияли на связывающую способность CD20-7, поскольку Kd muCD20-7, chCD20-7 и huCD20-7 была равна 0,4 нМ, 0,5 нМ и 0,5 нМ, соответственно.

Определение связывания при помощи ИФА

Для измерения связывающей способности при помощи ИФА были получены сырые лизаты клеток WSU-DLCL-2 (в качестве источника антигена CD20). Клетки WSU-DLCL-2 были выращены в роллерных флаконах на среде RPMI-1640 с добавкой 10% фетальной бычьей сыворотки, 2 мМ глутамина и 1% пенициллин-стрептомицина (все реактивы от Invitrogen) при 37°С в инкубаторе с увлажненным 5% CO2. Клетки были собраны центрифугированием, клеточный осадок был дважды промыт холодным 1х фосфатно-солевым буфером и лизирован в лизисном буфере (50 мМ Трис, рН 8, 150 мМ NaCl, 5 мМ ЭДТА, 1% NP-40, 0,25% натрия дезоксихолата, 25 мМ октилглюкозида). Для лизиса 1×107 собранных клеток использовалось 1 мл лизисного буфера. Клеточные лизаты были гомогенизированы десятикратным пропусканием через иглу 22 калибра, лизат вращали 45 минут при 4°С. Лизат был просветлен центрифугированием на 10000 г 45 минут при 4°С. Супернатант был профильтрован через фильтры 0,22 микрон, аликвотирован, мгновенно заморожен в жидком азоте и сохранялся при -80°С. Общая концентрация белка измерялась анализом ВСА (например, при помощи Micro BCA Protein Assay Kit, PIERCE, США).

Для ИФА препараты лизатов были разбавлены до уровня в 5 мкг/мл общего белка покрывающим буфером (15 мМ Na2CO3, 35 мМ NaHCO3, рН 9,6) и покрыты на планшеты Immulon 2HB по 100 мкл/лунку в течение 18-24 часов при 4°С. Затем планшеты были три раза промыты промывочным буфером (TBST: 0,1% Твин-20/TBS, рН 7,4) по 200 мкл/лунку. Планшеты были блокированы 200 мкл/лунку блокирующего буфера (1% казеин/TBS, рН 7,4) в течение 1 часа при комнатной температуре. Планшеты были промыты так, как описано ранее, затем последовательные разбавления антител были добавлены по 100 мкл/лунку. Планшеты были инкубированы в течение 3 часов при комнатной температуре и промыты так, как описано ранее. 1:5000 разбавление козьего анти-человеческого HRP в блокирующем буфере было добавлено в качестве вторичного антитела в количестве 100 мкл/лунку, далее растворы инкубировали 1 час при комнатной температуре. Планшеты были промыты так, как описано ранее, затем было добавлено по 100 мкл/лунку субстрата ТМВ1 (BioFX). Реакцию выдерживали 20 минут перед добавлением 100 мкл/лунку 450 нм стоп-реактива (BioFX). Измеряли абсорбцию на 450 нм, строили график ее зависимости от концентрации антитела для каждого образца. Сигмовидная кривая дозовой зависимости сопоставлялась с кривыми связывания при помощи GraphPad Prism v4 (GraphPad software, Сан-Диего, Калифорния). Величина кажущейся константы диссоциации (Kd) была рассчитана из кривой связывания для huCD20-7, представленной на Фигуре 10, и соответствовала 0,8 нМ.

Пример 9

Проапоптозная активность mu и huCD20-7

Проапоптозная активность huCD20-7 сравнивалась с активностью muCD20-7. Клетки Ramos были инкубированы с 10 нМ, 1 нМ или 0,1 нМ muCD20-7, huCD20-7 или антител изотипного контроля huIgG в течение 20 часов с последующими окрашиванием Аннексином-V-FITC и TO-PRO®-3 и проточной цитометрией. Процентное содержание Аннексин-V положительных клеток для каждого случая представлено на Фигуре 11. huCD20-7 сохраняло выраженную проапоптозную активность, свойственную muCD20-7. Приблизительно 60% клеток Ramos были Аннексин-V положительными после обработки 10 нМ любого антитела в сравнении с 6% клеток, обработанных изотопным контролем.

Проапоптозная активность huCD20-7

Проапоптозная активность huCD20-7 против клеток Ramos сравнивалась с активностью иных антител CD20. Ритуксимаб и 2F2 - антитела I типа с ранее описанной ограниченной проапоптозной активностью, GA101 и Bl - антитела II типа с установленной выраженной проапоптозной активностью. «Bl» соответствует немеченой форме Bexxar™ (Coulter); «GA101-F» соответствует фукозилированной версии афутузумаба или GA101 (Roche); «2F2» соответствует офатумумабу (Genmab). Различные количества каждого антитела были инкубированы с клетками Ramos в течение 20 часов с последующими окрашиванием Аннексином-V-FITC и TO-PRO®-3 и проточной цитометрией. Были построены полулогарифмические графики зависимости процентного количества Аннексин-V положительных клеток относительно концентрации антител (Фигура 12), на которых были построены кривые способом анализа нелинейной регрессии, с использованием которых были определены величины ЕС50. huCD20-7 обладало наиболее выраженным проапоптозным эффектом с максимальным процентным количеством Аннексин-V положительных клеток в 50% и ЕС50 0,2 нМ. Это антитело было даже более активно, чем В1, дающее 34% Аннексин-V положительных клеток с ЕС50 0,8 нМ. GA101-F было менее эффективно и давало 22% Аннексин-V положительных клеток с ЕС50 1,7 нМ. Ритуксимаб имел ограниченное влияние на апоптоз клеток Ramos и давал только 12% Аннексин-V положительных клеток с ЕС50 1,7 нМ. Как обработанные 2F2 образцы, так и не обработанные им образцы содержали 2% Аннексин-V положительных клеток, свидетельствуя о том, что 2F2 не индуцирует апоптоз у клеток Ramos. После вычитания величины необработанного контроля было получено, что huCD20-7 индуцировало 48% Аннексин-V положительных клеток в сравнении с 32% при В1, 20% при GA101-F и 10% при ритуксимабе.

Проапоптозная активность против панели клеточных линий

Проапоптозная активность huCD20-7 далее сравнивалась с активностью ритуксимаба и В 1 против расширенной панели клеточных линий. Каждая клеточная линия была инкубирована с 10 нМ или 1,5 мкг/мл huCD20-7 или ритуксимаба в течение 20 часов с последующими окрашиванием Аннексином-V-FITC и TO-PRO®-3 и проточной цитометрией. Процентное количество Аннексин-V положительных клеток было нанесено на график для каждого антитела и необработанных образцов, результаты представлены на Фигурах 13А-13Е. Антитело huCD20-7 было более активным, чем ритуксимаб и В1 на клеточных линиях Ramos и Raji. huCD20-7 индуцировало 60% Аннексин-V положительных клеток из клеток лимфомы Ramos в сравнении с 29% для В1, 9% для ритуксимаба и 6% для необработанных клеток. После вычитания величины необработанного контроля было получено, что huCD20-7 индуцировало 54% Аннексин-V положительных клеток Ramos в сравнении с 23% для В1 и 3% для ритуксимаба. huCD20-7 индуцировало 58% Аннексин-V положительных клеток из клеток лимфомы Raji в сравнении с 42% для В1, 14% для ритуксимаба и 5% для необработанных клеток. После вычитания величины необработанного контроля было получено, что huCD20-7 индуцировало 53% Аннексин-V положительных клеток Raji в сравнении с 37% для В1 и 9% для ритуксимаба. Помимо этого, huCD20-7 индуцировало 39% Аннексин-V положительных клеток из клеток WSU-DLCL-2 DLBCL в сравнении с 26% для ритуксимаба и 5% для необработанных клеток. После вычитания величины необработанного контроля было получено, что huCD20-7 индуцировало 34% Аннексин-V положительных клеток WSU-DLCL-2 DLBCL, а ритуксимаб - 21%. huCD20-7 индуцировало 20% Аннексии-V положительных клеток из клеток Jeko-1 MCL в сравнении с 9% для ритуксимаба и 8% для необработанных клеток. После вычитания величины необработанного контроля было получено, что huCD20-7 индуцировало 12% Annexin-VАнекс положительных клеток из клеток Jeko-1, а ритуксимаб - только 1%. Наконец, huCD20-7 индуцировало 58% Аннексин-V положительных клеток из клеток Granta-519 MCL в сравнении с 23% для ритуксимаба и 18% для необработанных клеток. После вычитания величины необработанного контроля было получено, что huCD20-7 индуцировало 40% Granta-519 положительных клеток, а ритуксимаб - только 5%.

Пример 10

Анализ липидных рафтов с использованием человеческих антител

Анализы липидных рафтов в клетках Ramos проводились для huCD20-7 так, как описано выше, осуществлялось сравнение с другими CD20-антителами. Ритуксимаб и 2F2 - антитела I типа с ранее описанной активностью по отношению к липидным рафтам, GA101-F и Bl - антитела II типа без активности по отношению к липидным рафтам и, как следствие, без КЗЦ-активности. Как и ожидалось, клетки, обработанные ритуксимабом и 2F2, проявляли одинаковую флуоресценцию с обработкой TritonX-100 и без таковой (Фигура 14). Наоборот, средняя флуоресценция клеток, окрашенных Bl или GA101-F, была гораздо ниже при обработке TritonX-100, чем без нее, что согласуется с их неспособностью перераспределять CD20 в липидные рафты. Примечательно, что средняя флуоресценция клеток, окрашенных huCD20-7, была одинакова при обработке TritonX-100 и без таковой. Таким образом, huCD20-7, подобно ритуксимабу и 2F2, может эффективно перемещать CD20 в компартменты липидных рафтов мембран В-клеток.

КЗЦ активность huCD20-7

КЗЦ-активность huCD20-7 в сравнении с ритуксимабом и GA101-F измерялась так, как это описано для химерных антител в примере 6. Неожиданным было то, что антитело huCD20-7 обладало такой же КЗЦ-активностью, что и ритуксимаб против клеток лимфомы Daudi, что продемонстрировано на Фигуре 15А. Обработка ритуксимабом или huCD20-7 полностью уменьшала жизнеспособность клеток Daudi с ЕС50 0,23 и 0,25 мкг/мл, соответственно. Как и ожидалось, GA101-F, являющееся типичным антителом II типа, не проявляло КЗЦ-активности против клеток Daudi. Аналогичные результаты наблюдались и для клеток лимфомы Ramos, что показано на Фигуре 15В. Обработка ритуксимабом или huCD20-7 полностью уменьшала жизнеспособность клеток Ramos с ЕС50 0,09 и 0,014 мкг/мл, соответственно. Как и ожидалось, GA101-F, являющееся типичным антителом II типа, обладало минимальной КЗЦ-активностью против клеток Ramos.

Помимо этого, huCD20-7 обладало большей КЗЦ-активностью, чем ритуксимаб, по отношению к клеткам лимфомы WSU-DLCL-2 и RL. Ритуксимаб уменьшал жизнеспособность клеток WSU-DLCL-2 до 34% при наивысшей концентрации с ЕС50 1,9 мкг/мл. В отличие от этого, huCD20-7 уменьшало жизнеспособность клеток WSU-DLCL-2 до 11% при наивысшей концентрации с ЕС50 0,58 мкг/мл (Фигура 16А). Ритуксимаб умеренно уменьшал жизнеспособность клеток RL до 56% при наивысшей концентрации с ЕС50 4,3 мкг/мл. В отличие от этого, huCD20-7 уменьшало жизнеспособность клеток RL более выражено - до 11% при наивысшей концентрации с ЕС50 0,67 мкг/мл (Фигура 16В).

Пример 11

АЗКЦ-активность huCD20-7

Анализ высвобождения лактатдегидрогеназы (LDH) использовался для измерения антителозависимой клеточноопосредованной цитотоксичности (АЗКЦ) линий опухолевых клеток с использованием свежевыделенных клеток-натуральных киллеров (НК) в качестве эффекторных клеток (например. Shields, J. Biol. Chem., 276(9):6591-6604 (2001)). НК-клетки были вначале выделены из человеческой крови здорового донора (Research Blood Components, Inc., Брайтон, Миннесота) по модифицированному протоколу, использующемуся для NK Isolation Kit II (Miltenyi Biotech, 130-091-152). Кровь была в два раза разбавлена 1х фосфатно-солевым буфером. 25 мл разбавленной крови было осторожно налито поверх 25 мл Ficoll Paque в 50 мл коническую пробирку и центрифугировано на 400 г 45 минут при комнатной температуре. Мононуклеарные клетки периферической крови (МКПК) были отобраны из границы раздела, перенесены в новую коническую пробирку вместимостью 50 мл и однократно промыты 1х фосфатно-солевым буфером. ПКМК были ресуспендированы в 2 мл НК-изолирующего буфера (1х фосфатно-солевого буфера, 0,5% альбумина бычьей сыворотки, 2 мМ ЭДТА), затем к клеточной суспензии было добавлено 500 мкл коктейля биотин-антитело. Коктейль биотин-антитело содержит биотинилированные антитела, связывающиеся с лимфоцитами, за исключением НК-клеток, что дает отрицательную селекцию НК-клеток. Смесь инкубировали при 4°С 10 минут, затем добавляли 1,5 мл НК-изолирующего буфера и 1 мл микрогранул Anti-Biotin Micro Beads. Смесь клеток и антител инкубировали еще 15 минут при 4°С. Затем клетки были один раз промыты 50 мл НК-изолирующего буфера и ресуспендированы в 3 мл НК-изолирующего буфера. Затем в сепаратор autoMACS (Miltenyi Biotech) была установлена колонка MACS LS, которую предварительно промыли 3 мл НК-изолирующего буфера. Клеточную суспензию автоматически вводили в колонку, промывали, выходящую фракцию с немечеными НК-клетками собирали в новую коническую пробирку вместимостью 50 мл. Полученные NK-клетки высеивали в 30 мл полной среды RPMI (RPMI-1640 с добавками 5% фетальной телячьей сыворотки, 1% пенициллина-стрептомицина, 1 мМ HEPES, 1 мМ натрия пирувата, 1% 100Х MEM раствора незаменимых аминокислот) и выдерживали в течение ночи. Последующие анализы и разбавления проводились в среде RHBP (RPMI-1640 с добавками 20 мМ HEPES, рН 7,4,0,1% альбумина бычьей сыворотки 1% пенициллина-стрептомицина).

Различные концентрации растворов антител в среде RHBP были аликвотированы в двух повторениях по 50 мкл/лунку в 96-луночный круглодонный планшет. Клетки-мишени были ресуспендированы по 106 клеток/мл в среде RHBP и добавлены по 100 мкл/лунку в каждую лунку с разведениями антител. Планшет с клетками-мишенями и разведениями антител инкубировали 30 минут при 37°С. Затем в лунки с клетками-мишенями добавляли НК-клетки по 50 мкл/лунку. Типичное соотношение составляло примерно 1 клетка-мишень на 3-4 НК-клетки. Для каждого эксперимента применялись следующие контроли: только НК-клетки, только клетки-мишени (спонтанное высвобождение LDH), клетки-мишени с НК-клетками (антитело-независимое высвобождение LDH), клетки-мишени с 10% TritonX-100 (максимальное высвобождение LDH). Смеси инкубировали при 37°С 4 ч для лизиса клеток. Планшеты центрифугировали 10 минут при 1200 об/мин, 100 мкл супернатанта осторожно переносили в новый 96-луночный плоскодонный планшет. В каждую лунку добавляли LDH-реакционную смесь (100 мкл/лунку) из набора Cytotoxicity Detection Kit (Roche 1 644 793), инкубировали при комнатной температуре 5-30 мин. Оптическую плотность образцов измеряли на 490 нм (OD490). Процентный специфический лизис каждого образца определяли по следующей формуле: процентный специфический лизис=(величина образца-спонтанное высвобождение)/(максимальное высвобождение-спонтанное высвобождение)* 100.

При инкубировании с huCD20-7 наблюдалась выраженная АЗКЦ-активность против клеток лимфомы Ramos и хронического лимфоцитарного лейкоза (ХЛЛ) JVM-13 в присутствии человеческих эффекторных НК-клеток. АЗКЦ-активность к клеткам лимфомы Ramos сравнивалась для huCD20-7, ритуксимаба, GA101-F и 2F2 (Фигура 17). При обработке huCD20-7 наблюдался лизис приблизительно 80% клеток Ramos, что сходно с активностью, наблюдавшейся у других антител CD20. АЗКЦ-активность huCD20-7 характеризовалась ЕС50 1,1 нг/мл, ритуксимаба - ЕС50 3,5 нг/мл, 2F2 - 1,2 нг/мл и GA101-F - 0,59 нг/мл. АЗКЦ-акгивность huCD20-7 к клеткам ХЛЛ JVM-13 сравнивалась с активностью ритуксимаба и 2F2. При обработке huCD20-7 наблюдался лизис примерно 40% клеток JVM-13, что сходно с активностью ритуксимаба или 2F2.

АЗКЦ-активность huCD20-7 характеризовалась ЕС50 0,23 нг/мл, ритуксимаба - ЕС50 0,29 нг/мл, 2F2 - 0,17 нг/мл.

Пример 12

Картирование эпитопов

Внеклеточный домен CD20 содержит две внеклеточных петли. Б[о]льшая петля содержит приблизительно 44 аминокислоты между третьим и четвертым трансмембранными доменами. Большинство описанных антител против CD20 нуждаются в аминокислотных остатках большей петли для эффективного связывания. Мутагенетический анализ выявил, что для связывания антител критичны по меньшей мере аланин в 170 положении (А170) и пролин в 172 положении (Р172) (Polyak, Blood, 99:3256-3262 (2002); и Polyak, J. Immunol., 161:3242-3248 (1998)). При изменении остатков А170 и Р172 на серин, который встречается в этих позициях мышиного CD20, связывание антител против CD20, например В1, не происходило. При введении остатков А170 и Р172 в CD20, содержащий мышиную большую петлю, позволяет связывание большинства антител против CD20, включая В1 и ритуксимаб. Наоборот, ряд иных антител, включая 2F2, как описано, связывается с вариантом CD20 A170S P172S (Teeling et al. (2006), выше). Помимо этого, при изменении остатков аспарагина 163 (N163) или аспарагина 166 (N166) на аспарагиновую кислоту, наблюдалось уменьшение связывания 2F2, хотя это не влияло на связывание других антител против CD20, например, В1 или ритуксимаба (Teeling et al. (2006) Blood. 177:363-371) Было предположено, что этот новый эпитоп связан с их биологической активностью и обусловливает выраженную КЗЦ-активность, но ограничивает проапоптозную активность против опухолевых клеток. Для дальнейшего определения характеристик CD20-7 и CD20-6 было проанализировано их связывание с вариантами CD20.

Клонирование и экспрессия вариантов CD20

Плазмида экспрессии pSRa-CD20 содержит полную человеческую последовательность CD20 кДНК, кодон-оптимизированную и синтезированную Blue Heron Biotechnologies, фланкированную сайтами рестрикции XbaI и BamHI для клонирования в вектор pSRa. Вариант CD20-A170S P172S (CD20-AP) был создан PCR-мутагенезом с использованием 5′-праймера hCD20sacAP-SS (ATTAGAGCTCACACACCATATATTAACATATACAACTGTGAACCATCGAATTCCTCT GAGAAAAACT (SEQ ID NO: 41)) вместе с 3′-конечным обратным праймером SRaMfe1R (AATGCAATTGTTGTTGTTAACT (SEQ ID NO: 42)), чтобы амплифицировать фрагмент SacI-Mfel плазмиды pSRa-CD20, содержащий мутацию A170S P172S. Данный ПЦР-продукт был клонирован в сайты SacI и Mfe1 плазмиды pSRa-CD20. Мутагенезом был введен сайт EcoRI, проверка изменения последовательности CD20 в полученных клонах производилась рестрикционным ферментативным расщеплением с последующим ДНК-секвенированием. Двойные CD20 N163D N166D (CD20-NNDD) и одинарные CD20 N163D (CD20-N163D) мутанты были получены ПЦР-мутагенезом такого же фрагмента SacI-Mfe1, модифицированием специфических кодонов 5′-конечных праймеров. Мутантный фрагмент CD20 N163D N166D был амплифицирован с 5′-конечным праймером hCD20sacNN-DD (ATTAGAGCTCACACACCATATATCGATATATACGATTGTGAACCA (SEQ ID NO: 43)), фрагмент CD20 N163D был амплифицирован с 5′-конечным праймером hCD20sacN163D (ATTAGAGCTCACACACCATATATTGATATCTACAACTGTGA (SEQ ID NO: 44)). ПЦР-фрагменты SacI-Mfel были клонированы в сайты SacI и Mfel pSRa-CD20, конструкции были подвергнуты скринингу на введенные сайты Clal или EcoRV, соответственно. Положительные клоны были впоследствии подтверждены ДНК-секвенированием.

Стабильные клеточные линии были созданы трансфекцией CD20-вариантной плазмиды экспрессии в клетки 300-19 по известным процедурам электропорации. Вкратце, 5×106 клеток 300-19 было электропорировано в холодной среде RPMI-1640 с использованием BioRad Gene Pulser, установленного на 260В и 960 мкФ. Затем клетки были разведены и высеяны в 96-луночные планшеты в среду RPMI-1640 с добавками 10% FBS и 50 мкМ β-меркаптоэтанола. Спустя 24 часа был добавлен G418 (например, от Invitrogen) в конечной концентрации 2 мг/мл для того, чтобы выбрать трансфицированные клетки. Спустя 2 недели были выделены и подвергнуты экспансии единичные колонии.

Связывание антител с вариантами CD20

Проточной цитометрией было проанализировано связывание различных антител против CD20 с CD20 АР, экспрессируемым CD20 дикого типа и вариантами. Как показано на Фигуре 18А и Фигуре 18В, все антитела, включая CD20-7 и CD20-6, связывались с клетками, экспрессирующими CD20 дикого типа. Данные, полученные для варианта CD20AP, показаны на Фигуре 19. Как и ожидалось, ритуксимаб и GA101-F не связывались с вариантом CD20AP, а В1 проявлял минимальное связывание. Наоборот, 2F2 может связываться с вариантом CD20AP, как описано ранее (Teeling et al. (2006), выше). Неожиданным оказалось то, что huCD20-7 связывается с вариантом CD20AP (см. Фигуру 19А). Аналогично muCD20-6 и muCD20-7 также были способны связываться с вариантом CD20AP (см. Фигуру 19В). Как было показано, мутации N163D и N166D способны уменьшать связывание 2F2, но не влияют на иные антитела против CD20, например, В1 или ритуксимаб. Как и ожидалось, ритуксимаб и GA101-F связывали вариант CD20-N163D, а 2F2 обладал пониженным связыванием с ним (Фигура 20А). Наоборот, huCD20-7, muCD20-7 и muCD20-6 обладали пониженным связыванием с CD20 N163D. Аналогично ритуксимаб и GA101-F связывали вариант CD20- N163D N166D, в то время как 2F2 обладал минимальным связыванием с ним (Фигура 21). Опять таки, huCD20-7, muCD20-7 и muCD20-6 обладали пониженным связыванием с CD20 N163D N166D.

Неожиданным результатом было то, что huCD20-7 функционально связан с антителами II типа, например, GA101 и В1, но явным образом нуждается в другом эпитопе. В отличие от большинства других антител, huCD20-7 не зависит от остатков А 170 и Р172 в CD20. Таким образом, huCD20-7 - новое антитело против CD20 с ранее не реализовывавшейся комбинацией физических и функциональных особенностей.

Пример 13

Получение huCD20-7-SPP-DM1

Линкер N-сукцинимидил 4-(2-пиридилдитио)пентаноат (SPP) был растворен в этаноле. Антитело huCD20-7 было инкубировано при 8 мг/мл с 7-кратным молярным избытком линкера SPP в течение приблизительно 100 минут при комнатной температуре в 50 мМ калий-фосфатном буфере (рН 6,5), содержащим 50 мМ NaCl, 2 мМ ЭДТА и 5% этанола. Реакционная смесь была очищена с использованием колонки SEPHADEX™ G25F, уравновешенной указанным выше калий-фосфатным буфером. Фракции, содержащие антитела, были объединены и использовались для последующих этапов.

Примерный майтансиноид DM1 был растворен в диметилацетамиде (DMA, конечная концентрация 3%), затем по каплям был добавлен его 1,7-кратный молярный избыток относительно линкера к SPP-модифицированному антителу. После инкубирования в течение ночи при комнатной температуре конъюгированное антитело было очищено хроматографией на SEPHADEX™ G25F, уравновешенной фосфатным солевым буфером (PBS), рН 6,5. Конъюгат huCD20-7-SPP-DM1 затем был диализирован в буфере, содержащем 10 мМ гистидина, 250 мМ глицина, 1% сахарозы с рН 5,5. Количество молекул DM1, присоединенных к одной молекуле антитела, определялось с использованием описанных ранее коэффициентов ослабления для антитела и DM1 (Liu et al., Proc. Natl. Acad. Sci. USA, 93, 8618-8623 (1996)). Процентное количество свободного майтансиноида, присутствующего после реакции конъюгации определялось путем инжекции 20-50 мкг конъюгата в колонку HiSepTM, уравновешенную 25% ацетонитрила в 100 мМ аммоний-ацетатном буфере, рН 7,0, с последующим элюированием ацетонитрилом. Площадь пика общих свободных майтансиноидов разных видов (элюированных в градиенте и идентифицированных сравнением времени элюирования с известными эталонами) измерялась с использованием детектора абсорбции, настроенного на длину волны 252 нм, затем она сравнивалась с пиком, обусловленным связанным майтансиноидом (элюированным в пике конъюгата в проточных фракциях), и рассчитывалось процентное содержание свободных майтансиноидов. Были получены конъюгаты с 3,5-4 молекул DM1 на антитело huCD20-7, присутствовало <1% неконъюгированных майтансиноидов.

Получение huCD20-7-SMCC-DM1

Линкер (сукцинимидил 4-(Н-малеимидометил)циклогексан-1-карбоксилат (SMCC, Pierce Biotechnology, Inc) был растворен в ДМА. Антитело huCD20-7 было модифицировано с SMCC для введения малеимидных групп в антитело путем инкубирования при концентрации 8 мг/мл в 50 мМ калий-фосфатном буфере, содержащем 50 мМ NaCl, 2 мМ ЭДТА, рН 6,5 с 7,5-10-кратным молярным избытком SMCC. После перемешивания в течение 2-4 часов под аргоном при комнатной температуре реакционная смесь была очищена с использованием колонки SEPHADEX™ G25, уравновешенной указанным выше калий-фосфатным буфером. Фракции, содержащие антитела, были объединены и использовались для последующих этапов.

SMCC-модифицированное антитело взаимодействовало с 10 мМ раствором DM1, взятым в 1,7-молярном избытке относительно малеимидного линкера. Реакционную смесь перемешивали при комнатной температуре в атмосфере аргона в течение от 4 до примерно 16 часов. Реакционная конъюгатная смесь была профильтрована через гелевую фильтровальную колонку SEPHADEX™ G25, уравновешенную 1×фосфатно-солевого буфера с рН 6,5. Конъюгат huCD20-7-SMCC-DM1 затем был диализирован в буфере, содержащем 10 мМ гистидина, 250 мМ глицина, 1% сахарозы с рН 5,5. Количество молекул DM1, присоединившихся к молекуле антитела и процентное содержание свободных майтансиноидов определялось так, как описано выше. Были получены конъюгаты с 3,5-4 молекул DM1 на антитело huCD20-7, присутствовало <1% неконъюгированных майтансиноидов.

Получение huCD20-7-SPDB-DM4

Примерный линкер N-сукцинимидил 4-(2-пиридилдитио)бутаноат (SPDB) был растворен в этаноле. Антитело huCD20-7 было инкубировано при 8 мг/мл с 5-кратным молярным избытком линкера SPDB в течение приблизительно 100 минут при комнатной температуре в 50 мМ калий-фосфатном буфере (рН 6,5), содержащим 50 мМ NaCl, 2 мМ ЭДТА и 3% этанола. Реакционная смесь была очищена с использованием колонки SEPHADEX™ G25F, уравновешенной указанным выше калий-фосфатным буфером. Фракции, содержащие антитела, были объединены и использовались для последующих этапов.

Майтансиноид DM4 был растворен в диметилацетамиде (DMA, конечная концентрация 3%), затем по каплям был добавлен его 1,7-кратный молярный избыток относительно линкера к SPDB-модифицированному антителу. После инкубирования в течение ночи при комнатной температуре конъюгированное антитело было очищено хроматографией на SEPHADEX™ G25F, уравновешенной фосфатным 1xсолевым буфером (PBS), рН 6,5. Конъюгат huCD20-7-SPDB-DM4 затем был диализирован в буфере, содержащем 10 мМ гистидина, 250 мМ глицина, 1% сахарозы с рН 5,5. Количество молекул DM4, присоединенных к одной молекуле антитела, определялось с использованием описанных ранее коэффициентов ослабления для антитела и майтансиноида (Widdison, WC, et al. J Med Chem, 49:4392-4408 (2006)). Процентное содержание свободных майтансиноидов определялось так, как описано выше. Были получены конъюгаты с 3,5-4 молекулами DM4 на антитело huCD20-7, присутствовало <1% неконъюгированных майтансиноидов.

Получение huCD20-7-PEG4-mal-DM4

Реагент DM4-mal-PEG4-NHS был растворен в ДМА до получения 12 мМ базового раствора. Антитело huCD20-7 было модифицировано с 15 эквивалентами DM4-mal-PEG4-NHS при концентрации антител 4 мг/мл в 50 мМ калий-фосфатном буфере, содержащем 50 мМ NaCl, 2 мМ ЭДТА, рН 7,5 и 10% ДМА по объему. После перемешивания в течение 2-4 часов под аргоном при комнатной температуре реакционная смесь была очищена с использованием колонки SEPHADEX™ G25, уравновешенной указанным выше калий-фосфатным буфером.

Конъюгат huCD20-7-PEG4-mal-DM4 затем был диализирован в буфере, содержащем 10 мМ гистидина, 250 мМ глицина, 1% сахарозы с рН 5,5. Количество молекул DM4, присоединившихся к молекуле антитела, и процентное содержание свободных майтансиноидов определялось так, как описано выше. Были получены конъюгаты с 3,5-4 молекулами DM4 на антитело huCD20-7, присутствовало <1% неконъюгированных майтансиноидов.

Получение huCD20-7-sulfo-mal-DM4

DM4-mal-3-sulfo-NHS был получен in situ взаимодействием линкера 3-sulfo-mal-NHS с 1,6 эквивалентами L-DM4-SH в 60% ДМА/40% 200 мМ сукцинатного буфера с рН 5 в течение 2 ч при комнатной температуре. 8 эквивалентов реакционной смеси (концентрация линкера 4 мМ) были добавлены к антителу huCD20-7 (5 мг/мл) в 50 мМ калий-фосфатном буфере, содержащем 50 мМ NaCl, 2 мМ ЭДТА, рН 7,5 и 10% ДМА по объему. После перемешивания в течение 2-4 часов под аргоном при комнатной температуре реакционная смесь была очищена с использованием колонки SEPHADEX™ G25, уравновешенной указанным выше калий-фосфатным буфером.

Конъюгат huCD20-7-sulfo-mal-DM4 затем был диализирован в буфере, содержащем 10 мМ гистидина, 250 мМ глицина, 1% сахарозы с рН 5,5. Количество молекул DM4, присоединившихся к молекуле антитела, и процентное содержание свободных майтансиноидов определялось так, как описано выше. Были получены конъюгаты с 3,5-4 молекулами DM4 на антитело huCD20-7, присутствовало <1% неконъюгированных майтансиноидов.

Пример 14

Связывающая способность конъюгатов

Связывающая способность huCD20-7 после конъюгирования с SMCC-DM1 или SPP-DM1 была проанализирована ИФА так, как описано в примере выше. Величины кажущихся констант диссоциации (Kd) были рассчитаны из кривых связывания, представленных на Фигуре 22, и соответствовали 0,7 нМ для huCD20-7, 0,9 нМ для конъюгатов SMCC-DM1 и 1,1 нМ для конъюгатов SPP-DM1. Эти результаты показывают, что, например, конъюгирование SMCC-DM1 или SPP-DM1 не влияет значимым образом на аффинность антитела (например, CD20-7).

Помимо этого, связывающая способность huCD20-7 после конъюгирования, например, с sulfo-mal-DM4 была проанализирована ИФА так, как описано в примере выше. Величины кажущихся констант диссоциации (Kd) были рассчитаны из кривых связывания, представленных на Фигуре 22В, и соответствовали 0,8 нМ для huCD20-7 и 1,3 нМ для конъюгатов sulfb-mal-DM4. Эти результаты показывают, что конъюгирование sulfb-mal-DM4 не влияет значимым образом на аффинность антитела (например, CD20-7).

Проапоптозная активность конъюгатов

Проапоптозная активность huCD20-7 после конъюгирования с SMCC-DM1 или с SPDB-DM4 оценивалась на клетках Ramos, к примеру, анализом с Аннексином-V, как описано выше. Клетки Ramos были инкубированы в течение 20 часов с различными концентрациями антитела huCD20-7 с последующими окрашиванием Аннексином-V-FITC и TO-PRO®-3 и проточной цитометрией. Были построены полулогарифмические графики зависимости процентного количества Аннексин-V положительных клеток относительно концентрации антител (Фигура 23). При обработке huCD20-7 было получено максимально, 51%, Аннексин-V положительных клеток в сравнении с 3% клеток без обработки. Обработка ритуксимабом индуцировала лишь 10% Аннексин-V положительных клеток. Обработка конъюгатами huCD20-7-SMCC-DM1 дала увеличение количества Аннексин-V положительных клеток до 73%, в то время как обработка huCD20-7-SPDB-DM4 дала дальнейшее увеличение до 82%. Наоборот, конъюгаты SMCC-DM1 или SPDB-DM4 с несвязывающимся изотипным контрольным антителом давали лишь 4% или 8% Аннексин-V положительных клеток, соответственно. Проапоптозная активность, к примеру, huCD20-7, против клеток Ramos усиливалась конъюгированием с майтансиноидами.

КЗЦ-активность конъюгатов

КЗЦ-активность, к примеру, huCD20-7, после конъюгирования оценивалась на клетках лимфомы в присутствии человеческого комплемента, как описано выше. Как показано на Фигуре 24А для клеток лимфомы Daudi, примерные конъюгаты SPDB-DM4 и PEG4-mal-DM4 с huCD20-7 обладали примерно такой же КЗЦ-активностью, как и неконъюгированные антитела с ЕС50 приблизительно 0,4 мкг/мл. По отношению к диффузным В-крупноклеточным лимфомным клеткам WSU-DLCL-2 (Фигура 24В) huCD20-7, huCD20-7-SPDB-DM4 и huCD20-7-PEG4-mal-DM4 обладали схожей КЗЦ-активностью с ЕС50 приблизительно 0,5 мкг/мл. Как показано на Фигуре 25А для клеток WSU-DLCL-2, huCD20-7, huCD20-7-SMCC-DM1, -SPP-DM1 и sulfo-mal-DM4 обладали примерно одинаковой КЗЦ-активностью с ЕС50 приблизительно 0,5 мкг/мл. По отношению к клеткам лимфомы Ramos (Фигура 25В) huCD20-7, huCD20-7-SMCC-DM1, -SPP-DM1 и sulfo-mal-DM4 обладали примерно одинаковой КЗЦ-активностью с ЕС50 приблизительно 0,02 мкг/мл. Таким образом, КЗЦ-активность, к примеру, huCD20-7, сохраняется при конъюгировании с майтансиноидом,

АЗКЦ-активность конъюгатов

АЗКЦ-активность, к примеру, huCD20-7, после конъюгирования с SMCC-DM1 оценивалась на клетках Ramos и Granta-519 в присутствии человеческих НК-эффекторных клеток способом анализа высвобождения лактатдегидрогеназы (LDH), как описано выше. Как показано на Фигуре 26, конъюгаты huCD20-7-SMCC-DM1 обладают такой же АЗКЦ-активностью, что и неконъюгированные антитела huCD20-7 по отношению к клеткам Ramos, обеспечивая 40% максимальный клеточный лизис (оба) и ЕС50 1,8 нг/мл и 1,4 нг/мл, соответственно. Аналогичные результаты были получены и с использованием иных клеток (например, клеток Granta-519 MCL) в качестве клеток-мишеней. Конъюгаты huCD20-7-SMCC-DM1 обладают сравнимой АЗКЦ-активностью с неконъюгированными антителами huCD20-7 по отношению к клеткам Granta-519, обеспечивая приблизительно 25% максимальный клеточный лизис (оба) и ЕС50 0,22 нг/мл и 0,14 нг/мл, соответственно. Подобно КЗЦ, АЗКЦ-активность huCD20-7 сохраняется при конъюгировании с майтансиноидом.

Пример 15

Анализы цитотоксичности in vitro

Способность примерных конъюгатов huCD20-7 ингибировать клеточный рост измерялась с использованием анализов цитотоксичности in vitro. В общем клетки-мишени были высеяны по 5000 клеток на лунку в 100 мкл полной среды RPMI (RPMI-1640, 10% фетальной телячьей сыворотки, 2 мМ глутамина, 1% пенициллина-стрептомицина, все реактивы от Invitrogen). Антитела и конъюгаты были разбавлены полной средой RPMI с использованием серий 3-кратного разбавления и добавлены по 100 мкл в лунку. Итоговая концентрация варьировалась от 3×10-8 М до 4,6×10-12 М. Клетки были инкубированы при 37°С в инкубаторе с увлажненным 5% СО2 в течение 4-5 дней. Жизнеспособность оставшихся клеток определялась колориметрическим анализом WST-8 (Dojindo Molecular Technologies, Inc., Роквилль, Мэриленд, США). WST-8 восстанавливался дегидрогеназами живых клеток с образованием оранжевого формозанового продукта, растворимого в питательной среде. Количество образующегося формозана прямо зависело от количества живых клеток. WST-8 был добавлен к 10% итогового объема, планшеты были инкубированы при 37°С в инкубаторе с увлажненным 5% СО2 в течение еще 2-4 часов. Планшеты были проанализированы путем измерения абсорбции на 450 нм (А450) в многолучном планшет-ридере. Фоновую абсорбцию А450 лунок, содержащих только среду и WST-8, вычитали из всех величин. Процентную жизнеспособность рассчитывали делением величины каждого образца на среднюю величину, определенную для лунок с необработанными клетками. Процентная жизнеспособность=100*(А450 обработанного образца-А450 фоновое)/(А450 необработанного образца-А450 фоновое). Для каждой обработки были построены полулогарифмические графики зависимости процентной жизнеспособности от концентрации антитела или конъюгата.

Цитотоксичность in vitro huCD20-7 и huCD20-7-SMCC-DM1 по отношению к клеткам Ramos

Цитотоксичность in vitro huCD20-7 и huCD20-7-SMCC-DM1 по отношению к клеткам Ramos сравнивалась с активностью ритуксимаба и неспецифического конъюгата huIgG-SMCC-DM1. Как показано на Фигуре 27А, при инкубировании с huCD20-7 наблюдалось уменьшение жизнеспособности до 60%, в то время как при обработке ритуксимабом жизнеспособность уменьшалась до 80%. Обработка huCD20-7-SMCC-DM1 снижала жизнеспособность до нулевой с ЕС50 0,68 нМ, в то время как неспецифический конъюгат huIgG-SMCC-DM1 имел ЕС50 20 нМ, что дает неожиданно значимое 29-кратное окно специфичности для huCD20-7-SMCC-DM1.

Цитотоксичность in vitro huCD20-7 и huCD20-7-SMCC-DM1 по отношению к клеткам Daudi

Цитотоксичность in vitro huCD20-7 и huCD20-7-SMCC-DM1 по отношению к клеткам Daudi сравнивалась с активностью ритуксимаба и неспецифического конъюгата huIgG-SMCC-DM1. Как показано на Фигуре 27В, при инкубировании с huCD20-7 наблюдалось уменьшение жизнеспособности до 65% при наивысшей концентрации, в то время как при обработке ритуксимабом жизнеспособность уменьшалась менее значительно, до 80%. Обработка huCD20-7-SMCC-DM1 снижала жизнеспособность до нулевой при наивысшей проверенной концентрации с ЕС50 0,77 нМ, в то время как неспецифический конъюгат huIgG-SMCC-DM1 имел ЕС50 12 нМ, что дает неожиданно значимое 16-кратное окно специфичности для huCD20-7-SMCC-DM1 против клеток Daudi.

Цитотоксичность in vitro huCD20-7 и huCD20-7-SMCC-DM1 по отношению к клеткам Granta-519

Цитотоксичность in vitro huCD20-7 и huCD20-7-SMCC-DM1 по отношению к клеткам Granta-519 MCL сравнивалась с активностью ритуксимаба и неспецифического конъюгата huIgG-SMCC-DM1. Как показано на Фигуре 28А, при инкубировании с huCD20-7 наблюдалось уменьшение жизнеспособности до 45% при наивысшей концентрации, в то время как при обработке ритуксимабом жизнеспособность уменьшалась менее значительно, до 60%. Обработка huCD20-7-SMCC-DM1 снижала жизнеспособность до нулевой при наивысшей проверенной концентрации с ЕС50 0,03 нМ, в то время как неспецифический конъюгат huIgG-SMCC-DM1 имел ЕС50 13 нМ, что дает неожиданно значимое 419-кратное окно специфичности для huCD20-7-SMCC-DM1 против клеток Granta-519.

Цитотоксичность in vitro huCD20-7 и huCD20-7-SMCC-DM1 по отношению к клеткам SC-1

Цитотоксичность in vitro huCD20-7 и huCD20-7-SMCC-DM1 по отношению к клеткам SC-1 FL сравнивалась с активностью ритуксимаба и неспецифического конъюгата huIgG-SMCC-DMI. Как показано на Фигуре 28В, при инкубировании с huCD20-7 наблюдалось уменьшение жизнеспособности до 35% при наивысшей концентрации, в то время как при обработке ритуксимабом жизнеспособность уменьшалась менее значительно, до 75%. Обработка huCD20-7-SMCC-DM1 снижала жизнеспособность до нулевой при наивысшей проверенной концентрации с ЕС50 0,39 нМ, в то время как неспецифический конъюгат huIgG-SMCC-DM1 имел ЕС50 31 нМ, что дает неожиданно значимое 79-кратное окно специфичности для huCD20-7-SMCC-DM1 против клеток SC-1.

Цитотоксичность in vitro huCD20-7 и huCD20-7-SMCC-DM1 по отношению к клеткам DOHH-2

Цитотоксичность in vitro huCD20-7 и huCD20-7-SMCC-DM1 по отношению к клеткам DOHH-2 FL сравнивалась с активностью ритуксимаба и неспецифического конъюгата huIgG-SMCC-DM1. Как показано на Фигуре 29А, при инкубировании с huCD20-7 наблюдалось уменьшение жизнеспособности до 20% при наивысшей концентрации, в то время как при обработке ритуксимабом жизнеспособность уменьшалась до 25%. Обработка huCD20-7-SMCC-DM1 снижала жизнеспособность до нулевой при наивысшей проверенной концентрации с ЕС50 0,12 нМ, в то время как неспецифический конъюгат huIgG-SMCC-DM1 имел ЕС50 35 нМ, что дает неожиданно значимое 292-кратное окно специфичности для huCD20-7-SMCC-DM1 против клеток DOHH-2.

Цитотоксичность in vitro huCD20-7-SMCC-DM1 по отношению к антиген-отрицательным клеткам Molt-4

Для дальнейшей проверки специфичности цитотоксичности huCD20-7-SMCC-DM1 его активность сравнивалась с активностью неспецифического конъюгата huIgG-SMCC-DM1 против неэкспрессирующих CD20 клеточной линии Т-клеточной острой лимфобластной лейкемии Molt-4. Чтобы заметить относительно слабую неспецифическую цитотоксичность, в данном эксперименте применялись повышенные концентрации обоих конъюгатов. Как показано на Фигуре 29В, huCD20-7-SMCC-DM1 и неспецифический конъюгат обладали примерно одинаковой цитотоксичностью с ЕС50 33 нМ.

Обзор цитотоксичности in vitro, проявляемой huCD20-7-SMCC-DM1

huCD20-7, к примеру, неожиданно более активен, нежели ритуксимаб против клеток Ramos, Daudi, Grant-519, SC-1 и DOHH-2. При инкубировании с huCD20-7 уменьшение жизнеспособности клеток-мишеней более выражено, чем при обработке ритуксимабом. Вдобавок, к примеру, конъюгирование huCD20-7 с SMCC-DM1 добавляет цитотоксическую активность антителу. Жизнеспособность опухолевых клеток более выражение снижалась в ответ на обработку конъюгатом, нежели на обработку только антителом. При сравнивании активности huCD20-7-SMCC-DM1 с активностью неспецифических конъюгатов huIgG-SMCC-DM1 наблюдается существенное окно специфичности для каждой CD20-экспрессирующей клеточной линии, что свидетельствует о том, что цитотоксичность есть следствием связывания huCD20-7 с клетками-мишенями. Помимо этого, к примеру, huCD20-7-SMCC-DM1 и неспецифический конъюгат проявляли одинаковую незначительную цитотоксичность против антиген-отрицательных клеток Molt-4. Таким образом, цитотоксичность, наблюдаемая у huCD20-7-SMCC-DM1, зависит от экспрессии CD20.

ЕС50 для конъюгатов SMCC-DM1

Пример 16

huCD20-7-SMCC-DM1 более активен, чем ритуксимаб-SMCC-DM1

против клеток Ramos

Цитотоксичность in vitro, к примеру, huCD20-7 и huCD20-7-SMCC-DM1, по отношению к клеткам лимфомы Ramos сравнивалась с активностью ритуксимаба, ритуксимаб-SMCC-DM1 и неспецифического конъюгата huIgG-SMCC-DMI. Как показано на Фигуре 30А, при инкубировании с huCD20-7 наблюдалось уменьшение жизнеспособности до 55% при наивысшей концентрации, в то время как при обработке ритуксимабом жизнеспособность существенно не уменьшалась. Обработка huCD20-7-SMCC-DM1 снижала жизнеспособность до нулевой с ЕС50 0,72 нМ, в то время как неспецифический конъюгат huIgG-SMCC-DM1 имел ЕС50 22 нМ. Обработка ритуксимаб-SMCC-DM1 обеспечивала цитотоксичность с ЕС50 3,3 нМ. Таким образом, конъюгаты huCD20-7-SMCC-DM1 обладают более выраженной цитотоксической активностью in vitro, чем ритуксимаб-SMCC-DM1.

huCD20-7-SMCC-DM1 более активен, чем ритуксимаб-SMCC-DM1 против клеток Daudi

Цитотоксичность in vitro, к примеру, huCD20-7 и huCD20-7-SMCC-DM1, по отношению к клеткам лимфомы Daudi сравнивалась с активностью ритуксимаба, ритуксимаб-SMCC-DM1 и неспецифического конъюгата huIgG-SMCC-DMI. Как показано на Фигуре 30B, при инкубировании с huCD20-7 наблюдалось уменьшение жизнеспособности до 50% при наивысшей концентрации, в то время как при обработке ритуксимабом жизнеспособность уменьшалась до 65%. Обработка huCD20-7-SMCC-DM1 снижала жизнеспособность до нулевой с ЕС50 1,0 нМ, в то время как неспецифический конъюгат huIgG-SMCC-DM1 имел ЕС50 15 нМ. Обработка ритуксимаб-SMCC-DM1 обеспечивала цитотоксичность с ЕС50 2,6 нМ. Таким образом, конъюгаты huCD20-7-SMCC-DM1 обладают более выраженной цитотоксической активностью, чем ритуксимаб-SMCC-DM1.

Пример 17

Приготовление радиомеченых конъюгатов

Радиомеченые конъюгаты huCD20-7 и ритуксимаба были приготовлены способами, описанными Widdison et al. (Widdison et al. J Med Chem 2006; 49:4392-408) для немеченых конъюгатов, за исключением того, что применялся меченный тритием DM1 ([3H]DM1). Этот способ также описан детально Erickson et al. (Erickson et al. Bioconjug Chem 2010; 21:84-92).

Вкратце, антитела вначале модифицируют на лизиновых остатках N-сукцинимидил-4-(N-малеимидометил) циклогексан-1 карбоксилатом (SMCC) и очищают гель-фильтрацией перед конъюгированием с DM1, стабильно инкорпорированным в его С-20-метокси-группу. Меченный тритием DM1 был приготовлен из Ансамитоцина Р-3. С20-метокси-группу Ансамитоцинов Р-3 удаляли инкубированием с бактериальным штаммом Streptomyces platensis с образованием PDM-3 (Asai et al. Патент США 4307016). С-20-ОН группу ансамитоцинов PDM-3 после этого метилировали с использованием меченного тритием метилиодида способом, описанным Sawada (Sawada et al. Bioconj Chem 1993; 4:284-289). Соотношение связанных майтансиноидных молекул на одну молекулу антитела (D/A) и специфическая радиоактивность были следующими: ритуксимаб-SMCC-[3H]DM1 (3,5 D/A, 1,9 Ci/ммоль) и huCD20-7-SMCC-[3H]DM1 (3,4 D/A, 1,8С1/ммоль).

Активность ритуксимаб-SMCC-[3H]DM1 и huCD20-7-SMCC-[3H]DM1

Два конъюгата и соответствующие немодифицированные антитела обладали схожей связывающей способностью с CD20-положительными SU-DHL-4 клетками (Фигура 31А). Цитотоксическая активность двух конъюгатов по отношению к CD20-положительным клеткам SU-DHL-4 и CD20-отрицательным клеткам COLO205 исследовалась при помощи клеточного анализа жизнеспособности, как описано в Примере 15. Оба конъюгата были активны с величинами IC50 приблизительно 0,1 нМ и 0,24 нМ для конъюгатов huCD20-7-SMCC-[3H]DM1 и ритуксимаб-SMCC-[3Н]DM1, соответственно (Фигура 31В). Как и ожидалось, оба конъюгата были малоактивны против антиген-отрицательной клеточной линии рака ободочной кишки COLO205 с величинами ЕС50 приблизительно 34 нМ и 11 нМ для конъюгатов huCD20-7-SMCC-[3H]DM1 и ритуксимаб-SMCC-[3H]DM1, соответственно. Это свидетельствует о том, что гибель клеток, вызываемая данными двумя конъюгатами, CD20-зависима. Как продемонстрировано в Примере 16 для клеток Ramos и Daudi, конъюгата huCD20-7-SMCC-[3H]DM1 обладали более выраженной цитотоксической активностью, нежели ритуксимаб-SMCC-DM1 против клеток SU-DHL-4.

Метаболиты ритуксимаб-[3H]DM1 и huCD20-7-SMCC-[3H]DM1. образуемые клетками-мишенями

Чтобы оценить количество и тип метаболита, образуемого после экспозиции клеток-мишеней радиомечеными конъюгатами, культуры клеток SU-DHL-4 (17×106) в 21 мл среды RPMI-1640 с добавкой 10% FBS были экспонированы 40 нМ 3H-конъюгата 30 минут при 37°С, 6% CO2. Клетки были промыты три раза средой RPMI-1640, чтобы удалить несвязанный конъюгат, и ресуспендированы в свежей питательной среде (8×105 клеток/мл), и инкубированы при 37°С, 6% СО2 в течение 22 ч. Клетки были собраны и суспендированы в 0,3 мл Трио-буферного солевого раствора, рН 7,5. Был добавлен ацетон (4:3 объем/объем), образцы были смешаны и заморожены при -80°С в течение 1 ч для осаждения белка. Образцы оттаяли и были центрифугированы при 2000 × г 15 минут, супернатанты и осадок были разделены. Супернатанты, содержащие майтансиноидные метаболиты без белков, были выпарены досуха с использованием центрифуги с эвакуированием. Экстракты были растворены в 0,12 мл 20% водного ацетонитрила, содержащего 0,025% трифторуксусной кислоты, метаболиты майтансиноидов были отделены на аналитической колонке С-18 (Vydac, 0,46×25 см) (Erickson et al. Cancer Res 2006; 66:4426-33). Элюат был собран фракциями по 1 мл, далее определяли радиоактивность каждой фракции, смешивая содержимое каждого флакона с 4 мл жидкого коктейля для сцинтилляции Ultima Gold с последующей съемкой в течение 5 минут в жидкостном сцинтилляционном счетчике Tri-Carb 2900T.

Ацетоновая гранула была ресуспендирована в 0,3 мл воды и растворена добавлением 1 мл сольватирующего реагента Solvable (Perkin Elmer). Затем образцы были инкубированы в течение ночи на водяной бане при 50°С. Образцы были сняты с инкубирования, к каждому образцу добавили по 0,1 мл 0,1 М ЭДТА и 0,3 мл 30% пероксида водорода с последующим инкубированием при комнатной температуре в течение 15 минут. Затем образцы инкубировали 1 час при 50°С. К каждому образцу добавляли по 0,2 мл 1 Н НС1 перед добавлением 15 мл сцинтиллирующей жидкости Ultima Gold. Образцы были энергично перемешаны и выдержаны в течение ночи в темноте перед подсчетом на жидкостном сцинтилляционном счетчике.

При краткой экспозиции клеток SU-DHL-4 к huCD20-7-SMCC-[3H]DM1 и ритуксимаб-SMCC-[3H]DM1 наблюдался одинаковый высший уровень конъюгатов, связавшихся с клеткой (Фигура 32А). Количество каждого конъюгата, связавшегося с клеткой определялось по общей радиоактивности, ассоциированной с клетками после начальной экспозиции к конъюгату и этапов промывки. Метаболиты майтансиноидов измерялись спустя 22 ч после экспозиции способом экстракции ацетоном, разделением ВЭЖХ и радиодетектирования. Единственным метаболитом, наблюдавшимся у клеток спустя 22 ч после экспозиции к обоим конъюгатам, был лизин-SMCC-[3H]DM1. Других метаболитов не наблюдалось. Метаболит лизин-SMCC-[3H]DM1 был ранее идентифицирован как единственный метаболит huC242-SMCC-[3H]DM1, образуемый клетками-мишенями (Erickson et al. Cancer Res 2006; 66:4426-33). Уровень метаболита лизин-SMCC-[3H]DM1, спустя 22 ч после экспозиции клеток к конъюгату huCD20-7-SMCC-[3H]DM1, был определен в примерно 0,6 пмоль/106 клеток. Напротив, уровень метаболита лизин-SMCC-[3H]DM1, спустя 22 ч после экспозиции клеток к конъюгату ритуксимаб-[3H]DM1, был определен в примерно 0,3 пмоль/106 клеток. Таким образом, при экспозиции клеток к huCD20-7-SMCC-[3H]DM1 выявляется больший в два раза уровень метаболита в сравнении с уровнем, наблюдаемым при экспозиции к ритуксимаб-SMCC-[3H]DM1 (Фигура 32В). Повышенный уровень метаболита при воздействии конъюгата huCD20-7 может обеспечивать большую активность in vitro конъюгата huCD20-7. Таким образом, huCD20-7, к примеру, является антителом с уникальными физическими и функциональными свойствами, позволяющими ему быть более эффективным in vitro в составе нерасщепляемого конъюгата.

Пример 18

Цитотоксичность in vitro конъюгатов huCD20-7 с различными линкерами Цитотоксичность huCD20-7-SMCC-DM1 сравнивалась с цитотоксичностью конъюгатов с различными линкерами. Как показано на Фигуре 33А, конъюгаты SPDB-DM4 и PEG4-mal-DM4 huCD20-7, к примеру, обладают такой же цитотоксической активностью, что и конъюгаты SMCC-DM1 по отношению к клеткам Granta-519. Все конъюгаты приводили к полному уменьшению жизнеспособности клеток при ЕС50 0,06 нМ. Как показано на Фигуре 33В, конъюгаты SPP-DM1 и sulfb-mal-DM4 huCD20-7, к примеру, обладают такой же цитотоксической активностью, что и конъюгаты SMCC-DM1 по отношению к клеткам Granta-519. Все конъюгаты приводили к полному уменьшению жизнеспособности клеток при ЕС50 0,1 нМ.

Пример 19

Эффективность in vivo антитела huCD20-7 в модели ксенотрансплантата SU-DHL-4

Примерное антитело huCD20-7 было протестировано с использованием установленной ксенотрансплантатной модели клеток диффузной В-крупноклеточной лимфомы SU-DHL-4, имплантированных подкожно мышам с ТКИН. Мыши были рандомизированы по весу тела в терапевтические группы и получали три раза еженедельно на 14, 21 и 28 день после инокуляции клеток либо по 10 мг/кг, либо по 1 мг/кг huCD20-7 или ритуксимаба. Медианный объем опухоли в различных терапевтических группах показан на Фигуре 34. Лечение ритуксимабом привело к уменьшению медианного объема опухоли в сравнении с контрольной группой, получавшей лечение фосфатно-солевым буфером в обеих группах; доза в 10 мг/кг была более эффективна, чем доза в 1 мг/кг. Лечение huCD20-7 в дозе 1 мг/кг привело к более выраженному уменьшению медианного объема опухоли в сравнении с контрольной группой, получавшей лечение фосфатно-солевым буфером в обеих группах, чем при лечении ритуксимабом в такой же дозе. Лечение huCD20-7 в дозе 10 мг/кг привело к более выраженному уменьшению роста опухоли в сравнении с ритуксимабом. На 66 день исследования, при терапии huCD20-7, было 7 из 10 выживших мышей без опухолей (TFS), а при терапии ритуксимабом - 1 из 10. В контрольной группе терапии фосфатно-солевым буфером и в группах приема дозы 1 мг/кг выживших мышей без опухолей не было.

Пример 20

Эффективность in vivo антитела huCD20-7. конъюгатов -SPP-DM1, SMCC-DM1 и BMPS-DM1 на мышиной модели ксенотрансплантата Daudi

Антитела huCD20-7 и их конъюгаты были протестированы in vivo на эффективность в ксенотрансплантатной модели с использованием клеток лимфомы Daudi, внутривенно имплантированных мышам с ТКИН. Мыши были рандомизированы по весу тела в терапевтические группы и получали однократно на 7 день после инокуляции клеток или 10 мг/кг huCD20-7, 10 мг/кг huCD20-7-SMCC-DM1 или 5 мг/кг huCD20-7-SPP-DM1. Количество выживших мышей в различных терапевтических группах представлено графически на Фигуре 35А. Медианная жизнеспособность в группе терапии фосфатно-солевым буфером составила 27 дней. При лечении huCD20-7 наблюдалось повышение медианной жизнеспособности до 45 дней. Оба конъюгата дали дальнейшее повышение медианной жизнеспособности в сравнении с антителом. При введении huCD20-7-SMCC-DM1 и huCD20-7-SPP-DM1 наблюдалась медианная жизнеспособность в 64 дня и 58 дней, соответственно.

В аналогичной ксенотрансплантатной модели использовались клетки лимфомы Daudi, которые внутривенно вводили мышам с ТКИН, после чего они на 7 день получали 10 мг/кг huCD20-7, ритуксимаба, huCH20-7-SMCC-DM1 или huCH20-7-BMPS-DM1. Количество выживших мышей в различных терапевтических группах представлено графически на Фигуре 35В. Медианная жизнеспособность в группе терапии фосфатно-солевым буфером составила 31 дней, а при лечении huCH20-7 наблюдалось повышение медианной жизнеспособности до 49 дней. В отличие от этого, при лечении ритуксимабом наблюдалось повышение медианной жизнеспособности до 40 дней. Оба основанных на huCD20-7 конъюгата дали дальнейшее повышение медианной жизнеспособности в сравнении с антителом. При введении huCH20-7-SMCC-DM1 и huCH20-7-BMPS-DM1 наблюдалась медианная жизнеспособность в 90% и 100% на день 5, соответственно.

Эффективность in vivo антитела huCD20-7, конъюгатов -SPP-DM1 и SMCC-DM1 на мышиной модели ксенографта DOHH-2

Примерные антитела huCD20-7 и их конъюгаты были протестированы на эффективность в пальпируемой ксенотрансплантатной модели с использованием клеток фолликулярной лимфомы DOHH-2, подкожно имплантированных мышам с ТКИН. Мыши были рандомизированы по весу тела в терапевтические группы и получали однократно на 3 день после инокуляции клеток или 10 мг/кг huCD20-7, 10 мг/кг huCD20-7-SMCC-DM1, или 5 мг/кг huCD20-7-SPP-DM1. Медианный объем опухоли в различных терапевтических группах показан на Фигуре 36. Лечение антителом huCD20-7 привело к уменьшению среднего объема опухоли в сравнении с контрольной группой, получавшей лечение фосфатно-солевым буфером. Конъюгаты huCD20-7 обладали повышенной активностью в сравнении с неконъюгированным антителом. В конце исследования, на 90 день, при терапии huCD20-7 было 2 из 10 выживших мышей без опухолей (TFS), при терапии huCD20-7-SMCC-DM1-6 из 10 TFS, а при терапии huCD20-7-SPP-DM1-10 из 10 TFS. В контрольной группе терапии фосфатно-солевым буфером выживших мышей без опухолей не было.

Обзор эффективности т vivo конъюгатов на основе huCD20-7

Конъюгаты антител против CD20 были описаны ранее. В одном случае нерасщепляемые конъюгаты SMCC-DM1 с антителом против CD20 обладали такой же эффективностью, что и неконъюгированное антитело, в то время как расщепляемый конъюгат SPP-DM1 такого же антитела обладал повышенной эффективностью в ксенотрансплантатной модели Granta-519 у мышей с ТКИН (Poison et al., выше). Аналогично конъюгаты калихеамицина с ритуксимабом, сделанные посредством кислотоустойчивого амидного линкера, не повышали эффективность in.vivo в ксенотрансплантатной модели Ramos на голых мышах. Только конъюгаты калихеамицина и ритуксимаба, сделанные кислотолабильным диметилгидразидным Ac-But линкером, обладали повышенной эффективностью in vivo в данном исследовании (DiJoseph et al., выше).

Неожиданным было то, что нерасщепляемые конъюгаты huCD20-7, например, конъюгаты SMCC-DM1 или BMPS-DM1, обладали повышенной эффективностью in vivo в 2 различных ксенотрансплантатных моделях в сравнении с неконъюгированным антителом. Помимо этого, расщепляемые конъюгаты huCD20-7, например, конъюгаты SPP-DM1, обладали примерно такой же эффективностью in vivo, что и неконъюгированные антитела. huCD20-7, к примеру, является антителом с уникальными физическими и функциональными свойствами, позволяющими ему быть более эффективным in vivo в составе нерасщепляемого конъюгата.

Хотя изобретение было описано детально со ссылками на специфические аспекты, специалисту в данной области техники очевидно, что могут быть сделаны различные изменения и модификации, не отступая от его сущности и охвата.

1. Выделенное антитело или его антигенсвязывающий фрагмент, которое специфически связывает CD20, где указанное антитело или его антигенсвязывающий фрагмент содержат вариабельную область легкой цепи и вариабельную область тяжелой цепи, где CDR1, CDR2 и CDR3 указанной вариабельной области легкой цепи содержат аминокислотные последовательности SEQ ID NO: 17-19 или SEQ ID NO: 25-27 и где CDR1, CDR2 и CDR3 указанной вариабельной области тяжелой цепи содержат аминокислотные последовательности SEQ ID NO: 20-22 или SEQ ID NO: 28-30.

2. Антитело или его антигенсвязывающий фрагмент по п.1, отличающиеся тем, что указанное антитело или его антигенсвязывающий фрагмент являются мышиным, нечеловеческим, гуманизированным, химерным, перестроенным или человеческим.

3. Антитело или его антигенсвязывающий фрагмент по п.1, отличающиеся тем, что (a) вариабельная область тяжелой цепи содержит аминокислотную последовательность SEQ ID NO: 35 или SEQ ID NO: 36, (b) вариабельная область легкой цепи содержит аминокислотную последовательность SEQ ID NO: 33 или (c) вариабельная область тяжелой цепи содержит аминокислотную последовательность SEQ ID NO: 35 или SEQ ID NO: 36, а вариабельная область легкой цепи содержит аминокислотную последовательность SEQ ID NO: 33.

4. Антитело или его антигенсвязывающий фрагмент по п.3, отличающиеся тем, что указанное антитело или его антигенсвязывающий фрагмент содержат тяжелую цепь, содержащую аминокислотную последовательность SEQ ID NO: 6 или SEQ ID NO: 7, и легкую цепь, содержащую аминокислотную последовательность SEQ ID NO: 5.

5. Конъюгат, содержащий антитело или его антигенсвязывающий фрагмент по любому из пп.1-4, связанный с цитотоксичным агентом.

6. Конъюгат по п.5, отличающийся тем, что указанный цитотоксический агент выбран из группы, состоящей из майтансиноида, аналога майтансиноида, бензодиазепина, таксоида, CC-1065, аналога CC-1065, дуокармицина, аналога дуокармицина, калихеамицина, доластатина, аналога доластатина, аристатина, производного томаимицина и производного лептомицина.

7. Конъюгат по п.5, отличающийся тем, что указанное связывание антитела или его антигенсвязывающего фрагмента с упомянутым цитотоксическим агентом осуществлено через линкер, выбранный из группы, состоящей из дисульфидной группы, тиоэфирной группы, кислото-лабильной группы, фотолабильной группы, пептидаза-лабильной группы и эстераза-лабильной группы.

8. Конъюгат по п.6, отличающийся тем, что указанное связывание антитела или его антигенсвязывающего фрагмента с упомянутым цитотоксическим агентом осуществлено через линкер, выбранный из группы, состоящей из дисульфидной группы, тиоэфирной группы, кислото-лабильной группы, фотолабильной группы, пептидаза-лабильной группы и эстераза-лабильной группы.

9. Конъюгат по любому из пп.6-8, отличающийся тем, что майтансиноид является DM1 или DM4.

10. Конъюгат по п.9, отличающийся тем, что указанный майтансиноид является DM1, и где указанное связывание указанного антитела или его антигенсвязывающего фрагмента с указанным DM1 осуществлено через линкер SMCC.

11. Конъюгат по п.9, отличающийся тем, что указанный майтансиноид является DM4, и где указанное связывание указанного антитела или его антигенсвязывающего фрагмента с указанным DM4 осуществлено через линкер PDB или sulfoSPDB.

12. Антитело или его антигенсвязывающий фрагмент по любому из пп.1-4 или конъюгат по любому из пп.5-11 для применения в способе лечения злокачественного новообразования.

13. Антитело или его антигенсвязывающий фрагмент или конъюгат по п.12, отличающийся тем, что злокачественное новообразование является B-клеточной лимфомой или B-клеточным лейкозом.

14. Антитело или его антигенсвязывающий фрагмент по любому из пп.1-4 или конъюгат по любому из пп.5-11 для применения в способе лечения аутоиммунного или воспалительного заболевания.

15. Способ in vitro ингибирования роста злокачественной опухолевой клетки, включающий контакт злокачественной опухолевой клетки с антителом или его антигенсвязывающим фрагментом по любому из пп.1-4 или конъюгатом по любому из пп.5-11.

16. Полинуклеотид, кодирующий легкую или тяжелую цепь антитела или его антигенсвязывающего фрагмента по любому из пп.1-4.



 

Похожие патенты:
Изобретение относится к медицине, а именно дерматологии и аллергологии, и может быть использовано для профилактики аллергодерматозов и их рецидивов. Для этого проводят сбор аллергологического анамнеза и заполнения аллергологического паспорта человека начинают с момента рождения ребенка в роддоме с отражением состояния здоровья ребенка и матери, их склонности к аллергическим процессам по результатам прививок и лабораторных показателей, полученных в случае наличия показаний при проведении иммунологического и аллергологического обследования, которые в дальнейшем осуществляют с дополнительным подбором как анестетиков перед каждым оперативным вмешательством, так и антибиотиков перед антибиотикотерапией.

Предложенное изобретение относится к области иммунологии. Предложено антитело против CXCR4 человека или его функциональный фрагмент, которые характенизуются тем, что содержат легкую и тяжелую цепи, содержащие по 3 соответствующих CDR.

Изобретение относится к области иммунологии. Представлены вариантные выделенные анти-CXCR4-антитела 414H5, 515H7 и их антигенсвязывающие фрагменты, способные ингибировать активацию CXCR4, где каждое антитело или его антигенсвязывающий фрагмент содержит набор из 6 CDR, последовательности, которых представлены в описании.

Изобретение относится к медицине, а именно к офтальмологии, и касается системы доставки офтальмологического лекарственного препарата. Эта система включает средство доставки, содержащее фосфолипид или смесь фосфолипидов, холестерин, и терапевтический агент в определенных массовых соотношениях.

Предложенное изобретение относится к применению антитела для получения медикамента для лечения или профилактики опухолей Крукенберга. Антитело, связываясь с эпитопом, расположенным на петле D1 или на петле D3 CLD18A2, опосредует уничтожение и/или ингибирование пролиферации клеток, экспрессирующих CLD18A2.

Настоящее изобретение относится к иммунологии и биотехнологии. Предложены варианты антитела или его эпитоп-связывающего фрагмента, специфичных в отношении бета-амилоидного пептида 1-40.

Группа изобретений относится к области медицины. Более подробно группа изобретений относится к применению антитела к ИЛ-1β для лечения и предупреждения семейной средиземноморской лихорадки, для создания лекарственного средства для лечения семейной средиземноморской лихорадки, а также фармацевтической композиции.

Изобретение относится к биотехнологии и иммунологии. Предложены варианты выделенного антитела или его фрагмента, которые специфично связываются с внеклеточным доменом CXCR5 человека.
Изобретение относится к области медицины, а именно к вирусологии, и касается лечения и профилактики инфекционных заболеваний, вызванных вирусом гриппа с типом поверхностного антигена H1N1, у домашних животных и птиц.

Настоящее изобретение относится к области биохимии. Предложены способы скрининга антитела IgG, обладающего повышенной способностью элиминировать антиген в плазме, основанные на отборе IgG, антигенсвязывающая активность которого при рН от 6,7 до 10,0 выше антигенсвязывающей активности при рН от 4,0 до 6,5.

Настоящее изобретение относится к области иммунологии. Предложены моноклональное антитело, которое связывается с по меньшей мере тремя CC-хемокинами, такими как RANTES/CCL5, MIP-1α/CCL3 или MIP-1β/CCL4, и его антигенсвязывающий фрагмент. Также рассмотрены гибридомные линии клеток, продуцирующие антитела по изобретению, композиция, содержащая антитело по изобретению или его антигенсвязывающий фрагмент, и способ лечения заболевания, нарушения или состояния, опосредованного одним или несколькими CC-хемокинами. Данное изобретение может найти дальнейшее применение в регулировании различных воспалительных и аутоиммунных заболеваний. 4 н. и 40 з.п. ф-лы, 13 ил., 5 табл., 10 пр.

Группа изобретений относится к области медицины и предназначена для лечения рассеянного склероза (PC). Заявлен способ лечения рассеянного склероза (PC) у пациента, которого сначала лечили с помощью PC-терапии лекарствами, отличными от алемтузумаба, включающий введение 1-12 мг/день алемтузумаба пациенту в течение 1-5 дней в качестве начального курса лечения и по меньшей мере 3 месяца после начального курса лечения введение 1-12 мг/день алемтузумаба пациенту в течение 1-5 дней в качестве второго курса лечения. Заявлен способ снижения числа лимфоцитов у пациентов с рассеянным склерозом (PC), причем этого пациента сначала лечили с помощью PC-терапии лекарствами, которые отличны от алемтузумаба, включающий введение 1-12 мг/день алемтузумаба пациенту в течение 1-5 дней в качестве начального курса лечения и по меньшей мере 3 месяца после начального курса лечения введение 1-12 мг/день алемтузумаба пациенту в течение 1-5 дней в качестве второго курса лечения. Заявлен способ снижения риска рецидива или риска развития клинически значимой инвалидности у пациентов с рассеянным склерозом, причем этого пациента сначала лечили с помощью PC-терапии лекарствами, которые отличны от алемтузумаба, включающий введение 1-12 мг/день алемтузумаба пациенту в течение 1-5 дней в качестве начального курса лечения и по меньшей мере 3 месяца после начального курса лечения введение 1-12 мг/день алемтузумаба пациенту в течение 1-5 дней в качестве второго курса лечения. Заявлен способ лечения рассеянного склероза (PC) у пациента, которого сначала лечили с помощью PC-терапии лекарствами, отличными от алемтузумаба, включающий введение 10-60 мг алемтузумаба пациенту в течение 1-5 дней в качестве начального курса лечения и по меньшей мере 3 месяца после начального курса лечения введение 10-60 мг алемтузумаба пациенту в течение 1-5 дней в качестве второго курса лечения. Заявлен способ лечения рецидивов рассеянного склероза (PC) у пациента, который сначала получал PC-терапию лекарствами, которые отличаются от алемтузумаба, включающий введение 12 мг/день алемтузумаба пациенту в течение 5 последовательных дней в качестве начального курса лечения и введение 12 мг/день после 12 месяцев алемтузумаба пациенту в течение трех последовательных дней в качестве второго курса лечения, где 12 мг алемтузумаба в течение каждого цикла лечения вводится пациенту посредством внутривенной инфузии в течение 4-часового периода времени и где пациента непосредственно до лечения алемтузумабом, который вводится в течение первых трех дней каждого лечебного цикла, предварительно лечат с помощью стероидов. Заявленная группа изобретений высокоэффективна для лечения рассеянного склероза. 5 н. и 18 з.п. ф-лы, 3 ил., 5 пр.

Изобретение относится к области биохимии, в частности к антителу, которое специфически связывает TSLP человека. Также раскрыты изолированная нуклеиновая кислота, кодирующая вышеуказанное антитело, экспрессирующий вектор, содержащий указанную нуклеиновую кислоту, и клетка-хозяин, содержащая указанный вектор, для экспрессии вышеуказанного антитела. Раскрыты композиция для лечения TSLP-ассоциированного нарушения, содержащая терапевтически эффективное количество вышеуказанного антитела, способ получения указанного антитела, способ супрессии иммунного ответа при введении указанного антитела, применение указанного антитела для получении лекарственного средства. Изобретение позволяет эффективно лечить TSLP-ассоциированные заболевания. 10 н. и 6 з.п. ф-лы, 1 ил., 9 табл., 7 пр.

Изобретение относится к области биохимии, в частности к cпособу получения двухвалентного биспецифического антитела, который включает трансформацию клетки-хозяина векторами, содержащими молекулы нуклеиновых кислот, кодирующих первую легкую цепь и первую тяжелую цепь двухвалентного биспецифического антитела, и векторами, содержащими молекулы нуклеиновых кислот, кодирующих вторую легкую цепь и вторую тяжелую цепь двухвалентного биспецифического антитела, культивирование клетки-хозяина в условиях, которые обеспечивают синтез молекулы двухвалентного биспецифического антитела и выделение молекулы двухвалентного биспецифического антитела из указанной культуры. При этом указанное антитело содержит легкую цепь и тяжелую цепь антитела, специфически связывающегося с первым антигеном и легкую цепь и тяжелую цепь антитела, специфически связывающегося со вторым антигеном, в котором CL- и СН1-домены константных областей заменены друг на друга. Изобретение позволяет повышать выход правильного биспецифического антитела путем увеличения уровня правильной гетеродимеризации тяжелых цепей дикого типа и модификацией полученных в результате кроссинговера тяжелых цепей. 1 з.п. ф-лы, 15 ил., 4 пр.

Изобретение относится к иммунологии. Предложено гуманизированное антитело против Аβ-олигомера, которое не связывается с Аβ-мономерами, характеризующееся наличием вариабельной области тяжелой цепи и вариабельной области легкой цепи. Описаны: средство против когнитивной дисфункции, лекарственный препарат для лечения болезни Альцгеймера, средство для подавления образования сенильных бляшек и ингибитор образования β-амилоидных волокон, содержащие гуманизированное антитело в качестве активного ингредиента. Предложены также: способ профилактики и/или лечения болезни Альцгеймера и способ подавления прогрессирования болезни Альцгеймера, включающие стадию введения гуманизированного антитела. Описан способ получения антитела с помощью рекомбинантного вектора с ДНК, кодирующей гуманизированное антитело, путем культивирования трансформанта с образованием и накоплением гуманизированного антитела в культуре. Использование изобретения обеспечивает новое гуманизированное антитело против Аβ-олигомера, которое не связывается с Аβ-мономерами, что может найти применение в медицине. 9 н.п. ф.-лы, 3 ил., 1 табл., 3 пр.

Изобретение относится к области иммунологии и биотехнологии. Описан иммуноконъюгат для лечения опухолевых расстройств, связанных с мезотелином. Конъюгат состоит из человеческого или гуманизированного антитела, или его функционального фрагмента, содержащего антигенсвязывающий участок, слитого с цитотоксическим средством DM4 через SPDB-линкер. Причем антитело или его функциональный вариант проявляют инвариантное связывание с мезотелином, то есть связывание с различными раковыми клетками, экспрессирующими мезотелин различной формы. Антигенсвязывающий участок содержит по 3 соответствующих CDR-участка лёгкой и 3 соответствующих CDR-участка тяжёлой цепи. Описана фармацевтическая композиция и способ лечения опухолевых расстройств, связанных с мезотелином, использующие иммуноконъюгат. Раскрыт также способ получения иммуноконъюгата, включающий присоединение цитотоксического средства DM4 к антителу через SPDB-линкер. Использование изобретения обеспечивает иммуноконъюгат на основе нового антитела, способного инвариантно связывать эпитоп мезотелина, не скрытый молекулой СА125, что может найти применение в терапии опухолей. 4 н. и 1 з.п. ф-лы, 4 ил., 3 табл., 3 пр.

Предложенное изобретение относится к иммунологии. Предложено антитело, которое специфически связывается с альфа-синуклеином человека, содержащее зрелые вариабельные области тяжелой и легкой цепей с соответствующими аминокислотными последовательностями. Раскрыта фармацевтическая композиция для лечения или профилактики заболевания с тельцами Леви, содержащая эффективное количество антитела. Использование изобретения обеспечивает новое антитело, которое специфично связывается с человеческим альфа-синуклеином и может быть использовано для иммунотерапии заболевания с тельцами Леви. 2 н. и 3 з.п. ф-лы, 6 ил., 4 табл., 4 пр.

Группа изобретений относится к медицине, а именно к онкологии, и может быть использована для получения лекарственного средства для лечения рака. Для этого применяют нефукозилированное анти-CD20 антитело с количеством фукозы 60% или менее от общего количества олигосахаридов (сахаров) в положении Asn297 в комбинации с бендамустином. При этом раком является рак, экспрессирующий CD20, и указанное антитело включает аминокислотную последовательность вариабельной области тяжелой цепи (VH) SEQ ID NO: 7 и аминокислотную последовательность вариабельной области легкой цепи (VL) SEQ ID NO: 20, также предложен способ лечения рака, экспрессирующего CD20. Группа изобретений обеспечивает лечение рака у пациентов за счет синергетического действия комбинации нефукозилированного анти-CD20 антитела с бендамустином. 2 н. и 8 з.п. ф-лы, 3 табл., 1 ил.

Группа изобретений относится к области фармацевтики и касается водной композиции, содержащей антитело и алкилгликозид, имеющий значение СМС около 1,0 мМ или более в воде при 25°С, где алкилгликозид присутствует в концентрации, которая меньше значения СМС алкилгликозида в воде при 25°С. Заявлены также способ ингибирования агрегации антитела и способ предотвращения окисления антитела в водном растворе с использованием водной композиции. Группа изобретений обеспечивает повышение стабильности антител в терапевтически пригодных составах. 3 н. и 30 з.п. ф-лы, 16 ил., 2 табл., 3 пр.
Изобретение относится к области медицины, а именно к офтальмологии, и касается лечения неоваскулярной глаукомы. Для этого сначала осуществляют введение ингибитора VEGF ранибизумаба в количестве 0,05 мл с помощью инъекционной иглы 30 G в проекции плоской части цилиарного тела в 3,5-4,0 мм от лимба через двухступенчатый самогерметизирующийся прокол склеры в стекловидное тело. Затем, через 7-10 дней, выполняют криоциклодеструкцию на протяжении 360° с помощью наконечника криоаппликатора размером 2×4 мм. При этом наносят 8 коагулятов с экспозицией криовоздействия 90 секунд. Одномоментно проводят криопексию сетчатки с помощью наконечника аппарата Criostar диаметром 3 мм в четырех квадрантах на расстоянии 9 мм от лимба с нанесением 3 рядов коагулятов с экспозицией 4 секунды. Способ обеспечивает достижение выраженного гипотензивного эффекта с окончательным подавлением неоваскуляризации при одновременном снижении воспалительной и геморрагической реакции в послеоперационном периоде. 1 пр.
Наверх