Кормовая добавка с фитопробиотической активностью на минеральной основе

Изобретение относится к сельскохозяйственной биотехнологии, а именно к кормовой добавке с фитопробиотической активностью на минеральной основе, которая может быть использована при приготовлении кормов для сельскохозяйственных животных и птицы. Кормовая добавка состоит из жизнеспособных бактерий штамма Enterococcus faecium, растительного сырья и наполнителя. В качестве наполнителя используют диатомит в виде обожженной крошки. В качестве жизнеспособных бактерий штамма Enterococcus faecium используют штамм бактерий Enterococcus faecium 1-35, депонированный в коллекции Всероссийского государственного научно-исследовательского института контроля, стандартизации и сертификации ветпрепаратов (ВГНКИ) 20.03.2008 под регистрационным номером Enterococcus faecium ВГНКИ 08.03.53-ДЕП, хранящийся в коллекции микроорганизмов ООО «БИОТРОФ», нанесенный на диатомит в виде обожженной крошки и имеющий титр бактерий Enterococcus faecium 1-35 не менее 106 КОЕ/мг. В качестве растительного сырья используют смесь эфирных масел эвкалипта, чабреца, чеснока и лимона, взятых при соотношении 1:2:1:2, соответственно, и нанесенную на диатомит в виде обожженной крошки с получением сухого концентрата смеси эфирных масел эвкалипта, чабреца, чеснока и лимона в виде порошка. Все исходные компоненты берут в определённом соотношении. Кормовую добавку вводят в состав корма при соотношении как 0,001:1. Осуществление изобретения позволяет расширить ассортимент кормовых добавок с высокой фитопробиотической активностью на минеральной основе. Скармливание кормовой добавки обеспечивает улучшение состояния здоровья, повышение сохранности молодняка и увеличение продуктивности сельскохозяйственных животных и птиц. 8 табл., 3 пр.


Изобретение относится к сельскохозяйственной биотехнологии, а именно к составу кормовой добавки с фитопробиотической активностью на минеральной основе и может быть использовано при приготовлении кормов для сельскохозяйственных животных и птицы.

Известна активная угольная кормовая добавка для повышения продуктивности кур-несушек, включающая сорбент, в качестве которого используют активированный уголь, полученный из мягколиственных пород древесины, имеющий размер частиц от 0,1 до 2 мм, в количестве 400 г на 1 т корма, U №2505069 C1, A23K 1/00, 27.01.2014.

Известна органоминеральная кормовая добавка, содержащая наполнитель и кремнесодержащий материал, в качестве которого добавка содержит диатомит Инзенского месторождения Ульяновской области с содержанием кремнезема 81,30-85,60% или опоку Дубинского месторождения Ульяновской области с содержанием кремнезема 84,10-89,62%, имеющие высокую пористость и гигроскопичность с возможностями накапливания физиологически активных веществ из наполнителя, RU №2199883 C1, A23K 1/16, A23K 1/175, 10.03.2003.

Известна кормовая добавка для крупного рогатого скота, включающая растительные и зерновые компонентов и минеральную добавку в виде голубой глины, являющейся природным сорбентом и дешевым источником жизненно необходимых макро- и микроэлементов и обладающей высокими адсорбционными и ионообменными свойствами, RU №2238659 С2, A23K 1/16, A23K 1/175, 27.10.2004.

Известна кормовая добавка для животных и птицы, включающая природный цеолит, RU №2484640 C1, A23K 1/00, 20.06.2013; RU №2467591 C1, A23K 1/16, A23K 1/00, 27.11.2012; RU №2448472 С2, A23K 1/175, 27.04.2012; RU №2390254 C1, A23K 1/00, A23K 1/16, A23K 1/175, 27.05.2010; RU №2385623 С2, A23K 1/16, A23K 1/175, 10.04.2010; RU №2374896 С1, A23K 1/00, A23K 1/175, 10.12.2009; RU №2262863 С2, A23K 1/16, A23K 1/175, 27.10.2005.

Известна кормовая добавка для стимулирования роста свиней, содержащая наполнитель и антибиотики, при этом в качестве наполнителя она содержит адсорбент «Бажедин», RU №2386343 С2, A23K 1/00, A23K 1/17, A23K 1/175, 20.04.2010.

Известна кормовая добавка для свиней, представляющая собой природный минерал Водинского месторождения Красноярского района Самарской области, содержащий в своем составе 47,37% серы и 21,4% кальция, RU №2480025 С2, A23K 1/175, 27.04.2013.

Известна кормовая добавка для молодняка крупного рогатого скота, включающая бентонит Донгузского месторождения, подсолнечный фуз и неорганический селенит натрия, а в качестве наполнителя - отруби пшеничные, RU №2497382 С2, A23K 1/16, A23K 1/175, 10.11.2013.

Известные кормовые добавки содержат в своем составе природные материалы на основе глины или торфа, или сорбирующие наполнители в виде активированного угля или природного цеолита (наиболее распространенного), которые в каждом конкретном случае имеют индивидуальные технологии обработки.

Известна кормовая добавка для сельскохозяйственной птицы, содержащая биологически активные вещества, в качестве которых используется вытяжка из растений: женьшеня, крапивы двудомной и других подобных растений, способствующих восстановлению репродуктивной функции организма сельскохозяйственных птиц, RU №2202223 С2, A23K 1/16, A23K 1/175, 20.04.2003.

Известна кормовая добавка, содержащая биологически активное вещество - экстракты хвойной зелени, RU №2304397 CI, A23K 1/00, A23K 1/12, A23K 1/14, A23K 1/16, 20.08.2007.

Известна кормовая добавка для сельскохозяйственной птицы и животных, содержащая сорбент и растительный стимулятор организма, включающий душицу, зверобой, мать-и-мачеху, подорожник, пижму, чистотел, донник, полынь горькую, тысячелистник, ромашку аптечную, крапиву двудомную, RU №2355187 C1, A23K 1/14, A23K 1/16, 20.05.2009.

Известно средство для профилактики колибактериоза птиц, содержащее биологически активное вещество, включающее растительные экстракты из листьев облепихи крушиновидной (Hippophae rhamnoides L.), и/или экстракт травы маклейи сердцевидной (Macleaya cordata Will L.) или маклейи мелкоплодной (Μ. microcarpas), и/или экстракт расторопши пятнистой (Silybum marianum (L.) Gaertn), и/или экстракт корней и травы эхинацеи пурпурной (Echinacea purpurea L.), RU №2355410 C2, A61K 36/00, 20.05.2009.

Известна фитоминеральная композиция для повышения иммунитета птиц в промышленном птицеводстве, состоящая из раствора морской соли, в который добавлены высушенные и измельченные бессмертник, календула, крапива, почки березы, почки сосны, тысячелистник, морская капуста, RU №2462257 C1, A61K 36/00, 27.09.2012.

Известна кремнийсодержащая кормовая добавка, включающая растительное сырье, содержащее рисовую шелуху, RU №2473244 С1, A23K 1/14, 27.01.2013.

Использование растительного сырья в известных кормовых добавках очень разнообразно и требует индивидуального подбора введения его в состав кормовой добавки для лечебных и профилактических целей.

Известна кормовая добавка для повышения резистентности и продуктивности сельскохозяйственных животных и птицы, содержащая эфирное масло душицы и наполнитель, RU №2297775 C1, A23K 1/16, A23K 1/14, 27.04.2007.

Использование растительного сырья в известных кормовых добавках очень разнообразно и требует индивидуального подбора введения его в состав кормовой добавки для лечебных и профилактических целей.

Известен способ получения биопрепарата с пробиотическими свойствами для кормления сельскохозяйственных животных и птицы, содержащего в своем составе смесь эфирных масел чеснока, эвкалипта, розмарина и тимьяна, и штамм бактерий Enterococcus faecium 1-35, и наполнитель, RU №2458527 C1, A23K 1/165, 20.08.2012.

Известен способ получения сухого пробиотического препарата, характеризующийся тем, что готовят маточную культуру совместным выращиванием в условиях глубинного культивирования молочнокислых микроорганизмов Enterococcus faecium В 3491, Lactobacillus plantarum В 3242, Bifidobacterium bifidum AC 1247, взятых в соотношении 1:1:1 в жидкой питательной среде, представляющей собой смесь коровьего молока с водой в соотношении 1:1 при температуре 37-39ºС в течение 72 ч до получения биотитра каждого микроорганизма не менее 5ּ108 КОЕ/мл, готовят смесь шротов пряно-ароматических трав из семян тмина, семян кориандра и травы петрушки, RU №2380107 C1, A61K 35/66, A23K 1/165, 27.01.2010.

Известен препарат для лечения и профилактики дисбактериальных состояний кишечника у птиц, содержащий инулин и закваску живых микроорганизмов Lactobacillus acidophilus, Enterococcus faecium, №2410105 C1, A61K 35/66, 27.01.2011.

Известна пробиотическая кормовая добавка, содержащая микроорганизмы, выбранные из группы, включающей Enterococcus faecium, DSM 16211, Lactobacillus reuteri, DSM 16350, и Lactobacillus salivarius ssp. salivarius, DSM 16351, Pediococcus acidilactici, DSM 16210, и Bifidobacterium animalis, DSM 16284, RU №2372788 C2, A23K 1/00, A23K 1/18, 20.11.2009.

Известна кормовая добавка для молодняка свиней, содержащая культуру бактерий Enterococcus faecium, растительное сырье и наполнитель, RU №2359465 C1, A23K 1/00, 27.06.2009.

Данное техническое решение принято в качестве ближайшего аналога настоящего изобретения.

Кормовая добавка ближайшего аналога содержит пробиотик, в состав которого входят культуры бактерий Bifidobacterium globosum, Bacillus subtilis, в том числе Enterococcus faecium.

В качестве растительного сырья в ближайшем аналоге использован сухой свекловичный жом, а в качестве наполнителя цеолит.

В ближайшем аналоге использование другого состава не предусмотрено.

В основу настоящего изобретения положено решение задачи, позволяющей расширить ассортимент кормовых добавок с высокой фитопробиотической активностью на минеральной основе, предназначенных для комплексного воздействия на улучшение состояние здоровья, повышение сохранности молодняка, и увеличение продуктивности сельскохозяйственных животных и птицы.

Технический результат настоящего изобретения заключается в обеспечении широкого спектра фитопробиотического действия кормовой добавки, включающего заселение желудочно-кишечного тракта животных нормальной микрофлорой, обеспечивающей повышение переваримости и усвояемости питательных веществ рациона за счет введения жизнеспособных бактерий Enterococcus faecium 1-35, подавление развития патогенной микрофлоры в желудочно-кишечном тракте, сохранение антимикробных свойств и проявление антиоксидантных свойств за счет введения смеси эфирных масел эвкалипта, чабреца, чеснока и лимона, и в нормализации процессов пищеварения за счет использования в качестве носителя диатомита в виде обожженной крошки при взаимодействии со смесью жизнеспособных бактерий Enterococcus faecium 1-35 и сухого концентрата смеси эфирных масел эвкалипта, чабреца, чеснока и лимона в виде порошка в составе кормовой добавки.

Согласно изобретению эта задача решается за счет того, что кормовая добавка с фитопробиотической активностью на минеральной основе, используемая в составе корма для сельскохозяйственных животных и птицы, состоит из жизнеспособных бактерий штамма Enterococcus faecium, растительного сырья и наполнителя.

В качестве наполнителя использован диатомит в виде обожженной крошки.

В качестве штамма взят штамм бактерий Enterococcus faecium 1-35.

Штамм бактерий Enterococcus faecium 1-35 депонирован в коллекции Всероссийского государственного научно-исследовательского института контроля, стандартизации и сертификации ветпрепаратов (ВГНКИ) 20.03.2008 под регистрационным номером Enterococcus faecium ВГНКИ 08.03.53-ДЕП и хранится в коллекции микроорганизмов ООО «БИОТРОФ».

Штамм бактерий Enterococcus faecium 1-35 состоит из жизнеспособных бактерий Enterococcus faecium 1-35 с титром бактерий не менее 106 КОЕ/мг, нанесенных на диатомит в виде обожженной крошки.

В качестве растительного сырья взята смесь эфирных масел эвкалипта, чабреца, чеснока и лимона при соотношении 1:2:1:2, соответственно, в виде порошка из смеси сухого концентрата этих эфирных масел.

Кормовая добавка имеет следующий состав, г:

сухой концентрат смеси эфирных масел эвкалипта, чабреца, чеснока и

лимона в виде порошка 50-150;

бактерии, нанесенные на диатомит в виде обожженной крошки, 100

диатомит в виде обожженной крошки 850-750.

Кормовая добавка в составе корма взята при соотношении как 0,001:1.

Заявителем не выявлены источники, содержащие информацию о технических решениях, идентичных настоящему изобретению, что позволяет сделать вывод о его соответствии критерию «новизна».

За счет реализации отличительных признаков изобретения (в совокупности с признаками, указанными в ограничительной части формулы) достигаются важные новые свойства объекта.

Жизнеспособные бактерии Enterococcus faecium 1-35 способствуют созданию нормальной микрофлорой, повышению переваримости и усвояемости питательных веществ рациона.

Использование смеси эфирных масел эвкалипта, чабреца, чеснока и лимона способствует подавлению развития патогенной микрофлоры в желудочно-кишечном тракте, сохранению антимикробных свойств и проявлению антиоксидантных свойств.

Использование в качестве носителя диатомита в виде обожженной крошки при взаимодействии со смесью жизнеспособных бактерий Enterococcus faecium 1-35 и сухого концентрата смеси эфирных масел эвкалипта, чабреца, чеснока и лимона в виде порошка нормализует процессы пищеварения и позволяет улучшить состояние здоровья, повысить сохранность молодняка, и увеличить продуктивность сельскохозяйственных животных и птиц.

Заявителю не известны какие-либо публикации, которые содержали бы сведения о влиянии отличительных признаков изобретения на достигаемый технический результат.В связи с этим, по мнению заявителя, можно сделать вывод о соответствии заявляемого технического решения критерию «изобретательский уровень».

Настоящее изобретение осуществляют следующим образом.

Кормовую добавку с фитопробиотической активностью используют в составе корма для сельскохозяйственных животных и птицы.

Кормовая добавка с фитопробиотической активностью содержит жизнеспособные бактерии Enterococcus faecium 1-35.

Видовая идентификация штаммов микроорганизмов

Наработка чистой культуры штамма бактерий, являющихся основой разрабатываемой кормовой добавки с пробиотической активностью, и испытание их проведено в период с 17.10.2013 г. по 21.10.2013 г. на производственной базе ООО «БИОТРОФ», г. Санкт-Петербург.

Чистую культуру штамма бактерий анализировали молекулярно-генетическим методом секвенирования.

ДНК из штамма бактерий выделяли согласно стандартному протоколу «Набора для выделения геномной ДНК из различных источников».

Были выбраны консервативные праймеры для наработки 16S рДНК.



Был определен следующий режим ПЦР-реакции:

1) 95ºС - 3 мин

2) 35 циклов

95ºС - 30 сек.

55ºС - 30 сек.

72ºС - 1 мин.

3) 72ºС - 20 мин

Электрофорез исследуемых образцов проводили в 1,0% агарозном геле при напряженности электрического поля 5 В/см.

Выделение ДНК из геля_проводили с использованием ДНК-сорбента «Silica».

Клонирование ПНР-фрагментов осуществляли в векторе pTZ-57R в компетентные клетки Enterococcus штамма DH5A.

Скрининг трансформантов проводили с помощью метода «ПНР-колоний» с помощью праймеров Μ13



Был установлен следующий режим ПЦР-реакции:

1). 95ºС - 3мин

2). 35 циклов

95ºС - 40 сек.

50ºС - 40 сек.

72ºС - 1 мин.

3). 72ºС - 20 мин

Определение нуклеотидной последовательности ПЦР-фрагментов проводили с использованием набора реагентов фирмы «Весктап» (США) в соответствии с рекомендациями изготовителя. Разделение фрагментов и их регистрацию осуществляли с помощью прибора для автоматического секвенирования CEQ8000, Весктап Coulter, США.

Определение филогенетической принадлежности проводили в базе данных NCBI BLAST ()

По базе данных отобраны виды, имеющие максимальное соответствие (не менее 99%) штамма бактерий - основы кормовой добавки с фитопробиотической активностью:

Enterococcus faecium strain XJHTB-ZP 16S ribosomal RNA gene, partial sequence 99%.

Штамм бактерий Enterococcus faecium 1-35 был проверен на патогенные свойства.

В соответствии с ГОСТ 12.1.007-76 проведены исследования штамма бактерий Enterococcus faecium 1-35 на патогенные свойства: вирулентность, токсичность, токсигенность, способность вызывать дессиминации во внутренних органах теплокровных животных.

Испытания проведены на беспородных белых крысах и беспородных белых мышах.

Вирулентность и диссеминацию штамма бактерий Enterococcus faecium 1-35 изучали при однократном введении суточной агаровой культуры в физиологическом растворе в желудок белым мышам и белым крысам в дозах но 106, 10′, 10х и 109 и внутрибрюшинно по 106, 107, 108 и 109 микробных клеток (мк. кл) на животное. В опыте использовали по 12 животных на дозу (6 самцов и 6 самок). В период наблюдения клинических симптомов заболевания у животных не наблюдалось, гибель отсутствовала. Через 30 суток после введения культуры микроорганизмов, животных умерщвляли ингаляцией СО2 и методом отпечатков делали посев из крови и внутренних органов (легких, печени, ночек и селезенки) на чашки Петри с агаризованной средой. Рост культуры в высевах из органов животных при обоих способах введения не обнаружен.

Токсичность штамма бактерий Enterococcus faecium 1-35 оценивали путем внутрибрюшинного введения мышам взвеси агаровой культуры микроорганизмов, приготовленной на стерильном физиологическом растворе и инактивированной нагреванием при 60ºС в течение 30 минут в концентрациях, 108 и 109 (мк. кл) на животное (по 6 особей на дозу). В течение срока наблюдения - первые двое суток - гибели мышей не было.

Токсигенность штамма бактерий Enterococcus faecium 1-35 изучали на мышах путем внутрибрюшинного и внутрижелудочного введения стерильною фильтрата культуральной жидкости (фильтрация через фильтр Millipor с размером пор 0,45 мкм) 3-х и 7-ми суточных культур в дозах 0,3 мл, 0,6 мл и 1,0 мл (по 6 особей на дозу). Животным контрольных групп вводили стерильную жидкую питательную среду в таких же объемах. Гибели мышей не было. ЛД5o не установлена, при обоих способах введения она превышала 1,0 мл на животное для 3-х и 7-ми суточных культуральных жидкостей.

Результаты представлены в Таблице 1.

Из таблицы 1 видно, что штамм бактерий Enterococcus faecium 1-35 по показателям вирулентности, диссеминации, токсичности и токсигенности не патогенен для теплокровных животных и, относятся к 4 классу опасности (малоопасны), что удовлетворяет требованиям, предъявляемым к промышленным микроорганизмам.

Была наработана культура микроорганизмов на основе штамма бактерий Enterococcus faecium 1-35 для получения кормовой добавки с фитопробиотической активностью.

Установлены характеристики культуры микроорганизмов Enterococcus faecium 1-35:

- внешний вид и цвет: жидкость светло-коричневого цвета с небольшим осадком питательной среды;

- культура микроорганизмов состоит из штамма бактерий Enterococcus faecium 1-35, не подвергавшихся генно-инженерным модификациям;

- титр бактерий составляет 1.0×106-2.0×108 КОЕ/г;

- посторонняя микрофлора отсутствует.

Выбранный интервал концентраций (титра) бактерий является оптимальным.

В кормовой добавке с фитопробиотической активностью в качестве наполнителя использован диатомит Инзенского месторождения Ульяновской области.

Диатомит - осадочная горная порода рыхлая или слабосцементированная, состоящая из останков диатомовых водорослей и имеющая серый или желтый цвет слабых тонов.

Химически диатомит более чем на 80% состоит из водного кремнезема.

Диатомит в виде обожженной крошки поставляет "Диатомовый Комбинат" г. Инза Ульяновской области.

В кормовой добавке использован диатомит в виде обожженной крошки фракций 0,3-0,7 мм с влажностью не больше 9%.

Кормовая добавка с фитопробиотической активностью содержит смесь эфирных масел эвкалипта, чабреца, чеснока и лимона.

Эвкалиптовое масло обладает противовоспалительными, антисептическими, противоинфекционными свойствами. Укрепляя иммунную систему, эфирное масло эвкалипта активно борется с вирусными инфекциями и воспалительными процессами. Благотворно эвкалиптовое масло влияет и на работу желудочно-кишечного тракта.

Эфирное масло чабреца повышает иммунитет, обладает противовоспалительным свойством, нормализует ферментацию желудка, является антисептическим средством.

Чесночное масло обладает мощным антисептическим действием, а также противомикробным, антитоксическим, противовирусным, бактерицидным и тонизирующим. Антисептические, бактерицидные и антитоксические свойства чеснока делают его ценным средством в борьбе с инфекцией.

Лимонное масло имеет выраженную противовирусную активность, помогает бороться с инфекциями и укрепляет иммунную систему. Основные свойства, которыми обладает лимонное масло: антисептическое, бактерицидное, дезинфицирующее и иммуностимулирующее.

Смесь эфирных масел эвкалипта, чабреца, чеснока и лимона взята при соотношении 1:2:1:2, соответственно.

Эфирные масла чабреца и лимона взяты в увеличенном в два раза количестве для повышения антисептических свойств кормовой добавки, что было подтверждено экспериментальными исследованиями.

Из смеси эфирных масел эвкалипта, чабреца, чеснока и лимона готовят сухой концентрат в виде порошка.

Приготовление сухого концентрата в виде порошка.

Смесь эфирных масел эвкалипта, чабреца, чеснока и лимона и жизнеспособные бактерии Enterococcus faecium 1-35 наносят на диатомит в виде обожженной крошки, помещенный в смеситель СМ-150, при соотношении 1:1:10, соответственно. Влажный препарат раскладывают на лотки.

Высушивание препарата проводят в шкафах сушильных РТ-ШС. В шкафы завозят лотки с разложенным на них препаратом.

Высушивание препарата проводят воздушно-тепловым способом при температуре от 55°С до 60°С в течение 9 часов до конечной влажности 7,0-7,2%.

После сушки препарат направляют на размол на дробилку кормов ДКР-3. Препарат размалывают до состояния порошка.

Приготовление кормовой добавки

Сухой концентрат в виде порошка в количестве 150 г смешивают с диатомитом в виде обожженной крошки в количестве 850 г в смесителе СМ-150.

Сухой концентрат в виде порошка в количестве 250 г смешивают с диатомитом в виде обожженной крошки в количестве 750 г в смесителе СМ-150.

Количество сухого концентрата в виде порошка в интервале 150-250 г и диатомита в интервале 850-750 г является оптимальным и определено экспериментально при проведении исследований на стадии приготовления кормовой добавки.

Кормовую добавку в составе корма берут при соотношении как 0,001:1.

Исследования по использованию предложенной кормовой добавки представлены в примерах 1-3.

Пример 1.

Использование кормовой добавки с фитопробиотической активностью в птицеводстве

Опыт проводили на базе ГУП «Загорское ЭПХ ВНИТИП» Россельхозакадемии на цыплятах-бройлерах кросса «Кобб Авиан 48».

Выращивание цыплят-бройлеров проводили с суточного до - дневного возраста в клеточных батареях Big Dutchman. Технологические параметры выращивания бройлеров соответствовали рекомендациям по работе с кроссом «Кобб Авиан 48».

Было сформировано 2 группы цыплят-бройлеров по 40 голов в каждой.

Цыплята-бройлеры получали сухие рассыпные комбикорма вволю. Поение также вволю.

Первая группа контрольная получала основной рацион (ОР) комбикормов.

Вторая группа опытная получала основной рацион (ОР) комбикормов с кормовой добавкой с фитопробиотической активностью (1000 г/т).

Основные зоотехнические показатели опыта на цыплятах-бройлерах при использовании кормовой добавки с фитопробиотической активностью представлены в таблице 2.

Из таблицы 2 видно, что эффективность введения кормовой добавки с фитопробиотической активностью в ОР во 2 опытной группе очевидна: среднесуточный прирост живой массы значительно выше в сравнении с 1 контрольной группой, а затраты корма на 1 кг живой массы во 2 опытной группе ниже на 2,4%.

Результаты балансового опыта представлены в таблице 3 (Переваримость и использование питательных веществ корма у цыплят-бройлеров при использовании кормовой добавки с фитопробиотической активностью).

Результаты балансового опыта согласуются с зоотехническими результатами выращивания цыплят-бройлеров и подтверждают эффективность кормовой добавки с фитопробиотической активностью при включении в комбикорм цыплятам-бройлерам.

Переваримость органического вещества комбикормов, использование азота, аминокислот, кальция и фосфора не имеют значительных различий между 1 контрольной и 2 опытной группами.

Влияние кормовой добавки с фитопробиотической активностью на микрофлору кишечника цыплят-бройлеров представлено в таблице 4.

Из таблицы 4 видно, что кормовая добавка с фитопробиотической активностью способствует увеличению численности полезных молочнокислых бактерий и снижению обилия условно-патогенных бактерий.

Пример 2

Использование кормовой добавки с фитопробиотической активностью в свиноводстве.

Опыт проводили на свиноферме ОАО ПЗ «Пламя» Ленинградской области. Продолжительность опыта составляла 60 дней.

Было сформировано 2 группы поросят-отъемышей по 50 голов в каждой.

Первая группа контрольная получала основной рацион (ОР) комбикормов.

Вторая группа опытная получала основной рацион (ОР) комбикормов с кормовой добавки с фитопробиотической активностью.

Результаты проведенных исследований приведены в таблице 5 (Зоотехнические показатели выращивания поросят-отъемышей при использовании кормовой добавки с фитопробиотической активностью).

Из таблицы 5 видно, что во 2 опытной группе среднесуточные привесы у поросят-отъемышей были выше на 10,8%, а затраты корма на 1 кг привеса ниже на 0,78 к. ед.

В период после отъема кормовая добавка с фитобиотической активностью способствовала компенсированию недостатка собственных пищеварительных ферментов у поросят-отъемышей, облегчив переход к концентрированному кормлению. Поросята легче переносили стрессы.

Применение кормовой добавки с фитопробиотической активностью способствовало повышению иммунитета у животных (не наблюдалось заболеваний желудочно-кишечного тракта), нормализации процессов пищеварения, повышению переваримости и усвояемости питательных веществ рациона, что положительно повлияло на рост и развитие поросят-отъемышей.

Влияние кормовой добавки с фитопробиотической активностью на микрофлору кишечника поросят-отъемышей представлено в таблице 6.

Из таблицы 6 видно, что применение кормовой добавки с фитопробиотической активностью в кормлении свиней способствует увеличению численности полезной микрофлоры, особенно - молочнокислых бактерий (лактобацилл) и существенно снижению численности энтеробактерий, в группу которых входит условно-патогенная бактерия Enterococcus - возбудитель колибактериоза.

Пример 3

Использование кормовой добавки, с фитопробиотической активностью в составе корма крупного рогатого скота

Опыт проводили в ЗАО «ПЛЕМЗАВОД БОЛЬШЕВИК» Ленинградской области. Продолжительность опыта составила 60 дней.

Было сформировано 2 группы дойных коров черно-пестрой породы второй и третьей лактации. Животные находились на привязном содержании.

Первая группа контрольная получала основной рацион (ОР) комбикормов.

Вторая группа опытная получала основной рацион (ОР) с кормовой добавкой с фитопробиотической активностью.

Основной рацион содержал: комбикорм - 7 кг, силос - 30 кг, сено - 1,5 кг, пивная дробина - 5 кг, жмых подсолнечный - 1,2 кг, патока - 0,2-1,0 кг (в зависимости от консистенции), минерально-витаминная добавка - 0,2 кг.

Кормовую добавку с фитопробиотической активностью вводили в ОР из расчета 50 г/гол в сутки.

Результаты проведенных исследований приведены в таблице 7 (Продуктивность коров и качество молока дойных коров черно-пестрой породы при использовании кормовой добавки с фитопробиотической активностью).

Из таблицы 7 видно, что за период опыта количество соматических клеток в молоке коров во 2 опытной группе снизилось на 36% по сравнению с животными в 1 контрольной группе. Среднесуточный удой молока натуральной жирности во 2 опытной группе был выше на 0,9 кг. Содержание жира в молоке у животных во 2 опытной группе было выше на 0,07%, что позволило дополнительно получить 1,4 кг молока 4%-ой жирности на 1 голову в сутки.

Полученная разница по сумме молочного жира и белка у коров во 2 опытной группе (53,3 кг и 46,2 кг соответственно) по сравнению с животными в 1 контрольной группе (50,2 кг и 43,2 кг соответственно), может быть обусловлена изменением направленности межуточного обмена. Сопоставимый анализ между группами показывает, что более высокий показатель жирномолочности у животных во 2 опытной группе получили как за счет увеличения надоя, так и увеличения процентного содержания жира и белка в молоке.

Влияние кормовой добавки с фитопробиотической активностью на микрофлору рубца коров дойного стада представлено в таблице 8.

Из таблицы 8 видно, что применение кормовой добавки с фитопробиотической активностью снижает численность патогенов (сем. Helicobacteriaceae, Fusobacteriaceae) и стимулирует развитие полезной микрофлоры рубца (сем. Lachnospiraceae, Ruminococcaceae, Eubacteriaceae).

Полученные результаты на основании Примеров 1-3 подтверждают целесообразность использования новой кормовой добавки с фитопробиотической активностью.

Кормовая добавка с фитопробиотической активностью оказывает комплексное воздействие на состояние здоровья сельскохозяйственных животных. Жизнеспособные бактерии Enterococcus faecium 1-35 способствуют заселению желудочно-кишечного тракта животных нормальной микрофлорой, что в свою очередь повышает переваримость и усвояемость питательных веществ рациона.

Основными источниками экстрактов эфирных масел являются целебные растения эвкалипт, чеснок, лимон, чабрец. Экстракты натуральных эфирных масел в составе кормовой добавки с фитопробиотической активностью обладают антимикробным действием и противовоспалительным эффектом, подавляют развитие патогенной микрофлоры в желудочно-кишечном тракте сельскохозяйственных животных. Проявляя антиоксидантные свойства, экстракты натуральных эфирных масел предохраняют корма от порчи.

Фитопробиотическую активность кормовой добавки определяли с использованием молекулярно-генетического метода на основе T-RFLP-анализа.

ДНК из содержимого кишечника экстрагировали с использованием коммерческого набора DNA Purification Kit (Fermentas, Литва). ПЦР-амплификацию генов 16S рРНК бактерий проводили с использованием праймеров: 63F (CAGGCCTAACACATGCAAGTC) - с меткой на 5′-конце (флуорофор D4 - WellRed); 1492R (TACGGHTACCTTGTTACGACTT).

Амплифицированный фрагмент выделяли из агарозного геля помощью 3М раствора гуанидина тиоционата.

Рестрикцию ампликонов проводили с использованием рестриктаз HaeIII, HhaI и MspI (Fermentas), в течение 2 ч при 37ºС. После окончания рестрикции ДНК из реакционной смеси осаждали этанолом, растворяли в SLS (Весктап Coulter) с последующим добавлением маркера молекулярного веса - 600 п. н. (Beckman Coulter). Следующим этапом анализа являлась флуоресцентная детекция целевой ДНК на автоматическом секвенаторе CEQ8000 (Beckman Coulter).

Вычисление размеров пиков и их площади проводили с использованием программного блока Fragment Analysis (Beckman Coulter). Для идентификации пиков T-RFLP-граммы для трех эндонуклеаз (HaeIII, HhaI и MspI) обрабатывали с помощью программы Fragment Sorter (http://www.oardc.ohio-state.edu/trflpfragsort/index.php).

Предложенная кормовая добавка с фитопробиотической активностью получена по известным биотехнологиям, имеющим широкое применение в сельском хозяйстве, и проведенные опытные работы на базе ФГУП Загорское ЭПХ ВНИТИП Россельхозакадемии, на свиноферме ОАО ПЗ «Пламя» Ленинградской области и в ЗАО «ПЛЕМЗАВОД БОЛЬШЕВИК» Ленинградской области обусловливают, по мнению заявителя, его соответствие критерию «промышленная применимость».

Предложенная кормовая добавка обладает высокой фитобиотической активностью за счет комплексного воздействия смеси жизнеспособных бактерий Enterococcus faecium 1-35, сухого концентрата эфирных масел эвкалипта, чабреца, чеснока и лимона в виде порошка и диатомита в виде обожженной крошки, что позволяет улучшить состояние здоровья, повысить сохранность молодняка и увеличить продуктивность сельскохозяйственных животных и птицы.

Кормовая добавка с фитопробиотической активностью на минеральной основе, используемая в составе корма для сельскохозяйственных животных и птицы и состоящая из жизнеспособных бактерий штамма Enterococcus faecium, растительного сырья и наполнителя, отличающаяся тем, что в качестве наполнителя используют диатомит в виде обожженной крошки, в качестве жизнеспособных бактерий штамма Enterococcus faecium используют штамм бактерий Enterococcus faecium 1-35, депонированный в коллекции Всероссийского государственного научно-исследовательского института контроля, стандартизации и сертификации ветпрепаратов (ВГНКИ) 20.03.2008 под регистрационным номером Enterococcus faecium ВГНКИ 08.03.53-ДЕП, хранящийся в коллекции микроорганизмов ООО «БИОТРОФ», нанесенный на диатомит в виде обожженной крошки и имеющий титр бактерий Enterococcus faecium 1-35 не менее 106 КОЕ/мг, а в качестве растительного сырья используют смесь эфирных масел эвкалипта, чабреца, чеснока и лимона, взятых при соотношении 1:2:1:2, соответственно, нанесенную на диатомит в виде обожженной крошки с получением сухого концентрата смеси эфирных масел эвкалипта, чабреца, чеснока и лимона в виде порошка, при этом кормовая добавка имеет следующий состав, г:

сухой концентрат смеси эфирных масел эвкалипта, чабреца, чеснока и лимона в виде порошка 50-150
бактерии, нанесенные на диатомит в виде обожженной крошки 100
диатомит в виде обожженной крошки 850-750,
и кормовую добавку вводят в состав корма при соотношении как 0,001:1


Похожие патенты:

Изобретение относится к кормопроизводству, а именно к диетологически полноценному продукту для кормления домашних животных. Кормовой продукт содержит, по меньшей мере, два состава для кормления домашних животных, в котором составы отличаются уровнем жиров, белков или углеводов от 6% до 50% по энергетической ценности, причем составы поедаются последовательно, при этом каждый состав поедается в последующие дни.
Изобретение относится к кормопроизводству, в частности к кормовой добавке для лактирующих коров. Кормовая добавка включает зерно злаковых культур, в качестве которого используют пшеничную крупку, сою, патоку, дрожжи, натрия селенит, калия йодид, кобальт сернокислый, витамины A, D3, Е.
Изобретение относится к области приготовления кормов для сельскохозяйственных животных и птицы, а именно к способу производства консервированного корма из биомассы червей.

Изобретение относится к животноводству. Осуществляют введение биодобавки в основной корм поросят-отъёмышей.

Изобретение относится к животноводству, в частности к способу кормления молодняка свиней. Способ включает введение в комбикорм микродобавку, состоящую из 0,5 кг/т биологически активной добавки «Простор» и 100 мг/гол в сутки муки из личинок мухи Hermetia illucens.

Изобретение относится к звероводству, в частности к способу выращивания молодняка пушных зверей. Способ характеризуюется тем, что в рацион молодняка пушных зверей, рожденного от матерей, получавших «Лигногумат КД-Б» во время гона и беременности, в период роста включают «Лигногумат КД-Б» в дозе 0,1-0,3 мл/кг массы тела ежедневно в первые 10 дней каждого месяца.
Изобретение относится к области сельского хозяйства, в частности к птицеводству. Способ включает основное полнорационное питание птицы и выпаивание ей препарата.

Изобретение относится к ветеринарии, в частности к способу профилактики послеродовых заболеваний у свиноматок и повышения жизнеспособности поросят. Способ включает использование жидкой кормовой добавки Вэрва по следующей схеме: свиноматкам с 80-го дня беременности в течение 30 суток вводят с основным рационом жидкую кормовую добавку в дозе 1,0-5,0 мл на животное.

Изобретение относится к кормопроизводству, а именно к кормовой добавке с фитобиотической активностью на минеральной основе, которая может использоваться в составе кормов для сельскохозяйственных животных и птицы.

Изобретение относится к сельскому хозяйству и биотехнологии, а именно к составу кормовой добавки с пробиотической активностью и может быть использовано при приготовлении кормов для сельскохозяйственных животных и птицы.

Изобретение относится к биотехнологии, сельскому хозяйству и ветеринарии, в частности к изготовлению биологически активных добавок для птицеводства. Кормовая добавка для птицеводства содержит комплекс биологически активных веществ и состоит из биомассы и/или культуральной жидкости, полученной при культивировании гриба Medusomyces Gisevii Lindau в смеси с пробиотиком "Бифидобактерин", взятым в концентрации 106-108 КОЕ/мл (г) в хитинсодержащей питательной среде, содержащей в качестве источника хитина порошок подмора пчел. Способ выращивания птицы включает введение в рацион молодняку птицы указанной кормовой добавки в корм или питьевую воду, начиная с суточного возраста двумя 7-10-дневными курсами. Скармливание кормовой добавки птице обеспечивает повышение физиологического и иммунного статуса организма птицы, устраняет дефицит аминокислот, витаминов и микроэлементов в рационе кормления птицы, обеспечивает повышение усвояемости кормов, стимулирование привесов и повышение продуктивности птицы. 2 н.п. ф-лы, 6 табл., 6 пр.

Изобретение относится к отрасли сельского хозяйства, в частности к способу снижения содержания свинца, олова и стронция в организме цыплят-бройлеров. Способ включает дачу корма цыплятам-бройлерам два раза в сутки, при этом в корм вводят ферментный препарат «Ронозим NP (СТ)» в количестве 125-175 мг/кг корма в период с 1 по 42 день жизни. Использование изобретения позволит выводить из организма цыплят-бройлеров одновременно свинец, олово и стронций. 1 табл.

Изобретение относится к способу снижения образования метана, выделяющегося за счет пищеварительной активности жвачных животных и/или повышения продуктивности жвачных животных за счет использования в качестве активного соединения по меньшей мере одного типа органических молекул, соответствующих определённой формуле, замещенных в любом положении по меньшей мере одной нитрооксигруппой, или солей указанных соединений. Указанные соединения вводят животному вместе с кормом. Кроме того, изобретение относится к применению указанных соединений в кормах и кормовых добавках для жвачных животных. Скармливание указанных соединений жвачным животным обеспечивает снижение образования метана в процессе пищеварения и улучшает продуктивность жвачных животных. 3 н. и 14 з.п. ф-лы, 9 табл., 18 пр.

Настоящее изобретение относится к области кормов для домашних животных. В частности, настоящее изобретение обеспечивает композиции кормов для домашних животных, содержащие нереплицирующиеся пробиотичекие микроорганизмы. Эти нереплицирующиеся пробиотические микроорганизмы приводятся в нереплицирующееся состояние тепловой обработкой при 120-150°C в течение 1-120 секунд. Указанная тепловая обработка может являться высокотемпературной/кратковременной (HTST) обработкой или ультравысокотемпературной (UHT) обработкой. Композиция корма для домашних животных может представлять собой корм, питательную диету, кормовую добавку, лакомство или съедобную игрушку для домашних животных. Композиция корма проста в приготовлении и сохраняет полезное пробиотическое действие в течение длительного срока хранения, а также обладает противовоспалительным эффектом и способствует укреплению иммунной системы домашних животных. 12 з.п. ф-лы, 9 ил., 2 пр.

Изобретение относится к сельскохозяйственной биотехнологии, а именно к кормовой добавке с фитопробиотической активностью на минеральной основе, которая может быть использована при приготовлении кормов для сельскохозяйственных животных и птицы. Кормовая добавка состоит из жизнеспособных бактерий штамма Enterococcus faecium, растительного сырья и наполнителя. В качестве наполнителя используют диатомит в виде обожженной крошки. В качестве жизнеспособных бактерий штамма Enterococcus faecium используют штамм бактерий Enterococcus faecium 1-35, депонированный в коллекции Всероссийского государственного научно-исследовательского института контроля, стандартизации и сертификации ветпрепаратов 20.03.2008 под регистрационным номером Enterococcus faecium ВГНКИ 08.03.53-ДЕП, хранящийся в коллекции микроорганизмов ООО «БИОТРОФ», нанесенный на диатомит в виде обожженной крошки и имеющий титр бактерий Enterococcus faecium 1-35 не менее 106 КОЕмг. В качестве растительного сырья используют смесь эфирных масел эвкалипта, чабреца, чеснока и лимона, взятых при соотношении 1:2:1:2, соответственно, и нанесенную на диатомит в виде обожженной крошки с получением сухого концентрата смеси эфирных масел эвкалипта, чабреца, чеснока и лимона в виде порошка. Все исходные компоненты берут в определённом соотношении. Кормовую добавку вводят в состав корма при соотношении как 0,001:1. Осуществление изобретения позволяет расширить ассортимент кормовых добавок с высокой фитопробиотической активностью на минеральной основе. Скармливание кормовой добавки обеспечивает улучшение состояния здоровья, повышение сохранности молодняка и увеличение продуктивности сельскохозяйственных животных и птиц. 8 табл., 3 пр.
