Детекция aad-1 объекта das-40278-9



Детекция aad-1 объекта das-40278-9
Детекция aad-1 объекта das-40278-9
Детекция aad-1 объекта das-40278-9
Детекция aad-1 объекта das-40278-9
Детекция aad-1 объекта das-40278-9
Детекция aad-1 объекта das-40278-9
Детекция aad-1 объекта das-40278-9
Детекция aad-1 объекта das-40278-9
Детекция aad-1 объекта das-40278-9
Детекция aad-1 объекта das-40278-9
Детекция aad-1 объекта das-40278-9

 


Владельцы патента RU 2577143:

ДАУ АГРОСАЙЕНСИЗ ЭлЭлСи (US)

Изобретение относится к области биохимии, в частности к способу определения зиготности растения кукурузы, содержащего трансгенную конструкцию, содержащую ген арилоксиалканоатдиоксигеназы, где указанный способ включает: получение образца геномной ДНК от указанного растения кукурузы; получение приведенного в контакт образца посредством контактирования указанного образца ДНК с первым праймером и вторым праймером и флуоресцентным зондом, определение зиготности указанного растения кукурузы, а также к набору для его осуществления. Изобретение позволяет эффективно определять зиготность растения кукурузы, содержащего ген арилоксиалканоатдиоксигеназы. 2 н. и 13 з.п. ф-лы, 3 ил., 1 табл., 1 пр.

 

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

Ген aad-1 (исходно ген Sphingobium herbicidovorans) кодирует белок арилоксиалканоатдиоксигеназу (AAD-1). Этот признак обеспечивает устойчивость к гербицидам 2,4-дихлорфеноксиуксусной кислоте и арилоксифеноксипропионату (которые обычно обозначают как гербициды "фоп", такие как диклофоп и кизалофоп), и его можно применять в качестве селективного маркера во время трансформации растения, а также в селекционных питомниках. Роль гена aad-1 в устойчивости к гербицидам впервые раскрыта в WO 2005/107437 (см. также US 2009-0093366).

Известны различные способы детекции объекта (event). Однако все они имеют свои недостатки. Один способ представляет собой пиросеквенирование, как описано Winge (Innov. Pharma. Tech. 00:18-24, 2000). По этому способу сконструирован олигонуклеотид, который перекрывается со стыком фланкирующей геномной ДНК и ДНК-вставки. Олигонуклеотид гибридизуют с одноцепочечным ПЦР-продуктом из нужной области (с одним праймером во встроенной последовательности и одним праймером во фланкирующей геномной последовательности) и инкубируют в присутствии ДНК-полимеразы, АТФ, сульфурилазы, люциферазы, апиразы, аденозин-5'-фосфосульфата и люциферина. Отдельно добавляют DNTP и оценивают результаты включения по световому сигналу. При успешной амплификации, гибридизации и удлинении на одно или множество оснований сигнал указывает на наличие вставки/фланкирующей последовательности.

Флуоресцентная поляризация представляет собой другой способ, который можно использовать для детекции ампликона по настоящему изобретению. По этому способу сконструирован олигонуклеотид, который перекрывается со стыком геномной фланкирующей последовательности и ДНК-вставки. Олигонуклеотид гибридизуют с одноцепочечным ПЦР-продуктом из нужной области (с одним праймером во встроенной последовательности и одним праймером во фланкирующей геномной последовательности) и инкубируют в присутствии ДНК-полимеразы и флуоресцентно меченных ddNTP. Однонуклеотидное удлинение приводит к включению ddNTP. Включение можно оценивать по изменению поляризации с применением флюориметра. При успешной амплификации, гибридизации и удлинении на одно основание изменение поляризации указывает на присутствие трансгенной вставки/фланкирующей последовательности.

Описаны молекулярные сигнальные индикаторы для применения в детекции последовательности. В кратком изложении, сконструирован олигонуклеотидный зонд FRET, который перекрывается со стыком геномной фланкирующей последовательности и ДНК-вставки. Благодаря своей уникальной структуре зонд FRET содержит вторичную структуру, которая удерживает флуоресцентные и гасящие фрагменты в непосредственной близости. Зонд FRET и праймеры ПЦР (один праймер во встроенной последовательности и один праймер во фланкирующей геномной последовательности) подвергают циклам гибридизации в присутствии термостабильной полимеразы и dNTP. После успешной ПЦР-амплификации гибридизация зонда FRET с последовательностью-мишенью приводит к удалению вторичной структуры зонда и пространственному отделению флуоресцентной части от нефлуоресцирующей части. В результате этого продуцируется флуоресцентный сигнал. При успешной амплификации и гибридизации этот флуоресцентный сигнал указывает на наличие фланкирующей последовательности/трансгенной вставки.

Анализ на основе гидролиза зондов, иначе известный как метод TAQMAN (PE Applied Biosystems, Foster City, California), представляет собой способ детекции и количественного определения наличия ДНК-последовательности. В кратком изложении, сконструирован олигонуклеотидный зонд FRET, который перекрывается со стыком геномной фланкирующей последовательности и ДНК-вставки. Зонд FRET и ПЦР-праймеры (один праймер во встроенной ДНК и один праймер во фланкирующей геномной ДНК-последовательности) подвергают циклам гибридизации в присутствии термостабильной полимеразы и dNTP. Гибридизация зонда FRET приводит к отщеплению и высвобождению флуоресцентной части от нефлуоресцирующей части на зонде FRET. При успешной амплификации, гибридизации и удлинении на одно основание флуоресцентный сигнал указывает на присутствие фланкирующей последовательности/трансгенной вставки.

Еще одна задача, среди многих других, заключается в поиске подходящего референтного гена для данного теста. Например, как указано в реферате Czechowski et al., "Исключительно большая группа данных, полученных при анализе генома Affymetrix ATH1 GeneChip, предоставляет способы идентификации нового поколения референтных генов с очень стабильными уровнями экспрессии у модельного вида растения Arabidopsis {Arabidopsis thaliana). Найдены сотни генов Arabidopsis, превосходящих традиционно применявшиеся референтные гены в отношении стабильности экспрессии в ходе развития и при различных условиях окружающей среды". (Czechowski et al. (2005) Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol. 139, 5-17.)

Brodmann et al. (2002) описывает количественную ПЦР в реальном времени для детекции содержания трансгенной кукурузы в пище для четырех различных сортов кукурузы, утвержденных Европейским Союзом.

Brodmann, P.D., P.D., Ilg E. C, Berthoud H., and Herrmann, A. Real-Time Quantitative Polymerase Chain Reaction Methods for Four Genetically Modified Maize Varieties and Maize DNA Content in Food. J. of AOAC international 2002 85 (3).

Hernandez et al. (2004) указывает четыре возможных гена для применения в ПЦР в реальном времени.

Hernandez, M., Duplan, M.-N., Berthier, G., Vaitilingom, M., Hauser, W., Freyer, R., Pla, M., and Bertheau, Y. Development and comparison of four real-time polymerase chain reaction systems for specific detection and quantification of Zea mays L. J. Agric. Food Chem. 2004, 52, 4632-4637.

Costa et al. (2007) изучил эти четыре гена (также в контексте ПЦР в реальном времени) и заключил, что гены алкоголь-дегидрогеназы и зеинов представляют собой лучшие референтные гены для детекции образцов "объекта" (гена лектина) в трансгенных продуктах питания. Costa, L. D., and Martinelli L. Development of a Real-Time PCR Method Based on Duplo Target Plasmids for Determining an Unexpected Genetically Modified Soybean Intermix with Feed Components. J. Agric. Food Chem. 2007, 55, 1264-1273.

Huang et al. (2004) применяли плазмиды pMulM2 в качестве референтных молекул для детекции трансгенов MON810 и NK603 у кукурузы. Huang and Pan, "Detection of Genetically Modified Maize MON810 and NK603 by Multiplex and Real-Time Polymerase Chain Reaction Methods," J. Agric. Food Chem., 2004, 52 (11), pp. 3264-3268.

Gasparic et al. (2008) предложили технологию ЗНК, созданную на основе способа циклизации зонда, TaqMan и различных составляющих ПЦР в реальном времени, для количественной оценки объектов кукурузы (таких как MON810). Gasparic, Cankar, ZeI, and Gruden, "Comparison of different realtime PCR chemistries and their suitability for detection and quantification of genetically modified organisms," BMC Biotechnol. 2008; 8: 26.

US 20070148646 относится к способу удлинения праймера для количественной оценки, требующему контролируемого высвобождения отдельных нуклеотидов, которые можно детектировать и количественно оценивать на основе числа включенных нуклеотидов. Этот способ отличается от способа ПЦР TaqMan, в котором применяют целый референтный ген.

Для различения гомозиготных и гемизиготных генотипов TC 1507 успешно проводили анализ Invader для этого объекта. Gupta, M., Nirunsuksiri, W., Schulenberg, G., Hartl, T., Novak, S., Bryan, J., Vanopdorp, N., Bing, J. and Thompson, S. A non-PCR-based Invader Assay Quantitatively Detects Single-Copy Genes in Complex Plant Genomes. MoI. Breeding 2008, 21, 173-181.

Huabang (2009) описывает основанный на ПЦР анализ зиготности трансгенной кукурузы. Однако в этой работе не применяли референтных генов. Huabang, "An Accurate and Rapid PCR-Based Zygosity Testing Method for Genetically Modified Maize," Molecular Plant Breeding, 2009, Vol.7, No.3, 619-623.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение предоставляет способы детекции наличия объекта AAD-1 кукурузы, обозначаемого DAS-40278-9, в образце (например, в зерне кукурузы). (Образцы семян депонированы в Американской коллекции типовых культур (ATCC) под регистрационным номером PTA-10244 (гибридные семена желтой зубовидной кукурузы (Zea Mays L.):DAS-40278-9; депонированы согласно Будапештскому договору Dow AgroSciences LLC; дата получения семян/штамма(ов) в ATTC: 10 июля 2009 года; жизнеспособность подтверждена 17 августа 2009 года.) Также приведены наборы и условия, использованные при проведении анализов.

Более конкретно, настоящее изобретение частично относится к анализу TaqMan ПЦР по конечной точке для объекта AAD-1 кукурузы с применением эндогенных референтных генов кукурузы. Некоторые варианты осуществления направлены на способы анализа зиготности с высокой пропускной способностью. Настоящее изобретение далее частично относится к поиску предпочтительных референтных генов инвертаз для применения в определении зиготности.

Таким образом, это изобретение также частично относится к селекции растений, включающей описанные здесь способы детекции. В некоторых вариантах осуществления указанный объект можно "сочетать" с другими признаками, включая, например, другой (другие) ген(ы) устойчивости к гербицидам и/или белки устойчивости к насекомым. Данные процедуры можно использовать для однозначной идентификации линий кукурузы, содержащих объект по настоящему изобретению.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На фиг. 1 представлена стратегия клонирования ДНК-вставки в объект DAS-40278-9 кукурузы.

На фиг. 2 представлена схема праймеров, использованных в ПЦР-амплификации для подтверждения наличия фланкирующих пограничных областей в объекте DAS-40278-9 кукурузы. Схема отображает расположение праймеров для подтверждения полноразмерного секвенса объекта DAS-40278-9 кукурузы AAD-1 от 5'-конца до 3'-конца.

На фиг. 3 представлена стратегия клонирования для фланкирующих пограничных областей объекта DAS-40278-9 кукурузы. Геномную ДНК объекта кукурузы DAS-40278-9 расщепляли с применением EcoR V, Stu I или Sca I и составляли соответствующие библиотеки GenomeWalker™, которые использовали как матрицу для амплификации нужной ДНК-последовательности.

КРАТКОЕ ОПИСАНИЕ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

SEQ ID NO:1 представляет собой последовательность 5'- и 3'- фланкирующих геномных последовательностей с каждой стороны вставки AAD-1, включая вставку, для объекта DAS-40278-9 кукурузы.

SEQ ID NO:2-7 представляют собой праймеры и зонды для применения по настоящему изобретению.

SEQ ID NO:8 представляет собой пример ампликона объекта.

SEQ ID NO:9 представляет собой пример референтного ампликона.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Трансгенный объект DAS-40278-9 кукурузы AAD-1 (обеспечивающий устойчивость к гербицидам) получали посредством трансформации встряхиванием клеток в суспензии микроигл. Фланкирующие последовательности как 5'-конца, так и 3'-конца этой трансгенной вставки AAD-1 клонировали, секвенировали и анализировали, как описано в USSN 61/235248 (поданной 19 августа 2009 года).

Конструировали специальные праймеры TAQMAN и зонды, как описано в настоящем документе, частично соответствующие последовательностям ДНК, расположенным на 5'-конце соединения вставки и геномной ДНК. Проводили успешный дуплексный анализ объект-специфичности праймеров и зондов посредством ПЦР в реальном времени для 16 различных объектов AAD-1 кукурузы и двух нетрансгенных разновидностей кукурузы с геном инвертазы кукурузы в качестве референтного гена. Разработаны процедуры для обработки результатов объект-специфичного анализа TAQMAN для DAS-40278-9 AAD-1 кукурузы, как описано в настоящем документе.

Последовательность, включающая область стыка хозяйской ДНК растения и интегрированной генной конструкции в этой AAD-1 кукурузе, является уникальной. Ее использовали для проведения объект-специфических анализов (традиционной ПЦР или ПЦР в реальном времени) для детекции наличия AAD-1 кукурузы DAS-40278-9 для тестирования ГМО и определения зиготности растений в размножающейся популяции. Объект-специфический анализ TAQMAN, описанный в настоящем документе, можно применять для обеих целей.

Настоящее изобретение предоставляет анализы для детекции присутствия представляющего интерес трансгенного объекта DAS-40278-9 кукурузы (также известного как pDAS 1740-278) в образце. Аспекты настоящего изобретения включают способы конструирования и/или получения диагностических молекул нуклеиновой кислоты, приведенных в качестве примеров или предоставленных в настоящем документе.

Настоящее изобретение также частично относится к селекции растений, включающей любые из этих способов. В некоторых вариантах осуществления объект по настоящему изобретению можно "сочетать" с другими признаками (например, такими как другой (другие) ген(ы) устойчивости к гербицидам и/или гены(ы), кодирующие белки устойчивости к насекомым). Линии растений, содержащие указанный объект, можно детектировать с применением последовательностей, раскрытых и предоставленных в настоящем документе.

В некоторых вариантах осуществления настоящее изобретение относится к идентификации устойчивых к гербицидам линий кукурузы. Настоящее изобретение частично относится к детекции наличия указанного объекта для выяснения того, несут ли потомки скрещивания представляющий интерес объект. Кроме того, предоставлен способ детекции объекта, полезный, например, с точки зрения соблюдения правил, предписываемых регуляторными органами, дающими разрешение на поступление данного продукта на рынок и требующих, например, наличия на упаковке пищевого продукта информации о том, что он получен из рекомбинантных сельскохозяйственных растений.

Настоящее изобретение частично относится к основанной на флуоресценции обработке результатов анализа TaqMan ПЦР с применением эндогенного гена в качестве референтного (число копий) контроля для анализа зиготности объекта кукурузы AAD-1 с высокой пропускной способностью. Настоящее изобретения частично относится к обнаружению предпочтительного референтного гена, инвертазы. Несколько референтных генов указаны в качестве возможных.

Настоящее изобретение также частично относится к разработке анализа TaqMan ПЦР по конечной точке для AAD-1 объект-специфического анализа зиготности. Далее, настоящее изобретение частично относится к получению тестовых наборов для селекции AAD-1.

Анализы TaqMan по конечной точке основаны на стратегии плюс-минус, где "плюс" обозначает образец, положительный на изучаемый ген, a "минус" обозначает образец, отрицательный на изучаемый ген. В этих анализах, как правило, применяют два набора олигонуклеотидов для определения трансгенной последовательности AAD-1 и генной последовательности дикого типа, соответственно, а также двояко-меченные зонды для измерения содержания трансгенной последовательности и последовательности дикого типа.

Хотя анализ Invader признан надежным способом оценки объектов, он очень чувствителен к качеству ДНК. Кроме того, для анализа необходимо большое количество ДНК. Для анализа Invader также необходимо проведение дополнительного этапа денатурации, в случае неправильного проведения которого анализ Invader может оказаться неуспешным. Кроме того, проведение анализа Invader занимает много времени, что не позволяет эффективно обрабатывать большое количество образцов AAD-1 для проведения анализа в коммерческих целях. Главное преимущество настоящего изобретения заключается в сокращении времени анализа и исключении этапа денатурации.

Рассматриваемый анализ TaqMan по конечной точке для детекции AAD-1 объектов предоставляет неожиданные преимущества по сравнению с анализом Invader, особенно при обработке большого количества образцов.

Настоящее изобретение может помочь получать и описывать признаки устойчивости AAD-1 к гербицидам у сельскохозяйственных культур, включая кукурузу, сою и хлопок.

Определения и примеры предоставлены в настоящем документе для удобства описания настоящего изобретения и для указания специалистам в данной области способов осуществления изобретения. Если не указано иначе, термины следует понимать согласно традиционному применению специалистами в соответствующей области. Использована система обозначения оснований ДНК, приведенная в 37 CFR §1.822. Как применяют в настоящем документе, термин "потомство" обозначает потомков любого поколения родительского растения, которое содержит объект DAS-40278-9 кукурузы AAD-1.

Трансгенный "объект" (event) получают трансформацией растительных клеток гетерологичной ДНК, т.е. конструкцией нуклеиновой кислоты, которая включает необходимый трансген, с последующей регенерацией популяции растений в результате встраивания трансгена в геном растения и отбора конкретного растения, характеризующегося наличием вставки в конкретном положении генома. Термин "объект" относится к исходному трансформанту и потомству этого трансформанта, которое включает гетерологичную ДНК. Термин "объект" также означает потомство, продуцированное путем полового ауткроссинга между данным трансформантом и другим сортом, который включает гетерологичную ДНК. Даже после повторного возвратного скрещивания с рекуррентным родителем встроенная ДНК и фланкирующая ДНК от трансформированного родителя присутствует в потомстве этого кросса в том же самом положении хромосомы. Термин "объект" также означает ДНК от исходного объекта, содержащего встроенную ДНК и фланкирующую геномную последовательность, непосредственно смежную со встроенной ДНК, которая, как ожидают, должна передаваться потомству, которое наследует встроенную ДНК, включающую нужный трансген, переданный в результате полового скрещивания родительской линии, содержащей встроенную ДНК (например, исходный трансформант и потомство, полученное в результате самоопыления), с родительской линией, которая не содержит встроенной ДНК.

"Последовательность стыка" охватывает область, в которой встроенная в геном ДНК стыкуется с ДНК природного генома кукурузы, фланкирующей сайт инсерции. В нее включены последовательности ДНК, охватывающие вставки в объекты кукурузы, описанные в настоящем документе, и имеющие одинаковую длину с фланкирующими ДНК.

Настоящее изобретение относится к идентификации нужного объекта. Соответствующие ПЦР-праймеры и ампликоны включены в изобретение. Эти молекулы можно использовать для детекции или определения коммерческих разновидностей трансгенной кукурузы или линий, полученных от рассматриваемых линий трансгенной кукурузы.

Полная последовательность вставки вместе с участками соответствующих фланкирующих последовательностей представлена в настоящем документе в SEQ ID NO: 1. Сайты вставки и фланкирующих последовательностей для этого объекта в отношении SEQ ID NO: 1 (всего 8557 пар нуклеотидов) приведены ниже.

Компоненты AAD-1 вставки и фланкирующих последовательностей для этого объекта далее приведены на фиг. 1-3.

Способы детекции по настоящему изобретению можно использовать в сочетании с селекцией растений для определения того, какие потомки содержат данный объект после скрещивания родительского растения, содержащего представляющий интерес объект, с растением другой линии с целью внесения одного или нескольких дополнительных признаков, представляющих интерес, в потомство. Способы по изобретению можно применять, например, в программах селекции кукурузы, а также в контроле качества, особенно для трансгенных семян кукурузы, применяемых в коммерческих целях. Это также может облегчить регистрацию продуктов и управление производством. Эти способы можно использовать для улучшенных стратегий селекции.

В некоторых вариантах осуществления основанный на флуоресценции анализ TaqMan по конечной точке для определения зиготности позволяет непосредственно анализировать результаты в спектрофотометре для чтения планшетов с идентификацией AAD-1 объекта в кукурузе и референтного гена.

Настоящее изобретение включает области применения в селекции, такие как анализ интрогрессии AAD-1 объекта в другие линии кукурузы.

Способы детекции и наборы по настоящему изобретению можно использовать для определения объектов согласно настоящему изобретению. Способы и наборы по настоящему изобретению можно использовать для улучшенных стратегий селекции и анализа сцепления генов.

Способы детекции по настоящему изобретению особенно эффективны в сочетании с селекцией растений для определения того, какие потомки содержат данный объект после скрещивания родительского растения, содержащего представляющий интерес объект, с растением другой линии с целью передачи одного или нескольких дополнительных признаков, представляющих интерес, потомству. Эти способы анализа Taqman ПЦР эффективны для применения в программах селекции кукурузы, а также в контроле качества, особенно для коммерчески используемых семян кукурузы. Также можно получать и применять наборы Taqman ПЦР для таких линий трансгенной кукурузы. Это также может быть эффективным для регистрации продуктов и управления производством.

Более того, указанные способы можно использовать для изучения и описания процесса интеграции трансгена, описания геномного сайта интеграции, сортировки объектов, стабильности трансгенов и их фланкирующих последовательностей и генной экспрессии (особенно относящейся к подавлению транскрипции гена, паттернам метилирования трансгена, эффекту положения и потенциально связанным с экспрессией элементами, такими как MARS [районы присоединения к ядерному матриксу], и т.п.).

Как применяют в настоящем документе, термин "кукуруза" означает маис (Zea mays) и включает все его разновидности, которые можно скрестить с кукурузой.

Настоящее изобретение далее включает способы скрещивания и применение способов по настоящему изобретению. Например, настоящее изобретение включает способ получения гибридных семян F1 посредством скрещивания представленного в качестве примера растения с другим (например, инбредным родительским) растением с получением гибридных семян, и детекцию необходимого объекта. Качества полученных растений можно также улучшать посредством объединения способов по настоящему изобретению.

Устойчивые к гербицидам растения кукурузы можно скрещивать посредством полового скрещивания первого родительского растения, представляющего собой растение кукурузы, выращенное из семян линии, указанной в настоящем документе, со вторым родительским растением кукурузы с получением множества растения первого поколения; и затем отбора растения первого поколения, устойчивого к гербициду (или несущего рассматриваемый объект); и самоопыления растений первого поколения с получением множества растения второго поколения; и затем отбора из растений второго поколения растения, устойчивого к гербициду (или несущего, по меньшей мере, один из объектов). Эти этапы могут далее включать возвратное скрещивание растения первого поколения или растения второго поколения со вторым родительским растением кукурузы или третьим родительским растением кукурузы. Урожай зерна, содержащий семена кукурузы по настоящему изобретению, или их потомство, можно высаживать.

Также необходимо понимать, что два различных трансгенных растения также можно скрещивать с получением потомства, которое содержит два независимо сегрегирующихся экзогенных гена. В результате самоопыления соответствующего потомства можно получать растения, гомозиготные по обоим этим экзогенным генам. В настоящем изобретении также рассматривается возвратное скрещивание с родительским растением и ауткроссинг с нетрансгенным растением, а также вегетативное размножение. Другие способы скрещивания, общеупотребительные для различных признаков и культур, также известны в данной области. Возвратное скрещивание применяли для переноса генов, кодирующих признаки с простым доминантным наследованием, в нужную гомозиготную культурную или инбредную линию, которая представляет собой рекуррентного родителя. Растение-носитель признака, подлежащего переносу, называют родителем-донором. Ожидают, что полученное растение несет признаки рекуррентного родителя (например, культурного сорта) и желаемый признак, полученный от родителя-донора. После первого скрещивания отбирают растения, обладающие фенотипом родителя-донора, и повторно скрещивают их (возвратное скрещивание) с рекуррентным родителем. Ожидают, что полученное растение несет признаки рекуррентного родителя (например, культурного сорта) и желаемый признак, полученный от родителя-донора.

Настоящее изобретение можно использовать в сочетании со способом скрещивания с применением маркера (MAB). Также молекулы ДНК по настоящему изобретению можно использовать с другими способами (такими как маркеры AFLP, маркеры RFLP, маркеры RAPD, SNP и SSR), которые позволяют идентифицировать генетически сцепленные агрономически полезные признаки. Признаки устойчивости к гербицидам можно отслеживать у потомства кросса (или потомков этого потомства и любых других культурных сортов или разновидностей кукурузы) с применением способов MAB. Способы по настоящему изобретению можно использовать для идентификации любых разновидностей кукурузы, несущих представляющий интерес объект.

Способы по настоящему изобретению включают способ получения устойчивых к гербицидам растений кукурузы, где указанный способ включает скрещивание с растением, несущим представляющий интерес объект. Предпочтительные способы дополнительно включают отбор потомков от указанного кросса посредством проверки указанного потомства на наличие объекта, детектируемых согласно настоящему изобретению. Например, настоящее изобретение можно использовать для отслеживания нужного объекта в циклах скрещивания растений, несущих желаемые признаки, такие как агрономические признаки. Растения, содержащие нужный объект и желаемые признаки, можно, например, детектировать, идентифицировать, отбирать и быстро применять в дальнейших циклах скрещивания. Нужный объект/признак можно также сочетать посредством скрещивания с признаком (признаками) устойчивости к насекомым и/или дополнительными признаками устойчивости к гербицидам и отслеживать согласно настоящему изобретению. Один предпочтительный вариант осуществления представляет собой растение, содержащее нужный объект в сочетании с геном, кодирующим устойчивость к гербицидам имидазолинону, глифосату и/или глуфосинату. В некоторых вариантах осуществления можно применять ген устойчивости к дикамбе.

Таким образом, настоящее изобретение можно комбинировать с, например, генами, кодирующими устойчивость к глифосату (например, устойчивое растение или бактериальные EPSPS, GOX, GAT), устойчивость к глуфосинату (например, Pat, bar), устойчивость к гербицидам, ингибирующим ацетолактатсинтазу (ALS) (например, имидазолинонам [таким как имазетапир], сульфонилкарбамиду, триазолопиримидина сульфонанилиду, пиримидинилтиобензоатам и другим химическим соединениям [Csrl, SurA, et al.]), устойчивость к бромоксинилу (например, Bxn), устойчивость к ингибиторам фермента HPPD (4-гидроксифенил-пируват-диоксигеназа), устойчивость к ингибиторам фитоен десатуразы (PDS), устойчивость к гербицидам, ингибирующим фотосистему II (например, psbA), устойчивость к гербицидам, ингибирующим фотосистему I, устойчивость к гербицидам, ингибирующим протопорфириноген оксидазу IX (PPO) (например, PPO-I), устойчивость к гербицидам фенилуреи (например, CYP76B1), дикамба-разрушающим ферментам (см., например, US 20030135879), и другими, которые можно сочетать по отдельности или в сложных комбинациях для предоставления возможности эффективного контроля или предотвращения заражения сорными растениями и/или устойчивости к гербицидам указанных выше классов.

В отношении дополнительных гербицидов некоторые дополнительные предпочтительные ALS (также известные как AHAS) ингибиторы включают триазолопиримидина сульфонанилиды (такие как клорансулам-метил, диклосулам, флорасулам, флуметсулам, метосулам и пеноксулам), пиримидинилтиобензоаты (такие как биспирибак и пиритиобак) и флукарбазон. Некоторые предпочтительные ингибиторы HPPD включают мезотрион, изоксафлютол и сулькотрион. Некоторые предпочтительные ингибиторы PPO включают флумиклорак, флумиоксазин, флуфенпир, пирафлуфен, флутиацет, бутафенацил, карфентразон, сульфентразон и дифенилэфиры (такие как ацифлуорфен, фомесафен, лактофен и оксифлуорфен).

Кроме того, AAD-1 по отдельности или в сочетании с одним или несколькими дополнительными признаками HTC можно сочетать с одним или несколькими дополнительными первичными (например, устойчивость к насекомым, устойчивость к грибам или устойчивость к стрессу и др.) или вторичными (например, повышенная урожайность, улучшенные характеристики масел, повышенное качество волокон и др.) признаками. Таким образом, настоящее изобретение можно применять для предоставления полного агрономического набора, включающего улучшенное качество культуры и возможность гибкого контроля любого количества сельскохозяйственных вредителей с оптимальными затратами.

Как применяют в настоящем документе, "линия" представляет собой группу растений, которая характеризуется низким генетическим разнообразием или ее отсутствием между индивидуумами для, по меньшей мере, одного признака. Такие линии можно получать посредством самоопыления и отбора для нескольких последовательных поколений, или посредством вегетативного размножения одного родительского растения с применением способов тканевой или клеточной культуры.

Как применяют в настоящем документе, термины "культурный сорт" и "разновидность" являются синонимами и относятся к линии, которую применяют для коммерческого производства.

"Стабильность" или "стабильный" означает, что в отношении данного компонента компонент получают от поколения к поколению, и, предпочтительно, по меньшей мере, в течение трех поколений, на практически одинаковом уровне, например, предпочтительно ±15%, более предпочтительно ±10%, наиболее предпочтительно ±5%. На стабильность может влиять температура, место, стресс и время посадки. При сравнении последовательных поколений в полевых условиях уровни получения компонента должны быть сходными.

Под "коммерческой пригодностью" понимают высокую мощность растений и высокую фертильность, в связи с чем урожай могут получать фермеры, применяющие традиционное фермерское оборудование, а из семян можно выделять масло с описанными компонентами с применением традиционного дробильного и экстракционного оборудования. Коммерчески пригодный урожай при оценке по массе семян, содержанию масла и общему количеству масла, получаемому в расчете на акр, отличается не более 15% от среднего урожая сопоставимой коммерческой разновидности кукурузы без признаков исключительных признаков, растущей в том же регионе.

"Агрономически ценный" означает, что линия обладает желаемыми агрономическими характеристиками, такими как урожайность, спелость, устойчивость к заболеваниям и т.п., в дополнение к устойчивости к насекомым, обусловленной рассматриваемым(и) объектом (объектами). Агрономические признаки рассматривают по отдельности или в сочетании.

Специалисты в данной области в свете настоящего изобретения должны понимать, что предпочтительные варианты осуществления наборов для детекции, например, могут включать зонды и/или праймеры. Например, они включают полинуклеотидные зонды, праймеры и/или ампликоны, как указано в настоящем документе.

Специалисты в данной области также должны понимать, что можно конструировать праймеры и зонды для гибридизации в диапазоне стандартных условий гибридизации и/или ПЦР с участком SEQ ID NO:1 (или комплементарной последовательности) и комплементарными ему последовательностями, где праймер или зонд не полностью комплементарны приведенной в качестве примера последовательности. Таким образом, можно допускать некоторую степень нарушения комплементарности. Например, для праймера длиной в приблизительно 20 нуклеотидов, как правило, один или два или т.п. нуклеотидов могут не связываться с противолежащей нитью, если некомплементарное основание является внутренним или находится на конце праймера, противоположном ампликону. Различные подходящие условия гибридизации приведены ниже. Синтетические аналоги нуклеотидов, такие как инозин, также можно использовать в зондах. Также можно использовать зонды из пептидных нуклеиновых кислот (ПНК), а также ДНК- и РНК-зонды. Важно, что такие зонды и праймеры являются диагностическими признаками (способными однозначно идентифицировать и различать) на наличие объекта по настоящему изобретению.

Компоненты каждой "вставки" приведены на фиг. 1-3. Полинуклеотидные последовательности ДНК этих компонентов или их фрагментов можно использовать в качестве ДНК-праймеров или зондов в способах по настоящему изобретению.

В некоторых вариантах осуществления изобретения предоставлены композиции и способы детекции наличия области-вставки трансген/геном у растений и семян и т.п. кукурузы.

В некоторых вариантах осуществления последовательности ДНК, содержащие смежный фрагмент новой области-вставки трансген/геном, представляют собой аспекты по настоящему изобретению. Включены последовательности ДНК, содержащие достаточное количество полинуклеотидов из последовательности трансгенной вставки и достаточное количество полинуклеотидов из геномной последовательности кукурузы и/или последовательности, применяемой в качестве последовательности праймера для получения ампликона для диагностики одного или нескольких таких растений кукурузы.

Связанные с этим варианты осуществления относятся к последовательностям ДНК, содержащим, по меньшей мере, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 или более последовательных нуклеотидов трансгенного участка последовательности ДНК, приведенной в настоящем документе, или комплементарных ей последовательностей. Такие последовательности можно применять в качестве ДНК-праймеров в способах амплификации ДНК. Ампликоны, полученные с применением этих праймеров, являются диагностическими признаками наличия объекта кукурузы, указанного в настоящем документе. Таким образом, изобретение также включает ампликоны, полученные с применением таких ДНК-праймеров и гомологичных праймеров.

Настоящее изобретение включает способы детекции наличия в образце ДНК, соответствующей ДНК объекта кукурузы, указанного в настоящем документе. Такие способы могут включать этапы: (а) контактирования биологического образца с парой праймеров, которые при применении в реакции амплификации нуклеиновой кислоты с указанной ДНК продуцируют ампликон, который представляет собой диагностический показатель присутствия указанного(ых) объекта(ов); (b) проведения реакции амплификации нуклеиновой кислоты с получением ампликона; и (с) детекции указанного ампликона.

Дальнейшие способы детекции по настоящему изобретению включают способ детекции присутствия в образце ДНК, соответствующей, по меньшей мере, одному из указанных объектов, где указанный способ включает этапы: (а) контактирования биологического образца с зондом, который гибридизуется в жестких условиях гибридизации с указанной ДНК и не гибридизуется в жестких условиях гибридизации с ДНК контрольного растения кукурузы (не содержащего представляющую интерес встроенную ДНК); (b) создания жестких условий гибридизации для указанного образца и зонда; и (с) детекции гибридизации указанного зонда с ДНК.

Настоящее изобретение включает способы детекции присутствия в образце ДНК от, по меньшей мере, одного растения кукурузы, указанного в настоящем документе. Такие способы могут включать этапы: (a) контактирования биологического образца с парой праймеров, которые при применении в реакции амплификации нуклеиновой кислоты с указанной ДНК продуцируют ампликон, который представляет собой диагностический показатель присутствия указанного(ых) объекта(ов); (b) проведения реакции амплификации TAQMAN ПЦР, используя референтный ген, указанный в настоящем документе; и (c) анализа результатов.

В дополнительных вариантах осуществления настоящее изобретение включает способы получения растения кукурузы, содержащего AAD-1 объект по настоящему изобретению, где указанный способ включает этапы: (a) полового скрещивания первой родительской линии кукурузы (содержащей экспрессирующие кассеты по настоящему изобретению, которые предоставляют указанный признак устойчивости к гербицидам растениям указанной линии) и второй родительской линии кукурузы (лишенной признака устойчивости к гербицидам) с получением множества растений-потомков; и (b) отбора потомков с применением молекулярных маркеров. Такие способы необязательно содержат дальнейший этап возвратного скрещивания потомства со второй родительской линией кукурузы с получением гомозиготного растения, несущего указанный признак устойчивости к гербицидам.

По другому аспекту изобретения предоставлены способы определения зиготности потомства кросса с применением рассматриваемого объекта. Указанные способы могут включать контактирование образца, содержащего ДНК кукурузы, с парой праймеров по настоящему изобретению. Указанные праймеры при применении в реакции амплификации нуклеиновой кислоты с указанной ДНК продуцируют первый ампликон, который представляет собой диагностический признак наличия, по меньшей мере, одного из указанных объектов кукурузы. Такие способы дополнительно включают проведение реакции амплификации нуклеиновой кислоты с получением первого ампликона; детекцию первого ампликона; и контактирование образца, содержащего ДНК кукурузы, с парой указанных праймеров, которые при применении в реакции амплификации нуклеиновой кислоты с геномной ДНК растений кукурузы продуцируют второй ампликон, содержащий природную геномную ДНК кукурузы, гомологичную геномной области кукурузы; и проведение реакции амплификации нуклеиновой кислоты с получением второго ампликона. Способы дополнительно содержат детекцию второго ампликона и сравнение первого и второго ампликонов в образце, где наличие обеих ампликонов указывает на то, что образец является гетерозиготным по трансгенной вставке.

Наборы для детекции ДНК можно получать с применением композиций, описываемых в настоящем документе, и способов, хорошо известных в области детекции ДНК. Наборы эффективны для идентификации ДНК рассматриваемого объекта кукурузы в образце, и их можно применять в способах скрещивания растений кукурузы, содержащих такую ДНК. Наборы содержат последовательности ДНК, гомологичные или комплементарные ампликонам, например, описываемым в настоящем документе, или последовательностям ДНК, гомологичным или комплементарным ДНК, содержащейся в трансгенных генетических элементах рассматриваемых объектов. Эти последовательности ДНК можно использовать в реакциях амплификации ДНК или в качестве зондов в способе гибридизации ДНК. Наборы могут также содержать реагенты и материалы, необходимые для проведения детекции.

"Зонд" представляет собой выделенную молекулу нуклеиновой кислоты, связанную со стандартной детектируемой меткой или репортерной молекулой (такой как радиоактивный изотоп, лиганд, хемилюминесцентное средство или фермент). Такой зонд комплементарен последовательности нуклеиновой кислоты-мишени, а в случае настоящего изобретения - последовательности геномной ДНК, происходящей от одного из указанных объектов кукурузы, либо от растения кукурузы, либо от образца, включающего ДНК данного объекта. Зонды по настоящему изобретению включают не только дезоксирибонуклеиновые или рибонуклеиновые кислоты, но также полиамиды и другие материалы-зонды, которые специфически связываются с ДНК-последовательностью-мишенью и которые можно применять для детекции присутствия такой ДНК-последовательности-мишени.

"Праймеры" представляют собой выделенные/синтезированные нуклеиновые кислоты, которые отжигаются с комплементарной ДНК-последовательностью-мишенью с образованием гибрида между праймером и ДНК-последовательностью-мишенью с последующим удлинением вдоль цепи ДНК-мишени посредством полимеразы, например, ДНК-полимеразы. Пары праймеров по настоящему изобретению применяют для амплификации последовательности-мишени нуклеиновой кислоты, например, посредством полимеразной цепной реакции (ПЦР) или других традиционных способов амплификации нуклеиновых кислот.

Длина зондов и праймеров составляет, как правило, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499 или 500 полинуклеотидов или более. Такие зонды и праймеры специфично гибридизуются с последовательностью-мишенью при строгих условиях гибридизации. Предпочтительно последовательности зондов и праймеров по настоящему изобретению полностью совпадают с последовательностью-мишенью, хотя традиционными способами можно конструировать зонды, отличающиеся от последовательности-мишени и сохраняющие способность гибридизоваться с последовательностью-мишенью.

Способы получения и применения зондов и праймеров описаны, например, в Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989. Пары ПЦР-праймеров можно получать из известной последовательности, например, с применением компьютерных программ, предназначенных для этой цели.

Праймеры и зонды, сконструированные на основе фланкирующих ДНК и последовательностей-вставок, описанных в настоящей заявке, можно применять для подтверждения (и, при необходимости, корректировки) рассматриваемых последовательностей традиционными способами, например, посредством повторного клонирования и секвенирования таких последовательностей.

Зонды нуклеиновых кислот и праймеры по настоящему изобретению гибридизуются в жестких условиях с ДНК последовательностью-мишенью. Для детекции наличия в образце ДНК трансгенного объекта можно применять любой традиционный способ гибридизации или амплификации нуклеиновой кислоты. Молекулы нуклеиновой кислоты или их фрагменты способны к специфической гибридизации с другими молекулами нуклеиновой кислоты при определенных условиях. Как применяют в настоящем документе, указано, что две молекулы нуклеиновой кислоты способны специфически гибридизоваться друг с другом, если указанные две молекулы способны к образованию антипараллельной двухцепочечной структуры нуклеиновой кислоты. Молекулу нуклеиновой кислоты считают "комплементарной" другой молекуле нуклеиновой кислоты, если они имеют полную комплементарность. Как применяют в настоящем документе, считают, что молекулы имеют "полную комплементарность", если каждый нуклеотид одной молекулы комплементарен нуклеотиду другой молекулы. Считают, что две молекулы имеют "минимальную комплементарность", если они могут гибридизоваться друг с другом со стабильностью, достаточной для их гибридизации друг с другом, по меньшей мере, в стандартных условиях "низкой жесткости". Аналогично, считают, что молекулы "комплементарны", если они могут гибридизоваться друг с другом со стабильностью, достаточной для их гибридизации друг с другом в стандартных условиях "высокой жесткости". Стандартные условия жесткости описаны в Sambrook et al., 1989. Таким образом, отклонения от полной комплементарности допустимы при условии, что такие отклонения никак не препятствуют способности молекул образовывать двухцепочечные структуры. Чтобы молекула нуклеиновой кислоты служила в качестве праймера или зонда, необходимо только, чтобы степень ее комплементарности нужной последовательности была достаточной для образования стабильной двухцепочечной структуры в конкретном растворителе и в конкретных концентрациях соли.

Как применяют в настоящем документе, по существу гомологичная последовательность представляет собой последовательность нуклеиновой кислоты, специфически гибридизующуюся с комплементом последовательности нуклеиновой кислоты, с которой ее сравнивают, в условиях высокой жесткости. Термин "жесткие условия" функционально определяют в отношении гибридизации нуклеиновокислотного зонда с нуклеиновой кислотой-мишенью (т.е. с определенной последовательностью нуклеиновой кислоты, представляющей интерес) посредством способов гибридизации, описанных в Sambrook et al., 1989, в 9.52-9.55. См. также Sambrook et al., 1989 в 9.47-9.52 и 9.56-9.58. Таким образом, нуклеотидные последовательности по изобретению можно использовать благодаря их способности специфично образовывать двойные молекулы с комплементарными участками фрагментов ДНК.

В зависимости от области применения можно использовать различные условия гибридизации для достижения различных степеней специфичности зонда к последовательности-мишени. Для областей применения, требующих высокой специфичности, как правило, применяют относительно жесткие условия для получения гибридов, например, применяют условия с относительно низкой концентрацией соли и/или высокой температурой, такие как от приблизительно 0,02 M до приблизительно 0,15 M NaCl при температуре от приблизительно 50°C до приблизительно 70°C. Жесткие условия, например, могут включать, по меньшей мере, двукратную промывку фильтра для гибридизации буфером для промывки в условиях высокой жесткости (0,2X SSC, 0,1% SDS, 65°C). Подходящие условия жесткости, которые способствуют гибридизации ДНК, например, 6,0X хлорид натрия/цитрат натрия (SSC) при приблизительно 45°C с последующей промывкой 2,0X SSC при 50°C, известны специалистам в данной области. Например, концентрация соли на этапе промывки может варьировать от концентрации, используемой в условиях низкой жесткости и составляющей приблизительно 2,0X SSC при 50°C, до концентрации, используемой в условиях высокой жесткости и составляющей приблизительно 0,2X SSC при 50°C. Кроме того, температуру на этапе промывки можно увеличивать от комнатной температуры, используемой в условиях низкой жесткости и составляющей приблизительно 22°C, до температуры, используемой в условиях высокой жесткости и составляющей приблизительно 65°C. Можно изменять одновременно и температуру, и концентрацию соли, или можно поддерживать температуру на постоянном уровне, изменяя концентрацию соли, и наоборот. Такие избирательные условия не допускают несовпадения, или допускают только небольшое несовпадение, между зондом и матричной цепью или цепью-мишенью. Детекция последовательности ДНК посредством гибридизации хорошо известна специалистам в данной области, и патенты США №№ 4965188 и 5176995 предоставляют примеры способов анализа гибридизации.

В особенно предпочтительном варианте осуществления нуклеиновая кислота по настоящему изобретению специфически гибридизуется с одним или несколькими праймерами (или ампликонами или другими последовательностями), приведенными в качестве примеров или предоставленными в настоящем документе, включая их комплементы и фрагменты, в условиях высокой жесткости. В одном из аспектов настоящего изобретения молекула нуклеиновой кислоты по настоящему изобретению имеет последовательность нуклеиновой кислоты, представленную в SEQ ID NO:2-7, или ее комплементы и/или фрагменты.

В другом аспекте настоящего изобретения последовательность маркерной молекулы нуклеиновой кислоты по настоящему изобретению на 80-100% или 90-100% идентична последовательности такой нуклеиновой кислоты. В дополнительном аспекте настоящего изобретения последовательность маркерной молекулы нуклеиновой кислоты по настоящему изобретению на 95-100% идентична такой последовательности. Такие последовательности можно использовать в качестве маркеров в способах скрещивания растений для идентификации потомства генетических кроссов. Гибридизацию зонда с молекулой ДНК-мишени можно детектировать различными способами, известными специалистам в данной области, причем эти способы включают в качестве неограничивающих примеров флуоресцентные метки, радиоактивные метки, метки на основе антител и хемилюминесцентные метки.

Что касается амплификации последовательности нуклеиновой кислоты-мишени (например, посредством ПЦР) с применением определенной пары праймеров для амплификации, "жесткие условия" представляют собой условия, которые позволяют паре праймеров гибридизоваться только с последовательностью нуклеиновой кислоты-мишени, с которой связывается праймер, содержащий соответствующую последовательность дикого типа (или ее комплемент), с предпочтительным получением уникального продукта амплификации, ампликона.

Термин "специфический для (последовательности-мишени)" означает, что зонд или праймер гибридизуется в жестких условиях гибридизации только с последовательностью-мишенью в образце, содержащем последовательность-мишень.

Как применяют в настоящем документе, "амплифицированная ДНК" или "ампликон" относится к продукту нуклеиновокислотной амплификации последовательности нуклеиновой кислоты-мишени, которая является частью матричной нуклеиновой кислоты. Например, чтобы определить, содержит ли растение кукурузы, полученное в результате полового скрещивания, геномную ДНК трансгенного объекта, происходящего от растения кукурузы по настоящему изобретению, ДНК, выделенную из образца ткани растения кукурузы, подвергают нуклеиновокислотной амплификации с применением пары праймеров, которая включает один праймер, происходящий от фланкирующей последовательности в геноме растения, смежной с сайтом инсерции встроенной гетерологичной ДНК, и второй праймер, происходящий от встроенной гетерологичной ДНК, с получением ампликона, который является диагностическим признаком наличия трансгенной ДНК. Длина и последовательность ампликона также являются диагностическими признаками наличия объекта. Длина такого ампликона может варьировать, составляя общую длину пар праймеров плюс одна пара нуклеотидов, и/или общую длину пар праймеров плюс приблизительно 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 750, 1000, 1250, 1500, 1750, 2000 или более пар нуклеотидов (плюс или минус значения удлинения, приведенные выше). Альтернативно, пара праймеров может происходить от фланкирующей последовательности с обеих сторон встроенной ДНК, так, чтобы продуцировать ампликон, включающий всю встроенную нуклеотидную последовательность. Член пары праймеров, происходящий от геномной последовательности растения, может находиться на расстоянии от встроенной последовательности ДНК. Это расстояние может варьировать от одной пары нуклеотидов до приблизительно двадцати тысяч пар нуклеотидов. В частности, применение термина "ампликон" исключает димеры праймеров, которые могут образовываться в реакции термоамплификации ДНК.

Амплификацию нуклеиновых кислот можно проводить различными способами амплификации нуклеиновых кислот, известными в данной области, которые включают полимеразную цепную реакцию (ПЦР). Ряд способов амплификации известны в данной области и описаны, в том числе, в патенте США № 4683195 и патенте США № 4683202. Разработаны способы ПЦР-амплификации для амплификации до 22 т.п.н. геномной ДНК. Эти способы, а также другие известные в данной области способы амплификации ДНК, можно применять в практическом осуществлении настоящего изобретения. Последовательность гетерологичной трансгенной ДНК-вставки или фланкирующей геномной последовательности, происходящей от рассматриваемого объекта кукурузы, можно подтверждать (и при необходимости корректировать) посредством амплификации таких последовательностей указанного объекта с применением праймеров, происходящих от последовательностей, приведенных в настоящем документе, с последующим проведением стандартного секвенирования ДНК ПЦР-ампликона или клонированной ДНК.

Ампликон, который получают этими способами, можно детектировать различными способами. Электрофорез в агарозном геле и окрашивание бромистым этидием представляет собой традиционный хорошо известный способ детекции ДНК-ампликонов. Другой такой способ представляет собой анализ генетического кода, в котором конструируют ДНК-олигонуклеотид, перекрывающийся как со смежной фланкирующей геномной последовательностью ДНК, так и со встроенной последовательностью ДНК. Олигонуклеотид иммобилизуют на лунках микролуночного планшета. После проведения ПЦР нужной области (с применением одного праймера во встроенной последовательности и одного праймера в смежной фланкирующей геномной последовательности) одноцепочечный ПЦР-продукт можно гибридизовать с иммобилизованным олигонуклеотидом, и он может служить в качестве матрицы для реакции удлинения на одно основание с применением ДНК-полимеразы и меченых ddNTP, специфических к следующему предполагаемому основанию. Считывание данных можно проводить посредством флуоресцентного анализа или ELISA-анализа. При успешной амплификации, гибридизации и удлинении на одно основание сигнал указывает на присутствие вставки/фланкирующей последовательности.

Все патенты, патентные заявки, предварительные заявки и публикации, упоминаемые или цитируемые в настоящем документе, в полном объеме включены путем ссылки в той степени, в которой они соответствуют идее настоящего изобретения.

Применяют приведенные ниже сокращения, если не указано иначе.

AAD-1 арилоксиалканоатдиоксигеназа-1
п.н. пара нуклеотидов
°C градусы Цельсия
ДНК дезоксирибонуклеиновая кислота
DIG дигоксигенин
ЭДТА этилендиаминтетрауксусная кислота
т.п.н. тысяча пар нуклеотидов
мкг микрограмм
мкл микролитр
мл миллилитр
M молярная масса
OLP перекрывающийся зонд
ПЦР полимеразная цепная реакция
PTU единица транскрипции растения
SDS додецилсульфат натрия
SOP стандартная методика работы
SSC буферный раствор, содержащий смесь хлорида натрия и цитрата натрия, pH 7,0
TBE буферный раствор, содержащий смесь триса, борной кислоты и ЭДТА, pH 8,3
V вольт

ПРИМЕРЫ

Пример 1. Объект-специфичный анализ Taqman

Объект-специфичный анализ Taqman разработан для детекции наличия объекта кукурузы DAS-40278-9 и определения типа зиготности растений в размножающихся популяциях. Для проведения объект-специфического анализа разработаны специфичные праймеры и зонды Taqman на основе последовательности ДНК, расположенной в области 5'-конца стыка трансген-геном. Для специфической детекции DAS-40278-9 амплифицировали фрагмент ДНК длиной в 73 т.п.н., который охватывает область стыка на 5'-конце, с применением двух специфичных праймеров. Амплификацию этого ПЦР-продукта оценивали с применением мишень-специфического зонда MGB, синтезированного Applied Biosystems, содержащего метку FAM на 5'-конце. Специфичность такого способа детекции Taqman для объекта DAS-40278-9 AAD-1 кукурузы тестировали на 16 различных объектах AAD-1 кукурузы и нетрансгенных разновидностях кукурузы с применением специфичного для кукурузы эндогенного референтного гена, гена инвертазы.

Пример 1.1. Выделение гДНК

Тестировали образцы гДНК от 16 различных объектов AAD-1 кукурузы и нетрансгенных разновидностей кукурузы. гДНК выделяли с применением двух способов, набора Qiagen и CTAB. Для образцов гДНК, выделенных посредством набора Qiagen, использовали восемь свежих кусочков листа кукурузы для выделения гДНК согласно модифицированной методике Qiagen DNeasy 96 Plant Kit. Для образцов гДНК, выделенных с применением способа CTAB, использовали приблизительно 0,3 г лиофилизированной ткани листа согласно методике, приведенной в Permingeat et al., 1998. Количество гДНК оценивали посредством способа Pico Green согласно инструкции производителя (Molecular Probes, Eugene, OR). Для проведения настоящего исследования образцы гДНК разбавляли свободной от ДНКазы водой с получением концентрации, составляющей 10 нг/мкл.

Пример 1.2. Анализ Taqman и результаты

Для проведения анализа Taqman, специфичного к объекту DAS-40278-9, конструировали специфические праймеры и зонды Taqman. Эти реагенты можно использовать в условиях, приведенных ниже, для детекции объекта DAS-40278-9 AAD-1 кукурузы. В таблице 1 приведены последовательности праймера и зонда, специально разработанных для детекции объекта DAS-40278-9.

Таблица 1
Праймеры ПЦР и зонды
Реакция с объектом-мишенью
Название Описание Последовательность от 5'-конца к 3'-концу
Corn278-F Прямой праймер Seq ID NO:2: 5' - ATTCTGGCTTTGCTGTAAATCGT - 3'
Corn278-R Обратный праймер Seq ID NO:3: 5' - TTACAATCAACAGCACCGTACCTT - 3'
Corn278-Probe Зонд Seq ID NO:4: 5' - FAM-CTAACCTTCATTGTATTCC-MGB - 3'
Реакция с референтным геном инвертазы
Название Описание Последовательность от 5'-конца к 3'-концу
IVF Прямой праймер Seq ID NO:5: 5' - TGGCGGACGACGACTTGT - 3'
IVR Обратный праймер Seq ID NO:6: 5' - AAAGTTTGGAGGCTGCCGT - 3'
IV-Probe Зонд Seq ID NO:7: 5' - HEX-CGAGCAGACCGCCGTGTACTTCTACC-BHQ2 - 3'

Условия множественной ПЦР для амплификации следующие: 1X буфера ПЦР, 0,5-2,5 мМ MgCl2, 0,2 мМ dNTP, 0,2 мкМ праймера Corn-278-F, 0,2 мкМ праймера Corn-278-R, 0,2 мкМ праймера IV-F, 0,2 мкМ праймер IV-R, 0,08 мкМ зонда Corn-278-Probe, 0,08 мкМ зонда IV-Probe, 40 Ед/мл HotStart Taq, 0,6-2,4 мкг/мл ДНК в общей реакционной смеси объемом 25 мкл. Тестировали различные концентрации MgCl2 и ДНК. Применяли концентрации, составляющие 0,5 мМ, 1,0 мМ, 1,8 мМ и 2,5 мМ MgCl2. Смесь амплифицировали с применением следующих условий: i) 95°C в течение 15 мин, ii) 95°C в течение 20 с, iii) 60°C в течение 60 с, iv) повторение этапов ii-iii в течение 50 циклов, v) удержание при 4°C. ПЦР в реальном времени проводили на приборе Bio-rad iCycler™. Анализ данных основывали на измерении порогового цикла (CT), который представляет собой номер цикла ПЦР, во время которого флуоресценция достигает установленного значения. Значение CT рассчитывали автоматически с применением программного обеспечения iCycler.

Последовательности ампликонов, полученных с применением указанных выше праймеров, представляют собой:

278F и 278R:

ttacaatcaacagcaccgtaccttgaagcggaatacaatgaaggttagctacgatttacagcaaagccagaat

(SEQ ID NO:8)

IVF и IVR:

tggcggacgacgacttgtccgagcagaccgccgtgtacttctacctgctcaagggcacggacggcagcctccaaacttt

(SEQ ID NO:9)

Способ Taqman для детекции объекта кукурузы AAD-1 DAS-40278-9 тестировали на 16 различных объектах AAD-1 кукурузы и нетрансгенных разновидностях кукурузы с применением специфичного для кукурузы эндогенного гена инвертазы в качестве референтного гена. Этот анализ позволял специфично обнаруживать объект кукурузы AAD-1 DAS-40278-9 и не давал никаких ложноположительных результатов для контрольных образцов (т.е. 16 различных объектов кукурузы AAD-1 и нетрансгенных разновидностей кукурузы). Объект-специфические праймеры и зонды можно использовать для детекции AAD-1 объекта DAS-40278-9 кукурузы, а также эти условия и реагенты применимы для анализов зиготности.

1. Способ определения зиготности растения кукурузы, содержащего SEQ ID NO: 1 в геноме кукурузы,
где указанный геном кукурузы содержит трансгенную конструкцию, содержащую ген арилоксиалканоатдиоксигеназы (AAD-1),
где указанная трансгенная конструкция фланкирована 5′-фланкирующей геномной ДНК кукурузы и 3′-фланкирующей геномной ДНК кукурузы,
где указанная 5′-фланкирующая геномная ДНК кукурузы состоит из остатков 1-1873 последовательности SEQ ID NO: 1 и указанная 3′-фланкирующая геномная ДНК кукурузы состоит из остатков 6690-8557 последовательности SEQ ID NO: 1, и
где указанная трансгенная конструкция состоит из остатков 1874-6689 последовательности SEQ ID NO: 1,
где указанный способ включает:
получение образца геномной ДНК от указанного растения кукурузы;
получение приведенного в контакт образца посредством контактирования указанного образца ДНК с
a) первым праймером и вторым праймером, где указанный первый праймер содержит сегмент указанной трансгенной конструкции, указанный второй праймер содержит сегмент указанной 5′-фланкирующей геномной ДНК кукурузы или сегмент указанной 3′-фланкирующей геномной ДНК кукурузы, и
где указанный первый праймер и указанный второй праймер продуцируют ампликон, который затем помещают в условия количественной ПЦР,
b) флуоресцентным зондом, который гибридизуется с указанным ампликоном;
помещение указанного приведенного в контакт образца в условия основанной на флуоресценции количественной ПЦР по конечной точке;
проведение количественного анализа указанного флуоресцентного зонда, гибридизованного с указанным ампликоном; и
определение зиготности указанного растения кукурузы, содержащего SEQ ID NO: 1.

2. Способ по п. 1, где указанные ампликоны состоят из 50-100 остатков.

3. Способ по п. 1, где указанный второй праймер связывается с остатками 1673-1873 последовательности SEQ ID NO: 1 или комплементарной ей последовательностью.

4. Способ по п. 1, где второй праймер объекта связывается с остатками 6690-6890 последовательности SEQ ID NO: 1.

5. Способ по п. 1, где указанный способ используют для анализа интрогрессии трансгенной конструкции AAD-1, содержащей последовательность SEQ ID NO: 1, в целях селекции в другую линию кукурузы.

6. Способ по п. 5, где указанная другая линия кукурузы лишена последовательности SEQ ID NO: 1.

7. Способ по п. 1, где указанный ампликон DAS-4 027 8-9 представляет собой 73 пар оснований.

8. Способ по п. 1, где указанные зонды мечены флуоресцентным красителем и гасителем.

9. Способ по п. 8, где указанный зонд содержит FAM в качестве указанного флуоресцентного красителя на 5′-конце указанного зонда и гаситель MGB на 3′-конце указанного зонда.

10. Способ по п. 1, где указанный ампликон состоит из последовательности SEQ ID NO: 8.

11. Способ по п. 1, где указанный зонд состоит из SEQ ID NO: 4.

12. Способ по п. 1, где указанные праймеры выбраны из группы, состоящей из SEQ ID NO: 2 и SEQ ID NO: 3.

13. Способ по п. 1, где результаты указанной зиготности растения кукурузы считывают непосредственно на устройстве для чтения планшетов.

14. Способ по п. 1, где указанный образец ДНК получают из растения кукурузы в поле.

15. Набор для осуществления способа по п. 1, где указанный набор включает указанные праймеры, состоящие из SEQ ID NO: 2 и SEQ ID NO: 3, и указанный зонд, состоящий из SEQ ID NO: 4.



 

Похожие патенты:

Изобретение относится к области биотехнологии, а именно к способу поиска белков-мишеней, запускающих процесс канцерогенеза, в образцах тканей индивидуального пациента, для последующей противоопухолевой фармакотерапии.

Изобретение относится к области медицины и предназначено для ПЦР-диагностики гена резус-фактора плода по крови беременной женщины. Предложен набор с лиофилизированными праймерами, содержащий готовые к амплификации реакционные пробирки с лиофилизированными праймерами и праймерами-зондами для экзонов RHD-5 и RHD-7 гена RHD.

Изобретение относится к биохимии. Описан способ получения кукурузного растения с улучшенной оптимизаций водопотребления и растение, полученное таким способом.

Настоящее изобретение относится к биотехнологии и представляет собой способ мониторинга экспрессии представляющего интерес гена полипептида CADM1, Rb, ZMYND10, RASSF5, PTEN, SERPINB5, EPB41L3 или DAPK1 для определения терапевтического эффекта соединения при лечении заболевания, связанного с экспрессией указанного представляющего интерес гена полипептида.

Изобретение относится к области биотехнологии, а именно к способу выявления РНК вируса бешенства и набору, который используется в данном способе. Способ включает проведение ОТ-ПЦР с олигонуклеотидными праймерами.

Настоящее изобретение относится к фосфодиэстеразе 4D7 (PDE4D7) для применения в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера повышена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы с экспрессией в нормальной ткани или ткани доброкачественной опухоли предстательной железы, и к применению PDE4D7 в качестве диагностического маркера для агрессивного гормон-чувствительного рака предстательной железы.

Изобретение относится к области биохимии. Заявлен способ молекулярно-генетического внутривидового типирования Vibrio cholerae O1 и O139 серогрупп.

Изобретение относится к области биотехнологии, а именно к способу определения эффективной терапевтической дозы противоэпилептического препарата и риска развития побочных эффектов.

Изобретение относится к области биотехнологии, в частности к набору синтетических олигонуклеотидов для выявления видовой принадлежности володушки многожильчатой (Bupleurum multinerve DC.), включающий проведение полимеразной цепной реакции с фрагментом ITS2 ядерной ДНК.

Биомаркер // 2573925
Изобретение относится к области биотехнологии, конкретно к маркерам рака, и может быть использовано в медицине. Выявление белка Engrailed-2 (EN2) или кодирующей его нуклеиновой кислоты в образце тканей мочевого пузыря или мочи от пациента может быть использовано в диагностике рака мочевого пузыря или для идентификации пациента, имеющего риск развития рака мочевого пузыря, а также для мониторинга прогрессирования рака мочевого пузыря у пациента или мониторинга эффективности лечения рака мочевого пузыря.

Изобретение относится к области биохимии, в частности к способу определения зиготности растения сои, включающего арилоксиалканоатдиоксигеназу (AAD-12) с SEQ ID NO: 1, где указанное растение содержит трансгенную конструкцию, включающую ген AAD-12, состоящий из остатков 2731-9121 SEQ ID NO: 1, и указанная трансгенная конструкция фланкирована 5′-фланкирующей геномной ДНК сои и 3′-фланкирующей геномной ДНК сои, где указанная 5′-фланкирующая геномная ДНК содержит остатки 1-2730 SEQ ID NO: 1, указанная 3′-фланкирующая геномная ДНК содержит остатки 9122-10212 SEQ ID NO: 1, а также к комплекту для его выполнения.

Изобретение относится к области биотехнологии. Предложен способ подготовки культур сульфидогенных бактерий для выделения ДНК.

Способ получения двуспиральной рибонуклеиновой кислоты (дсРНК) из клеток штамма Saccharomyces cerevisiae ВКПМ Y-448 включает разрушение клеток дрожжей в буфере с pH 7,4, содержащем 10 мМ Трис, 20 мМ ЭДТА и 0,5 М NaCl, обработку додецилсульфатом натрия в концентрации от 0,5 до 1,0% 20-25 мин при 20°C и хлороформом в концентрации до 25% 20-25 мин при 20°C.

Группа изобретений относится к области биохимии. Заявлены варианты способа скрининга и мониторинга онкологических заболеваний, включающего забор образца ткани, выделение из образца ткани РНК, синтез кДНК, амплификацию методом множественной обратной транскрипции полимеразой цепной реакции с последующим анализом амплифицированных продуктов.
Изобретение относится к фармацевтической промышленности, а именно к способу получения дрожжевого экстракта, содержащего биологически активную высокополимерную РНК.
Изобретение относится к биотехнологии и может быть использовано для получения свободного от белка биологически активного препарата высокополимерной РНК из сухих пекарских дрожжей Saccharomyces cerevisiae.

Изобретение относится к области биотехнологии, а именно к способу и диагностическому набору для диагностики коклюша и определения авирулентных мутантов возбудителя коклюша.
Изобретение относится к области биохимии. .

Изобретение относится к области генной инженерии и может быть использовано в биотехнологии для получения представляющих практический интерес белков, являющихся продуктами молчащих генов или генов с низким уровнем экспрессии.

Предложенная группа изобретений относится к области медицины. Предложен способ прогнозирования у пациента с влажной возрастной дегенерацией желтого пятна (AMD) повышенной вероятности эффекта от лечения высокоаффинным антителом против VEGF, в частности, ранибизумабом. Предложен набор, содержащий первый олигонуклеотид и вторые олигонуклеотиды, специфичные для аллелей полиморфизма гена BATF, соответствующего rs175714. Если генотип содержит АА или AG, у пациента прогнозируют повышенную вероятность эффекта от указанного лечения. Предложенная группа изобретений обеспечивает эффективные средства и методы для прогнозирования повышенной вероятности эффекта от лечения у пациента с влажной AMD. 2 н. и 7 з.п. ф-лы, 1 ил., 5 табл., 1 пр.
Наверх