Набор последовательности праймеров и аллель-специфических зондов для одновременной генодиагностики двух мутантных аллелей, вызывающих cvm и blad у крупного рогатого скота



Набор последовательности праймеров и аллель-специфических зондов для одновременной генодиагностики двух мутантных аллелей, вызывающих cvm и blad у крупного рогатого скота
Набор последовательности праймеров и аллель-специфических зондов для одновременной генодиагностики двух мутантных аллелей, вызывающих cvm и blad у крупного рогатого скота
Набор последовательности праймеров и аллель-специфических зондов для одновременной генодиагностики двух мутантных аллелей, вызывающих cvm и blad у крупного рогатого скота

 


Владельцы патента RU 2577990:

Общество с ограниченной ответственностью "Агровет" (RU)

Изобретение относится к области биотехнологии, а именно к набору последовательностей праймеров и аллель-специфических зондов для одновременной генодиагностики двух мутантных аллелей, вызывающих комплекс аномалий позвоночника (CVM) и дефицит лейкоцитарной адгезии (BLAD) у крупного рогатого скота. Набор включает последовательности праймеров и аллель-специфических зондов, которые имеют следующую структуру: CVM_up gattctcaagagcttaattctaagga, CVM_low aagtaaaccccagcaaagccac, CVM_Wt (FAM)-aggtctcatggcagttct-(BHQ1), CVM_m (R6G)-catggcatttctcacagcat-(BHQ2), BLAD_up ttaggcagttgcgttc, BLAD_low acgttgacgaggtcatccacca, BLAD_Wt (ROX)-accccatcgacctgtacta-(BHQ1), BLAD_m (Cy5)-ccatcggcctgtactacct-(BHQ2). Предложенное изобретение позволяет одновременно диагностировать CVM и BLAD у крупного рогатого скота методом ПЦР в реальном времени, а также сократить время выполнения полимеразной цепной реакции в реальном времени. 3 ил., 2 табл., 1 пр.

 

Изобретение относится к области молекулярной биологии и может быть использовано в ветеринарной практике при диагностике мутаций, вызывающих две наследственные болезни: комплекс аномалий позвоночника (CVM - Complex Vertebral Malformation) и дефицит лейкоцитарной адгезии (BLAD - Bovine Leucocyte Adhesion Deficiency) у крупного рогатого скота. Набор последовательности праймеров и аллель-специфических зондов позволяет одновременно идентифицировать CV и BL мутации соответственно в локусах SLC35A3 и CD 18 ДНК с помощью ПЦР в режиме реального времени (ПЦР-РВ).

В настоящее время у крупного рогатого скота описано около 60 наследственных заболеваний, которые выявляются на уровне ДНК (ICAR Guidelines…, 2011). Они вызывают морфологические и функциональные аномалии, негативно влияют на здоровье и продуктивность животного. Поэтому важной задачей ветеринарных врачей является своевременная диагностика и искоренение источника, вызывающего данную болезнь. Знание молекулярной структуры, определение гетерозиготного носителя является основой для эффективной борьбы с наследственным заболеванием.

Быстрота и точность диагностики комплекса аномалий позвоночника (CVM) и дефицита лейкоцитарной адгезии (BLAD) значительно повысилась благодаря установлению генетической природы данных молекулярных болезней (Kehrli M.E.Jr. et al., 1990; Tammen I., 1994; Batt C.A. et al., 1994; Марзанов Н.С. и др., 1997; Амерханов Х.А., Марзанов Н.С., 1999; Agerholm et al., 2001; Яковлев А.Ф. и др., 2004; Eggen A. et al., 2004; Oguni T. et al., 2004; Rusc A., Kaminski S., 2007; Калашникова Л.А., 2010; Марзанова С.Н. и др., 2011; 2012).

В развитых странах Европы и Северной Америки созданы специальные программы по элиминации мутантных аллелей CVM и BLAD в популяциях черно-пестрой породы (Shuster D.E. et al., 1992a,b; Czarnik U. et al., 2007; Schutz E. et al., 2008).

В Российской Федерации выдающихся производителей и ремонтный молодняк проверяют на носительство мутантных аллелей, а результаты в обязательном порядке, наряду с группами крови и каппа-казеином, регулярно публикуют в каталогах по племенным быкам (Шапочкин В.В., Ескин Г.В., 2004; Попов Н.А. и др., 2004; Савенко Н.А. и др., 2007; Ескин Г.В., 2010).

В открытой печати предложены ряд методов диагностики CVM и BLAD (Kehrli M.E.Jr. et al., 1990; Shuster D.E. et al., 1992a; Tammen I., 1994; Nagahata H. et al., 1997; Kanae Y. et al., 2005; Rusc A., Kaminski S., 2007). Однако диагностика при раздельном их выявлении занимает много времени.

Из уровня техники известен генетический тест для идентификации носителей рецессивного гена комплексных вертебральных мальформаций у крупного рогатого скота (Патент на изобретение №2276690, опубл. 20.05.2006). Данное изобретение принято в качестве ближайшего аналога. Отличительной особенностью заявленного изобретения от выявленного аналога является возможность определения CVM вместе с BLAD, т.е. идет одновременное определение двух мутаций по методике ПЦР в реальном времени (ПЦР-РВ), с помощью праймеров и аллель-специфических зондов. Точка мутации CV та же, что и в указанном аналоге, однако подход детекции принципиально иной.

В заявленном изобретении осуществляется идентификация полиморфизма в локусе SLC35A3 (G/T) с помощью ПЦР-РВ и использованием TaqMan зондов. Время исследования данного полиморфизма занимает не более 3-х часов. В ближайшем аналоге диагностируют CVM с помощью микросателлитов, с использованием электрофоретического метода детекции, что является принципиально другим методом диагностики данного полиморфизма и занимает больше времени и необходимого оборудования.

Предлагаемый к патентованию набор праймеров и зондов в сравнении со всеми изученными аналогами имеет следующие преимущества:

специфическая структура праймеров и зондов, а также с помощью предлагаемого к патентованию набора праймеров и зондов можно одновременно в одной пробирке провести полимеразную цепную реакцию в режиме реального времени (ПЦР-РВ), что обеспечивает быстроту проведения диагностики и получение результата сразу по двум представленным мутациям.

Техническим результатом заявленного изобретения является возможность одновременной диагностики комплекса аномалии позвоночника (CVM - Complex Vertebral Malformation) и дефицита лейкоцитарной адгезии (BLAD - Bovine Leucocyte Adhesion Deficiency) у крупного рогатого скота методом ПЦР в реальном времени, сокращение времени выполнения полимеразной цепной реакции в реальном времени (ПЦР-РВ) (через 3 часа получен результат); нетрудоемкость; возможность выполнять повторности; проводить контроль правильности исследования.

Для осуществления одновременной генодиагностики CV и BL аллелей у крупного рогатого скота с помощью ПЦР в реальном времени (ПЦР-РВ) использовали праймеры и аллель-специфические зонды, имеющие следующие последовательности:

CVM_up gattctcaagagcttaattctaagga
CVM_low aagtaaaccccagcaaagccac
CVM_Wt (FAM)-aggtctcatggcagttct-(BHQ1)
CVM_m (R6G)-catggcatttctcacagcat-(BHQ2)
BLAD_up ttaggcagttgcgttc
BLAD_low acgttgacgaggtcatccacca
BLAD_Wt (ROX)-accccatcgacctgtacta-(BHQ1)
BLAD_m (Cy5)-ccatcggcctgtactacct-(BHQ2)

В настоящем изобретении представлен набор праймеров и зондов для одновременной диагностики мутантных CV и BL аллелей у чёрно-пестрого генеалогического корня, куда относятся такие известные породы, как голштинская, черно-пестрая, холмогорская, ярославская, тагильская, кроме того красно-пестрая порода, а также синтетические популяции с примесью голштинской крови.

Экспериментально установлен оптимальный состав реакционной смеси для проведения полимеразной цепной реакции в режиме реального времени, подобрано сочетание праймеров, необходимое и достаточное соотношение компонентов реакционной смеси и определен режим постановки ПЦР, что является важным при проведении ПЦР-анализа. Система рассчитана на проведение 100 реакций объемом 25 мкл (20 мкл +5 мкл исследуемого образца).

Подбор праймеров и аллель-специфических зондов проводили при помощи пакета прикладных программ «Oligo 6.0» на основании анализа нуклеотидных последовательностей локусов SLC35A3 и CD 18 ДНК, опубликованных в базе NSBI.

Пример проведения полимеразной реакции с использованием заявленного набора.

Источником для проведения диагностики служит предварительно выделенная ДНК из образцов биологического материала (цельной крови, спермы, эмбрионов, молока или кожи).

Реакционная смесь для ПЦР-анализа имеет следующий состав: 50 мМ KCl, 50 мМ TRIS-HCl, 250 нМ dNTP, 2,5 мМ MgCl2, 2,5 ед. ДНК-полимеразы, праймеры в концентрации 200 нМ, флуоресцентные зонды - в концентрации 100 нМ, имеющие определенные последовательности:

CVM_up gattctcaagagcttaattctaagga
CVM_low aagtaaaccccagcaaagccac
CVM_Wt (FAM)-aggtctcatggcagttct-(BHQ1)
CVM_m (R6G)-catggcatttctcacagcat-(BHQ2)
BLAD_up ttaggcagttgcgttc
BLAD_low acgttgacgaggtcatccacca
BLAD_Wt (ROX)-accccatcgacctgtacta-(BHQ1)
BLAD_m (Cy5)-ccatcggcctgtactacct-(BHQ2)

Подготовку к проведению реакции осуществляли следующим образом.

Необходимый объем компонентов рассчитывали исходя из количества исследуемых образцов плюс 4 (три положительных контрольных образца и один отрицательный контрольный образец). Набор компонентов для реакции представлен в таблице №1.

Таблица 1 - Состав набора для диагностики CV и BL мутаций

п/п
Наименование Объем Кол-во
1 Реакционная смесь с CVM/BLAD * 1000 мкл 1
2 Разбавитель 1000 мкл 1
3 Taq ДНК полимераза 50 мкл 1
4 Положительный контрольный образец 1 с CVM/BLAD 50 мкл 1
5 Положительный контрольный образец 2 с CVM/BLAD 50 мкл 1
6 Положительный контрольный образец 3 с CVM/BLAD 50 мкл 1
7 Отрицательный контрольный образец 200 мкл 1
* содержит все необходимые компоненты для проведения ПЦР-РВ
Условия хранения: №1-7, -16 -20°C

Компоненты разморозили, перемешали и центрифугировали. Приготовили смесь компонентов, добавляя их в порядке, указанном в таблице 2, перемешали и центрифугировали.

Таблица 2 - Соотношение компонентов для проведения ПЦР-РВ
Наименование Объем на реакцию, мкл ×10 ×36
1 Реакционная смесь с CVM/BLAD 10 100 360
2 Разбавитель 10 100 360
3 Taq ДНК-полимераза 0,5 5 18

ПЦР пробирки маркировали. В подготовленные для ПЦР пробирки внесли по 20 мкл смеси компонентов. Затем в каждую ПЦР пробирку внесли по 5 мкл контрольных и исследуемых образцов в соответствии с маркировкой, перемешали многократным пипетированием и плотно закрыли крышку. Пробирки поместили в карусель амплификатора Rotor Gene Q (Corbett Research, Австралия), затем программировали прибор.

Профиль реакции:

1. Удержание температуры 94°С - 3 мин, один повтор.

2. Циклирование 1

94°С - 20 с

61°С - 20 с

64°С - 30 с

Цикл повторить 10 раз.

3. Циклирование 2 (с детекцией)

94°С - 20 с

61°С - 20 с

64°С - 30 с - детекция по каналам: Green, Yellow, Orange, Red

Цикл повторить 30 раз.

В процессе циклирования денатурация, отжиг праймеров и синтез новой цепи ДНК происходит при температуре 64°С. При первом циклировании провели 10 повторов - детекции нет, так как данные не репрезентативны. При втором циклировании провели повторов 30 - в результате получили стабильные данные, которые являются окончательными в плане диагностики.

Создание шаблона ПЦР-РВ, а также анализ результатов исследования проводили при помощи программного обеспечения «Rotor-Gene 6000 1.8» к прибору Rotor Gene Q (Corbett Research, Австралия).

Результатом анализа является определение мутантных аллелей, вызывающих комплекс аномалий позвоночника (CVM) и дефицит лейкоцитарной адгезии (BLAD) у крупного рогатого скота.

В заявленном изобретении использована технология аллель-специфических TaqMan зондов. В данном случае флуоресцентным зондом является олигонуклеотид, комплементарный продукту ПЦР.

Зонд метят флуорофором и гасителем флуоресценции, при этом возможно использование как концевого, так и внутреннего мечения олигонуклеотида. При отсутствии мишени, т.е. последовательности, комплементарной зонду, флуорофор и гаситель сближаются, в результате подавляется флуоресценция зонда. Процесс тушения основан на механизме флуоресцентно-резонансного переноса энергии. При наличии комплементарного зонду фрагмента ДНК, зонд гибридизуется с ампликоном, что ведет к его расщеплению в процессе синтеза за счет 5'-экзонуклеазной активности Taq-полимеразы. Интенсивность сигнала возрастает на соответствующем флуорофору канале флуоресценции с каждым циклом ПЦР, пропорционально накоплению ампликонов.

Аллель-специфические зонды эффективны при детекции CV и BL мутаций в исследуемом фрагменте генома. Для локуса с мутацией подбирают пару зондов, так чтобы один из них специфически гибридизовался при температуре проведения синтеза цепей с аллелем нормального (дикого) типа, а второй зонд - с аллелем мутантного типа.

Эти зонды метят разными флуорофорами, а результаты реакций с ними регистрируют на двух различных каналах детекции прибора для ПЦР-РВ. Для определения CT и CV аллелей используют 2 канала - Green и Yellow. Нормальный CT аллель дает рост сигнала по каналу Green, детектируемый флуорофором FAM, а мутантный аллель CV - по каналу Yellow, детектируемый флуорофором R6G.

Что касается TL и BL аллелей, то для их определения используют тоже 2 канала, только Orange и Red. Нормальный TL аллель дает рост сигнала по каналу Orange, детектируемый флуорофором ROX, а мутантный аллель BL - по каналу Red, детектируемый флуорофором Cy5.

Результаты интерпретируются на основании наличия или отсутствия пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией.

Переход порога - это характеристика количества копий ДНК отдельного гена. При оптимальном количестве копий ДНК кривая располагается между двумя пороговыми значениями 10 и 15 циклами амплификации.

При перемещении кривой влево по оси абсцисс это говорит о высокой концентрации ДНК, если вправо - о ее недостатке в реакции.

На рис. 1 представлены результаты исследований гомозиготного дикого типа или здорового животного или неносителя, флуоресценция представлена двумя линиями.

Кривая без маркеров располагается между 10 и 15 циклами над красной пороговой линией. Вторая кривая с окружностями ниже пороговой линии. Данная ситуация характерна для здорового исследуемого животного.

На рис. 2 представлены результаты исследования гетерозиготного животного или носителя мутантного CV аллеля. Как видно на рис. 2, обе кривые флуоресценции пересекают установленную на соответствующем уровне пороговую линию в обозначенном районе, между 10 и 15 циклами ПЦР-РВ.

В то же время следует отметить, что кривая с окружностями располагается выше кривой без маркеров. Данная картина характерна для гетерозиготного животного или носителя мутации.

При налаживании данного способа не было возможности получения больных телят опытным путем в хозяйственных условиях. В этой связи, впервые удалось смоделировать синтетические рецессивные генотипы больных телят по локусам SLC35A3 и CD 18, в лабораторных условиях, на основе знания структур мутантных CV и BL аллелей.

На рис. 3 представлен модельный образец животного, гомозиготного по мутантному CV аллелю. Как видно на рис. 3, модельный образец отражает ситуацию характерную для больного теленка. В данном случае кривая с окружностями располагается выше порога, кривая флуоресценции без окружностей, характерная для здорового животного, оказывается под пороговой линией.

Что касается принципа определения BL аллеля, то он аналогичен тому, что описано в отношении диагностики CV мутации. Анализ проводится по описанной выше методике, только по каналам Orange и Red, и вся процедура осуществляется одновременно.

Прогноз получаемого потомства в зависимости от присутствия или отсутствия мутантных CV и BL аллелей. Наличие CV, как и BL аллеля, является ярким примером носительства мутации с одной стороны, а с другой - проявления однонуклеотидного полиморфизма или SNP (single nucleotide polymorphism) в ДНК у крупного рогатого скота.

Основными преимуществами заявляемого изобретения являются:

1. Одновременная аттестация элитных животных черно-пестрого генеалогического корня и красно-пестрой породы по двум мутациям (CV и BL) при помощи набора представленных последовательностей праймеров и зондов позволит направленно формировать аллелофонд быков-производителей, быковоспроизводящих групп коров, ремонтный молодняк, а также накапливать племенной материал (банк семени и эмбрионов) от здоровых животных.

2. Наличие генетического паспорта на CV и BL мутации элитных животных позволит эффективно вести селекционно-племенную работу в племенных стадах черно-пестрого генеалогического корня и красно-пестрой породы.

3. При завозе племенного материала в Российскую Федерацию из-за рубежа обязательно наличие генетического паспорта. С целью купирования двух наследственных болезней закупленные животные после карантина должны пройти повторную аттестацию на наличие мутантных CV и BL аллелей.

Литература:

1. Амерханов Х.А., Марзанов Н.С. Генетики смотрят в будущее // Племенное дело. - 1999. - №1. - С. 7-9.

2. Калашникова Л.А. Геномная оценка молочного скота // Молочное и мясное скотоводство. - 2010. - N1. - С. 10-12.

3. Каталог быков-производителей ОАО «Головной центр по воспроизводству сельскохозяйственных животных» / под ред. Ескина Г.В. Быково. - 2010. - 36 с.

4. Марзанов Н.С., Попов А.Н., Зиновьева Н.А., Полежаева В.А., Игнатьев В.М., Брем Г. Скрининг BLAD-синдрома у животных черно-пестрого корня // Вестник РАСХН. - 1997. - №4. - С. 59-61.

5. Марзанова С.Н., Алексеев Я.И., Коновалова Н.В., Турбина И.С., Девришов Д.А., Сочивко Д.Г., Марзанов Н.С. Разработка метода диагностики комплексной аномалии позвоночника (CVM) методом ПЦР в реальном времени у черно-пестрого скота. Научно-практическая конференция: «Практическое использование современных научных разработок в воспроизводстве и селекции крупного рогатого скота» // Научно-теоретический журнал: Проблемы биологии продуктивных животных. - 2011. - №4. Спецвыпуск. - С. 79-82.

6. Марзанова С.Н., Алексеев Я.И., Коновалова Н.В., Турбина И.С., Девришов Д.А., Сочивко Д.Г., Марзанов Н.С. Диагностика CVM и BLAD у черно-пестрого скота. Материалы международной научно-практической конференции: «Роль ветеринарной науки и практики в эффективном развитии животноводства». Алматы. - 2012. - С.348-353.

7. Попов Н.А., Червяков Н.А., Белявин Н.А. и др. Каталог быков-производителей ОАО «Кировское». - Киров. - 2004. - 73 с.

8. Савенко Н.А., Бошляков В.Н., Жуков В.Ф. и др. Каталог быков-производителей ОАО «Московское» по племенной работе. - Москва: МСХиП МО. - 2007. - 104 с.

9. Шапочкин В.В., Ескин Г.В. Каталог быков-производителей ФГУП «ЦСИО». Подольск. - 2002. - 51 с.

10. Яковлев А., Терлецкий В., Митрофанова О., Дементьева Н. Определение носителей генетических дефектов среди быков-производителей // Молочное и мясное скотоводство. - 2004. - №7. - С. 31-32.

11. Agerholm J.S., Bendixen C., Arnbjerg J., Anderson O. Complex vertebral malformation in Holstein calves // J. Vet. Diagn. Invest. - 2001. - Vol.13. - P. 283-289.

12. Batt C.A., Wagner P., Wiedmann M., Luo J., Gilbert R.O. Detection of bovine leukocyte adhesion deficiency by nonisotopic ligase chain reaction // Anim. Genet. - 1994. - Vol.25. - P. 95-98.

13. Czarnik U., Grzybovski G., Kaminski S., Prusak B, Zabolewicz T. Effectiveness of a program aimed at the elimination of BLAD-carrier bulls from Polish Holstein-Friesian cattle // J. Appl. Genet. - 2007. - Vol. 48. - P. 375-377.

14. Eggen A., Duchesne A., Laurent P., Grohs C., Denis C., Gautier M., Boichard D., Ducos A. Controlling genetic disorders in the French dairy cattle population // 29th International Conference on Animal Genetics. Tokyo. Japan. - 2004. - P. 35.

15. ICAR Guidelines approved by the General Assembly held in Riga, Latvia on June 2010. Copyright ICAR. - 2011. - 485 p.

16. Kanae Y., Endoh D., Nagahata H., Hayashi M. A method for detecting complex vertebral malformation in Holstein calves using polymerase chain reaction-primer introduced restriction analysis // J. Vet. Diagn. Invest. - 2005. - Vol.17. - P.258-262.

17. Kehrli M.E., Schmalstieg C., Anderson D.C., Van Der Maaten M.J., Hughes B.J., Akermann M.R., Wilhemsen C.L., Brown G.B., Stevens M.G., Whetstone C.A. Molecular identification of deficiency of the Mac-1 (CD11b/CD18) glycoprotein // Am. J. Vet. Res. - 1990. - Vol.51. - P.1826-1836.

18. Nagahata H., Miura T., Tagaki K., Ohtake M., Noda H., Yasuda T., Nioka K. Prevalence and allele frequency estimation of bovine leukocyte adhesion deficiency (BLAD) in Holstein-Friesian cattle in Japan // J. Vet. Med. Sci. - 1997. - Vol. 59. - P. 233-238.

19. Oguni T., Takeda Ray M., Tsuji T., Sugimoto Y., Moritomo Y., Matsumoto M., Mishina Y., Kunieda T. Identification and control of a dwarfism gene in Japanese brown cattle // 29th International Conference on Animal Genetics. Tokyo. Japan, 2004. P. 35.

20. Rusc A., Kaminski S. Prevalence of complex vertebral malformation carriers among Polish Holstein-Friesian bull // J. Appl. Genet. - 2007. - Vol.48. - P. 247-252.

21. Shuster D.E., Kehrli M.E.Jr., Ackermann M.R., Gilbert R.O. Identification and prevalence of a genetic defect that causes leukocyte adhesion deficiency in Holstein cattle // Proc. Nat. Acad. Sci. USA. - 1992a. - Vol.89. - P. 9225-9229.

22. Shuster D.E., Bosworth B.T., Kehrli M.E.Jr. Sequence of the bovine CD18-encoding cDNA: comparison with the human and murine glycoproteins // Gene. - 1992b. - Vol.114. - P. 267-271.

23. Schutz E., Scharfenstein M., Brenig B. Implication of complex vertebral malformation and bovine leukocyte adhesion deficiency DNA-based Testing on disease frequency in the Holstein population // J. Dairy Sci. - 2008. - Vol.91. - P.4854-4859.

24. Tammen I. Weiterentwicklung des DNA-Tests auf BLAD (Bovine Leukozyten Adhasions defizienz) fur den Einsatz in Rinderzucht und klinischer Diagnostik. Hannover. - 1994. - 128s.

Набор последовательностей праймеров и аллель-специфических зондов для одновременной генодиагностики двух мутантных аллелей, вызывающих комплекс аномалий позвоночника (CVM) и дефицит лейкоцитарной адгезии (BLAD) у крупного рогатого скота путем проведения полимеразной цепной реакции в режиме реального времени, имеющих следующую структуру:

CVM_up gattctcaagagcttaattctaagga
CVM_low aagtaaaccccagcaaagccac
CVM_Wt (FAM)-aggtctcatggcagttct-(BHQ1)
CVM_m (R6G)-catggcatttctcacagcat-(BHQ2)
BLAD_up ttaggcagttgcgttc
BLAD_low acgttgacgaggtcatccacca
BLAD_Wt (ROX)-accccatcgacctgtacta-(BHQ1)
BLAD_m (Cy5)-ccatcggcctgtactacct-(BHQ2)



 

Похожие патенты:

Предложенная группа изобретений относится к области медицины. Предложен способ прогнозирования у пациента с влажной возрастной дегенерацией желтого пятна (AMD) повышенной вероятности эффекта от лечения высокоаффинным антителом против VEGF, в частности, ранибизумабом.

Изобретение относится к области биохимии, в частности к способу определения зиготности растения кукурузы, содержащего трансгенную конструкцию, содержащую ген арилоксиалканоатдиоксигеназы, где указанный способ включает: получение образца геномной ДНК от указанного растения кукурузы; получение приведенного в контакт образца посредством контактирования указанного образца ДНК с первым праймером и вторым праймером и флуоресцентным зондом, определение зиготности указанного растения кукурузы, а также к набору для его осуществления.

Изобретение относится к области биотехнологии, а именно к способу поиска белков-мишеней, запускающих процесс канцерогенеза, в образцах тканей индивидуального пациента, для последующей противоопухолевой фармакотерапии.

Изобретение относится к области медицины и предназначено для ПЦР-диагностики гена резус-фактора плода по крови беременной женщины. Предложен набор с лиофилизированными праймерами, содержащий готовые к амплификации реакционные пробирки с лиофилизированными праймерами и праймерами-зондами для экзонов RHD-5 и RHD-7 гена RHD.

Изобретение относится к биохимии. Описан способ получения кукурузного растения с улучшенной оптимизаций водопотребления и растение, полученное таким способом.

Настоящее изобретение относится к биотехнологии и представляет собой способ мониторинга экспрессии представляющего интерес гена полипептида CADM1, Rb, ZMYND10, RASSF5, PTEN, SERPINB5, EPB41L3 или DAPK1 для определения терапевтического эффекта соединения при лечении заболевания, связанного с экспрессией указанного представляющего интерес гена полипептида.

Изобретение относится к области биотехнологии, а именно к способу выявления РНК вируса бешенства и набору, который используется в данном способе. Способ включает проведение ОТ-ПЦР с олигонуклеотидными праймерами.

Настоящее изобретение относится к фосфодиэстеразе 4D7 (PDE4D7) для применения в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера повышена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы с экспрессией в нормальной ткани или ткани доброкачественной опухоли предстательной железы, и к применению PDE4D7 в качестве диагностического маркера для агрессивного гормон-чувствительного рака предстательной железы.

Изобретение относится к области биохимии. Заявлен способ молекулярно-генетического внутривидового типирования Vibrio cholerae O1 и O139 серогрупп.

Изобретение относится к области биотехнологии, а именно к способу определения эффективной терапевтической дозы противоэпилептического препарата и риска развития побочных эффектов.

Изобретения относятся к области биохимии. Описана группа изобретений, включающая двухцепочечную олиго-РНК конструкцию для эффективной доставки РНК и способ ее изготовления, наночастицу, содержащую вышеуказанную двухцепочечную олиго-РНК конструкцию, способ регулирования экспрессии гена in vitro путем использования вышеуказанной олиго-РНК конструкции и способ регулирования экспрессии гена in vivo путем использования вышеуказанной наночастицы.

Предложенное изобретение относится к области биотехнологии, а именно к вирусоподобной частице (VLP) для применения в вакцинах или антигенных композициях для лечения или профилактики инфекции вируса бешенства (RV), а также способам их получения и применения.

Изобретение относится к биохимии. Раскрыты способы повышения экспрессии полинуклеотида PAR4, включающие осуществление контакта с по меньшей мере одним олигонуклеотидом длиной от 15 до 30 нуклеотидов, который нацелен на природную антисмысловую последовательность для полинуклеотида PAR4, и при этом указанная природная антисмысловая последовательность имеет последовательность, представленную в SEQ ID NO: 2.

Изобретение относится к области биотехнологии, а именно к способу выявления РНК вируса бешенства и набору, который используется в данном способе. Способ включает проведение ОТ-ПЦР с олигонуклеотидными праймерами.

Настоящее изобретение относится к фосфодиэстеразе 4D7 (PDE4D7) для применения в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера повышена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы с экспрессией в нормальной ткани или ткани доброкачественной опухоли предстательной железы, и к применению PDE4D7 в качестве диагностического маркера для агрессивного гормон-чувствительного рака предстательной железы.

Изобретение относится к области биохимии, в частности к молекулам нуклеиновой кислоты для модуляции экспрессии генов-мишеней. Заявлена двухцепочечная молекула нуклеиновой кислоты для ингибирования экспрессии гена белка теплового шока 47 (hsp47).

Изобретение относится к биотехнологии. Предложена рекомбинантная ДНК, обеспечивающая в составе плазмидного вектора синтез в клетках E.coli химерного белка аполипопротеина Α-I человека, размером 852 п.н.

Группа изобретений относится к области молекулярной биологии. Сущность изобретения состоит в подавлении активности активированного онкогена AML-ETO методом РНК-интерференции в злокачественных кроветворных клетках, полученных от больных лейкозом, с использованием конструкции малой шпилечной РНК, встроенной в лентивирусный вектор pLSLP-AML-ETO-shRNA, кодируемой нуклеотидной последовательностью двухцепочечной ДНК, представляющей собой: 5′-р-gatccgCCTCGAAATCGTACTGAGActtcctgcaa TCTCAGTACGATTTCGAGGtttttg-3′ (смысловая цепь), 5′-р-aattcaaaaaCCTCGAAATCGTACT GAGAttgcaggaagTCTCAGTACGATTTCGAGGcg-3′ (антисмысловая цепь).

Изобретение относится к области биохимии. Заявлен лиганд гликопротеина VI (GPVI), представляющий собой нуклеиновую кислоту, который взаимодействует с гликопротеином тромбоцитов GPVI и модулирует его активность с регуляцией функции тромбоцитов.

Изобретение относится к области биохимии. Заявлен лиганд гликопротеина VI (GPVI), представляющий собой нуклеиновую кислоту, который взаимодействует с гликопротеином тромбоцитов GPVI и модулирует его активность с регуляцией функции тромбоцитов.

Изобретение относится к области биотехнологии и может быть использовано для индукции противоопухолевого иммунного ответа in vitro. Способ включает получение прилипающей и неприлипающей фракций мононуклеарных клеток (МНК), выделенных из периферической крови больного, совместное культивирование выделенных из периферической крови больного аутологичных МНК неприлипающей фракции со зрелыми дендритными клетками (ДК), полученными из прилипающей фракции МНК, трансфицированными РНК опухолевых клеток. После чего ДК подвергают стимулированному созреванию. Совместное культивирование неприлипающей фракции МНК и трансфицированных РНК аутологичных опухолевых клеток ДК проводят в течение пяти суток. При этом для получения зрелых ДК после трех суток культивирования прилипающей фракции МНК трансфицируют незрелые ДК опухолевой РНК, а через сутки после трансфицирования незрелые ДК подвергают еще в течение суток стимулированному созреванию путем добавления в культуру незрелых ДК фактора некроза опухоли-α (ФНО-α) и интерлейкина-1β (ИЛ-1β) при следующем соотношении компонентов: ФНО-α : ИЛ-1β=2,5:1. Изобретение позволяет эффективно индуцировать противоопухолевый цитотоксический иммунный ответ против клеток немелкоклеточного рака легкого in vitro с помощью дендритных клеток, трансфицированных РНК опухолевых клеток. 1 табл.
Наверх