Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот



Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот
Низкомолекулярные конъюгаты для внутриклеточной доставки нуклеиновых кислот

 


Владельцы патента RU 2582235:

Ф.ХОФФМАНН-ЛЯ РОШ АГ (CH)

Предложены соединения и композиции на их основе, применимые в медицине, формул (I) и (II)

где Y представляет собой -(СН2)3-; R1 представляет собой -(C1-6)алкил; или -(CH2)m-фенил, необязательно замещенный до четырех раз заместителем, выбранным из: -NO2, -CN, или галогена; R2 представляет собой водород; -(СН2)k-фенил; -(С1-6)алкил; -(CH2)k-C(O)-NH2; или -(CH2)k-N-C(Ph)3, причем фенильные кольца необязательно замещены -O-(С1-4)алкилом; R3 представляет собой -NH-фенил, причем фенил дополнительно замещен заместителем, независимо выбранным из -(СН2)-ОН или -(СН2)-O-С(O)-O-(4-нитрофенила); k равен 1, 2, 3, 4, 5 или 6; m равен 1, 2, 3 или 4; и n равен 0 или 1, Ra представляет собой -(CH2)k-NH2; R1, при этом нуклеиновая кислота представляет собой одноцепочечный РНК олигонуклеотид. Предложены новые соединения для доставки нуклеиновых кислот в клетки и соединения для их получения. 4 н. и 6 з.п. ф-лы, 653 пр., 19 табл., 6 ил.

 

Настоящее изобретение относится к применению новых низкомолекулярных конъюгатов для доставки нуклеиновых кислот, таких как миРНК (малая интерферирующая РНК). Доставка нуклеиновых кислот в живую клетку сильно ограничивается сложной мембранной системой клетки.

Одним способом, который использовали для доставки нуклеиновых кислот in vivo, было присоединение нуклеиновой кислоты либо к маленькой адресующей молекуле, либо к гидрофобной молекуле, такой как липид или стерин. В то время как при введении грызунам с данными конъюгатами наблюдалась некоторая доставка и активность, требующаяся доза была чрезмерно высокой, часто приводя к нежелательным эффектам токсичности in vivo, высоким затратам и непрактичной схеме обработки при переносе на людей. Здесь предложено применение низкомолекулярных соединений для доставки нуклеиновых кислот, таких как миРНК. При конъюгировании низкомолекулярных соединений с нуклеиновой кислотой, они опосредуют успешную доставку нуклеиновой кислоты в клетку. Неожиданно обнаружили, что при использовании новых предложенных здесь соединений для успешной доставки теперь являются достаточными значительно пониженные дозы нуклеиновой кислоты. Таким образом, применение данных соединений дает мощный инструмент для доставки нуклеиновых кислот со значительно ограниченной токсичностью in vivo.

В одном воплощении настоящее изобретение направлено на применение соединений формулы

для доставки нуклеиновых кислот, где

Y представляет собой линкерную группу, выбранную из -(СН2)3- и -C(O)-N-(CH2-СН2-O)р-СН2-СН2-;

R1 представляет собой

-(С1-6)алкил;

-(СН2)-нафтил; или

-(CH2)m-фенил, который является незамещенным или замещенным вплоть до четырех раз заместителем, независимо выбранным из:

-NO2,

-CN, галогена,

-O-(СН2)-фенила,

-O-(С1-6)алкила или

-C(O)-NH2;

R2 представляет собой

водород;

-(СН2)k-N-С(Ph)3, причем фенильные кольца являются незамещенными или независимо замещенными -O-(С1-4)алкилом;

-(CH2)k-C(O)-NH2;

-(СН2)k-фенилом;

-(С1-6)алкилом, который является незамещенным или один раз замещенным -S-СН3;

R3 представляет собой

-NH-фенил, причем фенильная группа является дополнительно замещенной заместителем, независимо выбранным из

-(СН2)-ОН или

-(СН2)-O-С(O)-O-(4-нитрофенила);

k равен 1, 2, 3, 4, 5, 6;

m равен 1, 2, 3 или 4;

n равен О или 1 и

р представляет собой целое число от 1 до 20.

В другом воплощении предложено применение соединений формулы (I) со специфичной конформацией, как показано в формуле (Ia)

для доставки нуклеиновых кислот,

где все заместители R1, R2, R3 и Y, а также переменные k, m, n и р имеют значения, приведенные выше.

В еще одном другом воплощении настоящее изобретение направлено на применение соединений формулы (I) или (Ia) для доставки нуклеиновых кислот, где Y представляет собой -(CH2)3-; и все остальные замещающие группы имеют значение, приведенное выше.

В еще одном другом воплощении настоящее изобретение направлено на применение соединений формулы (I) или (Ia) для доставки нуклеиновых кислот, где Y представляет собой -C(O)-N-(CH2-CH2-O)p-CH2-CH2-; и все замещающие группы имеют значение, приведенное выше.

В еще одном другом воплощении предложено применение соединений формул (I) или (Ia) для доставки нуклеиновых кислот, где

Y представляет собой -(CH2)3-;

R2 представляет собой -(СН2)k-N-С(Ph)3, причем фенильные кольца являются незамещенными или независимо замещенными -O-(С1-4)алкилом и

R3 представляет собой -NH-фенил, причем фенильная группа дополнительно замещена

-(СН2)-O-С(O)-O-(4-нитрофенилом);

n равен 0; и

R1 и k имеют значения, приведенные выше.

В еще одном другом воплощении предложено применение соединений формул (I) или (Ia) для доставки нуклеиновых кислот, где

Y представляет собой -С(O)-N-(СН2-СН2-O)р-СН2-СН3-;

R2 представляет собой -(СН2)k-N-С(Ph)3, причем фенильные кольца являются незамещенными или независимо замещенными -O-(С1-4)алкилом; и

R3 представляет собой -NH-фенил, причем фенильная группа дополнительно замещена

-(СН2)-O-С(O)-O-(4-нитрофенилом);

n равен 0; и

R1, k и р имеют значения, приведенные выше.

Термин «(С1-6)алкил» в том виде, как он здесь используется, означает линейный или разветвленный насыщенный углеводород, содержащий от 1 до 6 атомов углерода. Предпочтительные С1-6алкильные группы включают метильную, этильную, пропильную, изо-пропильную, бутильную, 2-бутильную и тому подобное.

Термин «галоген» в том виде, как он здесь используется, означает фтор, хлор, бром или йод, причем фтор или хлор являются предпочтительными.

Соединения для применения в доставке нуклеиновых кислот согласно настоящему изобретению обычно могут быть получены с использованием способов, известных обычному специалисту в области органической или медицинской химии. Подобным образом, понятно, что холестериновую группировку можно заменять другими природными или химически синтезированными соединениями класса стероидов (например холановой кислотой, литохолевой кислотой и т.д.) или другими маленькими молекулами (например витаминами), известными за эффективность в доставке нуклеиновых кислот, такими как токоферол (Molecular Therapy, 2008, 16, 734).

Для успешной доставки нуклеиновых кислот соединения формулы (I) или (Ia) ковалентно присоединяют к нуклеиновым кислотам. Предпочтительно ковалентная связь создается реакцией подходящей функциональной группы, такой как, например, первичная аминогруппа в нуклеиновой кислоте, с активированной карбонильной группой в группировке -O-С(O)-O- R3, как определено здесь ранее. Следовательно, здесь предложен конъюгат, содержащий соединения формулы (I) или (Ia) и нуклеиновую кислоту.

Термин «нуклеиновая кислота» в том виде, как он здесь используется, относится к любой форме ДНК, включая кДНК, или РНК, или их фрагменту, нуклеотиду, нуклеозиду, олигонуклеотидам (включая антисмысловые олигонуклеотиды, ЗНК (закрытая нуклеиновая кислота) и миРНК), которые вызывают биологический эффект при введении животному in vivo, включая, но не ограничиваясь, птицами и млекопитающими, включая человека. Предпочтительными используемыми здесь нуклеиновыми кислотами являются миРНК.

Конъюгат, содержащий соединения, ковалентно присоединенные в нуклеиновой кислоте, демонстрирует улучшенную способность к поглощению клетками по сравнению с одной указанной нуклеиновой кислотой. Как только конъюгат доставляется в клетку и транспортируется в лизосому, соответствующая нуклеиновая кислота высвобождается ферментативным расщеплением. Данное расщепление предпочтительно происходит при включении в конъюгат дипептидного мотива, предпочтительно состоящего из последовательности α- или β-(фенил)аланина и лизина в том виде, в котором они присутствуют в соединениях формулы (I) или (Ia) (см. схему 1). Наиболее предпочтительно конъюгат содержит дипептидный мотив и спейсер, такой как пара-аминобензилкарбаматный спейсер (Bioconjugate Chem. 2002,13,855), который спонтанно фрагментируется, как только расщепляется амидная связь, находящаяся ближе к С-концу от дипептидного мотива, что проиллюстрировано в качестве примера для миРНК на схеме 2. Следовательно, конъюгаты, содержащие соединения формулы (I) или (Ia), также именуются как холестериновые конъюгаты, содержащие дипептид. Ферментативное отщепление нуклеиновой кислоты от холестериновых конъюгатов, содержащих дипептид, по данному изобретению катализируется эндогенными протеазами клетки. Одним примером эндогенной протеазы, способной расщеплять дипептидный мотив, присутствующий в соединениях формулы (I) или (Ia), является катепсин В. Катепсин В представляет собой известную вездесущую цистеиновую протеазу, локализованную в лизосомах клеток млетопитающих (Bioconjugate Chem. 2002,13,855; J. Med. Chem. 2005,48,1344; Nat. Biotechnology 2003,21,778). Таким образом, дипептидный мотив, описанный выше, также именуется дипептидным мотивом, расщепляемым катепсином.

Согласно настоящему изобретению, следовательно, также предложен способ доставки нуклеиновой кислоты в клетки, где указанная нуклеиновая кислота может затем отщепляться от конъюгата с развертыванием терапевтической активности.

В другом воплощении настоящего изобретения предложено применение конъюгата соединений формулы (I) или (Ia), ковалентно присоединенного к миРНК для внутриклеточной доставки.

Конъюгаты формулы (I) или (Ia), ковалентно присоединенные к нуклеиновой кислоте, обозначены здесь как формула (II) или (IIa) соответственно.

Следовательно, в другом воплощении согласно настоящему изобретению предложено соединение формулы

где R3 представляет собой -(CH2)k-NH2;

R1 и k имеют значения, приведенные выше для формулы (I).

В более конкретном воплощении согласно настоящему изобретению предложены соединения формулы

где Ra представляет собой -(CH2)k-NH2;

R1 и k имеют значения, приведенные выше для формулы (I).

В предпочтительном воплощении нуклеиновая кислота в формуле (II) или (IIa) представляет собой миРНК.

Соединения формулы (II) или (IIa) могут иметь ценные свойства в терапии. Следовательно, в другом воплощении предложены соединения формулы (II) или (IIa) для применения в качестве лекарственных средств.

Другим воплощением изобретения является фармацевтическая композиция, содержащая конъюгаты соединений формулы (I) или (Ia), ковалентно присоединенные к нуклеиновой кислоте.

В еще одном другом воплощении изобретения предложена фармацевтическая композиция, содержащая соединения формулы (IIa) совместно с фармацевтически приемлемыми эксципиентами.

Приведенные ниже воплощения проиллюстрированы примерами для конъюгатов соединений формулы (I) или (Ia), ковалентно присоединенных к миРНК. Понятно, что данные воплощения также применимы для других типов нуклеиновых кислот, как определено выше.

Ковалентное присоединение миРНК к соединениям формулы (I) или (Ia) достигается посредством реакции подходящей нуклеофильной группы, т.е. первичной аминогруппы в миРНК, с активированной -С(O)- группой в R3 указанных соединений формулы (I) или (Ia). Активацию данной группы -С(O)- получают посредством пара-нитрофеноксикарбоната, как показано на схеме 2, приведенной ниже.

Карбонат, активированный пара-нитрофенилом, например, можно подвергать взаимодействию с миРНК, имеющей подходящий нуклеофил, такой как первичный амин гексиламинного линкера, с образованием карбаматной связи для получения ковалентного конъюгата миРНК. Как только миРНК внутриклеточно поглощается и переносится в лизосому, соединения формулы (II) или (IIa), где биологически активным веществом является миРНК, расщепляются протеазной активностью, высвобождая миРНК через реакцию 1,6-элиминации, как также показано на схеме 3. Холестериновая группировка конъюгата соединений формулы (II) или (IIa) модифицирует РК (фармакокинетические) свойства миРНК таким образом, что системное введение обеспечивает сайленсинг гена in vivo.

В одном воплощении соединения формулы (II) или (IIa), где нуклеиновая кислота представляет собой миРНК, вводятся совместно с полимером для доставки. Полимеры для доставки являются средствами разрушения клеточных мембран и опосредуют эндосомальное высвобождение. В другом воплощении указанный полимер для доставки и конъюгат миРНК по изобретению не являются ковалентно присоединенными, синтезируются раздельно и могут поставляться в отдельных контейнерах или в одном контейнере. Полимеры для доставки для олигонуклеотидов, таких как миРНК, хорошо известны в данной области.

Например, Rozema et al. в публикации патента США 20040162260 продемонстрировали способы обратимой регуляции мембраноразрушающей активности полиамина, активного в отношении мембран. Обратимая регуляция дает способ ограничения активности эндосомами клеток-мишеней, таким образом, ограничивая токсичность. Их способ основывался на реакции аминов на полиамине с 2-пропионово-3-метилмалеиновым ангидридом. Данная модификация превращала поликатион до полианиона посредством превращения первичных аминов до карбоксисодержащих групп и обратимого ингибирования мембранной активности полиамина.

Для обеспечения совместной доставки нуклеиновой кислоты с носителем для доставки, нуклеиновую кислоту ковалентно связывали с полимером для доставки. В предварительной заявке на патент США 61/307490 описано новое поколение полимеров для доставки. В ней предложен активный в отношении мембран полиамин, содержащий амфипатический терполимер, образованный случайной полимеризацией аминосодержащих мономеров, низших гидрофобных мономеров и высших гидрофобных мономеров. Это новое поколение полимеров для доставки устранило требование того, чтобы полинуклеотид и полимер были ассоциированы либо ковалентной связью, либо взаимодействием заряд-заряд.

Неограничивающие примеры полимеров для доставки, используемых для совместного введения с конъюгатами миРНК по настоящему изобретению, представляют собой активные в отношении мембран полиамины и поли(виниловый эфир) (PBAVE), динамические поликонъюгаты (DPC; Rozema et al. 2007) и улучшенные DPC, как раскрыто в предварительной заявке на патент США 61/307490.

В другом воплощении предложена новая структура химической модификации миРНК для функциональной доставки in vivo. Эта новая структура химической модификации миРНК является особенно полезной с носителями для доставки, которые демонстрируют относительно сильное удерживание в эндосомах/лизосомах.

Обнаружили, что стабилизация миРНК против деградации локализованными в эндосомах/лизосомах нуклеазами, такими как ДНКаза II, сильно улучшает нокдаун мишени. Такая стабилизация может непосредственно влиять на количество миРНК, высвобождаемой в цитоплазму, где локализуется аппарат клеточной РНКи (РНК-интерференция). Только та часть миРНК, которая доступна в цитоплазме, способна запускать эффект РНКи.

Помимо плохих фармакокинетических характеристик, миРНК чувствительны к нуклеазам в биологической среде при введении их, как таковых, в систему кровообращения без защитного носителя для доставки. Соответственно, многие миРНК быстро деградируют либо внеклеточно в ткани и кровотоке, либо после внутриклеточного поглощения (например, в эндосоме).

Одной хорошо известной нуклеазой, локализованной в эндосомном/лизосомном компартменте, является ДНКаза II. Данный фермент является активным при рН меньше 6-6,5 с максимумом активности в интервале рН 4,5-5, отражая условия, присутствующие в подкисленной среде эндосомного/лизосомного компартмента. Следующие пути деградации РНК, индуцированной ДНКазой II, были идентифицированы in vitro и раскрыты в данном изобретении:

А. Нити РНК, содержащие по меньшей мере один 2'-ОН нуклеотид, быстро деградируют через циклическое пятивалентное промежуточное соединение фосфора, приводя к 2'-3' циклическим фосфатам в 5'-продукте расщепления. Образование пятивалентного промежуточного соединения можно ингибировать нуклеотидами, не имеющими 2'-ОН группы, такими как 2'-дезокси, 2'-O-метил (2'-ОМе) или 2'-дезокси-2'-фтор (2'-F) нуклеотиды.

Б. Дополнительно, РНК деградирует в 5'-экзонуклеолитическом пути, независимо от 2'-модификации на 5'-концевых нуклеотидах. Данный путь деградации можно ингибировать 5'-концевыми ненуклеотидными группировками, подобными, например, холестерину, аминоалкильному линкеру или фосфоротиоату в первой межнуклеотидной связи.

В. 5'-фосфат также защищает и замедляет кинетику экзонуклеолитического расщепления, но не может полностью блокировать данный путь. Это вероятнее всего обусловлено расщеплением 5'-фосфата фосфатазами или собственной фосфатазной активностью ферментативного препарата ДНКазы II, используемого в анализах стабильности in vitro.

Г. Наилучшая защита достигалась с олигонуклеотидами, не имеющими какого-либо 2'-ОН нуклеотида в пределах нити, начинающимися 2'-ОМе нуклеотидом на 5'-конце, соединенным фосфоротиоатной (РТО) связью со вторым нуклеотидом. Другие концевые нуклеотиды, не имеющие 2'-ОН группы, также защищают против 5'-экзо деградации, но в меньшей степени по сравнению с модификацией 2'-ОМе.

Следовательно, авторы настоящего изобретения обнаружили, что миРНК можно значительно стабилизировать при использовании следующей конструкции, в которой предложен олигонуклеотид с антисмысловой нитью со структурой модификации: 5'-(w)-(Z1)-(Z2)-(Z3)na-3', и смысловой нитью со структурой модификации: 5'-(Z3)ns-3', где

w независимо представляет собой 5'-фосфат или 5'-фосфотиоат, или Н,

Z1 независимо представляет собой 2'-модифицированный нуклеозид.

Z2 независимо представляет собой 2'-дезоксинуклеозид или 2'-фтор-модифицированный нуклеозид,

Z3 независимо представляет собой 2'-модифицированный нуклеозид,

na равен 8-23, и ns равен 8-25.

В одном предпочтительном воплощении предложен олигонуклеотид с антисмысловой нитью со структурой модификации: 5'-(w)-(Z1)-(Z2)- (Z3)na-3', и смысловой нитью со структурой модификации: 5'-(Z3)ns-3', где Z1 представляет собой 2'-фтор-модифицированный нуклеозид или 2'-дезоксинуклеозид, и все остальные заместители, а также переменные Па и ns имеют значение, приведенное выше.

В одном предпочтительном воплощении предложен олигонуклеотид с антисмысловой нитью со структурой модификации: 5'-(w)-(Z1)-(Z2)-(Z3)na-3', и смысловой нитью со структурой модификации: 5'-(Z3)ns-3', где Z3 представляет собой 2'-O-метил-модифицированный нуклеозид, 2'-фтор-модифицированный нуклеозид или 2'-дезоксинуклеозид, и все остальные заместители, а также переменные na и ns имеют значение, приведенное выше.

В одном предпочтительном воплощении предложен олигонуклеотид с антисмысловой нитью со структурой модификации: 5'-(w)-(Z1)-(Z2)-(Z3)na-3', и смысловой нитью со структурой модификации: 5'-(Z3)ns-3', где Z1 представляет собой 2'-фтор-модифицированный нуклеозид или 2'-дезоксинуклеозид, Z3 представляет собой 2'-O-метил-модифицированный нуклеозид, 2'-фтор-модифицированный нуклеозид или 2'-дезоксинуклеозид, и все остальные заместители, а также переменные na и ns имеют значения, приведенные выше.

Нуклеозиды в последовательности нуклеиновой кислоты олигонукпеотида с новой структурой модификации могут быть связаны либо 5'-3' фосфодиэфирами, либо 5'-3' фосфоротиоатами.

Термин «антисмысловая» нить в том виде, как он здесь используется, означает нить миРНК, которая является комплементарной мРНК-мишени, и которая будет связываться с данной мРНК, как только миРНК разворачивается.

Смысловая нить указанной миРНК, содержащей новую структуру модификации, является комплементарной антисмысловой нити.

Указанная миРНК, содержащая новую структуру модификации, оказалась особенно полезной при ковалентном присоединении к полимеру для доставки, как проиллюстрировано примерами Rozema et al. (Dynamic PolyConjugates (DPC; Rozema et al. 2007). Силу и продолжительность эффекта можно значительно увеличивать с использованием стратегии модификации миРНК, описанной в данном изобретении.

В другом воплощении указанная миРНК, содержащая новую структуру модификации, является особенно полезной при конъюгировании с маленькими молекулами, которые изменяют фармакокинетические свойства миРНК, такими как холестерин или предложенные здесь соединения формулы (I) и (Ia). В одном воплощении предложен конъюгат маленькой молекулы и олигонуклеотида, где олигонуклеотид имеет следующую структуру модификации: антисмысловую нить со структурой модификации: 5'-(w)-(Z1)-(Z2)-(Z3)na-3', и смысловую нить со структурой модификации: 5'-(Z3)ns-, где заместители, а также переменные na и ns имеют значение, приведенное выше. В одном воплощении указанная маленькая молекула представляет собой холестерин. В другом воплощении указанная маленькая молекула представляет собой соединение формулы (I) или (Ia), приводя к соединениям формулы (II) или (IIa).

Предпочтительно указанные конъюгаты миРНК вводят совместно с полимером для доставки. Подходящие полимеры для доставки описаны выше.

В одном воплощении указанная миРНК, содержащая новую структуру модификации, является особенно полезной при конъюгировании с лигандом, для которого известно, что он связывается со специфичным рецептором, который интернализует конъюгат в клетку. В частности, асиалогликопротеиновый рецептор (ASGPR), экспрессируемый на гепатоцитах, является хорошо известным рецептором, обеспечивающим клиренс (эндоцитоз и лизосомную деградацию) десиалированных белков из системы кровообращения. Было показано, что N-ацетил-D-галактозамин имеет высокую аффинность связывания в отношении данного рецептора, особенно когда он присутствует в многовалентном состоянии, и когда остатки галактозы правильно расположены в пространстве (J Biol Chem, 2001, 276, 37577). Для того чтобы использовать этот высокоэффективный рецептор для эндоцитоза нуклеиновой кислоты, опосредованного рецептором, был получен показанный ниже синтетический лиганд, ковалентно присоединенный к миРНК, содержащей новую структуру модификации. Поскольку данный тип эндоцитоза приводит к лизосомальной деградации интернализованного вещества, миРНК должна быть получена таким способом, чтобы она была стабильной в лизосоме, что теперь решено посредством новой структуры модификации, описанной выше.

Подобным образом, понятно, что адресующий лиганд, показанный в формуле III, конъюгированный с нуклеиновой кислотой, такой как миРНК, как показано в формуле IV, может быть заменен другими природными или химически синтезированными соединениями (антагонистами или агонистами), демонстрирующими высокую аффинность связывания с рецепторами, экспрессируемыми на поверхности клетки. Пример включает фолат в качестве лиганда для фолатного рецептора, экспрессируемого на целом ряде раковых клеток (Ann. N.Y. Acad. Sci., 2009, 1175, 32), или молекулы, связывающиеся с PSMA (специфический мембранный антиген простаты) (Nature Biotech, 2006, 24, 1005; Mol Pharm, 2009, 6, 780).

Лиганд для ASGPR присоединяется к нуклеиновой кислоте посредством амидной связи. Образование амидной связи можно осуществлять с помощью N-гидрокси-сукцинимидной (NHS) химии. Лиганд, используемый в реакции конъюгирования, показан ниже (формула III). Для взаимодействия с ASGPR O-ацетатные группы на остатках Сахаров должны быть удалены, как показано в (формуле IV) для миРНК.

В одном воплощении изобретения предложены конъюгат соединения формулы IV и олигонуклеотид, где олигонуклеотид имеет следующую структуру модификации: антисмысловую нить со структурой модификации: 5'-(w)-(Z1)-(Z2)-(Z3)na-3', и смысловую нить со структурой модификации: 5'-(Z3)ns-, где заместители, а также переменные na и ns имеют значение, приведенное выше. Указанный конъюгат также называется GalNAc пальмитоиловый конъюгат. Предпочтительно указанный GalNAc пальмитоиловый конъюгат вводят совместно с полимером для доставки. Подводящие полимеры для доставки описаны выше.

Обнаружили, что для данных структур модификации расщепляемые линкеры оказались более полезными по сравнению со стабильно связанными низкомолекулярными лигандами. Возможные расщепляемые линкеры представляют собой дипептидный мотив, как проиллюстрировано примером на схеме 1, или расщепляемый РНК-линкер, включающий 2'-ОН содержащие нуклеотиды. Расщепляемый РНК-линкер является особенно полезным в связи с миРНК, имеющей новую структуру модификации (полностью 2'-модифицированная миРНК), описанную выше.

В принципе, сайт расщепления нуклеазой можно вводить посредством 3' или 5' липких концов, содержащих по меньшей мере один 2'-ОН нуклеотид либо в смысловой, либо в антисмысловой нити. Конечная активная форма миРНК генерируется внутриклеточным нуклеазным процессингом. Также возможно применение определенных сайтов расщепления с участием 2'-ОН нуклеотидов в пределах области спаривания оснований. Это можно сделать с использованием по меньшей мере одного 2'-ОН нуклеотида, комплементарного противоположной нити, или посредством введения либо по меньшей мере одного 2'-ОН нуклеотида с нарушением принципа комплементарности, либо шпильки/выпячивания, содержащего по меньшей мере один 2'-ОН нуклеотид.

В отличие от других химических подходов с расщепляемыми линкерами, применение определенных сайтов расщепления путем введения 2'-ОН нуклеотидов дает более надежный подход конъюгирования. Посредством введения селективных сайтов расщепления на одной или на обеих нитях миРНК или на 3', и/или на 5'-конце, или в пределах структуры дуплекса, возможно множественное конъюгирование.

Соответственно, в одном воплощении предложен конъюгат маленькой молекулы и олигонуклеотида, где

а) маленькая молекула содержит нуклеотидный линкер, содержащий 1-10, предпочтительно 1-5, наиболее предпочтительно 1-3 2'ОН-нуклеотида;

б) олигонуклеотид имеет следующую структуру модификации:

антисмысловую нить со структурой модификации: 5'-(w)-(Z1)-(Z2)-(Z3)na-3' и смысловую нить со структурой модификации: 5'-(Z3)ns-, где заместители, а также переменные na и ns имеют значение, приведенное выше; и

в) олигонуклеотид ковалентно присоединен к маленькой молекуле через нуклеотидный линкер.

Нуклеотидный линкер расщепляется, например, в эндосоме, посредством внутриклеточных нуклеаз, таких как ДНКаза II, после интернализации конъюгата, таким образом, высвобождая миРНК.

Предпочтительно указанный конъюгат вводится совместно с полимером для доставки. Подходящие полимеры для доставки описаны выше.

В другом воплощении изобретения предложено соединение формулы (V). Данное соединение содержит холестериновую группировку и нуклеотидный линкер, содержащий 1-10, предпочтительно 1-5, наиболее предпочтительно 1-3 2'ОН-нуклеотида. Этот нуклеотидный линкер является полезным для ковалентного присоединения олигонуклеотида, такого как миРНК, к соединению формулы (V). Предпочтительно указанный олигонуклеотид имеет новую структуру модификации, описанную выше. Следовательно, в другом воплощении предложен конъюгат соединения формулы (V) и олигонуклеотид, где олигонуклеотид ковалентно присоединен к нуклеотидному линкеру соединения формулы (V).

Нуклеотидный линкер расщепляется внутриклеточными нуклеазами, такими как ДНКаза II, после интернализации конъюгата соединения формулы (V) и олигонуклеотида в эндосому, таким образом, высвобождая миРНК.

Предпочтительно указанный конъюгат соединения формулы (V) и олигонуклеотид вводятся совместно с полимером для доставки. Подходящие полимеры для доставки описаны выше.

В другом воплощении указанный полимер для доставки, конъюгат соединения формулы (V) и олигонуклеотид по изобретению не являются ковалентно связанными, синтезируются раздельно и могут поставляться в отдельных контейнерах или в одном контейнере.

Определения

Термин «маленькая молекула» в том виде, как он здесь используется, относится к органическим или неорганическим молекулам либо синтезированным, либо обнаруженным в природе, обычно имеющим молекулярную массу меньше, чем 10000 граммов на моль, возможно меньше, чем 5000 граммов на моль и возможно меньше, чем 2000 граммов на моль.

Термин «пептид» в том виде, как он здесь используется, относится к любому полимерному соединению, продуцируемому посредством образования амидной связи между альфа-карбоксильной группой одной D- или L-аминокислоты и альфа-аминогруппой другой D- или L-аминокислоты. Термин «белок» в том виде, как он здесь используется, относится к полипептидам специфичной последовательности из более чем примерно 50 остатков.

Термин «дипептидный мотив» в том виде, как он здесь используется, относится к любому мотиву, содержащему амидную связь, образованную или D-, или L-альфа, или бета аминогруппой первой аминокислоты с альфа-карбоксильной группой второй D- или L-аминокислоты.

Термин «аминокислота» в том виде, как он здесь используется, относится к любой молекуле, которая содержит и амино и карбоксильную функциональные группы. Таким образом, термин «аминокислота» относится как к природным, неприродным, так и к синтетическим аминокислотам. Любые природные аминокислоты, используемые в настоящем изобретении, именуются здесь их обычными сокращениями.

Термин «лиганд» в том виде, как он здесь используется, относится к группировке, которая способна к ковалентному или иному химическому связыванию с нуклеиновой кислотой. Термин «лиганд» в контексте изобретения предпочтительно представляет собой соединение формулы (I) или (Ia), ковалентно присоединенное к нуклеиновой кислоте.

Термин «нуклеиновая кислота» в том виде, как он здесь используется, означает олигомер или полимер, состоящий из нуклеотидов, например, из дезоксирибонуклеотидов или рибонуклеотидов, или соединений, полученных синтетически (например ПНК (пептидная нуклеиновая кислота), как описано в патенте США №5948902 и процитированных в нем ссылках), который может гибридизоваться с встречающимися в природе нуклеиновыми кислотами специфично в отношении последовательности, аналогично гибридизации двух встречающихся в природе нуклеиновых кислот, например, может участвовать во взаимодействиях на основе образования пар оснований по Уотсону-Крику. Нуклеиновые кислоты, не встречающиеся в природе, представляют собой олигомеры или полимеры, которые содержат последовательности нуклеиновых оснований, которые не встречаются в природе, или соединения, которые содержат функциональные эквиваленты нуклеиновых оснований, встречающихся в природе, сахара или межсахарные связи, подобные пептидным нуклеиновым кислотам (ПНК), треозным нуклеиновым кислотам (ТНК), закрытым нуклеиновым кислотам (ЗНК) или глицериновым нуклеиновым кислотам (ГНК). Данный термин включает олигомеры, которые содержат встречающиеся в природе нуклеиновые основания нуклеиновых кислот: аденин (А), гуанин (G), тимин (Т), цитозин (С) и урацил (U), а также олигомеры, которые содержат аналоги оснований или модифицированные нуклеиновые основания. Нуклеиновые кислоты могут происходить из множества природных источников, таких как вирусные, бактериальные и эукариотические ДНК и РНК. Другие нуклеиновые кислоты могут происходить из синтетических источников и включают любой из многочисленных олигонуклеотидов, которые производят для применения в качестве исследовательских реактивов, диагностических агентов или потенциальных и определенных терапевтических агентов. Данный термин включает олигомеры, содержащие одноцепочечную нуклеиновую кислоту или двухцепочечную нуклеиновую кислоту.

Термин «2'-модифицированный» в том виде, как он здесь используется, относится к β-D-рибонуклеозиду или β-D-рибонуклеотиду, содержащему встречающиеся в природе нуклеиновые основания, имеющие группу 2'-ОН, замененную Н, F, O-СН3 или другими заместителями, известными в данной области.

Термин «2'-ОН-нуклеотид» в том виде, как он здесь используется, относится к p-D-рибонуклеотиду, содержащему встречающиеся в природе нуклеиновые основания, имеющие группу 2'-ОН.

Термин «5'-фосфат» в том виде, как он здесь используется, относится к формуле -O-Р(=0)(ОН)ОН. В другом аспекте фосфат модифицирован так, что одна из групп О или ОН заменена S, и именуется здесь «5'-фосфотиоат».

Термин «фосфоротиоат» в том виде, как он здесь используется, относится к межнуклеотидной связи, в которой один из кислородов, не образующих мостик, заменен серой.

Термин «полимер для доставки» в том виде, как он здесь используется, относится к полимерам, подходящим для функциональной доставки нуклеиновой кислоты. В контексте настоящего изобретения полимер для доставки является либо ковалентно присоединенным, либо вводится совместно с биологически активным веществом, конъюгированным с описанными здесь соединениями, и опосредует покидание эндосом после интернализации в клетку и поглощение в эндосому. Термин «полимер» в данном контексте означает любое соединение, которое составлено из двух или более чем двух мономерных единиц, ковалентно связанных друг с другом, где мономерные единицы могут быть одинаковыми или разными, так что полимер может быть гомополимером или гетерополимером. Репрезентативные полимеры включают пептиды, полисахариды, нуклеиновые кислоты и тому подобное, где полимеры могут быть встречающимися в природе или синтетическими. Неограничивающие примеры полимеров для доставки, например, рассматриваются в INTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH AND DEVELOPMENT, October - 2010/Volume - 2/Issue - 8/Article No-2. Неограничивающие примеры полимеров для доставки, полезных для доставки нуклеиновых кислот, раскрыты в заявках ЕР 10165502.5 и 10191030.5, публикации РСТ WO 2008/0022309, предварительной заявке на патент США 61/307490 и ссылках, процитированных здесь; которые все включены сюда посредством ссылки.

Термин «фармацевтическая композиция» в том виде, как он здесь используется, включает конъюгаты по изобретению, фармацевтический носитель или разбавитель и любые другие среды или агент, необходимые для приготовления препарата.

Термин «фармацевтический носитель» в том виде, как он здесь используется, включает все и любые растворители, диспергирующие среды, покрытия, антибактериальные и противогрибковые агенты, изотоничные агенты и агенты, замедляющие поглощение, и тому подобное, которые являются физиологически совместимыми. Предпочтительно носитель подходит для внутривенного, внутримышечого, подкожного, парентерального, спинального или эпидермального введения (например, посредством инъекции или инфузии).

Конъюгат по настоящему изобретению можно вводить множеством способов, известных в данной области. Как будет понятно специалисту, путь и/или способ введения будет варьировать, в зависимости от желательных результатов. Для введения конъюгата по изобретению определенными путями введения может быть необходимым покрытие конъюгата или совместное введение конъюгата с веществом для предотвращения его инактивации. Например, конъюгат можно вводить субъекту в подходящем носителе или разбавителе. Фармацевтически приемлемые разбавители включают физиологический раствор и водные буферные растворы. Фармацевтические носители включают стерильные водные растворы или дисперсии и стерильные порошки для получения стерильных инъецируемых растворов или дисперсии для немедленного приема. Применение таких сред и агентов для фармацевтически активных веществ известно в данной области.

Фразы «парентеральное введение» и «введенный парентерально» в том виде, как они здесь используются, означают способы введения, отличные от энтерального и местного введения, обычно посредством инъекции, и включают, без ограничения, внутривенную, внутримышечную, внутриартериальную, подоболочечную, внутрисуставную, внутриглазничную, внутрисердечную, внутрикожную, внутрибрюшинную, чрестрахейную, подкожную, подкутикулярную, внутрисуставную, подкапсулярную, подпаутинную, внутрипозвоночную, эпидуральную и надчревную инъекцию и инфузию.

Данные носители также могут содержать адъюванты, такие как консерванты, увлажнители, эмульгаторы и диспергирующие агенты. Предупреждение присутствия микроорганизмов может обеспечиваться как методиками стерилизации, приведенными выше, так и включением различных антибактериальных и противогрибковых агентов, например, парабена, хлорбутанола, фенола, сорбиновой кислоты и тому подобного. Также может быть желательным включение в композиции изотоничных агентов, таких как сахара, хлорид натрия и тому подобное. Кроме того, длительное поглощение инъецируемой фармацевтической формы может осуществляться включением агентов, которые задерживают поглощение, таких как моностеарат алюминия и желатин.

Независимо от выбранного пути введения, конъюгаты по настоящему изобретению, которые могут быть использованы в подходящей гидратированной форме, и/или фармацевтические композиции по настоящему изобретению готовят в виде препарата в фармацевтически приемлемых лекарственных формах традиционными способами, известными специалистам в данной области.

Реальные уровни дозировок активных ингредиентов в фармацевтических композициях по настоящему изобретению могут варьировать так, чтобы получать количество активного ингредиента, которое является эффективным для достижения желательного терапевтического ответа для конкретного пациента, композиции и способа введения, без того, чтобы быть токсичными для пациента. Выбранный уровень дозировки будет зависеть от множества фармакокинетических факторов, включающих активность конкретных применяемых композиций по настоящему изобретению, путь введения, время введения, скорость экскреции конкретного применяемого соединения, продолжительность лечения, другие лекарственные средства, соединения и/или вещества, используемые в комбинации с конкретными применяемыми композициями, возраст, пол, массу, состояние, общее состояние здоровья и предыдущую медицинскую историю пациента, которого лечат, и подобные факторы, хорошо известные в области медицины.

Фармацевтическая композиция должна быть стерильной и жидкой до такой степени, чтобы композицию можно было доставлять посредством шприца. Помимо воды, носитель предпочтительно представляет собой изотоничный буферизованный физиологический раствор.

Надлежащую жидкостность можно поддерживать, например, посредством применения такого покрытия, как лецитин, посредством поддержания требующегося размера частиц в случае дисперсии и посредством применения поверхностно-активных веществ. Во многих случаях в композицию предпочтительно включать изотоничные агенты, например, сахара, полиспирты, такие как маннит или сорбит, и хлорид натрия.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

На Фиг.1 показано совместное введение in vivo конъюгатов миРНК, содержащих соединения формулы (I) или (Ia) и полимер для доставки.

На Фиг.2 показано совместное введение in vivo конъюгатов миРНК, содержащих соединения формулы (I) или (Ia) и полимер для доставки.

На Фиг.3 показано совместное введение in vivo конъюгатов миРНК, содержащих соединения формулы (I) или (Ia) и полимер для доставки.

На Фиг.4 показано совместное введение in vivo конъюгатов миРНК, содержащих соединения формулы (I) или (Ia) и полимер для доставки.

На Фиг.5а показан опосредованный антисмысловой нитью сайленсинг гена посредством полностью 2'-модифицированных миРНК. Клетки COS7 сотрансфицировали миРНК, направленными на EGFP (усиленный зеленый флуоресцентный белок), в концентрации 3 нМ и psiCHECK2-AT. Активность нокдауна миРНК оценивали посредством измерения активности люциферазы Renilla по сравнению с активностью люциферазы светляка из репортерной конструкции. миРНК сортировали по активности нокдауна относительно немодифицированных (2-19-2) контрольных миРНК.

На Фиг.56 показан опосредованный смысловой нитью сайленсинг гена посредством полностью 2'-модифицированных миРНК. Клетки COS7 сотрансфицировали миРНК, направленными на EGFP, в концентрации 3 нМ и psiCHECK2-ST. Активность нокдауна миРНК оценивали посредством измерения экспрессии люциферазы из репортерной конструкции. миРНК сортировали по активности нокдауна относительно немодифицированных (2-19-2) контрольных миРНК.

На Фиг.6а показано снижение сывороточной активности FVII у приматов, не являющихся человеком, при внутривенной инъекции разных 2'-модифицированных миРНК, ковалентно присоединенных к полимеру для доставки. На Фиг.6б показано развитие протромбинового времени у приматов, не являющихся человеком, при обработке 2'-модифицированными миРНК, ковалентно конъюгированными с полимером для доставки.

ПРИМЕРЫ

Следующие примеры подразумеваются единственно в качестве ссылочного примера для того, чтобы проиллюстрировать синтез соединений для применения в доставке нуклеиновых кислот. Они не предназначены для того, чтобы образовать часть изобретения.

Пример 1

Стадия 1: 3-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-диметил-гексил)-10,13-диметил-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1 Н-циклопента[а]фенантрен-3-илокси]-пропиламин

Амин, указанный в заголовке, получали из его нитрильного предшественника согласно протоколу из литературы [Lollo et al., W02001/070415].

Стадия 2: N-{3-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-диметил-гексил)-10,13-диметил-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси]-пропил}-сукцинамовая кислота

В 2 л круглодонной колбе объединяли 3-((3S,8S,9S,10R,13R, 14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропан-1-амин (21,15 г, 47,7 ммоль, Экв.: 1,00) и основание Хунига (12,3 г, 16,6 мл, 95,3 ммоль, Экв.: 2,00) с AcOEt (этилацетат) (845 мл) с получением бесцветного раствора. Добавляли дигидрофуран-2,5-дион (4,77 г, 47,7 ммоль, Экв.: 1,00) в THF (тетрагидрофуран) (42 мл), и реакционную смесь перемешивали при температуре окружающей среды в течение ночи с получением белой суспензии. Все летучие вещества удаляли под вакуумом, остаток растворяли в CH2Cl2, органический слой промывали NH4Cl и рассолом, сушили над Na2SO4 и упаривали досуха. Неочищенный продукт растворяли в CH3CN/H2O и лиофилизировали с получением 29,8 г соединения, указанного в заголовке, в виде пушистого порошка.

МС (масс-спектрометрия) (ИСП) (индукционно-связанная плазма): (М-Н) 542,5.

Стадия 3: N 1-(3-((3S,8S,9S,10R,13R,148,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1 Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1 -((S)-1-(4-(гидроксиметил)фениламино)-6-((4-метоксифенил)дифенилметиламино)-1-оксогексан-2-иламино)-3-(4-нитрофенил)-1-оксопропан-2-ил)сукцинамид

В 10 мл круглодонной колбе в CH2Cl2 (1,8 мл) смешивали полученную ранее 4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1 Н-циклопента[а]фенантрен-3-илокси)пропиламино)-4-оксобутановую кислоту (106 мг, 184 мкмоль, Экв.: 1,00), (S)-2-((S)-2-амино-3-(4-нитрофенил)пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенилметиламино)гексанамид (132 мг, 184 мкмоль, Экв.: 1,00), HOAt (25,0 мг, 184 мкмоль, Экв.: 1,00) и EDC гидрохлорид (35,3 мг, 184 мкмоль, Экв.: 1,00) с получением желтого раствора. Добавляли основание Хунига (47,5 мг, 64,2 мкл, 368 мкмоль, Экв.: 2,00), и реакционную смесь перемешивали при температуре окружающей среды в течение ночи. ТСХ (тонкослойная хроматография) показала потребление исходного вещества. Все летучие вещества удаляли под вакуумом, и неочищенный продукт очищали флэш-хроматографией SiO2/7% МеОН/0,1% NEt3 в CH2Cl2 с получением 128 мг соединения, указанного в заголовке, в виде светло-желтого твердого вещества.

МС: ожидаемая масса: 1240,7552, обнаруженная масса: 1240,7518.

Стадия 4:

В 10 мл круглодонной колбе полученный ранее N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((Р)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-((S)-1-(4-(гидроксиметил)фениламино)-6-((4-метоксифенил)дифенилметиламино)-1-оксогексан-2-иламино)-3-(4-нитрофенил)-1-оксопропан-2-ил)сукцинамид (126 мг, 101 мкмоль, Экв.: 1,00) и основание Хунига (39,3 мг, 53,2 мкл, 304 мкмоль, Экв.: 3,00) объединяли с CH2Cl2 (1,4 мл) и DMF (1,0 мл) с получение желтой суспензии; добавляли бис(4-нитрофенил)карбонат (46,3 мг, 152 мкмоль, Экв.: 1,50), и давали реакции идти в течение ночи. Смесь выливали на битый лед, экстрагировали 2×AcOEt, промывали H2O, сушили над Na2SO4 и упаривали досуха. После растирания с ~10 мл диэтилового эфира получали 99 мг продукта, указанного в заголовке, в виде беловатого твердого вещества.

МС: ожидаемая масса: 1405,7614, обнаруженная масса: 1405,7518.

Необходимый дипептидный строительный блок для стадии 3 получали следующим образом:

Стадия а: (S)-2-[(S)-2-(9H-флуорен-9-илметоксикарбониламино)-3-(4-нитро-фенил)-пропиониламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановая кислота

В 25 мл круглодонной колбе в CH2Cl2 (20 мл) растворяли (S)-2-амино-6-((4-метоксифенил)дифенилметил-амино)гексановую кислоту (Bioconjugate Chem. 2002, 13, 855-869, 968 мг, 2,31 ммоль, Экв.: 1,00) с получением светло-желтого раствора. Добавляли основание Хунига (897 мг, 1,21 мл, 6,94 ммоль, Экв.: 3,00) и триметилхлорсилан (528 мг, 621 мкл, 4,86 ммоль, Экв.: 2,10), и реакционную смесь перемешивали в течение 15 мин.

Во второй 50 мл круглодонной колбе в DMF (диметилформамид) (20 мл) растворяли (S)-2-(((9Н-флуорен-9-ил)метокси)карбониламино)-3-(4-нитрофенил)пропановую кислоту (1 г, 2,31 ммоль, Экв.: 1,00) с получением бесцветного раствора. Добавляли основание Хунига (359 мг, 485 мкл, 2,78 ммоль, Экв.: 1,20) и TPTU [125700-71-2] (687 мг, 2,31 ммоль, Экв.: 1,00), и реакционную смесь перемешивали в течение 20 минут. Добавляли раствор из первой колбы, содержащий соответствующий силиловый эфир моносилиламина, и реакционную смесь перемешивали в течение еще 3 часов. Смесь выливали на битый лед/NH4Cl, экстрагировали 2×AcOEt, промывали H2O и рассолом, сушили над Na2SO4 и упаривали досуха. Флэш-хроматография SiO2/10% МеОН/0,1% NEt3 в CH2Cl2 давала 1,38 г соединения, указанного в заголовке, в виде коричневатой пены.

МС (ИСП): (М+Н) 833,5, (M+Na) 855,4.

Стадия б: сложный 9H-флуорен-9-илметиловый эфир [(S)-1-((S)-1-(4-гидроксиметил-фенилкарбамоил)-5-{[(4-метокси-фенил)-дифенил-метил]-амино}-пентилкарбамоил)-2-(4-нитро-фенил)-этил]-карбаминовой кислоты

В 250 мл грушевидной колбе в CH2Cl2 (16,6 мл) растворяли ранее синтезированную (S)-2-((S)-2-(((9Н-флуорен-9-ил)метокси)карбониламино)-3-(4-нитрофенил)пропанамидо)-6-((4-метоксифенил)дифенил-метиламино)гексановую кислоту (1,38 г, 1,66 ммоль, Экв.: 1,00), (4-аминофенил)метанол (204 мг, 1,66 ммоль, Экв.: 1,00), HOAt (226 мг, 1,66 ммоль, Экв.: 1,00) и EDC гидрохлорид (318 мг, 1,66 ммоль, Экв.: 1,00) с получением желтого раствора. Добавляли основание Хунига (428 мг, 579 мкл, 3,31 ммоль, Экв.: 2,00), и давали реакции идти в течение ночи. Смесь выливали на битый лед/NH4Cl (рН ~7), экстрагировали 2×AcOEt, промывали H2O, сушили над Na2SO4 и упаривали досуха. Неочищенный продукт растирали с диэтиловым эфиром (1×50 мл); образующееся твердое вещество отфильтровывали и сушили с получением 1,214 г соединения, указанного в заголовке, в виде светло-коричневого твердого вещества.

МС (ИСП): (М+Н) 938,7.

Стадия в: (4-гидроксиметил-фенил)-амид (S)-2-[(S)-2-амино-3-(4-нитро-фенил)-пропиониламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты

В 50 мл круглодонной колбе с THF (тетрагидрофуран) (19 мл) объединяли полученный ранее сложный 9Н-флуорен-9-илметиловый эфир [(S)-1-((S)-1-(4-гидроксиметил-фенилкарбамоил)-5-{[(4-метокси-фенил)-дифенил-метил]-амино}-пентилкарбамоил)-2-(4-нитро-фенил)-этил]-карбаминовой кислоты (1,214 г, 1,29 ммоль, Экв.: 1,001) с получением коричневого раствора. При 0° добавляли диэтиламин (1,77 г, 2,49 мл, 24,2 ммоль, Экв.: 18,70). Реакционную смесь перемешивали при температуре окружающей среды в течение 3 ч, когда МС показывала исчезновение исходного вещества. Все летучие вещества упаривали под вакуумом; следующая флэш-хроматография SiO2/0,1% NEt3 в CH2Cl2→10% МеОН/0,1% NEt3 в CH2Cl2, с последующей второй флэш-хроматографией SiO2/5% МеОН/0,1% NEt3 в CH2Cl2 давали 502 мг соединения, указанного в заголовке, в виде светло-коричневой пены.

МС: ожидаемая масса: 715,337, обнаруженная масса: 715,3362.

Пример 2

O-Бензил-N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-1--тирозил-N~6~-[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-лизинамид

получали по аналогии с Примером 1, но используя на стадии 3 в качестве партнера связывания (4-гидроксиметил-фенил)-амид (S)-2-[(S)-2-амино-3-(4-бензилокси-фенил)-пропиониламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты вместо (S)-2-((S)-2-амино-3-(4-нитрофенил)пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенил-метиламино)гексанамида. Первый получали из (S)-2-(((9Н-флуорен-9-ил)метокси)карбониламино)-3-(4-(бензилокси)фенил)пропановой кислоты, как описано выше на стадиях а]-в].

МС: ожидаемая масса: 1466,8182, обнаруженная масса: 1466,8136.

Пример 3

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-4-циано-1-фенилаланил-N~6~-[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-лизинамид

получали по аналогии с Примером 1, но используя на стадии 3 в качестве партнера связывания (4-гидроксиметил-фенил)-амид (S)-2-[(S)-2-амино-3-(4-циано-фенил)-пропиониламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты вместо (S)-2-((S)-2-амино-3-(4-нитрофенил)-пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенил-метиламино)гексанамида. Первый получали из (S)-2-(((9Н-флуорен-9-ил)метокси)карбониламино)-3-(4-цианофенил)пропановой кислоты, как описано выше на стадиях а]-в].

МС: ожидаемая масса: 1385,7716, обнаруженная масса: 1385,7696.

Пример 4

3,4-Дихлор-N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-фенилаланил-N~6~[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-лизинамид

получали по аналогии с Примером 1, но используя на стадии 3 в качестве партнера связывания (4-гидроксиметил-фенил)-амид (S)-2-[(S)-2-амино-3-(3,4-дихлор-фенил)-пропиониламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты вместо (S)-2-((S)-2-амино-3-(4-нитрофенил)-пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенил-метиламино)гексанамида. Первый получали из (S)-2-(((9Н-флуорен-9-ил)метокси)карбониламино)-3-(3,4-дихлорфенил)пропановой кислоты, как описано выше на стадиях а]-в]. МС: ожидаемая масса: 1428,6984, обнаруженная масса: 1428,695.

Пример 5

4-Хлор-N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-фенилаланил-N~6~-[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-лизинамид

получали по аналогии с Примером 1, но используя на стадии 3 в качестве партнера связывания (S)-2-((S)-2-амино-3-(4-хлорфенил)пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенил-метиламино)гексанамид вместо (3)-2-((S)-2-амино-3-(4-нитрофенил)-пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенил-метиламино)гексанамида. Первый получали из (S)-2-(((9Н-флуорен-9-ил)метокси)-карбониламино)-3-(4-хлорфенил)пропановой кислоты, как описано выше на стадиях а]-в].

МС: ожидаемая масса: 1394,7373, обнаруженная масса: 1394,7342.

Пример 6

4-{[(2S)-2-{[(2S)-2-[(4-{[3-({(3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((2R)-6-метилгептан-2-ил]-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-ил}окси)пропил]амино}-4-ксобутаноил)амино]-3-(нафталин-1-ил)пропаноил]амино}-6-{[(4-метоксифенил)(дифенил)метил]амино}гексаноил]амино}бензил 4-нитрофенил карбонат (непредпочтительное название)

получали по аналогии с Примером 1, но используя на стадии 3 в качестве партнера связывания (4-гидроксиметил-фенил)-амид (S)-2-((S)-2-амино-3-нафталин-1-ил-пропиониламино)-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты вместо (S)-2-((S)-2-амино-3-(4-нитрофенил)-пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенил-метиламино)гексанамида. Первый получали из (S)-2-(((9Н-флуорен-9-ил)метокси)-карбониламино)-3-(нафталин-1-ил)пропановой кислоты, как описано выше на стадиях а]-в]. МС: ожидаемая масса: 1410,792, обнаруженная масса: 1410,7918.

Пример 7

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-4-фтор-1--фенилаланил-N~6~-[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-лизинамид

получали по аналогии с Примером 1, но используя на стадии 3 в качестве партнера связывания (4-гидроксиметил-фенил)-амид (S)-2-[(S)-2-амино-3-(4-фтор-фенил)-пропиониламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты вместо (S)-2-((S)-2-амино-3-(4-нитрофенил)-пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенил-метиламино)гексанамида. Первый получали из (S)-2-(((9Н-флуорен-9-ил)метокси)карбониламино)-3-(4-фторфенил)пропановой кислоты, как описано выше на стадиях а]-в].

МС: ожидаемая масса: 1378,7669, обнаруженная масса: 1378,7609.

Пример 8

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-2-фтор-L-фенилаланил-N~6~-[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-лизинамид

получали по аналогии с Примером 1, но используя на стадии 3 в качестве партнера связывания (4-гидроксиметил-фенил)-амид (S)-2-[(S)-2-амино-3-(2-фтор-фенил)-пропиониламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты вместо (S)-2-((S)-2-амино-3-(4-нитрофенил)-пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенил-метиламино)-гексанамида. Первый получали из (S)-2-(((9Н-флуорен-9-ил)метокси)карбониламино)-3-(2-фторфенил)пропановой кислоты, как описано выше на стадиях а]-в].

МС: ожидаемая масса: 1378,7669, обнаруженная масса: 1378,7689.

Пример 9

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-3-фтор-1--фенилаланил-N~6~-[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-лизинамид

получали по аналогии с Примером 1, но используя на стадии 3 в качестве партнера связывания (4-гидроксиметил-фенил)-амид (S)-2-[(S)-2-амино-3-(3-фтор-фенил)-пропиониламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты вместо (S)-2-((S)-2-амино-3-(4-нитрофенил)-пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенил-метиламино)гексанамида. Первый получали из (S)-2-(((9Н-флуорен-9-ил)метокси)карбониламино)-3-(3-фторфенил)пропановой кислоты, как описано выше на стадиях а]-в].

МС: ожидаемая масса: 1378,7669, обнаруженная масса: 1378,7659.

Пример 10

Стадия 1: N1-(3-((3S,8S,9S,10R,13R,148,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-(4-фторфенил)-4-((S)-1-(4-(гидроксиметил)фениламино)-6-((4-метоксифенил)дифенилметиламино)-1-оксогексан-2-иламино)-4-оксобутан-2-ил)сукцинамид

В 10 мл круглодонной колбе в CH2Cl2 (2 мл) смешивали друг с другом полученную ранее 4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропиламино)-4-оксобутановую кислоту (109 мг, 188 мкмоль, Экв.: 1,00), (4-гидроксиметил-фенил)-амид (S)-2-[(S)-3-амино-4-(4-фтор-фенил)-бутириламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты (132 мг, 188 мкмоль, Экв.: 1,00), HOAt (25,6 мг, 188 мкмоль, Экв.: 1,00) и EDC гидрохлорид (36,1 мг, 188 мкмоль, Экв.: 1,00) с получением желтого раствора. Добавляли основание Хунига (48,7 мг, 64,1 мкл, 377 мкмоль, Экв.: 2,00), и реакционную смесь перемешивали при температуре окружающей среды в течение ночи. ТСХ показала потребление исходного вещества. Все летучие вещества удаляли под вакуумом, и неочищенный продукт очищали флэш-хроматографией SiO2/5% МеОН/0,1% NEt3 в CH2Cl2 с получением 197 мг соединения, указанного в заголовке, в виде беловатого твердого вещества.

МС: ожидаемая масса: 1227,7763, обнаруженная масса: 1227,7714.

Стадия 2: 4-((S)-2-((S)-3-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропиламино)-4-оксобутанамидо)-4-(4-фторфенил)бутанамидо)-6-((4-метоксифенил)дифенилметиламино)гексанамидо)-бензил 4-нитрофенил карбонат

В 10 мл круглодонной колбе полученный ранее N1-(3-((3S,8S,9S, 10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-(4-флорфенил)-4-((3)-1-(4-(гидроксиметил)фениламино)-6-((4-метоксифенил)дифенилметиламино)-1-оксогексан-2-иламино)-4-оксобутан-2-ил)сукцинамид (196 мг, 160 мкмоль, Экв.: 1,00) и основание Хунига (61,9 мг, 81,4 мкл, 479 мкмоль, Экв.: 3,00) объединяли с CH2Cl2 (1,6 мл) и DMF (0,8 мл) с получение желтой суспензии; добавляли бис(4-нитрофенил)карбонат (72,8 мг, 239 мкмоль, Экв.: 1,50), и давали реакции идти при температуре окружающей среды в течение ночи. Смесь выливали на битый лед/NH4Cl (рН~6), экстрагировали 2×AcOEt, промывали H2O и рассолом, сушили над Na2SO4 и упаривали досуха. После растирания с AcOEt/гептаном получали 123 мг соединения, указанного в заголовке, в виде светло-желтого твердого вещества.

МС: ожидаемая масса: 1392,7825, обнаруженная масса: 1392,7819.

Необходимый дипептидный строительный блок для стадии 1 получали следующим образом:

Стадия а: (S)-2-[(S)-3-(9Н-флуорен-9-илметоксикарбониламино)-4-(4-фтор-фенил)-бутириламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановая кислота

В 25 мл круглодонной колбе в CH2Cl2 (12,5 мл) растворяли (S)-2-амино-6-((4-метоксифенил)дифенилметил-амино)гексановую кислоту (Bioconjugate Chem. 2002, 13, 855-869, 1040 мг, 2,48 ммоль, Экв.: 1,00) с получение бледно-желтого раствора. Добавляли основание Хунига (961 мг, 1,27 мл, 7,44 ммоль, Экв.: 3,00) и триметилхлорсилан (566 мг, 621 мкл, 5,21 ммоль, Экв.: 2,10), и реакционную смесь перемешивали при температуре окружающей среды в течение 20 мин.

Во второй 50 мл круглодонной колбе в DMF (12,5 мл) растворяли (S)-3-(((9H-флуорен-9-ил)метокси)карбонил-амино)-4-(4-фторфенил)бутановую кислоту (1040 мг, 2,48 ммоль, Экв.: 1,00) с получением бесцветного раствора. Добавляли основание Хунига (385 мг, 506 мкл, 2,98 ммоль, Экв.: 1,20) и TPTU [125700-71-2] (737 мг, 2,48 ммоль, Экв.: 1,00), и реакционную смесь перемешивали в течение 15 минут. Добавляли раствор из первой колбы, содержащий соответствующий силиловый эфир моносилиламина, и реакционную смесь перемешивали в течение еще 3 часов при температуре окружающей среды. Смесь выливали на битый лед/NH4Cl, экстрагировали 2×AcOEt, промывали H2O и рассолом, сушили над Na2SO4 и упаривали досуха. Флэш-хроматография SiO2/5% МеОН/0,1% NEts в CH2Cl2 давала 2,10 г соединения, указанного в заголовке, в виде желтой пены.

МС (ИСП): (М+Н) 820,6.

Стадия б: сложный 9Н-флуорен-9-илметиловый эфир {(S)-2-(4-фтор-фенил)-1-[((S)-1-(4-гидроксиметил-фенилкарбамоил)-5-{[(4-метокси-фенил)-дифенил-метил]-амино}-пентилкарбамоил)-метил]-этил}-карбаминовой кислоты

В 250 мл грушевидной колбе в CH2Cl2 (12,5 мл) растворяли ранее синтезированный сложный 9Н-флуорен-9-илметиловый эфир {(S)-2-(4-фтор-фенил)-1-[((S)-1-(4-гидроксиметил-фенилкарбамоил)-5-{[(4-метокси-фенил)-дифенил-метил]-амино}-пентилкарбамоил)-метил]-этил}-карбаминовой кислоты (2,10 г, 2,56 ммоль, Экв.: 1,00), (4-аминофенил)метанол (315 мг, 2,55 ммоль, Экв.: 1,00), HOAt (349 мг, 2,56 ммоль, Экв.: 1,00) и EDC гидрохлорид (491 мг, 2,56 ммоль, Экв.: 1,00). Добавляли основание Хунига (662 мг, 871 мкл, 5,21 ммоль, Экв.: 2,00), и давали реакции идти в течение ночи. Смесь выливали на битый лед/NN4Cl (pH ~7), экстрагировали 2×AcOEt, промывали Н20 и рассолом, сушили над Na2S04 и упаривали досуха. Неочищенный продукт растирали с диэтиловым эфиром (1×50 мл); образующееся твердое вещество отфильтровывали и сушили с получением 0,796 г соединения, указанного в заголовке, в виде светло-коричневого твердого вещества.

МС (ИСП): (М+Н) 925,6.

Стадия в: (4-гидроксиметил-фенил)-амид (S)-2-[(S)-3-амино-4-(4-фтор-фенил)-бутириламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты

В 50 мл круглодонной колбе объединяли с THF (12 мл) полученный ранее сложный 9Н-флуорен-9-илметиловый эфир {(S)-2-(4-фтор-фенил)-1-[((S)-1-(4-гидроксиметил-фенилкарбамоил)-5-{[(4-метокси-фенил)-дифенил-метил]-амино}-пентилкарбамоил)-метил]-этил}-карбаминовой кислоты (793 мг, 857 мкмоль, Экв.: 1,001) с получением коричневатого раствора. При 0° добавляли диэтиламин (1,13 г, 1,59 мл, 15,4 ммоль, Экв.: 18). Реакционную смесь перемешивали при температуре окружающей среды в течение ночи. Смесь выливали на битый лед/NH4Cl (pH~7), экстрагировали 2×AcOEt, промывали H2O и рассолом, сушили над Na2S04 и упаривали досуха. Флэш-хроматография SiO2/10% МеОН/0,1% NEt3 в CH2Cl2 давала 500 мг соединения, указанного в заголовке, в виде беловатого твердого вещества.

МС: ожидаемая масса: 702,3581, обнаруженная масса: 702,3578.

Пример 11

4-((S)-2-((S)-3-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропиламино)-4-оксобутанамидо)-4-фенилбутанамидо)-6-((4-метоксифенил)дифенилметиламино)гексанамидо)бензил 4-нитрофенил карбонат

получали по аналогии с Примером 10, но используя на стадии 1 в качестве партнера связывания (S)-2-((S)-3-амино-4-фенилбутанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенил-метиламино)гексанамид вместо (4-гидроксиметил-фенил)-амида (S)-2-[(S)-3-амино-4-(4-фтор-фенил)-бутириламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты. Первый получали из (S)-3-(((9Н-флуорен-9-ил)метокси)карбониламино)-4-фенилбутановой кислоты, как описано выше на стадиях а]-в].

МС: ожидаемая масса: 1374,792, обнаруженная масса: 1374,7877.

Пример 12

4-({N~2~-[(38)-4-(4-хлорфенил)-3-{[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]амино}бутаноил]-N~6~-[(4-метоксифенил)(дифенил)метил]-L-лизил}амино)бензил 4-нитрофенил карбонат

получали по аналогии с примером 10, но используя на стадии 1 в качестве партнера связывания (S)-2-((S)-3-амино-4-(4-хлорфенил)бутанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)-дифенилметиламино)гексанамид вместо (4-гидроксиметил-фенил)-амида (3)-2-[(3)-3-амино-4-(4-фтор-фенил)-бутириламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты. Первый получали из (S)-3-(((9Н-флуорен-9-ил)метокси)карбониламино)-4-(4-хлорфенил)-бутановой кислоты, как описано выше на стадиях а]-в].

МС (ИСП): (М+Н) 1409,9.

Пример 13

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-O-метил-L-тирозил-N~6~-[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-лизинамид

получали по аналогии с Примером 1, но используя на стадии 3 в качестве партнера связывания (S)-2-((S)-2-амино-3-(4-метоксифенил)пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)-дифенилметиламино)гексанамид вместо (S)-2-((S)-2-амино-3-(4-нитрофенил)-пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенил-метиламино)гексанамида. Первый получали из (S)-2-(((9Н-флуорен-9-ил)метокси)карбониламино)-3-(4-метоксифенил)пропановой кислоты, как описано выше на стадиях а]-в] примера 1.

МС (ИСП): (М+Н) 1391,9.

Пример 14

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-O-фенилаланил-N~6~-[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-O-лизинамид

получали по аналогии с примером 1, но используя на стадии 3 в качестве партнера связывания (R)-2-((R)-2-амино-3-фенил-пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенилметиламино)-гексанамид вместо (S)-2-((S)-2-амино-3-(4-нитрофенил)-пропанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенил-метиламино)гексанамида. Этот строительный блок синтезировали из (R)-2-(((9Н-флуорен-9-ил)метокси)карбониламино)-6-аминогексановой кислоты и (R)-2-амино-6-((4-метоксифенил)-дифенилметиламино)гексановой кислоты (см. Bioconjugate Chem. 2002, 13, 885-869), как описано выше на стадиях а]-в].

МС: ожидаемая масса: 1360,7763, обнаруженная масса: 1360,7774.

Пример 15

4-({N~2~-[(38)-3-{[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]амино}-4-(4-цианофенил)бутаноил]-N~6~-[(4-метоксифенил)(дифенил)метил]-1--лизил}амино)бензил 4-нитрофенил карбонат

получали по аналогии с примером 10, но используя на стадии 1 в качестве партнера связывания (S)-2-((S)-3-амино-4-(4-цианофенил)бутанамидо)-N-(4-(гидроксиметил)фенил)-6-((4-метоксифенил)дифенил-метиламино)гексанамид вместо (4-гидроксиметил-фенил)-амида (S)-2-[(S)-3-амино-4-(4-фтор-фенил)-бутириламино]-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты. Первый получали из (3)-3-(((9Н-флуорен-9-ил)метокси)карбониламино)-4-(4-цианофенил)бутановой кислоты, как описано выше на стадиях а]-в].

МС: ожидаемая масса: 1399,7872, обнаруженная масса: 1399,7857.

Пример 16

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-фенилаланил-N~6~-[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-лизинамид

Стадия 1:

(4-Гидроксиметил-фенил)-амид (S)-2-((S)-2-амино-3-фенил-пропиониламино)-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты

Строительный блок (4-гидроксиметил-фенил)-амид (S)-2-((S)-2-амино-3-фенил-пропиониламино)-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты был получен по аналогии с методикой, описанной в Bioconjugate Chem., Vol.13, No.4, 2002, 855-869.

МС (ИСП): (М+Н) 671,5

Стадия 2:

N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгетан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-((S)-1-(4-(гидроксиметил)фениламино)-6-((4-метоксифенил)дифенилметиламино)-1-оксогексан-2-иламино)-1-оксо-3-фенилпропан-2-ил)сукцинамид

TPTU [125700-71-2](233 мг, 784 мкмоль, Экв.: 1,00) добавляли к раствору N-{3-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-диметил-гексил)-10,13-диметил-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси]-пропил}-сукцинамовой кислоты (смотрите пример 1, стадия 2) (426 мг, 0,784 ммоль, Экв.: 1,00) и основания Хунига (304 мг, 411 мкл, 2,35 ммоль, Экв.: 3) в DMF (10 мл). Через 3 минуты добавляли (4-гидроксиметил-фенил)-амид (S)-2-((S)-2-амино-3-фенил-пропиониламино)-6-{[(4-метокси-фенил)-дифенил-метил]-амино}-гексановой кислоты (стадия 1). TLC (тонкослойная хроматография) в t=1 ч показала то, что реакция была завершена. Растворитель удаляли при пониженном давлении. Остающийся остаток переносили в этилацетат и экстрагировали наполовину насыщенным раствором NaHCO3 (1X), 0,05 М раствором гидрофталата калия (2X), водой (1X) и рассолом (1X). Органический экстракт сушили над MgS04 и концентрировали при пониженном давлении. Неочищенное вещество очищали флэш-хроматографией с получением продукта, указанного в заголовке (682 мг, 513 мкмоль), в виде светло-коричневого твердого вещества.

МС (ИСП): (М+Н) 1196,8

Стадия 3:

Основание Хунига (465 мг, 629 мкл, 3,6 ммоль, Экв.: 6) добавляли в раствор полученного ранее спирта (718 мг, 600 мкмоль, Экв.: 1,00) и бис(4-нитрофенил)карбоната (548 мг, 1,8 ммоль, Экв.: 3) в THF (20 мл). Желтый раствор перемешивали в течение ночи при комнатной температуре. Растворитель удаляли при пониженном давлении. Остающийся остаток растирали с диэтиловым эфиром. Твердое вещество собирали фильтрованием, промывали эфиром и сушили при пониженном давлении с получением соединения, указанного в заголовке (800 мг, 529 мкмоль) в виде светло-коричневого твердого вещества. МС(ИСП): (М+Н) 1361,9

Пример17

Стадия 1: (S)-2-[(S)-2-(9Н-флуорен-9-илметоксикарбониламино)-3-фенил-пропиониламино]-гексановая кислота

Имеющийся в продаже L-Fmoc-Phe-OSu (0,969 г, 2,00 ммоль, Экв.: 1,00) суспендировали в смеси 1,2-диметоксиэтана и воды 1:1 (об./об.) (17 мл) и обрабатывали L-норлейцином (0,275 г, 2,10 ммоль, Экв.: 1,05) и NaHCO3 (0,185 г, 2,20 ммоль, Экв.: 1,10) при 0°С.Удаляли охлаждающую баню, и давали реакции идти при температуре окружающей среды в течение 14 ч. Смесь выливали на битый лед / лимонную кислоту (рН ~3), экстрагировали 2х этилацетатом, промывали H2O и рассолом, сушили над Na2SO4 и упаривали досуха. Флэш-хроматография SiO2/AcOEt давала 0,870 мг соединения, указанного в заголовке, в виде белого твердого вещества.

МС (ИСП): (М+Н) 501,2.

Стадия 2: сложный 9H-флуорен-9-илметиловый эфир {(S)-1-[(S)-1-(4-гидроксиметил-фенилкарбамоил)-пентилкарбамоил]-2-фенил-этил}-карбаминовой кислоты

В грушевидной колбе в CHzCl2 (320 мл) растворяли ранее синтезированную (S)-2-[(S)-2-(9Н-флуорен-9-илметокси-карбониламино)-3-фенил-пропиониламино]-гексановую кислоту (10,72 г, 21 ммоль, Экв.: 1,00), (4-аминофенил)метанол (2,717 г, 22 ммоль, Экв.: 1,03) и 2-этокси-1-этоксикарбонил-1,2-дигидрохинолин (EEDQ) (7,994 г, 32 ммоль, Экв.: 1,50) и перемешивали в течение ночи под баллоном с Ar. Смесь выливали на битый лед/NH4Cl, экстрагировали 2×AcOEt, промывали N2O, сушили над Na2SO4, и объем уменьшали до ~300 мл. Осадок отфильтровывали и сушили с получением 5,25 г соединения, указанного в заголовке, в виде светло-коричневого твердого вещества.

МС (ИСП): (М+Н) 606,3.

Стадия 3: (4-гидроксиметил-фенил)-амид (S)-2-((3)-2-амино-3-фенил-пропиониламино)-гексановой кислоты

В круглодонной колбе в CH2Cl2 (28 мл) растворяли полученный ранее сложный 9H-флуорен-9-илметиловый эфир {(S)-1-[(S)-1-(4-гидроксиметил-фенилкарбамоил)-пентилкарбамоил]-2-фенил-этил}-карбаминовой кислоты (4,738 г, 7,822 ммоль, Экв.: 1,0). При 0°С добавляли диэтиламин (28 мл, 19,80 г, 271 ммоль, Экв.: 35), и реакционную смесь перемешивали при температуре окружающей среды в течение ночи. Все летучие соединения выпаривали под вакуумом; следующая далее флэш-хроматография SiO2/CH2Cl2/10% МеОН, с последующей кристаллизацией из AcOEt давала 2,116 г соединения, указанного в заголовке, в виде светло-коричневых кристаллов. МС (ИСП): (М+Н) 384,2.

Стадия 4

N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-((S)-1-(4-(гидроксиметил)фениламино)-1-оксогексан-2-иламино)-1-оксо-3-фенилпропан-2-ил)сукцинамид

получали вместе с этим по аналогии с примером 16, стадия 2

МС (ИСП): (М+Н) 909,7; (M+Na) 931,8.

Стадия 5

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-фенилаланил-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-норлейцинамид

получали вместе с этим по аналогии с примером 16, стадия 3

МС ожидаемая масса: 1073,6453, обнаруженная масса: 1073,642.

Пример 18

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-аланил-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]глицинамид

Стадия 1

Присоединение FMOC-4-аминобензилового спирта к 2-хлортритильной смоле

2-Хпортритилхлоридная смола (Novabiochem 01-64-0114, 100-200 меш), 1% DVB (18 г, 21,6 ммоль, Экв.: 1,00) набухала в DCM/DMF=1/1 (300 мл) в течение десяти минут. Смолу сушили и добавляли раствор FMOC-4-аминобензилового спирта (14,9 г, 43,2 ммоль, Экв.: 2) и пиридина (6,83 г, 6,99 мл, 86,4 ммоль, Экв.: 4) в DCM/DMF=1/1 (300 мл). Смесь встряхивали в течение ночи. Смолу сушили и покрывали раствором 10% основания Хунига в метаноле (300 мл). Смолу промывали DMF и DCM и сушили в течение ночи под HV (сильный вакуум) с получением 21,7 г смолы. Определение загрузки давало 0,41 ммоль/г.

Стадия 2:

N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1 Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-(2-(4-(гидроксиметил)фениламино)-2-оксоэтиламино)-1-оксопропан-2-ил)сукцинамид

Смолу со стадии 1 (1 г, 410 мкмоль, Экв.: 1,00) предварительно промывали DMF (2 X) и обрабатывали пиперидином/DMF=1/4 (10 мл) в течение 5 и 10 минут. Смолу поочередно промывали DMF и IPA (3×10 мл). Раствор Fmoc-Gly-OH (488 мг, 1,64 ммоль, Экв.: 4), TPTU (487 мг, 1,64 ммоль, Экв.: 4) и основания Хунига (636 мг, 859 мкл, 4,92 ммоль, Экв.: 12) в DMF (10 мл) перемешивали в течение 5 минут и затем встряхивали со смолой в течение одного часа. Смолу поочередно промывали DMF и изопропиловым спиртом (3Х).

Соответственно, проводили последующие отщепления Fmoc и последующие связывания с Fmoc-Ala-OH (511 мг, 1,64 ммоль, Экв.: 4) и N-{3-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-диметил-гексил)-10,13-диметил-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси]-пропил}-сукцинамовой кислотой (пример 1, стадия 2) (892 мг, 1,64 ммоль, Экв.: 4). Высушенную пептидную смолу перемешивали в течение примерно 2×30 мин в TFA 1%/DCM (2×20 мл). Реакционную смесь фильтровали, и смолу промывали DCM. Фильтраты объединяли, и растворители выпаривали под вакуумом. Неочищенное вещество растирали с диэтиловым эфиром (2х). После очистки флэш-хроматографией получали продукт (84 мг, 97,3 мкмоль) в виде белого твердого вещества.

МС ожидаемая масса: 776,5452, обнаруженная масса: 776,5455.

Стадия 3:

Полученный ранее спирт N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-(2-(4-(гидроксиметил)фениламино)-2-оксоэтиламино)-1-оксопропан-2-ил)сукцинамид [RO5545270] (70 мг, 90,1 мкмоль, Экв.: 1,00) и бис(4-нитрофенил)карбонат (137 мг, 450 мкмоль, Экв.: 5) растворяли в DMF (4 мл) под аргоном при комнатной температуре, обрабатывали основанием Хунига (34,9 мг, 47,2 мкл, 270 мкмоль, Экв.: 3), и давали смеси реагировать в течение ночи. Растворитель удаляли под вакуумом. Образующееся твердое вещество растирали с диэтиловым эфиром. Твердое вещество собирали фильтрованием и промывали диэтиловым эфиром. Продукт сушили под вакуумом с получением соединения, указанного в заголовке (84 мг, 80,2 мкмоль), в виде светло-коричневого твердого вещества.

МС ожидаемая масса: 941,5514, обнаруженная масса 941,5518.

Пример 19

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-лейцил-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-метионинамид

Стадия 1:

Присоединение FMOC-4-аминобензилового спирта к 2-хлортритиловой смоле

проводили по аналогии с примером 18, стадия 1

Стадия 2

N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-((S)-1-(4-(гидроксиметил)фениламино)-4-(метилтио)-1-оксобутан-2-иламино)-4-метил-1-оксопентан-2-ил)сукцинамид

получали по аналогии с примером 18, стадия 2, с использованием Fmoc-Met-OH (609 мг, 1,64 ммоль, Экв.: 4) и Fmoc-Leu-OH (580 мг, 1,64 ммоль, Экв.: 4) в качестве аминокислот.

Продукт (208 мг, 210 мкмоль) получали в виде светло-желтого твердого вещества.

МС (ИСП): (М+Н) 893,6183.

Стадию 3 проводили по аналогии с примером 18, стадия 3. После очистки на силикагеле получали соединение, указанное в заголовке (161 мг, 137 мкмоль) в виде светло-коричневого твердого вещества.

МС ожидаемая масса: 1057,6174, обнаруженная масса 1057,6184.

Пример 20

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-лейцил-N~1~-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-аспартамид

Стадия 1:

Присоединение FMOC-4-аминобензилового спирта к 2-хлортритильной смоле

проводили по аналогии с примером 18, стадия 1

Стадия 2

(S)-2-((S)-2-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1 Н-циклопента[а]фенантрен-3-илокси)пропиламино)-4-оксобутанамидо)-4-метилпентанамидо)-N1-(4-(гидроксиметил)фенил)сукцинамид

получали по аналогии с примером 18, стадия 2, с использованием Fmoc-Asn-OH (581 мг, 1,64 ммоль, Экв.: 4) и Fmoc-Leu-OH (580 мг, 1,64 ммоль, Экв.: 4) в качестве аминокислот.

Продукт (87 мг, 89,4 мкмоль) получали в виде светло-желтого твердого вещества.

МС ожидаемая масса: 875,6136, обнаруженная масса 875,6133.

Стадия 3

Соединение, указанное в заголовке, получали по аналогии с примером 18, стадия 3. После очистки на силикагеле (87 мг, 89,4 мкмоль) получали соединение, указанное в заголовке, в виде светло-коричневого твердого вещества.

МС ожидаемая масса: 1040,6198, обнаруженная масса 1040,6188.

Пример 21

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-аланил-N~1~-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-аспартамид

Стадия 1:

Присоединение FMOC-4-аминобензилового спирта к 2-хлортритильной смоле

проводили по аналогии с примером 18, стадия 1

Стадия 2

(S)-2-((S)-2-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропиламино)-4-оксобутанамидо)пропанамидо)-N1-(4-(гидроксиметил)фенил)сукцинамид

получали по аналогии с примером 18, стадия 2, с использованием Fmoc-Asn-OH (581 мг, 1,64 ммоль, Экв.: 4) и Fmoc-Ala-OH (511 мг, 1,64 ммоль, Экв.: 4) в качестве аминокислот.

Продукт (140 мг, 159 мкмоль) получали в виде светло-желтого твердого вещества.

МС (ИСП): (М+Н) 834,8; (M+Na) 856,7.

Стадия 3

Соединение, указанное в заголовке, получали по аналогии с примером 18, стадия 3. После очистки на силикагеле (169 мг, 152 мкмоль) его получали в виде светло-коричневого твердого вещества.

МС ожидаемая масса: 998,5729, обнаруженная масса 998,5739.

Пример 22

N~2~-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-аспарагинил-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]глицинамид

Стадия 1:

Присоединение FMOC-4-аминобензилового спирта к 2-хлортритильной смоле

проводили по аналогии с примером 18, стадия 1

Стадия 2

(S)-2-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропиламино)-4-оксобутанамидо)-N1-(2-(4-(гидроксиметил)фениламино)-2-оксоэтил)сукцинамид

получали по аналогии с примером 18, стадия 2, с использованием Fmoc-Gly-OH (488 мг, 1,64 ммоль, Экв.: 4) и Fmoc-Asn-OH (581 мг, 1,64 ммоль, Экв.: 4) в качестве аминокислот.

Продукт (140 мг, 162 мкмоль) получали в виде белого твердого вещества. МС ожидаемая масса: 819,551, обнаруженная масса: 819,5503.

Стадия 3: Соединение, указанное в заголовке, получали по аналогии с примером 18, стадия 3 (176 мг, 161 мкмоль) в виде светло-коричневого твердого вещества.

МС ожидаемая масса: 984,5572, обнаруженная масса: 984,5489.

Пример 23

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-фенилаланил-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]глицинамид

Стадия 1:

Присоединение FMOC-4-аминобензилового спирта к 2-хлортритильной смоле

проводили по аналогии с примером 18, стадия 1

Стадия 2:

N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-(2-(4-(гидроксиметил)фениламино)-2-оксоэтиламино)-1-оксо-3-фенилпропан-2-ил)сукцинамид

получали по аналогии с примером 18, стадия 2, с использованием Fmoc-Gly-OH (488 мг, 1,64 ммоль, Экв.: 4) и Fmoc-Phe-OH (635 мг, 1,64 ммоль, Экв.: 4) в качестве аминокислот.

Получали продукт (259 мг, 288 мкмоль) в виде белого твердого вещества. МС ожидаемая масса: 852,5765, обнаруженная масса: 852,5754.

Стадия 3

Соединение, указанное в заголовке (280 мг, 247 мкмоль), получали по аналогии с примером 18, стадия 3, в виде светло-коричневого твердого вещества. МС ожидаемая масса: 1017,5827, обнаруженная масса: 1017,5775.

Пример 24

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-лейцил-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]глицинамид

Стадия 1:

Присоединение FMOC-4-аминобензилового спирта к 2-хлортритильной смоле

проводили по аналогии с примером 18, стадия 1.

Стадия 2

N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-(2-(4-(гидроксиметил)фениламино)-2-оксоэтиламино)-4-метил-1-оксопентан-2-ил)сукцинамид

получали по аналогии с примером 18, стадия 2, с использованием Fmoc-Gly-OH (488 мг, 1,64 ммоль, Экв.: 4) и Fmoc-Leu-OH (580 мг, 1,64 ммоль, Экв.: 4) в качестве аминокислот.

Продукт (240 мг, 278 мкмоль) получали в виде светло-желтого твердого вещества.

МС ожидаемая масса: 818,5921, обнаруженная масса: 818,5921.

Стадия 3

Соединение, указанное в заголовке, получали по аналогии с примером 18, стадия 3. После очистки на силикагеле, его (194 мг, 177 мкмоль) получали в виде светло-желтого твердого вещества.

МС ожидаемая масса: 983,5983, обнаруженная масса: 983,6004.

Пример 25

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-лейцил-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-фенилаланинамид

Стадия 1:

Присоединение FMOC-4-аминобензилового спирта к 2-хлортритильной смоле

проводили по аналогии с примером 18, стадия 1

Стадия 2

N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-((S)-1-(4-(гидроксиметил)фениламино)-1-оксо-3-фенилпропан-2-иламино)-4-метил-1-оксопентан-2-ил)сукцинамид

получали по аналогии с примером 18, стадия 2, с использованием Fmoc-Phe-OH (635 мг, 1,64 ммоль, Экв.: 4) и Fmoc-Leu-OH (580 мг, 1,64 ммоль, Экв.: 4) в качестве аминокислот.

Продукт (153 мг, 151 мкмоль) получали в виде светло-желтого твердого вещества.

МС ожидаемая масса: 908,6391, обнаруженная масса: 908,637.

Стадия 3:

Соединение, указанное в заголовке, получали по аналогии с примером 18, стадия 3. После очистки на силикагеле его (117 мг, 98 мкмоль) получали в виде белого твердого вещества.

МС ожидаемая масса: 1073,6453, обнаруженная масса: 1073,646.

Пример 26

14-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-фенилаланил-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-фенилаланинамид

Стадия 1:

Присоединение FMOC-4-аминобензилового спирта к 2-хлортритильной смоле

проводили по аналогии с примером 18, стадия 1

Стадия 2

N1-(3-((3S,8S,9S,10R,13R,148,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1 Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-((S)-1-(4-(гидроксиметил)фениламино)-1-оксо-3-фенилпропан-2-иламино)-1-оксо-3-фенилпропан-2-ил)сукцинамид

получали по аналогии с примером 18, стадия 2, с Fmoc-Phe-OH (635 мг, 1,64 ммоль, Экв.: 4) в качестве аминокислоты.

Продукт (240 мг, 204 мкмоль) получали в виде светло-желтого твердого вещества.

МС ожидаемая масса: 942,6234, обнаруженная масса: 942,6218.

Стадия 3:

Соединение, указанное в заголовке, получали по аналогии с примером 18, стадия 3. После очистки на силикагеле его (190 мг, 154 мкмоль) получали в виде белого твердого вещества.

МС ожидаемая масса: 1107,6296, обнаруженная масса: 1107,6287.

Пример 27

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-лейцил-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-лейцинамид

Стадия 1:

Присоединение FMOC-4-аминобензилового спирта к 2-хлортритильной смоле

проводили аналогично примеру 18, стадия 1

Стадия 2

N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-((S)-1-(4-(гидроксиметил)фениламино)-4-метил-1-оксопентан-2-иламино)-4-метил-1-оксопентан-2-ил)сукцинамид

получали по аналогии с примером 18, стадия 2, с Fmoc-Leu-OH (1,59 г, 4,5 ммоль, Экв.: 3) в качестве аминокислоты.

Продукт (254 мг, 284 мкмоль) получали в виде белого твердого вещества. МС ожидаемая масса: 874,6547, обнаруженная масса: 874,6527.

Стадия 3

Соединение, указанное в заголовке, получали по аналогии с примером 18, стадия 3. После очистки на силикагеле его получали в виде белого твердого вещества (178 мг, 168 мкмоль).

МС ожидаемая масса: 1039,6609, обнаруженная масса: 1039,6588.

Пример 28

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-аланил-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-аланинамид

Стадия 1

Сложный 9Н-флуорен-9-илметиловый эфир {(S)-1-[(S)-1-(4-гидроксиметил-фенилкарбамоил)-этилкарбамоил]-этил}-карбаминовой кислоты

Раствор Fmoc-Ala-Ala-OH (1 г, 2,61 ммоль, Экв.: 1,00) и (4-аминофенил)метанола (483 мг, 3,92 ммоль, Экв.: 1,5) в THF (20 мл) обрабатывали EEDQ (2-этокси-1-этоксикарбонил-1,2-дигидрохинолин) (970 мг, 3,92 ммоль, Экв.: 1,5). Раствор перемешивали в течение ночи при комнатной температуре. Смесь разбавляли 10% 2-пропанола/этилацетата (100 мл), и раствор промывали KHSO4 5%/K2SO4 10% (2X), водой (1Х) и рассолом (1Х), сушили над MgSO4 и упаривали в вакууме. Остаток обрабатывали ультразвуком в диэтиловом эфире в течение нескольких минут, и твердое вещество собирали фильтрованием с получением продукта (1,27 г, 1,2 ммоль) в виде светло-коричневого твердого вещества.

МС (ИСП): (М+Н) 488,3

Стадия 2:

(S)-2-Амино-N-[(3)-1-(4-гидроксиметил-фенилкарбамоил)-этил]-пропионамид

Соединение получали по аналогии с примером 1, стадия в, с получением продукта (245 мг, 877 мкмоль) в виде светло-желтого твердого вещества. МС (ИСП): (М+Н) 266,3, (M+Na) 288,2 (2М+Н) 531,3.

Стадия 3:

N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1 Н-циклопента[а]фенантрен-3-илокси)пропил)-N4-((S)-1-((S)-1-(4-(гидроксиметил)фениламино)-1-оксопропан-2-иламино)-1-оксопропан-2-ил)сукцинамид

Соединение получали по аналогии с примером 16, стадия 2 (165 мг, 198 мкмоль), в виде светло-коричневого твердого вещества.

МС ожидаемая масса: 790,5608, обнаруженная масса: 790,5587.

Стадия 4

Соединение, указанное в заголовке, получали по аналогии с примером 18, стадия 3. После очистки на силикагеле его получали в виде белого твердого вещества (99 мг, 98,4 мкмоль).

МС ожидаемая масса: 955,567, обнаруженная масса: 955,5651.

Пример 29

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-L-изолейцил-N~1~-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-аспартамид

Стадия 1

(S)-2-[(2S,3S)-2-(9Н-Флуорен-9-илметоксикарбониламино)-3-метил-пентаноиламино]-сукцинамовая кислота

2-Хлортритилхлоридная смола (5 г, 7,5 ммоль, Экв.: 1,00) набухала в DCM, и затем ее обрабатывали раствором Fmoc-Asn(Trt)-OH (8,95 г, 15,0 ммоль, Экв.: 2) и основания Хунига (3,88 г, 5,1 мл, 30,0 ммоль, Экв.: 4) в DCM в течение ночи. Смолу промывали DCM и покрывали раствором 10% основания Хунига в метаноле. Проводили связывание Fmoc-Ile-OH (5,3 г, 15,0 ммоль, Экв.: 2) с TPTU (4,46 г, 15,0 ммоль, Экв.: 2) и основанием Хунига (3,88 г, 5,1 мл, 30,0 ммоль, Экв.: 4) согласно стандартному твердофазному пептидному синтезу. Продукт отщепляли от смолы смесью TFA/вода/триизопропилсилан (95/2,5/2,5 об./об./об.) в течение двух часов при комнатной температуре. Смолу фильтровали, и фильтрат концентрировали при пониженном давлении до малого объема. После растирания с диэтиловым эфиром продукт фильтровали и сушили в вакууме с получением продукта (2,85 г, 5,79 ммоль) в виде белого твердого вещества.

МС ожидаемая масса: 467,2056, обнаруженная масса: 467,2056.

Стадия 2

Сложный 9Н-флуорен-9-илметиловый эфир {(1S,2S)-1-[2-карбамоил-1-((S)-4-гидроксиметил-фенилкарбамоил)-этилкарбамоил]-2-метил-бутил}-карбаминовой кислоты

Соединение получали по аналогии с примером 28, стадия 1 (620 мг, 336 мкмоль), в виде светло-желтого твердого вещества.

Стадия 3

(S)-2-((28,38)-2-Амино-3-метил-пентаноиламино)-N*1*-(4-гидроксиметил-фенил)-сукцинамид

Соединение получали по аналогии с примером 1, стадия в (100 мг, 228 мкмоль), в виде светло-желтого твердого вещества.

Стадия 4

(S)-2-((2S,3S)-2-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-((R)-6-метилгептан-2-ил)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илокси)пропиламино)-4-оксобутанамидо)-3-метилпентанамидо)-N1-(4-(гидроксиметил)фенил)сукцинамид

Соединение получали по аналогии с примером 16, стадия 2 (89 мг, 91,4 мкмоль), в виде светло-желтого твердого вещества.

Стадия 5

Соединение с предыдущей стадии подвергали взаимодействию с соединением, указанным в заголовке, аналогично примеру 18, стадия 3. После очистки на силикагеле его (42 мг, 36,3 мкмоль) получали в виде светло-коричневого твердого вещества.

МС ожидаемая масса: 1040,6198, обнаруженная масса: 1040,6177.

Пример 30

N-[4-({3-[(3бета)-холест-5-ен-3-илокси]пропил}амино)-4-оксобутаноил]-1_-фенилаланил-N~6~-[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-D-лизинамид

Соединение получали по аналогии с примером 16, стадия 1, начиная с Fmoc-D-Lys(Boc)-OH, (158 мг, 116 мкмоль), в виде светло-коричневого твердого вещества.

МС (ИСП): (М+Н) 1362,8 (M+Na) 1383,8.

Пример 31

N-{15-[(3бета)-холест-5-ен-3-илокси]-4,15-диоксо-8,11-диокса-5,14-диазапентадекан-1-оил}-L-фенилаланил-N~6~-[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-лизинамид

Соединение, указанное в заголовке, получали на стадии 2 синтеза аналогично примеру 16 с использованием холестерин-олиго-PEG (полиэтиленгликоль) производного.

МС (ИСП): (М+Н) 1479,8.

Необходимое холестерин-PEG промежуточное соединение - N-[2-(2-{2-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-диметил-гексил)-10,13-диметил-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1 Н-циклопента[а]фенантрен-3-илоксикарбониламино]-этокси}-этокси)-этил]-сукцинамовую кислоту для стадии 2 получали следующим образом:

Стадия а: Сложный (3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-диметил-гексил)-10,13-диметил-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-иловый эфир {2-[2-(2-амино-этокси)-этокси]-этил}-карбаминовой кислоты

В раствор 2,2'-(этилендиокси)бис-(этиламина) (495 мг, 3,34 ммоль) в 75 мл дихлорметане добавляли по каплям при перемешивании раствор холестерилхлорформиата (1 г, 2,23 ммоль) в 25 мл дихлорметана. Реакционную смесь перемешивали в течение ночи при комнатной температуре. Реакционную смесь разбавляли дихлорметаном и экстрагировали водой. Органический экстракт сушили над безводным MgSO4 дигидратом, фильтровали и упаривали. После очистки на амино-модифицированном силикагеле (элюент: MeCl2→MeCl2/MeOH=975:25 об./об.) получали продукт (615 мг) в виде белого воскообразного твердого вещества.

МС(ИСП): (М+Н)561,5.

Стадия б: N-[2-(2-{2-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-диметил-гексил)-10,13-диметил-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-илоксикарбониламино]-этокси}-этокси)-этил]-сукцинамовая кислота

Амин со стадии а (480 мг, 0,856 ммоль) и триэтиламин (0,13 мл, 0,94 ммоль) растворяли в 5 мл дихлорметана. После добавления янтарного ангидрида (90 мг, 0,9 ммоль) раствор перемешивали в течение ночи при комнатной температуре. Проверка ТСХ показала, что все еще оставалось некоторое количество исходного вещества. Добавляли дополнительное количество янтарного ангидрида (20 мг, 0,2 ммоль). После перемешивания реакционной смеси в течение еще 3 часов при комнатной температуре ее разбавляли дихлорметаном и промывали смесью 5% KHSO4/10% K2HSO4. Органический экстракт сушили над безводным MgSO4 дигидратом, фильтровали и упаривали в вакууме с получением желательной кислоты (490 мг, 0,667 ммоль).

МС (ИСП): (М+Н) 661,5.

Пример 32

N-{30-[(3бета)-холест-5-ен-3-илокси]-4,30-диоксо-8,11,14,17,20,23,26-гептаокса-5,29-диазатриаконтан-1-оил}-L-фенилаланил-М~6~-[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-лизинамид

Соединение, указанное в заголовке, получали аналогично примеру 16 с использованием холестерин-PEG производного на стадии 2 синтеза.

МС (ИСП): (М+Н) 1699,9.

Необходимое холестерин-PEG промежуточное соединение 1-[(3бета)-холест-5-ен-3-илокси]-1,27-диоксо-5,8,11,14,17,20,23-гептаокса-2,26-диазатриаконтан-30-оевую кислоту для стадии 2 получали следующим образом:

Стадия а: трет-бутил [25-({(3S,8S,9S,10R,13R,14S,17R)-10,13-диметил-17-[(2R)-6-метилгептан-2-ил]-2,3,4,7,8,9,10,11,12,13,14,15,16,17-тетрадекагидро-1Н-циклопента[а]фенантрен-3-ил}окси-25-оксо-3,6,9,12,15,18,21-гептаокса-24-азапентакоз-1-ил]карбамат

Холестерилхлорформиат (476 мг, 1,06 ммоль) и триэтиламин (155 мкп, 1,113 ммоль) растворяли в 5 мл дихлорметана. Затем добавляли раствор альфа-амино-омега-boc-амино-окта(этиленгликоля) (497 мг, 1,06 ммоль), растворенного в 1 мл дихлорметана. Раствор перемешивали в течение ночи при комнатной температуре, разбавляли дихлорметаном и экстрагировали смесью водных KHSO4 5%/K2SO4 10%. Органический экстракт сушили над безводным MgSO4, фильтровали и упаривали в вакууме. После очистки на силикагеле (элюент: MeCl2/MeOH=975:25→95:5 об./об.) получали продукт (530 мг, 0,571 ммоль) в виде бесцветного масла.

МС (ИСП): (M+NH4) 898,7.

Стадия б: 1-[(3бета)-холест-5-ен-3-илокси]-1,27-диоксо-5,8,11,14,17,20,23-гептаокса-2,26-диазатриаконтан-30-оевая кислота

Предыдущее Вос производное (450 мг, 0,511 ммоль) растворяли в 4 М HCl в диоксане (10,2 мл, 40,9 ммоль). Раствор перемешивали при комнатной температуре в течение 40 мин. Растворитель удаляли под вакуумом, и остающееся белое твердое вещество растворяли в 5 мл дихлорметана и обрабатывали триэтиламином (32 мкл, 0,229 ммоль) и янтарным ангидридом (11,5 мг, 0,114 ммоль) в течение ночи. Добавляли дополнительное количество янтарного ангидрида (11 мг, 0,11 ммоль, 0,2 эквив.), и через 60 мин реакционную смесь разбавляли дихлорметаном и промывали буфером KHSO4 5%/K2SO4 10%. Органический экстракт сушили над безводным MgSO4, фильтровали и упаривали с получением 390 мг желательного продукта. МС (ИСП):(М+Н) 881,7.

Пример 33

N-{66-[(3бета)-холест-5-ен-3-илокси]-4,66-диоксо-8,11,14,17,20,23,26,29,32,35,38,41,44,47,50,53,56,59,62-нонадекаокса-5,65-диазагексагексаконтан-1-оил}-L-фенилаланил-N~6~-[(4-метоксифенил)(дифенил)метил]-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-лизинамид

Соединение, указанное в заголовке, получали аналогично примеру 16 с использованием на стадии 2 синтеза холестерин-PEG производного.

МС (ИСП): (М+Н) 2228,1.

Необходимое для стадии 2 холестерин-PEG промежуточное соединение 1-[(3бета)-холест-5-ен-3-илокси]-1,63-диоксо-5,8,11,14,17,20,23,26,29,32,35,38,41,44,47,50,53,56,59-нонадекаокса-2,62-диазагексагексаконтан-66-оевую кислоту получали следующим образом:

Стадия а; (3бета)-холест-5-ен-3-ил (59-амино-3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57 нонадекаоксанонапентаконт-1-ил)карбамат

Альфа, омега-бис-амино 20(этиленгликоль) (538 мг, 0,6 ммоль) и триэтиламин (92 мкл, 0,66 ммоль) растворяли в 15 мл сухого дихлорметана. Добавляли по каплям при комнатной температуре раствор холестерилхлорформиата (270 мг, 0,6 ммоль) в 2 мл сухого дихлорметана. Раствор перемешивали в течение ночи, затем концентрировали в вакууме до небольшого объема и очищали непосредственно на силикагеле (элюент: MeCl2/MeOH=95:5→9:4→4:1 об./об.) с получением продукта (350 мг, 0,254 ммоль) в виде воскообразного твердого вещества.

МС (ИСП): (М+Н) 1309,9.

Стадия б, 1-[(3бета)-холест-5-ен-3-илокси]-1,63-диоксо-5,8,11,14,17,20,23,26,29,32,35,38,41,44,47,50,53,5б,59-нонадекаокса-2,62-диазагексагексаконтан-66-оевая кислота

Амин со стадии а (329 мг, 0,251 ммоль), янтарный ангидрид (26,4 мг, 0,264 ммоль) и триэтиламин (40 мкл, 0,286 ммоль) растворяли в 5 мл сухого дихлорметана. После добавления дополнительного количества триэтиламина (40 мкл, 0,286 ммоль), раствор (рН>8) перемешивали в течение ночи при комнатной температуре. Реакционную смесь разбавляли дихлорметаном и дважды промывали водной смесью KHSO4 5%/K2SO4 10%. Органический экстракт сушили над безводным MgSO4, фильтровали и упаривали с получением продукта (260 мг, 0,175 ммоль) в виде бесцветного, воскообразного твердого вещества.

МС (ИСП): (M+NH4) 1408,9.

Следующие рабочие примеры иллюстрируют изобретение:

Пример 34: общая методика для получения конъюгатов РНК Материалы

Диметилсульфоксид (DMSO), N,N-диизопропилэтиламин (DIPEA) и раствор ацетата натрия (3 М, рН 5,2) приобретали у Sigma Aldrich Chemie GmbH (Traufkirchen, Германия).

Ацетат триэтиламмония (ТЕАА) (2,0 М, рН 7,0) и ацетонитрил (ACN, класс качества для ВЭЖХ) для ВЭЖХ-ОФ (высокоэффективная жидкостная хроматография с обращенной фазой) приобретали у Biosolve (Valkenswaard, Нидерланды).

Этанол (EtOH, ч.д.а.) приобретали у Merck (Darmstadt, Германия). Использовали очищенную воду из системы Optilab HF (Membra Pure, Германия).

3 мл колонку Resource RPC (10×0,64 см; размер частиц 15 мкм) приобретали у GE Healthcare (Freiburg, Германия).

Очистку ВЭЖХ проводили с использованием системы АКТА Explorer 100 (GE Healthcare).

Синтез аминомодифицированной РНК

РНК, имеющую гексиламинолинкер на 5'-конце смысловой нити, получали посредством стандартной фосфорамидитной химии на твердой фазе в масштабе 1215 мкмоль с использованием АКТА Oligopilot 100 (GE Healthcare, Freiburg, Германия) и стекла с контролируемым размером пор в качестве твердой подложки (Prime Synthesis, Aston, PA, США). РНК, содержащую 2'-O-метилнуклеотиды, получали с использованием соответствующих фосфорамидитов, 2'-O-метилфосфорамидитов и амидита TFA-гексиламинолинкера (Sigma-Aldrich, SAFC, Hamburg, Германия). Расщепление и снятие защиты, а также очистка достигались способами, известными в данной области (Wincott F., et al, NAR 1995, 23,14, 2677-84).

Аминомодифицированную РНК характеризовали анионообменной ВЭЖХ (чистота: 96,1%), и идентичность подтверждали МС-ЭРИ (масс-спектрометрия с электрораспылительной ионизацией) ([М+Н]1+расчетное: 6937,4; [М+Н]1+ измеренное:6939,0.

Последовательность: 5'-(NH2C6)GGAAUCuuAuAuuuGAUCcAsA-3'; u, с: 2'-O-метилнуклеотиды соответствующих нуклеотидов РНК, s: фосфоротиоат.

Общая экспериментальная методика конъюгирования

Соединения, указанные в заголовках примеров 1-33, связывали через аминомодифицированную РНК согласно следующей методике:

РНК, имеющую С-6 аминолинкер на 5'-конце (16,5 мг, 1 эквивалент), растворяют в 500 мкл DMSO и 150 мкл воды. Добавляют пара-нитрофенилкарбонатное производное (10 эквивалентов), растворенное в 1 мл DMSO, с последующим добавлением 8 мкл DIPEA. Реакционную смесь встряхивают при 35°С в темноте и отслеживают с использованием ВЭЖХ-ОФ (Resource RPC 3 мл, буфер А: 0,1 М ТЕАА в воде, Б: 0,1 М ТЕАА в 95% ACN, градиент: от 3% Б до 100% Б за 20 CV (объем колонки)). Как только реакция доходит до конца, конъюгат РНК осаждают с использованием ацетата натрия (3 М) в ЕtOH при -20°С. Для примеров, не имеющих защитную группу ММТ в дипептидном мотиве, соответствующие конъюгаты очищают с использованием описанных выше условий. Чистые фракции объединяют, и вещество осаждают с использованием ацетата натрия/ЕtOH с получением желательного конъюгата РНК.

Конъюгаты РНК, содержащие защитную группу ММТ в дипептидной последовательности, подвергают дальнейшей переработке согласно методике, приведенной ниже.

Общая методика для расщепления ММТ

Неочищенный осадок конъюгата РНК растворяют в 500 мл воды и 1,5 мл натрий-ацетатного буфера (3 М, рН 5,2 или 0,1 М, рН 4,0). Раствор встряхивают в течение 2 суток при 30°С. Реакционную смесь отслеживают с использованием ВЭЖХ-ОФ (Resource RPC 3 мл, буфер А: 0,1 М ТЕАА в воде, Б: 0,1 М ТЕАА в 95% ACN, градиент: от 3% Б до 100% Б за 20 CV). После полного отщепления защитной группы ММТ конъюгат РНК прямо очищают с использованием условий, только что упомянутых выше. Чистые фракции объединяют, и желательный конъюгат осаждают с использованием ацетата натрия/ЕЮН.

В качестве контроля синтезировали конъюгат РНК, не имеющий дипептидного мотива. Для этой цели холестерин присоединяли к 5'-концу через линкер, описанный в литературе (Nature Biotech, 2007, 25, 1149). Данный конъюгат называется «нерасщепляемым».

Все конъюгаты РНК анализировали ВЭЖХ-ОФ на чистоту, и идентичность подтверждали МС ЭРИ (режим определения отрицательных ионов). Вкратце, ВЭЖХ-ОФ проводили на системе Dionex Ultimate (Dionex, Idstein, Германия), оснащенной колонкой XBridge C18 (2,5×50 мм, размер частиц 2,5 мкм, Waters, Eschborn, Германия) при температуре колонки 65°С. Градиентную элюцию проводили с использованием 100 мМ гексафторизопропанола (HFIP) и 16 мМ триэтиламина в 1% метаноле в качестве элюента А, и в 95% метаноле в качестве элюента Б (от 1% Б до 18% Б за 30 минут). УФ (ультрафиолетовая область спектра) детекцию проводили при 260 нм. Для масс-спектрометрического анализа система МС-ЭРИ ThermoFinnigan LCQ DecaXP с микрораспылительным источником и детектором с ионной ловушкой была связана он-лайн с системой ВЭЖХ.

Примеры конкретных соединений формулы (IIa) раскрыты в таблице 1. Образующиеся соединения называются «холестериновые конъюгаты миРНК, содержащие дипептид», где конкретные холестериновые конъюгаты миРНК, содержащие дипептид, кроме того называются «Соединение, указанное в заголовке примера Х-(NHC6)-(последовательность миРНК) и «миРНК с соединением, указанным в заголовке примера X».

Получение миРНК

Антисмысловая последовательность: 5'- uuGGAUcAAAuAuAAGAuUCcscsU-3'

u, с: 2'-O-метилнуклеотиды соответствующих нуклеотидов РНК, s: фосфоротиоат.

Холестериновые конъюгаты миРНК, содержащие дипептид, направленные против мРНК аполипопротеина В, получали путем смешивания эквимолярного раствора комплементарных нитей в буфере для отжига (20 мМ фосфат натрия, рН 6,8; 100 мМ хлорид натрия), нагревали в водной бане при 80-85°С в течение 3 минут и охлаждали до комнатной температуры в течение периода 3-4 часов. Образование дуплекса подтверждали нативным гель-электрофорезом.

Все полученные холестериновые конъюгаты миРНК, содержащие дипептид, перечислены в таблице 2.

Таблица 1: холестериновые конъюгаты миРНК, содержащие дипептид (5'-3') и аналитические данные. Легенда: строчные буквы а, с, g, u обозначают 2'-O-метилнуклеотиды; фосфоротиоатные связи обозначены строчной буквой "s". (NHC6) представляет собой аминогексильный линкер, включенный на 5'-конце смысловой нити.

Соединение, указанное в заголовке, из примера № Холестериновый конъюгат (5'-3') мол. масса расч. мол. масса ЭКСП. чистота (%) (RP
16 (Соединение, указанное в заголовке Пр.16) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7885,7 7885,7 94,4
31 (Соединение, указанное в заголовке Пр.31) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 8003,8 8003,8 97,3
33 (Соединение, указанное в заголовке Пр.33) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 8752,7 8752,4 97,6
Соединение, указанное в заголовке, из примера № Холестериновый конъюгат (5'-3') мол. масса расч. мол. масса эксп. чистота (%) (RP
32 (Соединение, указанное в заголовке Пр.32) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 8223,1 8226,5 97,3
17 (Соединение, указанное в заголовке Пр.17) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 7870,7 7873,5 90,6
30 (Соединение, указанное в заголовке Пр.30) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7884,8 7888,8 95,2
27 (Соединение, указанное в заголовке Пр.27) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 7840,0 7840,0 94,8
28 (Соединение, указанное в заголовке Пр.28) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7755,4 7754,9 93,2
29 (Соединение, указанное в заголовке Пр.29) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7840,4 7839,9 87,2
1 (Соединение, указанное в заголовке Пр.1) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7931,1 7935,2 98,2
2 (Соединение, указанное в заголовке Пр.2) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7992,2 7995,0 96,7
3 (Соединение, указанное в заголовке Пр.3) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7911,1 7913,8 98,2
4 (Соединение, указанное в заголовке Пр.4) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7955,1 7958,5 98,0
5 (Соединение, указанное в заголовке Пр.5) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7920,5 7923,9 97,2
6 (Соединение, указанное в заголовке Пр.6) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7936.1 7939,6 98,5
7 (Соединение, указанное в заголовке Пр.7) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7904,2 7905,5 95,1
8 (Соединение, указанное в заголовке Пр.8) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7904,2 7908,7 98,8
9 (Соединение, указанное в заголовке Пр.9) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7904,2 7906,7 98,7
10 (Соединение, указанное в заголовке Пр.10) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7918,2 7921,0 95,4
11 (Соединение, указанное в заголовке Пр.11) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7902,0 7901,5 98,7
12 (Соединение, указанное в заголовке Пр.12) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7934,54 7936,5 94,4
13 (Соединение, указанное в заголовке Пр.13) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7916,09 7917,9 96,5
14 (Соединение, указанное в заголовке Пр.14) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7886,07 7888,3 94,9
24 (Соединение, указанное в заголовке Пр.24) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7781,8 7783,4 97,2
23 (Соединение, указанное в заголовке Пр.23) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7815,8 7817,3 95,2
22 (Соединение, указанное в заголовке Пр.22) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7781,8 7783,9 90,5
26 (Соединение, указанное в заголовке Пр.26) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7905,9 7907,0 96,4
25 (Соединение, указанное в заголовке Пр.25) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7871,9 7873,2 96,1
20 (Соединение, указанное в заголовке Пр.20) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7840,7 7840,0 95,5
Соединение, указанное в заголовке, из примера № Холестериновый конъюгат (5'-3') мол. масса расч. мол. масса эксп. чистота (%) (RP
19 (Соединение, указанное в заголовке Пр.19) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7857,8 7856,6 97,3
18 (Соединение, указанное в заголовке Пр.18) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7741,6 7741,1 93,9
21 (Соединение, указанное в заголовке Пр.21) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7798,6 7797,8 87,6
15 (Соединение, указанное в заголовке Пр.15) (NHC6)GGAAUCuuAuAuuuGAUCcAsA 7927,1 7926,8 97,2

Таблица 2: холестериновые конъюгаты миРНК, содержащие дипептид. Последняя запись (пара SEQ ID NO 266/154) представляет собой конъюгат миРНК, не имеющий дипептидного мотива. Легенда: строчные буквы а, с, g, u обозначают 2'-O-метилнуклеотиды; фосфоротиоатные связи обозначены строчной "s". (NHC6) представляет собой аминогексильный линкер, включенный на 5'-конце смысловой нити.

SEQ ID No Смысловая последовательность (5'-3') SEQ ID No Антисмысловая последовательность (5'-3')
- (Соединение, указанное в заголовке Пр.16) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.31) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.33) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.32) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.17) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.30) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
SEQ ID No Смысловая последовательность (5'-3') SEQ ID No Антисмысловая последовательность (5'-3')
- (Соединение, указанное в заголовке Пр.27) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.28) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.29) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.1) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.2) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.3) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.4) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.5) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.6) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.7) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.8) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.9) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в 154 uuGGAUcAAAuAuAAGAuUCcscsU
SEQ ID No Смысловая последовательность (5'-3') SEQ ID No Антисмысловая последовательность (5'-3')
заголовке Пр.10) (NHC6) GGAAUCuuAuAuuuGAUCcAsA
- (Соединение, указанное в заголовке Пр.11) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.12) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.13) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.14) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAu UCcscsU
- (Соединение, указанное в заголовке Пр.24) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.23) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.22) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.26) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.25) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.20) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.19) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.18) (NHC6) 154 UuGGAUcAAAuAuAAGAuUCcscsU
SEQ ID No Смысловая последовательность (5'-3') SEQ ID No Антисмысловая последовательность (5'-3')
GGAAUCuuAuAuuuGAUCcAsA
- (Соединение, указанное в заголовке Пр.21) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
- (Соединение, указанное в заголовке Пр.15) (NHC6) GGAAUCuuAuAuuuGAUCcAsA 154 uuGGAUcAAAuAuAAGAuUCcscsU
266 (Xon.)GGAAUCuuAuAuuuGAUCcAsA 154 UuGGAUcAAAuAuAAGAuUCcscsU

Пример 35: эксперименты in vivo

Совместное введение холестериновых конъюгатов миРНК, содержащих дипептид, и полимера для доставки in vivo

Шести-восьминедельных мышей (линия C57BL/6 или ICR, каждая имеет массу ~18-20 г) приобретали у Harlan Sprague Dawley (Indianapolis IN). До инъекции мышей содержали по меньшей мере 2 суток. Питание производили без ограничений диетой для грызунов Harlan Teklad (Harlan, Madison WI).

Мышам (n=3 на группу) инъецировали смесь из 0,2 мл раствора полимера для доставки и 0,2 мл холестериновых конъюгатов миРНК, содержащих дипептид. Инъецированная доза составляла, если не утверждается иное, 15 мг/кг для полимера для доставки и 0,1 мг/кг в том, что касается холестериновых конъюгатов миРНК, содержащих дипептид. Растворы инъецировали посредством инфузии в хвостовую вену. Через 48 часов после инъекции измеряли уровни АроВ в сыворотке относительно животных, обработанных изотоничной глюкозой, согласно методике, приведенной ниже.

Определение уровней АроВ в сыворотке

Мыши голодали в течение 4 ч до отбора сыворотки посредством подчелюстного кровопускания. Уровни белка АроВ в сыворотке определяли стандартными способами сэндвичного ELISA (твердофазный иммуноферментный анализ). Вкратце, в качестве захватывающего и детектирующего антител использовали соответственно поликлональное антитело козы против АроВ мыши и антитело кролика против АроВ мыши (Biodesign International). Затем наносили антитело козы против IgG кролика, конъюгированное с HRP (пероксидаза хрена) (Sigma), для связывания с комплексом АроВ/антитело. Затем измеряли развитие окрашивания по поглощению тетраметилбензидина (ТМВ, Sigma) посредством микропланшет-ридера Tecan Safire2 (Австрия, Европа) при 450 нм.

На Фиг.1 разные холестериновые конъюгаты миРНК, содержащие дипептид, подвергали сравнительному тесту относительно такой же миРНК, конъюгированной с холестерином, но не имеющей расщепляемого мотива, разработанного ранее в этом разделе. Эффект данного конъюгата миРНК (пара SEQ ID NO 266/154, «нерасщепляемый контроль») на уровни АроВ в сыворотке был принят за 1 для того, чтобы оценить влияние конъюгатов, содержащих дипептид, относительно нерасщепляемого контроля. Замена исходно используемого мотива Phe-Lys (миРНК с соединением, указанным в заголовке Примера 16) соответствующими D-аминокислотами (миРНК с соединением, указанным в заголовке Примера 14) или просто замена Lys неприродным энантиомером (миРНК с соединением, указанным в заголовке Примера 30) давали менее выраженное или эквивалентное уменьшение уровня АроВ относительно миРНК нерасщепляемого контроля. Замена Lys на Gly (миРНК с соединением, указанным в заголовке Примера 23) или Phe на пара-метоксифенилаланин (миРНК с соединением, указанным в заголовке Примера 31) уменьшали эффективность по сравнению с миРНК с соединением, указанным в заголовке Примера 16. Было показано, что конъюгаты миРНК, содержащие другие дипептидные мотивы, являются такими же эффективными, как и исходный конъюгат, содержащий Phe-Lys.

На Фиг.2 обобщены холестериновые конъюгаты миРНК, содержащие дипептид, которые были такими же эффективными или имели улучшенную эффективность по сравнению с миРНК с соединением, указанным в заголовке Примера 16, состоящим из мотива Phe-Lys. Все данные конъюгаты были значительно более активными по сравнению с «нерасщепляемым» холестериновым конъюгатом миРНК пары SEQ ID NO 266/154. Лучше всего работающие холестериновые конъюгаты миРНК, содержащие дипептид, имели фенильное кольцо, модифицированное фтором, в мотиве Phe-Lys (миРНК с соединением, указанным в заголовке Примера 8, миРНК с соединением, указанным в заголовке Примера 9) или имели замену фенилаланина на бета-фенилаланин (миРНК с соединением, указанным в заголовке Примера 11) или его производное (миРНК с соединением, указанным в заголовке Примера 10).

Поскольку холестериновые конъюгаты миРНК, содержащие дипептид, с дипептидными мотивами, состоящими из D-аминокислот, работают одинаково по отношению к нерасщепляемому контрольному конъюгату, вероятно, что другие дипептидные последовательности действительно расщепляются протеазной активностью in vivo. Однако, принимая во внимание широкую приемлемость разных аминокислот и их производных, вероятно, что в реакции расщепления участвует более чем один фермент, о чем говорится в литературе (Bioconjugate Chem. 2002,13,855).

Как показано на Фиг.3, включение дипептидного мотива, расщепляемого катепсином (в данном случае Phe-Lys, миРНК с соединением, указанным в заголовке Примера 16), между миРНК и низкомолекулярным лигандом холестерином увеличивает эффективность конъюгата миРНК по сравнению с конъюгатом миРНК с одним холестерином (пара SEQ ID NO 266/154). Дальнейшее отделение холестеринового лиганда от дипептидного мотива посредством линкеров на основе PEG уменьшает эффективность пропорционально длине PEG линкера.

На Фиг.4 доза полимера поддерживалась на постоянном уровне 15 мг/кг. Дозу миРНК титровали, и измеряли эффект на содержание АроВ в сыворотке. Холестериновые конъюгаты миРНК, содержащие дипептид, содержащие мотив Phe-Lys (F-K) были значительно более эффективными по сравнению с контрольным конъюгатом, не имеющим дипептидной последовательности.

Пример 36: синтез 2'-модифицированного олигорибонуклеотида

Олигорибонуклеотиды синтезировали согласно фосфорамидитной методике на твердой фазе. В зависимости от масштаба использовали либо синтезатор ABI 394 (Applied Biosystems), либо АКТА oligopilot 100 (GE Healthcare, Freiburg, Германия). Синтез проводили на твердой подложке, сделанной из стекла с контролируемым размером пор (CPG, 520, с загрузкой 75 мкмоль/г, приобретенной у Prime Synthesis, Aston, PA, США). Все 2'-модифицированные фосфорамидиты РНК, а также вспомогательные реактивы приобретали у SAFC (Hamburg, Германия). В частности, использовали следующие 2'-O-метил фосфорамидиты: (5'-O-диметокситритил-N6-(бензоил)-2'-O-метил-аденозин-3'-O-(2-цианоэтил-N,N-диизопропиламино) фосфорамидит, 5'-O-диметокситритил-N4-(ацетил)-2'-O-метил-цитидин-3'-O-(2-цианоэтил-N,N-диизопропиламино)фосфорамидит, (5'-O-диметокситритил-N2-(изобутирил)-2'-O-метил-гуанозин-3'-O-(2-цианоэтил-N,N-диизопропиламино) фосфорамидит и 5'-O-диметокситритил-2'-O-метил-уридин-3'-O-(2-цианоэтил-N,N-Диизопропиламино) фосфорамидит. 2'-Дезокси-2'-фтор-фосфорамидиты несли такие же защитные группы, что и 2'-O-метил РНК амидиты. Все амидиты растворяли в безводном ацетонитриле (100 мМ) и добавляли молекулярные сита (ЗА). Для получения 5'-фосфата использовали 2-[2-(4,4'-диметокситритилокси)этилсульфонил]этил-(2-цианоэтил)-(N,N-диизопропил)-фосфорамидит от Glen Research (Sterling, Virginia, США). Для того чтобы ввести С-6 аминолинкер на 5'-конце олигомеров использовали 6-(трифторацетиламино)-гексил-(2-цианоэтил)-(N,N-диизопропил)-фосфорамидит от Thermo Fisher Scientific (Milwaukee, Wisconsin, США). 5'-модификации вводили без какой-либо модификации цикла синтеза. 5-Этилтиотетразол (ЕТТ, 500 мМ в ацетонитриле) использовали в качестве активаторного раствора. Время связывания составляло 6 минут. Для того чтобы ввести фосфоротиоатные связи, использовали 50 мМ раствор 3-((диметиламино-метилиден)амино)-3Н-1,2,4-дитиазол-3-тиона (DDTT, приобретенный у AM Chemicals, Oceanside, СА, США) в безводном ацетонитриле/пиридине (1:1, об./об.).

Пример 37: отщепление и снятие защиты с олигомера, связанного с подложкой

После завершения твердофазного синтеза высушенную твердую подложку переносили в 15 мл пробирку и обрабатывали концентрированным водным аммиаком (Aldrich) в течение 18 часов при 40°С. После центрифугирования супернатант переносили в новую пробирку, и CPG промывали водным аммиаком. Объединенные растворы выпаривали, и твердый остаток растворяли в буфере А (см. ниже).

Пример 38: очистка олигорибонуклеотидов

Неочищенные олигомеры очищали анионообменной ВЭЖХ с использованием колонки, набитой Source Q15 (GE Helthcare) и системы АКТА Explorer (GE Helthcare). Буфер А представлял собой 10 мМ перхлорат натрия, 20 мМ Tris, 1 мМ EDTA (этилендиаминтетрауксусная кислота), рН 7,4 (Fluka, Buchs, Швейцария) и содержал 20% ацетонитрила, и буфер Б был таким же, что и буфер А, за исключением того, что он содержал 500 мМ перхлорат натрия. Использовали градиент от 22% Б до 42% Б в пределах 32 объемов колонки (CV). Записывали кривые поглощения в УФ при 280 нм. Подходящие фракции объединяли и осаждали 3 М NaOAc, pH=5,2 и 70% этанолом. Наконец, осадок промывали 70% этанолом.

Пример 39: отжиг олигорибонуклеотидов с получением миРНК

Комплементарные нити смешивали путем объединения эквимолярных растворов РНК. Смесь лиофилизировали и растворяли в подходящем объеме буфера для отжига (100 мМ NaCl, 20 мМ фосфат натрия, рН 6,8) с достижением желательной концентрации. Данный раствор помещали в водную баню при 85°С, которую охлаждали до комнатной температуры в пределах 2 ч.

Пример 40: активность миРНК, лишенной 2'-ОН остатков, in vitro

Для того чтобы исследовать, показывают ли миРНК, лишенные каких-либо 2'-ОН остатков, мощную активность, вызывающую нокдаун in vitro, авторы изобретения тестировали ряд миРНК, направленных на мРНК EGFP (усиленный зеленый флуоресцентный белок), с разными химическими структурами 2'-модификации (пары SEQ ID 31/32-149/150, и см. Таблицу 3 для примеров). миРНК были подвергнуты скринингу на смысловую и антисмысловую активность с системой анализа люциферазы Dual-Glo® (Promega), используя вектор psiCHECK2 (Promega) в клетках COS7 (DSMZ, Braunschweig, Германия, кат. №АСС-60). Для рассмотрения активности сайленсинга, которую дает смысловая и антисмысловая нить, авторы изобретения клонировали каждую соответствующую 19-мерную последовательность сайта-мишени в виде отдельной конструкции psiCHECK2 (psiCHECK2-AT для антисмысловой активности, psiCHECK2-ST для смысловой активности) в область множественного клонирования, расположенную 3' относительно кодона терминации трансляции синтетической люциферазы Renilla. Посредством применения липофектамина 2000 (Invitrogen GmbH, Karlsruhe, Германия, кат. №11668-019) клетки COS7 сотрансфицировали векторной конструкцией и 3 нМ соответствующей миРНК, комплементарной клонированному сайту-мишени. Успешный сайленсинг, опосредованный миРНК, определяли через 24 часа после трансфекции через активность люциферазы Renilla, нормированную к уровням активности люциферазы светляка для того, чтобы принять во внимание эффективность трансфекции (смотрите Фиг.5а для антисмысловой активности и Фиг.56 для смысловой активности).

Таблица 3: типичные последовательности миРНК и химические модификации, используемые для определения активности нокдауна in vitro, зависимой от 2'-модификаций. Контрольные дуплексы и избранные примеры соответствующих вариантов модификации, использованных в данном исследовании. Xf указывает 2'-фтор модификацию нуклеотида X, маленькие буквы указывают 2'-O-метил модификацию, подчеркнутые буквы указывают нуклеотид ДНК, все другие заглавные буквы указывают рибонуклеотиды. Буква «р» указывает 5'-фосфат.

Дуплексы РНК
немод. 5'-UGCCCAUCCUGGUCGAGCUTT-3'
3'-TTACGGGUAGGACCAGCUCGAp-5'
F/OMe 5'-UfgCfcCfaUfcCfuGfgUfcGfaGfcUfTsT-3'
3'-TsTaCfgGfgUfaGfgAfcCfaGfcUfcGfap-5'
F/ДНК 5'-UfGCfCCfAUfCCfUGfGUfCGfAGfCUfTsT-3'
3'-TsTACfGGfGUfAGfGAfCCfAGfCUfCGfAp-5'
ДНК/ОМе 5'-UgCcCaUcCuGgUcGaGcUTsT-3'
3'-TsTaCgGgUaGgAcCaGcUcGap-5'

Обнаружили, что 5 самых эффективных модифицированных миРНК (нокдаун ≥60%) были сконструированы со структурой чередующихся 2'-фтор/2'-O-метилов (2'F/2'-OMe). Давая антисмысловую активность, данная химическая структура полностью устраняла активность соответствующих смысловых нитей, на что указывает отсутствие или минимальная активность люциферазы Renilla для всех протестированных вариантов 2'F/2'-OMe.

Авторы изобретения сделали заключение о том, что такая структура 2'F/2'-OMe стимулирует намеченную активность антисмысловой нити миРНК при полном подавлении нежелательных эффектов не на мишень, возникающих от смысловой нити.

Пример 41: детекция сайтов, чувствительных к ДНКазе II, посредством анализа in vitro

Для тестирования стабильности in vitro избранных одно и двухцепочечных РНК наладили способ, основанный на высокоэффективной жидкостной хроматографии (ВЭЖХ) с обращенной фазой (ОФ) и образованием ионных пар (ИП) или анионообменной (АО) ВЭЖХ.

Описание способа: для анализа стабильности 10 мкМ раствор либо одноцепочечной, либо двухцепочечной РНК инкубировали при 37°С в 5 мМ растворе натрий-ацетатного буфера (рН 4,5), содержащего 0,8 или 8 единиц ДНКазы II (из коровьей селезенки, Тип V, Sigma Aldrich). Реакцию инкубации останавливали добавлением 100 мМ раствора ацетата триэтиламмония (ТЕАА), сдвигая рН до 7 и инактивируя фермент ДНКазу II. Анализ проводили либо ЖХ/МС (жидкостная хроматография/масс-спектрометрия) в сочетании с УФ детекцией, либо АО-ВЭЖХ с УФ детекцией. Кривые УФ детекции при 260 нм использовали для количественного анализа, данные МС служили для идентификации сайта расщепления в пределах последовательности РНК.

А. ВЭЖХ-ОФ-ИП проводили с использованием C18 колонки Waters XBridge (2,5×50 мм, размер частиц 2,5 мкм) при температуре колонки 85°С. Градиентную элюцию проводили с использованием 100 мМ гексафторизопропанола (HFIP) и 16 мМ триэтиламина в 1% метаноле в качестве элюента А и композиции А в 95% метаноле в качестве элюента Б. Использовали градиент от 1% Б до 18% Б за 30 минут.

Б. АО-ВЭЖХ проводили на колонке Dionex DNA Рас200 (4×250 мм) при 50°С с использованием 20 мМ фосфатного буфера, содержащего 10% ACN при рН=11. Элюент Б содержал 1 М NaBr в элюенте А. Использовали градиент от 25 до 62% Б за 18 минут.

Таблица 4: дуплексы и остающиеся интактными нити, оцениваемые на их стабильность против ДНКазы II. Легенда: строчные буквы а, с, g, u обозначают 2'-O-метилнуклеотиды; заглавные буквы А, С, G, U с последущей "f" указывают 2'-фторнуклеотиды. Строчная "р" указывает 5'-фосфат.(invdT) представляет инвертированный дезокситимидин (3'-3'-связанный). Фосфоротиоатные связи обозначены строчной "s". dT представляет собой дезокситимидин. (NHC6) представляет собой аминогексильный линкер, включенный на 5'-конце смысловой нити.

Заключения:

А. Нити РНК, содержащие по меньшей мере один 2'-ОН нуклеотид (например, обе нити пары SEQ ID NO 157/158), быстро деградируют через циклическое пентавалентное промежуточное соединение, что приводит к 2'-3' циклическим фосфатам в 5'-продукте расщепления. Образование пентавалентного промежуточного соединения можно ингибировать с использованием нуклеотидов, не имеющих 2'-ОН группу, подобных, например, 2'-дезокси, 2'-ОМе или 2'-F.

Б. Дополнительно РНК деградирует через 5'-экзонуклеолитический путь, который не зависит от 2'-модификации на 5'-концевых нуклеотидах. Данный путь деградации можно ингибировать с использованием 5'-концевых ненуклеотидных группировок, подобных, например, С6-аминолинкеру (например, SEQ ID NO 160 в паре SEQ ID NO 160/159 или SEQ ID NO 165 в паре SEQ ID NO 165/166) или фосфоротиоату в первой межнуклеотидной связи (например, SEQ ID NO 160 в паре SEQ ID NO 160/159).

В. 5'-Фосфатная группа замедляет кинетику экзонуклеолитического расщепления, но не может полностью блокировать деградацию, начинающуюся на этом конце (например, SEQ ID NO 160 в паре SEQ ID NO 160/159). Это вероятнее всего обусловлено расщеплением 5'-фосфата либо фосфатазами, либо фосфатазной активностью, присущей ферменту ДНКазе II.

Г. Лучшая защита для нитей РНК достигалась с олигонуклеотидами, не содержащими 2'-ОН нуклеотида, начинающимися с 2'-ОМе нуклеотида на 5'-конце, соединенного фосфоротиоатной связью со вторым нуклеотидом (например, SEQ ID NO 173 в паре SEQ ID NO 173/174). Другие концевые не-2'-ОН нуклеотиды также защищают против 5'-экзо деградации, но в меньшей степени по сравнению с 2'-ОМе модификацией (см. Таблицу 9).

Пример 42: активность нокдауна in vivo миРНК, не имеющих остатков 2'-ОН

Эксперименты in vivo проводили с мышами, которым инъецировали миРНК, направленные на Фактор VII (FVII) (пары SEQ ID NO 179/166 и 180/168, см. Таблицу 5), вводимые совместно с DPC-GalNac.

Таблица 5а: последовательности миРНК для эксперимента in vivo. Легенда:

строчные буквы а, с, g, u обозначают 2'-O-метилнуклеотиды; заглавные буквы А, С, G, U с последующей "f" указывают 2'-фторнуклеотиды. Строчная "р" указывает 5'-фосфат. (invdT) представляет инвертированный дезокситимидин (3'-3'-связанный). Фосфоротиоатные связи обозначены строчной "s". dT представляет собой дезокситимидин. (NHC6) представляет собой аминогексильный линкер, включенный на 5'-конце смысловой нити. GalNAc относится к структуре в формуле (IV).

пара SEQ ID NO SEQ ID NO Последовательность 5'→3'
179/166 179 GalNAc-(NHC6)-GfcAfaAfgGfcGfuGfcCfaAfcUfcAf (invdT)
166 puGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT)
180/168 180 GalNAc-(NHC6)-GcAAAGGcGuGccAAcucAdTsdT
168 UGAGUUGGcACGCCUUUGCdTsdT

Была получена миРНК FVII с чередующейся структурой 2'-OMe/2'-F на смысловой и антисмысловой нити с 5'-концевым 2'-ОМе нуклеотидом на антисмысловой и 5'-концевым 2'-F нуклеотидом на смысловой нити. Обе нити защищены inv(dT) на 3'-концевом липком конце. Антисмысловая нить несла 5'-фосфатную группу для поддержания активности миРНК. С 5'-концом смысловой нити был конъюгирован GalNAc-пальмитоиловый лиганд для обеспечения адресования в гепатоциты посредством асиалогликопротеинового рецептора, экспрессируемого на данных клетках. миРНК (2,5 мг/кг) вводили мышам совместно с GalNAc-адресуемым полимером для доставки PBAVE (15 мг/кг).

Измерения мРНК FVII из гомогенатов печени проводили с использованием набора для анализа с разветвленной ДНК (рДНК) QuantiGene 1.0 (Panomics, Fremont, Calif., США, Кат. №: QG0004).

При вскрытии в жидком азоте быстро замораживали 1-2 г ткани печени. Замороженную ткань растирали в порошок на сухом льду с использование ступки и пестика. 15-25 мг ткани переносили в охлажденную 1,5 мл реакционную пробирку, добавляли 1 мл 1:3 лизирующей смеси, предварительно разведенной в воде MilliQ, и 3,3 мкл протеиназы К (50 мкг/мл), и ткань лизировали посредством обработки ультразвуком в течение нескольких секунд при 30-50%-ной мощности (HD2070, Bandelin, Berlin, Германия). Лизаты хранили при -80°С до анализа. Для анализа мРНК лизат размораживали и расщепляли протеиназой К в течение 15 мин при 1000 об/мин в термомиксере при 65°С (Thermomixer comfort, Eppendorf, Hamburg, Германия). Уровни мРНК FVII и GAPDH (глицеральдегид-3-фосфатдегидрогеназа) определяли с использованием реактивов набора для анализа с рДНК QuantiGene 1.0 согласно рекомендациям производителя. Экспрессию мРНК FVII анализировали с использованием 20 мкл лизата и набора зондов для мышиного FVII. Экспрессию мРНК GAPDH анализировали с использованием 40 мкл лизата и набора зондов Rattus norwegicus, для которых было показано, что они перекрестно реагирует с мышиной последовательностью (последовательности наборов зондов см. выше). В качестве вывода результатов анализа измеряли сигнал хемилюминисценции в конце анализа на счетчике люминисценции Victor 2 Light (Perkin Elmer, Wiesbaden, Германия) в виде относительных световых единиц (RLU). Сигнал для мРНК FVII делили на сигнал для мРНК GAPDH из того же самого лизата. Значения приведены в виде экспрессии мРНК FVII, нормированной к GAPDH.

Результаты демонстрируют 79%-ный нокдаун мРНК FVII в 48 часов после дозировки после введения пары SEQ ID NO 179/166. В отличие от этого, миРНК пары SEQ ID NO 180/168, несущие 2'-ОН нуклеотид, не показывали значительного нокдауна (<25%), как показано в Таблице 5.

Таблица 5б:
результаты исследований по нокдауну in vivo
Пара SEQ ID NO 179/166 Пара SEQ ID NO180/168
Время [час] Остающаяся мРНК [%] Остающаяся мРНК [%]
1 84 92
6 83 88
24 53 100
48 21 76

Пример 43: распределение в ткани миРНК, не имеющих 2'-ОН остатков

Концентрацию миРНК в образцах ткани печени определяли с использованием запатентованного способа детекции олигонуклеотидов, как описано в WO 2010043512. Вкратце, количественное измерение миРНК основано на гибридизации флуоресцентно (Atto-425) меченого ПНК-зонда (Atto425-00-GCAAAGGCGTGCCAACT, приобретенного у Panagene Inc, Корея), комплементарного антисмысловой нити дуплекса миРНК, с последующим разделением на основе АО-ВЭЖХ. Количественное измерение осуществляли посредством детекции флуоресценции относительно внешней калибровочной кривой, которую получали из ряда разведении двух миРНК FVII, используемых в эксперименте in vivo (см. пример 42). Для образцов плазмы в систему ВЭЖХ инъецировали 0,2-2 мкл аликвоты, и для ткани - ~1 мг аликвоты.

Анализ в ткани печени стабилизированной миРНК, не имеющей 2'-ОН нуклеотидов, показал высокие концентрации интактной антисмысловой нити в печени в мкг/г диапазоне, но ~95% присутствовало в 5'-дефосфорилированной неактивной форме (см. таблицу 6). Образующаяся РНК с концевым 2'-ОМе нуклеотидом не склонна к повторному фосфорилированию в цитоплазме посредством фосфокиназы hClp1 (см. ниже). В отличие от этого, антисмысловая нить миРНК, содержащей 2'-ОН, полностью деградировала в ткани в пределах первых 6 часов после дозирования.

Таблица 6:
анализ в ткани печени стабилизированной миРНК, не содержащей 2'-ОН нуклеотид
Пара SEQ ID NO 181/186 в печени [нг/г] Пара SEQ ID NO 181/185 в печени [нг/г]
Время [час] -5'-фосфат +5'-фосфат -5'-фосфат +5'-фосфат
1 873 171 9 BDL
6 1351 106 BDL* BDL
24 1043 65 BDL BDL
48 1062 66 BDL BDL
*BDL = меньше предела определения

Пример 44: активность нокдауна миРНК с оптимизированными 5'-концами in vitro

Проводили дополнительный скрининг миРНК FVII in vitro для того, чтобы идентифицировать миРНК, которые могут подвергаться внутриклеточному (повторному) фосфорилированию на 5'-конце антисмысловой нити, что приводит к РНКи-компетентным соединениям. Все миРНК из данного скрининга показаны в Таблице 7. Чередующаяся структура модификации 2'-ОМе/2'-F была идентична конструкции 1-го поколения (без каких-либо 2'-ОН остатков) за исключением различных модификаций в первых двух нуклеотидах на 5'-конце антисмысловой нити. Получали два 5'-концевых нуклеотида антисмысловой нити в виде 2'-F- или 2'-дезокси-модифицированных нуклеотидов в разных комбинациях с или без дополнительных 5'-фосфата или 5'-фосфотиоата. Все миРНК подвергали скринингу на ответ активности нокдауна на дозу (от 24 нМ до 0,00037 нМ с 4-кратными разведениями) после трансфекции первичных мышиных гепатоцитов (30000 клеток на лунку; формат 96-луночного планшета) с использованием липофектамина 2000 согласно инструкциям изготовителя. Две миРНК были сопоставимо активными относительно исходного дуплекса (пара SEQ ID NO 182/168); сопоставимо активные миРНК: пары SEQ ID NO 181/186 и 181/185) в показателях значений ИКбо - миРНК с 5'-концевым 2'-F и фосфатной группой и миРНК с двумя 5'-концевыми 2'-дезоксинуклеотидами и 5'-фосфоротиоатом (см. Таблицу 7 относительно значений ИК50). Обе из них являются в ~5-6 раз более активными по сравнению с миРНК с концевым 2'-ОМе нуклеотидом (пара SEQ ID NO 181/166), используемой в первом эксперименте на животных.

Пример 45: 5'-фосфорилирование миРНК с оптимизированными 5'-концами in vitro

Все миРНК без 5'-фосфата или 5'-фосфоротиоата, перечисленные в Таблице 7, оценивали на фосфорилирование посредством hClp1 в экстракте клеток HeLa S100.

5'-фосфорилирование анализировали из экстрактов S100 HeLa, как описано Weitzer and Martinez (S. Weitzer and J. Martinez. hClp1: a novel kinase revitalizes RNA metabolism. Cell Cycle 6 (17):2133-2137, 2007). Раствор анализировали либо ВЭЖХ-ОФ-ИП, либо АО-ВЭЖХ при денатурирующих условия непосредственно после инкубации 1 мкМ миРНК в экстракте S100 HeLa, содержащем 5 мМ АТФ, путем инъецирования 5 мкл раствора образца:

А. ВЭЖХ-ОФ-ИП проводили с использованием C18 колонки Waters XBridge (2,5×50 мм, размер частиц 2,5 мкм) при температуре колонки 65°С. Градиентную элюцию проводили с использованием 100 мМ гексафторизопропанола (HFIP) и 16 мМ триэтиламина в 1% метаноле в качестве элюента А и композиции А в 95% метаноле в качестве элюента Б. Использовали градиент от 1% Б до 18% Б за 30 минут.

Б. АО-ВЭЖХ проводили на колонке Dionex DNA Рас200 (4×250 мм) при 50°С с использованием 20 мМ фосфатного буфера, содержащего 10% ACN при рН=11. Элюент Б содержал 1 М NaBr в элюенте А. Использовали градиент от 25 до 62% Б за 18 минут.

Таблица 7:
значения ИК50
SEQ ID NO Последовательность смысловой нити (5'-3') SEQ ID NO Последовательность антисмысловой нити (5'-3') ИК50 [нМ]
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 185 pUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0,17
182 GcAAAGGcGuGccAAcucAdTsdT 168 UGAGUUGGcACGCCUUUGCdTsdT 0,228
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 186 psdTdGaGfuUfgGfcAfcGfcCfuUfuGfcCinvdT) 0,228
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 187 psdTsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0,554
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 188 pdTsdGaGfuUfgGfcAfcGfcCiuUfuGfc(invdT) 0,631
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 189 pdTsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0,702
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 190 pusGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0,749
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 166 puGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 1,002
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 191 psUfGfaGfuUfgGfcAfcGfcCfuUftiGfc(invdT) 1,185
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 192 UfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 2,257
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 193 psUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 2,428
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 194 psdTsdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 3,208
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 195 usGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 3,974
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 196 uGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 4,235
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 197 dTsGfaGfuUfgGfcAfcGfcCftiUfuGfc(invdT) 4,235
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 198 psdTGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 4,704
181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 199 dTsdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 5,341
183 (Chol)GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 190 pusGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 9,771

Отношение 5'-фосфорилирования рассчитывается для каждой нити миРНК из кривой поглощения в УФ при 260 нм с использованием следующего уравнения (РА представляет собой площадь пика):

%(5'-фосфорилирования)=100*РА[5'-фосфорилированная нить]/(PA[5'-фосфорилированная нить]+РАисходная нить])

В Таблице 8 показано, что антисмысловая нить миРНК не может быть 5'-фосфорилирована при локализации на 5'-конце 2'-ОМе нуклеотида (пара SEQ ID NO 181/196 и пара SEQ ID NO 181/195). В отличие от этого, антисмысловая нить является чувствительной к 5'-фосфорилированию при включении на 5'-конце 2'-F,2'-дезокси или 2'-ОН нуклеотида (пара SEQ ID NO 181/195, пара SEQ ID NO 181/192, пара SEQ ID NO 181/197, пара SEQ ID NO 181/199 и пара SEQ ID NO 182/168). Две миРНК, которые были сопоставимо активными в анализе in vitro с исходной парой SEQ ID NO 182/168 (пара SEQ ID NO 181/186 и 181/185), становятся чувствительными к 5'-фосфорилированию, как только синтетически введенная группа 5'-фосфат/5'-РТО расщепляется in vivo, например, фосфатазами.

Таблица 8: Процентная доля 5'-фосфорилированной нити после 4 часов инкубации в клеточном экстракте S100 HeLa. Легенда: строчные буквы а, с, g, u обозначают 2'-O-метилнуклеотиды; заглавные буквы А, С, G, U с последующей "f" указывают 2'-фторнуклеотиды. (invdT) представляет инвертированный дезокситимидин (3'-3'-связанный). Фосфоротиоатные связи обозначены строчной "s". dT представляет собой дезокситимидин.

Пример 46: стабильность миРНК с оптимизированными 5'-концами к ДНКазе II in vitro

Все антисмысловые нити подвергали скринингу на стабильность к ДНКазе II, как описано в примере 41. Две антисмысловые нити, присутствующие в миРНК, которые имели сопоставимую активность в отношении исходного дуплекса (пара SEQ ID NO 186 и SEQ ID NO 185, миРНК с 5'-концевым 2'-F и фосфатной группой и миРНК с двумя 5'-концевыми 2'-дезоксинуклеотидами и 5'-фосфоротиоатом, являются стабильными к расщеплению ДНКазой II (>70% интактной нити после 20 ч инкубации).

Таблица 9:
стабильность миРНК в отношении ДНКазы II in vitro после 20 часов инкубации
SEQ ID NO смысловой SEQ ID NO антисмысловой Последовательность (5'-3') % интактной нити
181 192 UfsGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 11
181 197 dTsGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 0
181 199 dTsdGaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 0
181 193 psUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 106
181 187 psdTsGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 96
181 194 psdTsdGaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 101
181 191 psUfGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 100
181 198 psdTGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 95
181 186 psdTdGaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 99
181 185 pUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 71
181 189 pdTsGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 74
181 188 pdTsdGaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 64

Пример 47: активность нокдауна миРНК с оптимизированными 5'-концами in vivo

Для того чтобы оценить, переносится ли улучшение оптимизированными 5'-концами in vitro на ситуацию in vivo, авторы изобретения провели дополнительные эксперименты на мышах с GalNAc-пальмитоиловыми конъюгатами избранных миРНК (смотрите Таблицу 10). миРНК вводили при таких же условиях, что и условия, описные для первого эксперимента на мышах (пример 42, данная патентная заявка). Для измерения уровней FVII образцы плазмы от мышей получали путем отбора крови (9 объемов) подчелюстным кровопусканием в микроцентрифужные пробирки, содержащие 0,109 моль/л антикоагулянта - цитрата натрия (1 объем), следуя стандартным методикам. Активность FVII в плазме измеряли хромогенным способом с использованием набора BIOPHEN VII (Hyphen BioMed/Aniara, Mason, ОН), следуя рекомендациям изготовителя. Развитие окрашивания по поглощению при 405 нм измеряли с использованием микропланшет-ридера Tecan Safire2.

Исследуемые миРНК показали улучшенную активность in vivo, полностью коррелирующую с результатами скрининга in vitro. Активность FVII в сыворотке снижалась более чем на 80% для обеих миРНК через 48 часов после дозировки по сравнению с 49% при использовании конструкции миРНК первого поколения (смотрите Таблицу 10). Данный результат ясно подчеркивает важность 5'-концевого нуклеотида на антисмысловой нити, который может эффективно фосфорилироваться, в том случае, если фосфатазы отщепляют in vivo полученную синтетически 5'-фосфатную или 5'-фосфотиоатную группу. В случае 5'-концевого 2'-ОМе нуклеотида в том виде, в котором он использовался в исходной конструкции или был описан в литературе в качестве более эффективной конструкции миРНК на основе сравнения с каноническими миРНК in vitro (Allerson et al. J. Med Chem. 2005, 48, 901-904), отщепление синтетического фосфата in vivo приводило бы к сильному снижению эффективности соответствующей миРНК.

Таблица 10: активность нокдауна миРНК с оптимизированными 5'-концами in vivo. Легенда: строчные буквы а, с, g, u обозначают 2'-O-метилнуклеотиды; заглавные буквы А, С, G, U с последующей "f" указывают 2'-фторнуклеотиды. Строчная "р" указывает 5'-фосфат. (invdT) представляет инвертированный дезокситимидин (3'-3'-связанный). Фосфоротиоатные связи обозначены строчной "s". (NHC6) представляет собой аминогексильный линкер, включенный на 5'-конце смысловой нити. GalNAc относится к структуре в формуле (IV).

SEQ ID NO Последовательность смысловой нити (5'-3') SEQ ID NO Последовательность антисмысловой нити (5'-3') % остающегося FVII в сыворотке
179 GalNAc-(NHC6)-pGfcAfaAfgGfcGfuGfcCfaAfcUfcAf (invdT) 166 puGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 27
179 GalNAc-(NHC6)-pGfcAfaAfgGfcGfuGfcCfaAfcUfcAf (invdT) 190 pusGfaGfuUfgGfcAfcGfcCfuUfu Gfc (invdT) 51
179 GalNAc-(NHC6)-pGfcAfaAfgGfcGfuGfcCfaAfcUfcAf (invdT) 185 pUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 17
179 GalNAc-(NHC6)-pGfcAfaAfgGfcGfuGfcCfaAfcUfcAf (invdT) 186 psdTdGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT) 13

Пример 48: активность нокдауна миРНК с оптимизированными 3'-концами in vitro

Для дальнейшего увеличения активности миРНК, стабильных к ДНКазе II, проводили исследование SAR 3'-пипкого конца. Разные комбинации invdT, dTinvdT или dTsdT на 3'-липком конце смысловой либо антисмысловой нити применяли в отношении миРНК, направленных на Aha1 и EGFP (см. Таблицы 11 и 12 соответственно), и попарно сравнивали в отношении состава обоих 3'-концов в самых эффективных миРНК. Все миРНК подвергали скринингу в отношении активности нокдауна в ответ на дозу (от 24 нМ до 0,00037 нМ с 4-кратными разведениями) после трансфекции первичных мышиных гепатоцитов (30000 клеток/лунку; формат 96-луночного планшета) с использованием липофектамина 2000 согласно инструкциям производителя.

Таблица 11:
активность нокдауна in vitro миРНК с разными 3'-концами, направленных на EGFP.
SEQ ID NO Последовательность смысловой нити (5'-3') SEQ ID NO Последовательность антисмысловой нити (5'-3') ИК50 [нМ]
45 GCUGGAGUUCGUGACCGCCdTdT 46 GGCGGUCACGAACUCCAGCdTdT 1,0490
212 GcuGGAGuucGuGAccGccdTsdT 225 GGCGGUcACGAACUCcAGCdTsdT #N/A
201 gcUfgGfaGfuUfcGfuGfaCfcGfcCf (invdT) 221 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfc (invd) 0,4377
201 gcUfgGfaGfuUfcGfuGfaCfcGfcCf (invdT) 214 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0,1479
211 gcUfgGfaGfuUfcGfuGfaCfcGfcCfdT (invdT) 223 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdT (invdT) 0,5833
203 gcUfgGfaGfuUfcGfuGfaCfcGfcCfdTsdT 214 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0,2166
204 GfcUfgGfaGfuUfcGfuGfaCfcGfcCf (invdT) 224 pGfsGfcGfgUfcAfcGfaAfcUfcCfaGfc (invdT) 0,9100
204 GfcUfgGfaGfuUfcGfuGfaCfeGfcCf (invdT) 215 pGfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0,2241
207 GfcUfgGfaGfuUfcGfuGfaCfcGfcCfdT (invdT) 218 pGfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdT (invdT) 0,3474
206 GfcUfgGfaGfuUfcGfuGfaCfcGfcCfdTsdT 215 pGfsGfcGfgUfcAfcGraAfcUfcCfaGfcdTsdT 0,2392
205 GfscUfgGfaGfuUfcGfuGfaCfcGfcCf (invdT) 220 GfsGfcGfgUfcAfcGfaAfcUfcCfaGfc (invdT) 0,4251
205 GfscUfgGfaGfuUfcGfuGfaCfcGfcCf (invdT) 216 GfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0,2349
210 GfscUfgGfaGfuUfcGfuGfaCfcGfcCfdT (invdT) 222 GfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdT (invdT) 0,5230
209 GfscUfgGfaGfuUfcGfuGfaCfcGfcCfdTsdT 216 GfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0,4937
200 gscUfgGfaGfuUfcGfuGfaCfcGfcCf (invdT) 217 pdGsGfcGfgUfcAfcGfaAfcUfcCfaGfc (invdT) 0,2643
200 gscUfgGfaGfuUfcGfuGfaCfcGfcCf (invdT) 213 pdGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0,0936
208 gseUfgGfaGfuUfcGfuGfaCfcGfcCfdT (invdT) 219 pdGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdT (invdT) 0,3776
202 gscUfgGfaGfuUfcGfuGfaCfcGfcCfdTsdT 213 pdGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0,1569
Таблица 12:
активность нокдауна in vitro миРНК с разными 3'-концами, направленных на Aha1
SEQ ID NO Последовательность смысловой нити (5'-3') SEQ ID NO Последовательность антисмысловой нити (5'-3') ИК50 [нМ]
157 GGAuGAAGuGGAGAuuAGudTsdT 158 ACuAAUCUCcACUUcAUCCdTsdT 0,094
234 GfgAfuGfaAfgUfgGfaGfaUfuAfgUf (invdT) 246 AfsCfuAfaUfcUfcCfaCftjUfcAfuCfc (invdT) 0,081
234 GfgAfuGfaAfgUfgGfaGfaUfuAfgUf(invdT) 240 AfsCfuAfaUfcUfcCfaCftjUfcAfuCfcdTsdT 0,036
233 GfgAfuGfaAfgUfgGfaGfaUfuAfgUfdT (invdT) 239 AfsCfuAfaUfcUfcCfaCfuUfcAfuCfcdT (invdT) 0,034
236 GfgAfuGfaAfgUfgGfaGfaUfuAfgUfdTsdT 240 AfsCfuAfaUfcUfcCfaCfuUfcAftjCfcdTsdT 0,040
231 GfsgAfuGfaAfgUfgGfaGfaUfuAfgUf (invdT) 241 pAfsCfuAfaUfcUfcCfaCfuUfcAfuCfc (invd7) 0,037
231 GfsgAftjGfaAfflUfgGfaGfaUfuAfgUf (invdT) 267 pAfsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0,030
229 GfsgAftjGfaAfgUfgGfaGfaUfuAfgUfdT (invdT) 268 pAfsCfuAfaUfcUfcCfaCfuUfcAfuCfcdT (invdT) 0,024
228 GfsqAfuGfaAfgUfgGfaGfaUfuAfgUfdTsdT 267 pAfsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0,021
232 ggAfuGfaAfgUfgGfaGfaUfuAfgUf (invdT) 245 dAsCfuAfaUfcUfcCfaCfaUfcAftjCfc (invdT) 0,060
232 ggAfuGfaAfgUfgGfaGfaUfuAfgUf (invdT) 238 dAsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0,030
237 ggAfuGfaAfgUfgGfaGfaUfuAfgUfdT (invdT) 244 dAsCfuAfaUfcUfcCfaCfuUfcAfuCfcdT (invdT) 0,045
230 ggAfuGfaAfgUfgGfaGfaUfuAfgUfdTsdT 238 dAsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0,025
227 gsgAfuGfaAfgUfgGfaGfaUfuAfgUf (invdT) 243 pdAsCfuAfaUfcUfcCfaCfuUfcAfuCfc (invdT) 0,045
227 gsgAfuGfaAfqUfgGfaGfaUfuAfqUf (invdT) 266 pdAsCfuAfaUfcUfcCfaCfuUfcAfuCfcdfsdt 0,015
235 gsgAfuGfaAfgUfgGfaGfaUfuAfgUfdT (invdT) 242 pdAsCfuAfaUfcUfcCfaCfuUfcAfuCfcdT (invdT) 0,039
226 gsgAfuGfaAfgUfqGfaGfaUfuAfqUfdTsdT 266 pdAsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0,014

Обнаружили, что миРНК с липкими концами с 2 нуклеотидами dTsdT на антисмысловой нити работали вседа лучше, чем миРНК с липким концом с одним invdT на 3'-конце антисмысловой нити (в то время как смысловые нити были одинаковыми). Кроме того, полезной была комбинация со смысловой нитью, модифицированной липким концом с одним invdT в качестве 3' липкого конца.

Пример 49: активность нокдауна миРНК in vivo у приматов, не являющихся человеком

Получение DPC и дозировка

DPC получали путем ковалентного присоединения полимера «149 RAFT» к указанной миРНК, направленной на фактор свертывания крови VII (миР7), в соотношении 4:1 масс.:масс. (полимер:миРНК) через дисульфидную связь и затем модифицируя конъюгат полимер-миРНК смесью 2:1 масс.:масс. CDM-PEG:CDM-NAG в 7х соотношении масс.:масс. (СОМ:полимер). Яванским макакам дозировали 1 мг/кг DPC (масса полимера) и 0,25 мг/кг указанной миРНК. Одно животное получало DPC, содержащий миР7 пары SEQ ID NO 151/152, два животных получали DPC, содержащий миР7 пары SEQ ID NO 253/254), №1 и №2), и два животных получали DPC, содержащий пару SEQ ID NO 251/255), №1 и №2). Значения F7 нормировали к среднему из двух значений до дозы. Животные, получающие DPC, содержащие пару SEQ ID NO 253/254 или пару SEQ ID NO 251/255, имели большие уровни нокдауна F7 и более длительное РТ (протромбиновое время), чем животные, получающие пару SEQ ID NO 251/255.

Процедура инъекции DPC

Для каждой процедуры инъекции животным давали в.м. (внутримышечная) инъекцию, содержащую комбинацию кетамина (вплоть до 7 мг/кг) и дексмедетомидина (вплоть до 0,03 мг/кг), и переводили их в продедурный кабинет. В процедурном кабинете животных помещали на грелку с водяной рубашкой, место инъекции выбривали и обрабатывали антисептиком. В системную вену (головную или подкожную малую вену ноги) вставляли внутривенный катетер (калибра 20-22), и медленно инфундировали (2 мл/кг) раствор DPC в течение 1-2 минут. Для мониторинга скорости сердечных сокращений и насыщения кислородом во время и сразу после процедуры инъекции использовали пульсовый оксиметр. Проведение каждой процедуры инъекции занимало примерно 20 минут. После инъекции катетер удаляли, и к месту прокола вены прилагали небольшое давление. Животных забирали обратно в их клетки, и давали им в.м. инъекцию обращающего лекарственного средства атипамезола (антиседан) (от 0,10 до 0,15 мг/кг). За животными наблюдали, пока у них не восстанавливалась нормальная активность.

Процедура отбора крови

Образцы крови (1-5 мл) получали для измерения ингибирования гена (активность F7, время свертывания), химического состава крови и маркеров повреждения печени (СВС (общий анализ крови), биохимический анализ крови, ALT, цитокины, комплемент). Для этих процедур отбора крови животным давали в.м. инъекцию, содержащую комбинацию кетамина (вплоть до 7 мг/кг) и дексмедетомидина (вплоть до 0,03 мг/кг). Сразу после засыпания животных перемещали на передвижной процедурный стол, и для отбора крови из бедренной вены использовали иглу 22 калибра и шприц. Сразу после отбора крови, к месту прокола вены прилагали давление, и кровь распределяли в подходящие пробирки для каждого анализа крови. Затем животным давали в.м. инъекцию обращающего лекарственного средства атипамезола (антиседан) (от 0,10 до 0,15 мг/кг) и возвращали в их клетку. За любой 30-суточный период отбирали не более чем 20% от общего объема крови (оценочный объем крови = 60 мл/кг). Проведение каждой процедуры отбора крови занимало примерно 10 минут.

Измерения активности Фактора VII (F7)

Образцы крови от приматов, не являющихся человеком, готовили путем заполнения цельной кровью пробирок сепаратора сыворотки и обеспечения свертывания крови при комнатной температуре в течение по меньшей мере 20 минут. После свертывания, пробирки с кровью центрифугировали в течение 3 минут при 9000 об./мин, производили аликвотирование в пробирки Эппендорфа и хранили образцы при -20°С до анализа. Активность F7 в сыворотке измеряли хромогенным способом с использованием набора BIOPHEN VII (Hyphen BioMed/Aniara, Mason, ОН), следуя рекомендациям изготовителя. Развитие окрашивания по поглощению при 405 нм измеряли с использованием микропланшет-ридера Tecan Safire2.

Тесты на свертывание (протромбиновое время, частичное протромбиновое время и фибриноген)

Образцы крови от приматов, не являющихся человеком, получали путем полного наполнения цельной кровью пробирок с цитратом натрия (BD Vacutainer) и легкого помешивания для предотвращения образования сгустков. Пробирки транспортировали в клиническую испытательную лабораторию в пределах одного часа, а анализы свертывания проводили в пределах 4 часов со времени отбора.

Таблица 13: дцРНК (двухцепочечные РНК) FVII для эксперимента на МНР (приматы, не являющиеся человеком). Легенда: строчные буквы а, с, g, u обозначают 2'-O-метилнуклеотиды; заглавные буквы А, С, G, U с последущей "Г указывают 2'-фторнуклеотиды. Строчная "р" указывает 5'-фосфат.(invdT) представляет инвертированный дезокситимидин (3'-3'-связанный). Фосфоротиоатные связи обозначены строчной "s". dT представляет собой дезокситимидин. NH2C6 представляет собой аминогексильный линкер, включенный на 5'-конце смысловой нити.

SEQ ID NO Последовательность смысловой нити (5'-3') SEQ ID NO Последовательность антисмысловой нити (5'-3')
251 (NH2C6) GfuUfgGfuGfaAfuGfgAfgCfuCfaGf (invdT) 252 pCfsUfgAfgCfuCfcAfuUfcAfcCfaAfc (invdT)
253 (NH2C6) GfgUfcCfuGfuUfgUfuGfgUfgAfaUf (invdT) 254 pAfsUfuCfaCfcAfaCfaAfcAfgGfaCfcdTsdT
251 (NH2C6) GfuUfgGfuGfaAfuGfgAfgCfuCfaGf (invdT) 255 PCfsUfgAfgCfuCfcAfuUfcAfcCfaAfcdTsdT

Замена от 3'-липкого конца с одним нуклеотидом (invdT) на обеих нитях до асимметричной конструкции миРНК с 3'-(invdT) липким концом на смысловой нити и липким концом с dTsdT на антисмысловой нити, но при постоянной в иных отношениях структуре модификации приводила к более отчетливому снижению FVII в сыворотке и к значительно возросшей продолжительности данного эффекта у приматов, не являющихся человеком (см. фиг.6а). Данное наблюдение поддерживается ожидаемым биологическим последствием, а именно - более отчетливым эффектом на протромбиновое время, соответствующим степени уменьшения уровня Фактора 7 (см. Фиг.6б).

Пример 50: активность нокдауна миРНК с расщепляемыми РНК линкерами/л vivo

В Таблице 14 эффективность in vivo, основанную на ингибировании белка FVII в сыворотке, сравнивали с использованием холестеринового или GalNAc-пальмитоилового конъюгата миРНК в одинаковом контексте последовательностей у мышей. Эксперимент in vivo проводили, как описано в примере 42. Ингибирование FVII сильно снижалось для миРНК, конъюгированных с холестерином, не содержащих 2'-ОН нуклеотида, по сравнению с аналогами, конъюгированными с GalNAc-пальмитоилом (пара SEQ ID NO 179/166 по сравнению с 179/190, пара SEQ ID NO 257/264 по сравнению с парой SEQ ID NO 179/262, пара SEQ ID NO 257/263 по сравнению с парой SEQ ID NO 179/163 и пара SEQ ID NO 257/166 по сравнению с парой SEQ ID NO 179/166). В отличие от 2'-ОН, содержащих миРНК, холестериновый конъюгат приводил к большему ингибированию FVII по сравнению с GalNAc-пальмитоиловым производным (пара SEQ ID NO 180/168 по сравнению с парой SEQ ID NO 258/168).

Низкомолекулярные лиганды: GalNAc-пальмитоил и холестерин, использованные в описанном эксперименте in vivo, соединяются с миРНК через нерасщепляемый линкер с 5'-концом смысловой нити. В случае когда смысловая нить демонстрирует 2'-ОН нуклеотиды, лиганд все еще расщепляется нуклеазами (например, ДНКазой II в эндосомальном или лизосомальном компартменте). Реакция расщепления высвобождает свободную миРНК, которая затем высвобождается в цитоплазму посредством активности полимера для доставки, нарушающей целостность эндосомы.

Для миРНК, не имеющих 2'-ОН нуклеотида в смысловой нити, лиганды стабильно соединяются с дуплексом, так как нет ферментативного (нуклеазного/протеазного/эстеразного и т.д.) или химического механизма, запускающего отщеление лиганда. Следовательно, полностью стабильная миРНК, конъюгированная с холестерином, может захватываться в клеточных мембранах из-за взаимодействия с мембраной липофильного холестеринового лиганда. Даже высокие концентрации миРНК в ткани не являются достаточными для эффективного высвобождения миРНК в цитоплазму. В отличие от этого, менее липофильная миРНК, конъюгированная с GalNAc-пальмитоилом, может высвобождаться в цитоплазму из-за менее выраженного взаимодействия с клеточными мембранами. По этой причине стабильный, нерасщепляемый GalNAc-пальмитоиловый конъюгат миРНК является более эффективным по сравнению с такой же миРНК, конъюгированной с холестерином.

Разработка конструкций с расщепляемым линкером помогла бы обойти проблему захвата в мембране миРНК, стабильно конъюгированной с холестерином. Применение химической структуры с дисульфидным линкером описывают как привлекательную возможность введения определенного сайта расщепления. Однако расщепление ограничивается восстанавливающими органеллами в клетке (PNAS, 2006, 103, 13872). Поскольку ожидается, что расщепление в эндосомальном/лизосомальном компартменте является медленным, большая часть миРНК, конъюгированной с холестерином посредством дисульфида, все еще может захватываться в мембранах, как описано для нерасщепляемых холестериновых конъюгатов.

Таблица 14
Конъюгат пара SEQ ID NO SEQ ID NO Последовательность 5'→3' % активности FVII в сыворотке
GalNAc 179/166 179 GalNAc-NHC6-pGfcAfaAfgGfcGfuGfcCfaAfcUfcAf (invdT) 27
166 puGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT)
179/190 179 GalNAc-NHC6-pGfcAfaAfgGfcGfuGfcCfaAfcUfcAf (invdT) 51
190 pusGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT)
179/262 179 GalNAc-NHC6-pGfcAfaAfgGfcGfuGfcCfaAfcUfcAf (invdT) 17
262 pUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT)
179/263 179 GalNAc-NHC6-pGfcAfaAfgGfcGfuGfcCfaAfcUfcAf (invdT) 13
263 psdTdGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT)
180/168 180 GalNAc-NHC6-pGcAAAGGcGuGccAAcucAdTsdT 86
168 UGAGUUGGcACGCCUUUGCdTsdT
Холестерин 257/166 257 Хол-pGfcAfaAfgGfcGfuGfcCfaAfcUfcAf (invdT) 48
166 puGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT)
257/190 257 Хол-pGfcAfaAfgGfcGfuGfcCfaAfcUfcAf (invdT) 93
190 pusGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT)
257/264 257 Хол-pGfcAfaAfgGfcGfuGfcCfaAfcUfcAf (invdT) 63
264 pUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT)
257/263 257 Хол-pGfcAfaAfgGfcGfuGfcCfaAfcUfcAf (invdT) 41
263 psdTdGfaGfuUfgGfcAfcGfcCfuUfuGfc (invdT)
258/168 258 Хол-pGcAAAGGcGuGccAAcucAdTsdT 50
168 UGAGUUGGcACGCCUUUGCdTsdT

Помимо хорошо установленной химической структуры дисульфидного расщепляемого линкера, другой возможностью является получение определенных сайтов расщепления посредством применения 2'-ОН нуклеотидов в определенных положениях. Введение 2'-ОН нуклеотидов в избранных положениях является новым подходом для достижения отщепления конъюгатов от нитей РНК. 2'-ОН нуклеотиды можно задействовать либо путем добавления одноцепочечных липких концов с по меньшей мере одним 2'-ОН нуклеотидом на 3'- или 5'-конце нити РНК, либо путем применения 2'-ОН нуклеотидов в пределах дуплексной области миРНК. Ферментативная активность нуклеаз, присутствующих в эндосоме/лизосоме осуществляет селективное расщепление в данных положениях. В первой конструкции холестерин соединяли со смысловой нитью через одноцепочечный липкий конец, содержащий 3 2'-ОН нуклеотида (AUC) на 5'-конце.

миРНК, конъюгированные с холестерином, у которых сравниваются разные химические структуры расщепляемого линкера, показаны в Таблице 15. Все миРНК имеют идентичный контекст последовательностей, была изменена лишь химическая структура линкера. Холестерин соединяли со смысловой нитью через одноцепочечный липкий конец, содержащий три 2'-ОН нуклеотида (AUC) на 5'-конце. При совместном введении с полимером для доставки эта миРНК (пара SEQ ID NO 260/263) приводила к 77%-ной понижающей модуляции FVII в сыворотке у мышей по сравнению лишь с 60%-ной при использовании идентичной миРНК со стабильно присоединенным холестерином (пара SEQ ID NO 257/263). Такая же миРНК с холестерином, конъюгированным через линкер согласно формуле Ia с 5'-концом смысловой нити (пара SEQ ID NO 261/263), приводила к 93%-ному снижению активности FVII в сыворотке. Все результаты достигались посредством совместного введения 15 мг/кг полимера для доставки с 2,5 мг/кг миРНК, конъюгированной с холестерином, у мышей.

Данные результаты показывают, что применение расщепляемого линкера улучшает эффективность in vivo миРНК, не содержащих 2'-ОН нуклеотид. Расщепляемый линкер может состоять либо из нуклеотидов, содержащих 2'-ОН, либо из дипептидного расщепляемого мотива, либо из химической структуры дисульфидного линкера. Все конструкции расщепляемого линкера улучшают эффективность in vivo в ситуации совместного введения миРНК, конъюгированных с холестерином, с полимером для доставки, обеспечивающим медленное высвобождение из эндосом.

Таблица 15
Сравнение in vivo разных химических структур линкеров для умРНК, конъюгированных с холестерином
SEQ ID NO Последовательность смысловой нити (5'-3') SEQ ID NO Последовательность антисмысловой нити (5'-3') % активности FVII в сыворотке
257 Хол-pGfcAfaAfgGfcGfuGfcCfaAfc UfcAf (invdT) 263 psdTdGfaGfuUfgGfcAfcGfcCfu UfuGfc (invdT) 40
259 Хол-C6SSC6-pGfcAfaAfgGfcGfuGfcCfaAfc UfcAf (invdT) 263 PsdTdGfaGfuUfgGfcAfcGfcCfu UfuGfc (invdT) 22
260 Хол-AUC-pGfcAfaAfgGfcGfuGfcCfaAfc UfcAf (invdT) 263 psdTdGfaGfuUfgGfcAfcGfcCfu UfuGfc (invdT) 23
261 Xon-Cathepsin-(NHC6)-pGfcAfaAfgGfcGfuGfcCfaAfc UfcAf (invdT) 263 psdTdGfaGfuUfgGfcAfcGfcCfu UfuGfc (invdT) 7

Пример 51: стабильность миРНК с расщепляемыми линкерами в сыворотке in vitro

Стабильность расщепляемого линкера оценивали в анализе стабильности in vitro. Смысловые нити, конъюгированные с холестерином, инкубировали в 90%-ной мышиной сыворотке при 37°С в течение разных интервалов времени. Инкубационную реакцию останавливали добавлением протеиназы К и буфера, содержащего додецилсульфат натрия (SDS). Данная обработка деградирует все белки и ферменты, не нарушая целостности нити РНК. 25 мкл данного раствора инъецировали непосредственно в систему АО-ВЭЖХ, соединенную с УФ детектором, работающим при 260 нм. АО-ВЭЖХ проводили на колонке Dionex DNA Рас200 (4×250 мм) при 75°С, используя 20 мМ Tris буфер, содержащий 50% ACN, при рН=8. 800 нМ NaBr в элюенте Б служит в качестве элюирующей соли. Использовали градиент от 25 до 62% Б за 18 минут.

Одноцепочечная РНК, содержащая холестерин, элюируется из колонки ВЭЖХ в виде широкого пика при 260 нм. После отщепления холестерина наблюдаются острые симметричные пики при меньшем времени удерживания. Скорость отщепления холестерина определяли следующим уравнением (РА = площадь пика):

%(свободная РНК)=100*РА[свободная РНК]/(РА[свободная РНК]+РА[РНК, конъюгированная с холестерином])

In vitro было показано, что 3-нуклеотидный (AUC) липкий конец количественно расщепляется меньше, чем за 1 час в 90%-ной мышиной сыворотке. Расщепление происходит 3' относительно двух пиримидиновым нуклеотидов в липком конце, приводя к двум отличным метаболитам расщепления (площади пиков метаболитов обобщали для оценки данных). В отличие от этого, линкер, содержащий дипептид, согласно формуле Ia, дисульфид и стабильно связанный холестерин являются полностью стабильными в мышиной сыворотке.

Пример 52: распределение миРНК с расщепляемыми линкерами в ткани

Данные результаты показывают, что применение расщепляемого линкера улучшает эффективность in vivo миРНК, не содержащих 2'-ОН нуклеотид. Расщепляемый линкер может содержать либо нуклеотиды, содержащие 2'-ОН, либо дипептидный расщепляемый мотив, либо химическую структуру дисульфидного линкера. Все конструкции расщепляемого линкера улучшают эффективность in vivo в ситуации совместного введения миРНК, конъюгированных с холестерином, с полимером для доставки, обеспечивающим медленное высвобождение из эндосом.

Вкратце, количественное измерение миРНК основано на гибридизации флуоресцентно (Atto-425) меченого ПНК-зонда (Atto425-OO-TGAGTTGGCACGCCTTT, приобретенного у Panagene Inc, Корея), комплементарного смысловой нити диплекса миРНК, с последующим разделением на основе АО-ВЭЖХ. Количественное измерение осуществляли флуоресцентной детекцией относительно внешней калибровочной кривой, которую получали из ряда разведения двух миРНК FVII, используемых в эксперименте in vivo (см. пример 42). В систему ВЭЖХ инъецировали аликвоты от 0,2 до 2 мкл для образцов плазмы, и для ткани - аликвоты, соответствующие ~1 мг.

В Таблице 16 показаны результаты из анализа ткани печени. При анализе содержания миРНК обнаружили, что смысловая нить, которая присутствует в ткани печени, количественно отщепляется от холестерина при использовании либо мотива дипептидного линкера, либо 3-нуклеотидного 5'-липкого конца с немодифицированной последовательностью линкера AUC. В отличие от этого, лишь 15% миРНК, связанной посредством дисульфида, которая присутствует в печени, отщеплялось от холестерина в пределах первых 48 часов после дозировки, и никакое количество стабильно присоединенного холестерина не отщеплялось от миРНК.

При сравнении абсолютных количеств миРНК, не содержащей холестерин, в ткани печени обнаружили аналогичные количества для дисульфидного линкера и для AUC-линкера РНК, хорошо коррелирующие с равной сывороточной активностью FVII через 48 часов после дозировки. Меньшая активность FVII, достигающаяся с миРНК, связанной с холестерином посредством дипептида, полностью коррелирует с большим абсолютным количеством отщепленной миРНК, не содержащей холестерин.

Общее количество холестеринового конъюгата миРНК, имеющей (AUC)-линкер на смысловой нити, доставленного в печень, ~6 раз ниже по сравнению со стабильно присоединенным холестерином или холестерином, присоединенным посредством дисульфида, и ~3 раза ниже по сравнению с миРНК, конъюгированной с холестерином посредством дипептида. Пониженное присутствие в ткани может приписываться к тому факту, что AUC-линкер является не только субстратом для внутриклеточных нуклеаз, но также и для нуклеаз, присутствующих в системе кровообращения, как показано при инкубации in vitro с мышиной сывороткой. При отщеплении холестеринового лиганда от миРНК уже в системе кровообращения образующаяся миРНК склонна к почечному клиренсу и быстро экскретируется в мочу без доставки в ткань.

Таблица 16:
SEQ ID NO Последовательность смысловой нити (5'-3') SEQ ID NO Последовательность антисмысловой нити (5'-3') Общая миРНК в печени [нг/г] % лигам-да, от-щеп-леного от смысловой нити в печени
257 Хол-pGfcAfaAfgGfcGfuGfcCf aAfcUfcAf (invdT) 263 psdTdGfaGfuUfgGfcAfcGfcCfu UfuGfc (invdT) 5837 0
259 Хол-C6SSC6-GfcAfaAfgGfcGfuGfcCfa AfcUfcAf (invdT) 263 psdTdGfaGfuUfgGfcAfcGfcCfu UfuGfc (invdT) 4357 14,8
260 Хол-AUC-GfcAfaAfgGfcGfuGfcCfa AfcUfcAf(invdT) 263 PsdTdGfaGfuUfgGfcAfcGfcCfu UfuGfc (invdT) 912 96,1
261 Хол-Катепсин-(NHC6)-pGfcAfaAfgGfcGfuGfcCf aAfcUfcAf(invdT) 263 PsdTdGfaGfuUfgGfcAfcGfcCfu UfuGfc (invdT) 2760 99,8

Пример 53: активность нокдауна миРНК с расщепляемыми РНК-линкерами/л vivo

Эксперимент in vivo проводили на мышах, как описано в примере 50, с использованием холестериновых конъюгатов миРНК. В примере 50 холестерин был присоединен к смысловой нити через одноцепочечный липкий конец, содержащий 3 2'-ОН нуклеотида (AUC) на 5'-конце (пара SEQ ID NO 260/263), который показывала низкую стабильность в сыворотке, как описано в примере 51. Это приводило к явно пониженной концентрации в ткани по сравнению с химическими структурами линкеров, стабильными в сыворотке, как описано в примере 52. Комбинация только одного или двух выбранных 2'-ОН нуклеотидов совместно с 2'-ОМе нуклеотидами в пределах линкера приводит к более высокой стабильности в сыворотке, но поддерживает чувствительность против нуклеаз, присутствующих в эндосоме/лизосоме. Ферментативная активность нуклеаз, присутствующих в эндосоме/лизосоме, осуществляет селективное расщепление в положениях 2'-ОН нуклеотидов.

миРНК, конъюгированные с холестерином, у которых сравниваются различные мотивы расщепляемого нуклеотидного линкера, обобщены в Таблице 17. Все миРНК имеют идентичный контекст последовательности, только химическая структура линкера была изменена. Холестерин был присоединен к 5'-концу смысловой нити через одноцепочечный липкий конец, состоящий из трех или четырех нуклеотидов, с варьирующим числом 2'-ОН и 2'-ОМе нуклеотидов. При совместном введении с полимером для доставки все миРНК приводили к понижающей регуляции FVII в сыворотке у мышей. миРНК (пара SEQ ID NO 276/282) приводит к 87%-ному снижению активности FVII в сыворотке через 48 часов и к 95%-ному - через 168 часов после дозировки. миРНК (пара SEQ ID NO 277/282) приводит к 79%-ному снижению активности FVII в сыворотке через 48 часов и к 97%-ному - через 168 часов после дозировки. Все результаты у мышей достигались посредством совместного введения 15 мг/кг полимера для доставки с 2,5 мг/кг миРНК, конъюгированной с холестерином.

Таблица 17:
сравнение in vivo разных мотивов нуклеотидных линкеров для миРНК, конъюгированных с холестерином.
SEQ ID NO Последовательность смысловой нити (5'-3') SEQ ID NO Последовательность антисмысловой нити (5'-3') % активности FVII в сыворотке (через 48 и 168 ч после дозирова-ния)
276 Хол-uAu-GfcAfaAfgGfcGfuGfcCfaAfcU fcAf (invdT) 282 pdTsGfaGfuUfgGfcAfcGfcCfuUf uGfdTsdT 13 и 5
277 Хол-uGu-GfcAfaAfgGfcGfuGfcCfaAfcU fcAf (invdT) 282 PdTsGfaGfuUfgGfcAfcGfcCfuUf uGfdTsdT 21 и 3
278 Хол-uAuu- 282 PdTsGfaGfuUfgGfcAfcGfcCfuUf 19 и 9
GfcAfaAfgGfcGfuGfcCfaAfcU fcAf (invdT) uGfdTsdT
279 Хол-uGuu-GfcAfaAfgGfcGfuGfcCfaAfcU fcAf (invdT) 282 pdTsGfaGfuUfgGfcAfcGfcCfuUf uGfdTsdT 20 и 6
280 Хол-uuAG-GfcAfaAfgGfcGfuGfcCfaAfcU fcAf (invdT) 282 PdTsGfaGfuUfgGfcAfcGfcCfuUf uGfdTsdT 46 и 18
281 Хол-uAGu-GfcAfaAfgGfcGfuGfcCfaAfcU fcAf (invdT) 282 PdTsGfaGfuUfgGfcAfcGfcCfuUf uGfdTsdT 21 и 6

Данные результаты показывают, что применение нуклеотидного линкера, который является стабильным в сыворотке и расщепляемым в эндосоме/лизосоме, дополнительно улучшает эффективность миРНК in vivo по сравнению с миРНК с линкером, лабильным в сыворотке. Все конструкции с расщепляемым линкером улучшают эффективность in vivo в ситуации совместного введения миРНК, конъюгированных с холестерином, с полимером для доставки, обеспечивающим медленное высвобождение из эндосом.

В следующих таблицах обобщаются миРНК, использованные в примерах:

Таблица 18:
центральные последовательности.
SEQ ID NO Последовательность смысловой нити (5'-3') SEQ ID NO Последовательность антисмысловой нити (5'-3')
1 ACAUGAAGCAGCACGACUU 2 AAGUCGUGCUGCUUCAUGU
3 GCCCGACAACCACUACCUG 4 CAGGUAGUGGUUGUCGGGC
5 CGAGAAGCGCGAUCACAUG 6 CAUGUGAUCGCGCUUCUCG
7 AUAUCAUGGCCGACAAGCA 8 UGCUUGUCGGCCAUGAUAU
9 ACAAGCUGGAGUACAACUA 10 UAGUUGUACUCCAGCUUGU
11 GCAGCUCGCCGACCACUAC 12 GUAGUGGUCGGCGAGCUGC
13 CGUCCAGGAGCGCACCAUC 14 GAUGGUGCGCUCCUGGACG
15 GCUGGAGUUCGUGACCGCC 16 GGCGGUCACGAACUCCAGC
17 CCACCCUGACCUACGGCGU 18 ACGCCGUAGGUCAGGGUGG
19 CGACUUCAAGGAGGACGGC 20 GCCGUCCUCCUUGAAGUCG
21 UUCAAGAUCCGCCACAACA 22 UGUUGUGGCGGAUCUUGAA
23 GGCAACUACAAGACCCGCG 24 CGCGGGUCUUGUAGUUGCC
25 CCGGCAAGCUGCCCGUGCC 26 GGCACGGGCAGCUUGCCGG
27 UGCCCAUCCUGGUCGAGCU 28 AGCUCGACCAGGAUGGGCA
29 CAAGUUCAGCGUGUCCGGC 30 GCCGGACACGCUGAACUUG
151 GGAAUCUUAUAUUUGAUCCAA 152 UUGGAUCAAAUAUAAGAUUCCCU
155 GGAUGAAGUGGAGAUUAGU 156 ACUAAUCUCCACUUCAUCC
161 GCAAAGGCGUGCCAACUCA 162 UGAGUUGGCACGCCUUUGC
161 GCAAAGGCGUGCCAACUCA 178 TGAGUUGGCACGCCUUUGC
163 GGAUCAUCUCAAGUCUUAC 164 GUAAGACUUGAGAUGAUCC
171 UGACCACAGUCGGAUUAAA 172 UUUAAUCCGACUGUGGUCA
247 GUUGGUGAAUGGAGCUCAG 248 CUGAGCUCCAUUCACCAAC
249 GGUCCUGUUGUUGGUGAAU 250 AUUCACCAACAACAGGACC
256 UAUGCAAAGGCGUGCCAACUCA 178 TGAGUUGGCACGCCUUUGC
271 UGUGCAAAGGCGUGCCAACUCA 178 TGAGUUGGCACGCCUUUGC
272 UAUUGCAAAGGCGUGCCAACUCA 178 TGAGUUGGCACGCCUUUGC
273 UGUUGCAAAGGCGUGCCAACUCA 178 TGAGUUGGCACGCCUUUGC
274 UUAGGCAAAGGCGUGCCAACUCA 178 TGAGUUGGCACGCCUUUGC
275 UAGUGCAAAGGCGUGCCAACUCA 178 TGAGUUGGCACGCCUUUGC

1. Применение соединения формулы

для приготовления конъюгата для доставки нуклеиновых кислот в клетку, где
Y представляет собой -(СН2)3-;
R1 представляет собой
-(C1-6)алкил; или
-(CH2)m-фенил, который является незамещенным или замещенным вплоть до четырех раз заместителем, независимо выбранным из:
-NO2,
-CN, или
галогена;
R2 представляет собой
водород;
-(СН2)k-фенил;
-(С1-6)алкил;
-(CH2)k-C(O)-NH2; или
-(CH2)k-N-C(Ph)3, причем фенильные кольца являются незамещенными или независимо замещенными -O-(С1-4)алкилом;
R3 представляет собой
-NH-фенил, причем фенильная группа является дополнительно замещенной заместителем, независимо выбранным из
-(СН2)-ОН или
-(СН2)-O-С(O)-O-(4-нитрофенила);
k равен 1, 2, 3, 4, 5 или 6;
m равен 1, 2, 3 или 4; и
n равен 0 или 1.

2. Применение по п. 1, где соединение формулы (I) имеет конформацию, как показано в формуле (1a)

3. Применение по п. 1, где заместитель соединений формулы (I) или (Ia)
Y представляет собой -(СН2)3-;
R2 представляет собой -(CH2)k-N-C(Ph)3, причем фенильные кольца являются незамещенными или независимо замещенными -O-(С1-4)алкилом; и
R3 представляет собой -NH-фенил, причем фенильная группа дополнительно замещена -(СН2)-O-С(O)-O-(4-нитрофенилом);
n равен 0; и
R1 и k имеют значения, приведенные выше.

4. Применение по любому из пп. 1-3, где указанное соединение ковалентно присоединяют к нуклеиновой кислоте.

5. Соединение формулы

где
Ra представляет собой -(CH2)k-NH2;
R1, Y, n и k имеют значения, приведенные выше для формулы (I), при этом нуклеиновая кислота представляет собой одноцепочечный РНК олигонуклеотид.

6. Соединение по п. 5, имеющее конформацию, как показано в формуле (IIa)

где
Ra представляет собой -(CH2)k-NH2;
R1 и k имеют значения, приведенные выше для формулы (I).

7. Соединение формулы

где
Ra представляет собой -(CH2)k-NH2;
R1, Y, n и k имеют значения, приведенные выше для формулы (I), где нуклеиновая кислота представляет собой одноцепочечный РНК олигонуклеотид, содержащий антисмысловую нить со структурой модификации: 5′-(w)-(Z1)-(Z2)-(Z3)na-3′, и смысловую нить со структурой модификации: 5′-(Z3)ns-3′, где
w независимо представляет собой 5′-фосфат или 5′-фосфотиоат, или Н,
Z1 независимо представляет собой 2′-модифицированный нуклеотид.
Z2 независимо представляет собой 2′-дезоксинуклеотид или 2′-фтор-модифицированный нуклеотид,
Z3 независимо представляет собой 2′-модифицированный нуклеотид, na равен 8-23, и ns равен 8-25.

8. Соединение по любому из пп. 5-7, где нуклеиновая кислота представляет собой миРНК.

9. Соединение по любому из пп. 5-7, где нуклеиновая кислота вводится с полимером для доставки.

10. Фармацевтическая композиция для доставки нуклеиновых кислот в клетку, содержащая соединения по любому из пп. 5-9 и фармацевтически приемлемый эксципиент.



 

Похожие патенты:

Изобретение относится к биотехнологии, а именно к комплексу, для применения в способе адъювантной терапии у нуждающегося в таком лечении пациента, а также к вакцине, которая включает данный комплекс.

Изобретение относится к области биохимии, в частности к способу стабильного интегрирования представляющей интерес линейной молекулы нуклеиновой кислоты в клетку растения, имеющую клеточную стенку, с использованием положительно заряженной полупроводниковой наночастицы.

Изобретение относится к области биохимии, в частности к способу введения молекулы функционализированной линейной нуклеотидной кассеты, представляющей интерес, в клетку растения, имеющую клеточную стенку, способу введения молекулы функционализированной линейной нуклеотидной кассеты, представляющей интерес, в растительный материал, а также к способу интрогрессии признака в растение.
Изобретение относится к фотохимиотерапии и фотодинамической терапии, а именно к применению фармацевтически приемлемой соли амфифильного фотосенсибилизирующего средства в способе фотохимической интернализации, где указанная соль обладает водорастворимостью по меньшей мере 30 мг/мл и выбрана из диэтаноламиновой соли TPCS2a, этаноламиновой соли TPCS2a, триэтаноламиновой соли TPCS2a, диэтаноламиновой соли TPPS2a, этаноламиновой соли TPPS2a и триэтаноламиновой соли TPPS2a.

Группа изобретений относится к биохимии. Предложена липидная частица для доставки нуклеиновой кислоты (варианты), способ введения нуклеиновой кислоты в клетку, способ изготовления липидных частиц, включающих нуклеиновую кислоту.

Изобретение относится к области биохимии, в частности к способам внесения представляющей интерес нуклеиновой кислоты в растительную клетку, имеющую клеточную стенку.

Изобретение относится к области медицины, генетической инженерии и биотехнологии. Предложен способ обеспечения безопухолевой тканезаместительной терапии на основе получаемых из взрослых соматических клеток индуцированных плюрипотентных стволовых клеток (иПСК), где последние генетически модифицируют при помощи искусственной хромосомы (ИХ), несущей бицистронную кассету с геном-самоубийцей и геном чувствительности к антибиотику под контролем регуляторного элемента, специфичного для плюрипотентных стволовых клеток, при этом модифицированные иПСК отбирают в присутствии соответствующего антибиотика, подтверждают отсутствие интеграции ИХ в геном иПСК, вводят в организм реципиента напрямую, без предварительной дифференцировки in vitro, через 1-14 дней реципиентам проводят 5-10-дневный курс терапии индуктором токсичности продукта гена-самоубийцы.

Изобретение относится к области биотехнологии, в частности к биотехнологии бактерий, и связано с получением полифункциональных магнитных наночастиц. В качестве настоящего изобретения предложен способ получения полифункциональных магнитных наночастиц на основе бактериальных магнетосом и гибридного белка MGG, позволяющий получать магнетосомы, связывающие иммуноглобулины класса IgG по фрагменту Fc.

Изобретение относится к области генетической инженерии, молекулярной биологии и медицины. Предложен носитель для направленной доставки нуклеиновых кислот в клетки, экспрессирующие рецептор CXCR4, состоящий из последовательности-лиганда к рецептору CXCR4 с последовательностью аминокислот KPVSLSYRSPSRFFESH, линкерного участка из двух молекул ε-аминогексановой кислоты, соединяющей последовательность-лиганд с последовательностью для компактизации нуклеиновых кислот, последовательности, обеспечивающей компактизацию нуклеиновых кислот и выход комплекса из эндосом CHRRRRRRHC.

Изобретение относится к области биотехнологии, конкретно к способу введения молекулы siRNA в цитозоль клетки, и может быть использовано в медицине. Способ включает контактирование указанной клетки с молекулой siRNA, носителем и фотосенсибилизирующим веществом и облучение клетки светом с длиной волны, эффективной для активации фотосенсибилизирующего вещества.

Изобретение относится к области биотехнологии, а именно к тест-системе для обнаружения экспрессии гена NAT2 у человека. Данная тест-система включает смесь праймеров, комплементарных концам разных цепей требуемого фрагмента ДНК-матрицы для ПЦР, эндонуклеазу рестрикции с буфером и технологическую смесь для ПЦР с Taq-полимеразой.

Группа изобретений относится к обоасти биохимии и биотехнологии. Представлены аптамер, связывающийся с химазой и ингибирующий активность химазы, содержащий нуклеотидную последовательность, представленную как X1GAUAGAN1N2UAAX2, где X1 и X2 идентичны или не идентичны друг другу и каждый означает A или G, а N1 и N2 идентичны или не идентичны друг другу и каждый означает A, G, C, U или T; комплекс, включающий аптамер и функциональное вещество, например вещество, обладающее сродством, вещество для мечения, фермент, средство доставки лекарственного средства, лекарственное средство; лекарственное средство или реагент, содержащее аптамер или комплекс; способы детекции и очистки химазы с использованием аптамера или комплекса.

Изобретение относится к области биотехнологии и может быть использовано для индукции противоопухолевого иммунного ответа in vitro. Способ включает получение прилипающей и неприлипающей фракций мононуклеарных клеток (МНК), выделенных из периферической крови больного, совместное культивирование выделенных из периферической крови больного аутологичных МНК неприлипающей фракции со зрелыми дендритными клетками (ДК), полученными из прилипающей фракции МНК, трансфицированными РНК опухолевых клеток.

Изобретение относится к области биотехнологии, а именно к набору последовательностей праймеров и аллель-специфических зондов для одновременной генодиагностики двух мутантных аллелей, вызывающих комплекс аномалий позвоночника (CVM) и дефицит лейкоцитарной адгезии (BLAD) у крупного рогатого скота.

Изобретения относятся к области биохимии. Описана группа изобретений, включающая двухцепочечную олиго-РНК конструкцию для эффективной доставки РНК и способ ее изготовления, наночастицу, содержащую вышеуказанную двухцепочечную олиго-РНК конструкцию, способ регулирования экспрессии гена in vitro путем использования вышеуказанной олиго-РНК конструкции и способ регулирования экспрессии гена in vivo путем использования вышеуказанной наночастицы.

Предложенное изобретение относится к области биотехнологии, а именно к вирусоподобной частице (VLP) для применения в вакцинах или антигенных композициях для лечения или профилактики инфекции вируса бешенства (RV), а также способам их получения и применения.

Изобретение относится к биохимии. Раскрыты способы повышения экспрессии полинуклеотида PAR4, включающие осуществление контакта с по меньшей мере одним олигонуклеотидом длиной от 15 до 30 нуклеотидов, который нацелен на природную антисмысловую последовательность для полинуклеотида PAR4, и при этом указанная природная антисмысловая последовательность имеет последовательность, представленную в SEQ ID NO: 2.

Изобретение относится к области биотехнологии, а именно к способу выявления РНК вируса бешенства и набору, который используется в данном способе. Способ включает проведение ОТ-ПЦР с олигонуклеотидными праймерами.

Настоящее изобретение относится к фосфодиэстеразе 4D7 (PDE4D7) для применения в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера повышена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы с экспрессией в нормальной ткани или ткани доброкачественной опухоли предстательной железы, и к применению PDE4D7 в качестве диагностического маркера для агрессивного гормон-чувствительного рака предстательной железы.

Изобретение относится к области биохимии, в частности к молекулам нуклеиновой кислоты для модуляции экспрессии генов-мишеней. Заявлена двухцепочечная молекула нуклеиновой кислоты для ингибирования экспрессии гена белка теплового шока 47 (hsp47).

Изобретение относится к области биотехнологии и может быть использовано для индукции противоопухолевого иммунного ответа in vitro. Способ включает получение прилипающей и неприлипающей фракций мононуклеарных клеток (МНК), выделенных из периферической крови больного, совместное культивирование выделенных из периферической крови больного аутологичных МНК неприлипающей фракции со зрелыми дендритными клетками (ДК), полученными из прилипающей фракции МНК, трансфицированными РНК опухолевых клеток.
Наверх