Способ выявления мутации p.q368x в гене миоцилина (myoc), вызывающей развитие первичной открытоугольной глаукомы



 

G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2582956:

Федеральное государственное бюджетное учреждение науки Институт биохимии и генетики Уфимского научного центра Российской академии наук (ИБГ УНЦ РАН) (RU)
Государственное бюджетное образовательное учреждение высшего профессионального образования Башкирский государственный медицинский университет Министерства здравоохранения Российской Федерации (ГБОУ ВПО БГМУ Минздрава России) (RU)

Изобретение относится к области медицины. Предложен способ выявления мутации p.Q368X (с.1102С>Т) в гене MYOC, сопровождающейся развитием наследственной формы первичной открытоугольной глаукомы (ПОУГ). Осуществляют выделение ДНК из лимфоцитов периферической крови методом фенольно-хлороформной экстракции и проведение полимеразной цепной реакции в реальном времени с последующей детекцией пика кривой плавления в конечной точке. Амплификацию участка гена MYOC проводят в присутствии двух последовательностей олигонуклеотидов с красителем EvaGreen. Изобретение обеспечивает эффективную диагностику развития ПОУГ у пациентов из семей с отягощенной наследственностью. 1 ил., 2 табл., 2 пр.

 

Изобретение относится к медицине, а именно к медицинской генетике и офтальмологии, может быть использовано для диагностики врожденных форм наследственной глаукомы.

Первичная открытоугольная глаукома (ПОУГ) относится к группе заболеваний с наследственной предрасположенностью, возникающих и развивающихся под взаимодействием наследственности и окружающей среды [Quigley and Broman, 2006]. Вклад генетических факторов в развитие ПОУГ, по данным различных авторов, составляет от 20 до 60% [Liu et al., 2011]. В настоящее время большинство исследователей считают, что основным диагностическим признаком этой разнородной группы заболеваний является специфическая глаукоматозная оптическая нейропатия [Hewitt et al., 2006 b; Liu et al., 2011; Liu and Allingham, 2013]. По социально-экономическому ущербу, влиянию на уровень здоровья и качество жизни пациентов первичная открытоугольная глаукома наравне с диабетической ретинопатией и макулярной дегенерацией составляют три главные патологии в структуре слепоты у человека. Хроническое бессимптомное течение первичной открытоугольной глаукомы, часто проявляющейся в среднем возрасте и неуклонно прогрессирующей в течение всей жизни, в особенности ювенильные формы ПОУГ, которые нередко становятся причиной инвалидности в молодом возрасте, определяют необходимость исследования факторов риска и механизмов развития данного заболевания с целью разработки эффективных методов диагностики и профилактики с учетом индивидуальных особенностей каждого больного. Первичная открытоугольная глаукома (ПОУГ) является самой распространенной клинической формой заболевания и составляет в Европе, Америке и России по разным оценкам от 70 до 90% всех случаев этого заболевания [Libby, 2005; Allingham, 2009; Liu and Allingham, 2013]. По данным Всемирной Организации Здравоохранения (ВОЗ), глаукома стоит на втором месте среди всех заболеваний, приводящих к слепоте [http://www.who.int/topics/blindness]. Последние достижения геномных и постгеномных технологий позволили выявить формы ПОУГ с моногенным типом наследования среди многофакторных форм заболевания [Allingham et al., 2009; 2011; 2013]. В ряде популяционных исследований было продемонстрировано, что наличие отягощенного по глаукоме семейного анамнеза является важным фактором риска развития глаукомы [Nemesure et al., 2007; Ramdas et al., 2011]. Выраженная генетическая гетерогенность, различия в механизмах возникновения и разнообразие клинических проявлений различных форм глауком нередко затрудняют поиск и идентификацию мутаций, которая необходима для определения риска возникновения и скорости прогрессирования заболевания у пробандов и их родственников, а также проведения профилактических мероприятий в семьях высокого риска по ПОУГ. В связи с этим изучение этиопатогенеза и генетических аспектов различных форм первичной открытоугольной глаукомы является одной из наиболее актуальных проблем офтальмогенетики и молекулярной медицины. Вместе с тем своевременная и точная диагностика наследственного дефекта при ПОУГ позволит наиболее качественно и в самые ранние сроки назначать лечебные и реабилитационные мероприятия для обеспечения полноценной социальной адаптации лиц с первичной открытоугольной глаукомой.

Преимущества предлагаемой разработки перед существующими аналогами заключаются в оптимальности разрабатываемых подходов ДНК-диагностики заболеваний, основанных на выявлении существующего своеобразия генофонда народов Волго-Уральского региона.

Согласно литературным данным, большинство случаев генетически детерминированной первичной открытоугольной глаукомы наследуется, в основном, по аутосомно-доминантному типу [Bhattacharya et al., 2013]. Однако выраженная генетическая гетерогенность заболевания, а также различная пенетрантность мутаций, вызывающих ПОУГ, зачастую не позволяет точно выяснить механизм наследования заболевания [Libby, 2005; Allingham, 2009; Liu and Allingham, 2013]. Среди всех идентифицированных генов, вовлеченных в функционирование оттока водянистой влаги из передней камеры глаза, наиболее значимым является ген миоциллина (MYOC), вклад которого в развитие ПОУГ, по данным различных авторов, достигает 2-10% в различных этнических группах [Fuse et al., 2010; Alingham et al., 2011].

Однако у довольно большого числа семей, которые обращаются к врачу-офтальмологу по поводу выяснения риска возникновения ПОУГ у потомства, как правило, не удается выявить генетический дефект и правильно провести генеалогическое обследование вследствие достаточно высокой генетической гетерогенности данного заболевания и отсутствия данных о фенотипических проявлениях той или иной мутации в генах, повреждение которых вызывает ПОУГ. По данным различных авторов, процент семей с невыявленными генетическими дефектами, приводящими к наследственным формам ПОУГ, в зависимости от этноса составляет, в среднем, около 80% (Ramdas et al., 2011; Child et al., 2013).

Наиболее часто встречаемая мутация гена миоциллина - p.Q368X (с.1102С>Т) - характерна для 1,6% больных ПОУГ европеоидной расы [Faucher М., et al., 2002]. На ее долю приходится около 30% от всех найденных в гене MYOC мутаций [Resch et al., 2009; Fingert et al., 2011]. В отношении распространенности мутаций p.Q368X (c.1102С>Т) гена MYOC показана расовая и/или этническая специфичность, обусловленная, в ряде случаев, эффектом основателя, а также, возможно, географической и социальной изоляцией некоторых популяций [Brezin А.P. et al., 1998; Campos-Mollo et al., 2007; Fautsch et al., 2010; Fingert et al., 2011 Cheng et al., 2012]. p.Q368X идентифицирована у пациентов с ПОАГ из США [Gong et al., 2004], Канады [Faucher et al., 2002], Австралии [Baird et al. (2003)], Европы [Melki et al., 2003; Hogewind et al., 2007], Южной Америки [Liu et al., 2012; Mendoza-Reinoso et al., 2012] и России [Рахманов B.B., 2005].

Встречающиеся в гене миоцилина мутации не равнозначны по своему фенотипическому проявлению. Так, для мутации p.Q368X характерна более поздняя манифестация заболевания и более доброкачественное течение по сравнению с p.Y437H, p.I477N и, особенно, p.P370L, которые приводят к развитию ювенильных форм ПОУГ с агрессивным течением [Campos-Mollo et al., 2007; Cai et al., 2012].

Известен способ детекции мутации p.Q368X (с.1102C>Т) в гене миоцилина {MYOC) посредством ПДРФ-анализа (Baird P.N., Dickinson J., Craig J.E., Mackey D.A. The Taal restriction enzyme provides a simple means to identify the Q368STOP mutation of the myocilin gene in primary open angle glaucoma. Am J Ophthalmol. - 2001 - V. 131(4). - P. 510-511). Однако рестрикционый анализ - относительно дорогостоящий и трудоемкий метод, который требует проведения электрофоретического разделения рестриктов в акриламидном или агарозном гелях, последующего ресеквенирования и к тому же на проведение ПДРФ анализа необходимо более 3 суток.

Также известен способ детекции и мутации p.Q368X (с.1102С>Т) в гене миоцилина (MYOC) посредством анализа конформационнных полиморфизмов одноцепочечной ДНК (SSCP-анализ) (Craig J.E., Baird P.N., Healey D.L., McNaught A.I., McCartney P.J., Rait J.L., Dickinson J.L., Roe L., Fingert J.H., Stone E.M., Mackey D.A. Evidence for genetic heterogeneity within eight glaucoma families, with the GLC1A Gln368STOP mutation being an important phenotypic modifier. Ophthalmology. - 2001. - V. 108(9). - P. 1607-1620). Наибольшим недостатком этого метода является достаточно низкая чувствительность - от 50 до 97% даже при использовании капиллярного электрофореза. При этом ложноотрицательные результаты не гарантируют отсутствие мутации в образце.

Глубокое ресеквенирование - анализ, широко применяемый для детекции любых изменений нуклеотидной последовательности, был разработан Фредериком Сенгером в 1977 году и в настоящее время после завершения проекта «Геном человека» широко используется для ресеквенирования нуклеотидной последовательности ДНК человека (Sanger F. Determination of nucleotide sequences in DNA // Biosci Rep. - 2004. - V. 24 (4-5). - P. 237-253). Существенными недостатками этого метода являются его трудоемкость и необходимость дорогостоящего оборудования и реактивов, а также определенное количество времени (около 3 суток).

Прототипом изобретения является работа Souzeau с соавторами (Souzeau Е., Burdon K.Р., Dubowsky A., Grist S., Usher В., Fitzgerald J.Т., Crawford A., Hewitt A.W., Goldberg I., Mills R.A., Ruddle J.B., Landers J., Mackey D.A., Craig J.E. Higher prevalence of myocilin mutations in advanced glaucoma in comparison with less advanced disease in an Australasian disease registry. Ophthalmology. - 2013. - V. 120(6) - P. 1135-1143.). Основными недостатками ближайшего аналога являются его трудоемкость и необходимость в использовании дорогостоящего оборудования и реактивов.

Техническим результатом изобретения является упрощение способа и повышение точности определения мутации p.Q368X (с.1102С>Т) в гене миоцилина (MYOC) и сокращение времени исследования (до 2-х суток) посредством разработки специфических олигонуклеотидных праймеров для ПЦР в реальном времени с анализом кривой плавления в конечной точке амплификации у больных ПОУГ и у гетерозиготных носителей данной мутации. Преимуществом ПЦР с флуоресцентной детекцией является отсутствие необходимости проведения этапов ПДРФ-анализа и электрофореза, что уменьшает риск контаминации и резко сокращает время и трудоемкость проведения анализа. Интерпретация результатов проводится с помощью программных средств амплификатора с возможностью проведения ПЦР в реальном времени (Allelic Discrimination) в автоматическом режиме.

Указанный технический результат достигается тем, что в способе, включающем выделение ДНК из лимфоцитов периферической крови методом фенольно-хлороформной экстракции и проведение полимеразной цепной реакции в реальном времени с флуоресцентной детекцией, проводят амплификацию фрагментов ДНК, содержащих мутацию p.Q368X (с.1102C>Т) в гене миоцилина (MYOC) в присутствии интеркалирующего красителя EvaGreen® и олигонуклеотидов:

Q368X - F, GTCCAGAACTGTCATAAGATA,

Q368X - R, CCAAGAATACGGGAACTG,

(длина фрагмента 100 п.н.), фланкирующих область с возможным содержанием мутации p.Q368X (c.1102С>Т).

Способ осуществляется следующим образом.

ДНК выделяют из лимфоцитов периферической крови. В качестве консерванта используют раствор следующего состава: 0,48% лимонной кислоты, 1,32% цитрата натрия, 1,47% глюкозы. При заборе крови к 1 мл консерванта добавляют 4 мл венозной крови и хорошо перемешивают.

Для получения ДНК необходимой степени чистоты и достаточного молекулярного веса используется метод выделения ДНК из крови фенольно-хлороформной экстракцией, описанный Метью (Mathew С.С.The isolation of high molecular weight eucariotic DNA. // Methods in Molecular Biology / Ed. Walker J.M.Y.L.: Human Press. 1984. - V. 2. - P. 31-34).

1. Кровь в пробирке с консервантом тщательно перемешивается и переливается в центрифужный стакан объемом 50 мл, туда же добавляем 30 мл охлажденного лизирующего буфера, содержащего 320 мМ сахарозы, 1% раствор тритона Х-100, 5 мМ MgCl2, 10 мМ трис HCl (pH 7,6).

2. Смесь центрифугируется 20 мин при 4000 об/мин.

3. Надосадочную жидкость сливают, к получившемуся осадку приливают 0,4 мл 10% SDS и протеиназу K (концентрация 10 мг/мл). Смесь для лизиса оставляют на 16 часов в термостате при температуре 37°C.

Экстракцию ДНК осуществляют в следующем порядке:

4. К лизату добавляют 0,5 мл фенола, насыщенного 1М трис HCl до pH 7,8.

5. Смесь встряхивают на шейкере и центрифугируют 10 мин при 6000 об/мин.

6. Отбирают водную фазу, содержащую ДНК и неденатурированные белки.

7. Отобранную фазу обрабатывают смесью фенол-хлороформа (1:1), а затем хлороформом.

8. Препараты осаждают двумя объемами охлажденного этанола 96%.

9. Образовавшийся осадок ДНК растворяют в 1,5 мл деионизированной H2O; раствор хранят при -20°C.

В дальнейшем полученную ДНК используют в качестве матрицы для полимеразной цепной реакции в реальном времени (ПЦР) для амплификации нужного фрагмента кодирующего региона гена MYOC. Подготовка образцов для ПЦР проводится в ламинарном боксе с использованием специального комплекта пипеток и наконечников с аэрозольными фильтрами.

- Образцы ДНК перед проведением ПЦР полностью размораживаются при комнатной температуре. После размораживания содержимое пробирок тщательно перемешивается и центрифугируется при 5000 об/мин.

- Измеряется концентрация образцов ДНК на спектрофотометре.

- Образцы ДНК разводятся деионизованной водой до оптимальной концентрации, необходимой для проведения ПЦР в реальном времени (30 нг/мкл).

Основные компоненты реакции:

1. Смесь для ПЦР (670 мМ Tris-HCl (pH 8,8); 0,1% Tween-20, 2 мМ dNTPs, 10 мМ специфичных праймеров).

2. Taq-полимераза

3. Краситель EvaGreen® (водный раствор 20-кратный)

- Для ПЦР-анализа одного образца в амплификационную пробирку вносятся следующие компоненты реакции (таблица 1):

- Для ПЦР-анализа нескольких образцов следует подготовить реакционную смесь на необходимое количество проб. Для этого в отдельной стерильной пробирке смешать следующие компоненты ПЦР: деионизованную воду, краситель EvaGreen®, смесь для ПЦР и Taq-полимеразу.

- Все компоненты перемешиваются на микроцентрифуге-вортексе, затем реакционную смесь разливают по амплификационным пробиркам или плашкам по 2 мкл в лунку или в пробирку.

- Вносят ДНК (1,0 мкл) в лунки плашки или в пробирки с учетом отрицательных контролей.

- Тщательно закрывают плашку или пробирки и ставят в реал-тайм ПЦР амплификатор

Специфические последовательности олигонуклеотидных праймеров для детекции мутации p.Q368X (с.1102С>Т) в гене MYOC и их оптимальные концентрации в реакционной смеси, размер амплифицируемого фрагмента и температурный режим ПЦР указаны в таблице 2.

Детекцию результатов проводят на амплификаторах с возможностью проведения анализа флуоресценции по конечной точке - «Rotor-Gene» 3000/6000 («Corbet Research)), Австралия); «iQCycler, «iQ5», «CFX96» («BioRad», США), ABI 7300/7500/7900 («Applied Biosystems)), США). Время исследования составляет 2 дня. После прохождения ПЦР следует провести анализ кривых флуоресценции по отдельным лункам в окне «Расчет» раздела «Анализ данных» и анализ кривых плавления образцов ДНК в окне «Нормализация кривых плавления» согласно протоколу используемого прибора. О наличии мутации p.Q368X (с.1102С>Т) в исследуемом локусе следует судить по определенной форме кривых плавления по сравнению с нормой (фигура 1).

В качестве конкретных примеров обследовано в целом 1045 пациентов (496 пациентов с ПОУГ и 589 индивидов из группы контроля) с ПОУГ, состоящих на учете в Государственном бюджетном учреждении «Уфимский научно-исследовательский институт глазных болезней» г.Уфы, членов их семей, а также здоровых доноров, проживающих в Волго-Уральском регионе.

Критерием включения в исследование был диагноз «Первичная открытоугольная глаукома» (Н40.1 по МКБ-10), установленный на основании клинических, лабораторно-инструментальных и молекулярно-генетических методов исследований в соответствии с современными диагностическими критериями, предлагаемыми ФГБУ "Московский научно-исследовательский институт глазных болезней им. Гельмгольца" Минздравсоцразвития России. Диагноз глаукомы устанавливался на основании данных анамнеза, по результатам полного клинического обследования, включавшего: исследование центральной остроты зрения, исследование периферического поля зрения и статической периметрии на оборудовании SYNIMED (USA), бесконтактную тонометрию в динамике (ежедневно) на пневмотонометре REICHERT (USA), колорометрический анализ диска зрительного нерва на ретинофоте CARL ZEISS, биомикроскопию переднего отрезка глаза и глазного дна. В ходе исследования уточнялись данные об этнической принадлежности больных путем опроса и выяснения национальной принадлежности родителей до третьего поколения. Особое внимание уделялось установлению места рождения пробандов, их родителей и прародителей; выявлению кровнородственных браков в семьях обследованных пациентов. Таким образом, в исследование вошли 496 пациентов с ПОУГ и 589 здоровых индивидов из трех этнических групп (русские (223 человека), татары (124 человек) и другие национальности (242 человека)) из Волго-Уральского региона.

Молекулярно-генетический анализ частоты мутации p.Q368X (с.1102С>Т) в гене MYOC проводился у больных, страдающих первичной открытоугольной глаукомой, предположительно наследственной этиологии.

На первом этапе исследований был проведен скрининг мутации p.Q368X (С.1102C>Т) в гене MYOC у 496 неродственных пациентов из Республики Башкортостан. У 8 неродственных пациентов данная мутация была выявлена в гетерозиготном состоянии, что составляет 1,6% всех обследованных семей с ПОУГ. По этнической принадлежности пациенты с мутацией p.Q368X (с.1102C>Т) распределились следующим образом: 6 - русских, 1 татарин и 1 метис (русский/татарин). У всех пациентов был отягощен анамнез по ПОУГ. Таким образом, учитывая относительное преобладание мутации p.Q368X (с.1102C>Т) в гене MYOC у пациентов из европейских популяций, достаточно легко объяснить сегрегацию мутантных аллелей в гене MYOC и среди больных ПОУГ из Республики Башкортостан. На основании этого анализа больным с мутацией p.Q368X (с.1102C>Т) в гене MYOC был выставлен диагноз - аутосомно-доминантная форма первичной открытоугольной глаукомы. Следовательно, общий вклад идентифицированной у пациентов с ПОУГ мутации p.Q368X (с.1102С>Т) в гене MYOC составил 0,8%. Далее были проанализированы здоровые доноры из популяционных выборок русских, татар, башкир и метисов - наиболее многочисленных этносов, живущих в Волго-Уральском регионе. Мутация p.Q368X (с.1102С>Т) в гене MYOC была идентифицирована в гетерозиготном состоянии у 1 русского пациента (0,17%). Носители мутации p.Q368X в гене MYOC в течение жизни имеют риск развития заболевания, варьирующий от 60 до 100%.

Относительное преобладание мутации p.Q368X в гене MYOC у больных с первичной открытоугольной глаукомой обуславливает целесообразность ее первоочередного тестирования при проведении генетического анализа. Также при наличии у пациента мутации p.Q368X в гене MYOC из схем лечения необходимо исключить применение глюкокортикоидных препаратов, таких как дексаметазон, преднизолон и др. В литературе имеются данные о том, что у носителей p.Q368X (c.1102C>Т) в гене MYOC под действием дексаметазона клетки трабекулярной сети радужки становятся более чувствительными к различным факторам и воздействиям (механическое растяжение, оксидативный стресс, изменение гормональной регуляции) и подвергаются апоптозу, что может быть связано либо с индукцией экспрессии миоцилина в клетках, либо с ассоциацией дефектного миоцилина в них с митохондриями, играющими ключевую роль в запрограммированной клеточной смерти [Rozsa et al., 2006; Yuan He et al., 2009; Colak et al., 2012].

Таким образом, учитывая существование выражения межпопуляционных различий в частоте мутации p.Q368X (с.1102C>Т) в гене MYOC, анализ генетической гетерогенности при первичной открытоугольной глаукоме в отдельных регионах и этнических группах является актуальной проблемой медицинской генетики, необходимым условием при разработке оптимальных для данного региона подходов ДНК-диагностики наследственных форм ПОУГ.

Пример 1. Больной Л.Н., 1956 год рождения, город Уфа, Республика Башкортостан. Диагноз первичной открытоугольной глаукомы установлен в 2012 году. В настоящее время пациент проперирован. Со стороны родителей и ближайших родственников - наследственность отягощена. Первичная открытоугольная глаукома была выявлена у матери пациента. При молекулярно-генетическом тестировании у больного было взято по 8 мл венозной крови с последующим выделением ДНК и проведена реал-тайм ПЦР с флуоресцентной детекцией мутации p.Q368X (с.1102С>Т) в гене MYOC в реакционной смеси, содержащей 1,0 мкг геномной ДНК, соответствующее кол-во буфера, содержащего смесь для ПЦР (670 мМ Tris-HCl (pH 8,8); 0,1% Tween-20, 2 мМ dNTPs, 10 мМ специфичных праймеров, краситель EvaGreen® - 0,3 мкл, и Taq-полимеразу. Затем провели провели амплификацию ДНК в амплификаторе «CFX96» («BioRad», США) с возможностью проведения анализа флуоресценции по конечной точке согласно программе: начальная денатурация: 94°C - 2:00, 40 циклов амплификации: денатурация 95°C - 0:10, отжиг 56/60°C - 1:00. Исследование ДНК больного выявило гетерозиготное носительство p.Q368X (с.1102С>Т) в гене MYOC. Время исследования составило 2 дня.

Пример 2. Пациент А.К., 1958 год рождения, город Уфа, Республика Башкортостан. Диагноз первичной открытоугольной глаукомы установлен в 2012 году. Со стороны матери пациента наследственность отягощена по первичной открытоугольной глаукоме. У пациента взяли 8 мл венозной крови с последующим выделением ДНК и постановкой реакции реал-тайм ПЦР с флуоресцентной детекцией мутации p.Q368X (с.1102С>Т) в гене MYOC. Амплификацию ДНК проводили в амплификаторе «CFX96» («BioRad», США) с возможностью проведения анализа флуоресценции по конечной точке согласно программе: начальная денатурация: 94°C - 2:00, 40 циклов амплификации: денатурация 95°C - 0:10, отжиг 56/60°C - 1:00. Исследование ДНК больного выявило гетерозиготное носительство мутации p.Q368X (с.1102С>Т) в гене MYOC. Диагноз наследственной формы первичной открытоугольной глаукомы был подтвержден.

В заключение необходимо отметить, что в связи с интенсивным накоплением знаний об основных этиологических, патогенетических механизмах на молекулярно-генетическом уровне существенно расширяются возможности проведения дополнительных методов исследования, среди которых особенно актуальными становятся методы ДНК-диагностики. Поскольку они позволяют выяснить первопричину болезни, открытие патогенетических механизмов, которые в дальнейшем значительно облегчают терапию заболевания. Полученные в ходе данного исследования результаты позволяют оценивать вероятность развития первичной открытоугольной глаукомы у пациентов из семей с отягощенной наследственностью. Установление с помощью молекулярно-генетических методов наследственных форм первичной открытоугольной глаукомы позволяет правильно организовывать процесс лечения и реабилитации пациента, оптимизировать лекарственную терапию заболевания и значительно снизить экономические затраты на проведение повторных дорогостоящих диагностических процедур.

Таблица 1
Компоненты реакционной смеси
Деионизованная вода 6,4 мкл
Смесь для ПЦР 2,0 мкл
Taq-полимераза 0,2 мкл
Краситель EvaGreen® 0,4 мкл
Исследуемый образец (30 нг ДНК/мкл) 1,0 мкл
Суммарный объем 10 мкл

Способ выявления мутации p.Q368X (с.1102С>Т) в гене MYOC, сопровождающейся развитием наследственной формы первичной открытоугольной глаукомы, включающий выделение ДНК из лимфоцитов периферической крови методом фенольно-хлороформной экстракции, проведение полимеразной цепной реакции с возможностью проведения анализа флуоресценции по конечной точке, отличающийся тем, что амплифицируют участок гена MYOC в присутствии двух последовательностей олигонуклеотидов с красителем EvaGreen®:
Q368X - F, GTCCAGAACTGTCATAAGATA,
Q368X - R, CCAAGAATACGGGAACTG,
фланкирующих область с возможным содержанием мутации p.Q368X (c.1102С>Т) в гене MYOC.



 

Похожие патенты:

Изобретение относится к флуоресцентной иммуноцитохимической диагностике метастатического поражения лимфатических узлов. Сущность способа состоит в том, что для получения клеточной суспензии клеточный материал помещают в питательную среду накопления, состоящую из растворов: Хенкса, реоплиглюкина и альбумина, смешанных в равных количествах, хорошо перемешанную клеточную суспензию вносят по 100 мл на дно каждой пробирки с питательной средой, добавляют 5 мкл моноклонального антитела Ber ЕР4 FITC и перемешивают 5 с, после этого материал инкубируют 20 мин в холодильнике при t° 2-8 C, полученную взвесь клеток распределяют по 50-100 мкл в контейнеры центрифуги и центрифугируют при 1000 об/мин в течение 5 мин, полученные препараты окрашивают ядерным флюоресцентным красителем и осуществляют флуоресцентную микроскопию.

Изобретение относится к биохимии. Описан набор олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации генетического материала риккетсий методом ПЦР в реальном времени.

Изобретение относится к области биотехнологии, молекулярно-генетической диагностики и молекулярной биологии. Предложен набор, содержащий два олигодезоксирибонуклеотидных праймера и флуоресцентно-меченый ДНК-зонд.

Изобретение относится к области медицины, в частности к хирургии, и может быть использовано для прогнозирования эндогенной интоксикации у больных острым перитонитом.
Изобретение относится к области медицины, а именно к способу определения типа энтеровируса, явившегося причиной развития менингита у детей. В крови заболевших детей в период с 1 по 7-й день болезни определяют X- значение уровня лимфоцитов, на поверхности которых находятся СD3+IL4+ маркеры, рассчитывают значение Y по формуле 1,12+9,32*X.

Изобретение относится к медицине и предназначено для диагностики рака желудка. В сыворотке крови определяют концентрации фактора роста эндотелия сосудов, раково-эмбрионального антигена и пепсиногена-1.
Изобретение относится к медицине и представляет собой способ оценки эффективности процедуры радиочастотной симпатической денервации почечных артерий у пациентов с медикаментозно-резистентной артериальной гипертензией, характеризующийся тем, что пациенту в условиях стационара проводят измерение β-адренореактивности эритроцитарных мембран периферической крови до и через 7 дней после процедуры, и при снижении значения β-адренореактивности мембран на 10 условных единиц и более процедуру оценивают как эффективную.
Изобретение относится к медицине и представляет собой способ прогнозирования риска развития осложнений ХИЭ у индивидуумов русской национальности, уроженцев Центрального Черноземья РФ, отличающийся тем, что способ включает выделение ДНК из периферической венозной крови, анализ генетического полиморфизма лимфотоксина α(+250A/G Ltα) в сочетании с такими предикторами, как наличие очагов хронической инфекции и уровень лейкоцитов, прогноз риска развития осложнений по уравнениям линейной дискриминантной функции следующего вида: у1=-114,015+108,475x1+1,267x2+2,743x3 у2=-114,720+103,793x1+2,370x2+3,399x3, где x1 - наличие очагов хронической инфекции (да - 1; нет - 2), x2 - уровень лейкоцитов (1012/л), x3 - генетический вариант по локусу+250 A/G Ltα: AA - x3=1; AG - x3=2; GG - x3=3.

Изобретение относится к области медицины, а именно к способу прогнозирования вероятности риска возникновения преэклампсии у женщин русской национальности, являющихся уроженками Центрально-Черноземного региона России.

Изобретение относится к медицине и касается способа очистки гозерелина, включающего растворение гозерелина-сырца в водном растворе уксусной кислоты, фильтрование полученного раствора и последующую трехстадийную хроматографическую очистку: жидкостную хроматографию низкого давления на колонне с полистиролдивинилбензольным сорбентом, ионообменную хроматографию низкого давления и ВЭЖХ.

Изобретение относится к области биохимии, в частности к антителу или его функциональному фрагменту, которые способны связывается с cMet. Также раскрыты мышиная гибридома, способная секретировать указное антитело, нуклеиновая кислота, которая экспрессирует указанное антитело и набор для прогнозирования эффективности лечения онкогенного расстройства, включающий указанное антитело.

Изобретение относится к биохимии. Описан способ тестирования нуклеиновых кислот на подложке, включающий иммобилизацию одной или нескольких нуклеиновых кислот посредством сшивания, где каждая из иммобилизованных нуклеиновых кислот содержит участок нуклеотидов с одним видом оснований, получение меченых олигонуклеотидов, комплементарных указанному участку нуклеотидов, и определение показателя, отражающего состояние указанных нуклеиновых кислот.

Изобретение относится к области биохимии. Заявлен набор дифференцирующих олигонуклеотидов для анализа полиморфизма в генах АВ0, HLA-DQA1, AMEL, DARC, NAT2 с помощью технологии гидрогелевых ДНК-микрочипов (биочипов).

Настоящее изобретение относится к аналитической биоорганической химии. Предложенные флуоресцентно-меченные дезоксирибонуклеозидтрифосфаты и рибонуклеозидтрифосфаты имеют общую формулу H-Л-Ф, где Н - модифицированный по конечному атому фосфора природный дезоксирибонуклеозидтрифосфат или рибонуклеозидтрифосфат, Л - линкерная группа, присоединенная к конечному атому фосфора и построенная на основе вторичных диаминов, Ф - репортерная флуоресцентная группа, присоединенная к линкеру посредством вторичной аминогруппы.

Изобретение относится к биохимии. Описан набор олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации генетического материала риккетсий методом ПЦР в реальном времени.

Изобретение относится к области биотехнологии, молекулярно-генетической диагностики и молекулярной биологии. Предложен набор, содержащий два олигодезоксирибонуклеотидных праймера и флуоресцентно-меченый ДНК-зонд.

Изобретение относится к области токсикологии и может быть использовано для определения в образцах жидкости или растений токсичных веществ, а именно рибосом-инактивирующих белков II типа.

Изобретение относится к биотехнологии, конкретно к стоматологии и медицинской генетике, и может быть использовано для прогнозирования злокачественной трансформации эрозивно-язвенной формы красного плоского лишая (КПЛ) слизистой оболочки полости рта (СОПР).

Изобретение относится к области биотехнологии, а именно к тест-системе для обнаружения экспрессии гена NAT2 у человека. Данная тест-система включает смесь праймеров, комплементарных концам разных цепей требуемого фрагмента ДНК-матрицы для ПЦР, эндонуклеазу рестрикции с буфером и технологическую смесь для ПЦР с Taq-полимеразой.

Группа изобретений относится к области генной инженерии, в целом к трансгенным конструкциям, трансгенным животным, отличным от человека, способам количественного анализа активации GPCR лигандов неинвазивно в интактных животных, тканевых срезах или в нативных клетках, используя трансгенную модель, содержащую систему биолюминесцентного трансгена-репортера, которая является чувствительной к модуляции путей после связывания лиганда с рецепторами GPCR.

Изобретение относится к области биотехнологии, молекулярной биологиии. Представлен набор олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации ДНК возбудителей кокцидиоидомикоза С. immitis и С. posadasii методом полимеразной цепной реакции с гибридизационно-флуоресцентной детекцией результатов, содержащего пару олигонуклеотидов, обладающих активностью прямого и обратного праймеров, и зонд с комплементарными концевыми последовательностями по типу «молекулярного маяка», имеющих следующую структуру: Использование разработанного набора олигонуклеотидных праймеров CimMBP3s/CimMBP4as и флуоресцентно-меченого зонда Pf-MBP-1 позволяет в короткий срок с высокой чувствительностью и специфичностью проводить идентификацию ДНК возбудителей кокцидиоидомикоза С. immitis и С. posadasii в пробах чистых культур, биологическом материале и объектах окружающей среды. 1 ил., 1 табл., 3 пр.
Наверх