Способ неинвазивной пренатальной диагностики анеуплоидий плода



Способ неинвазивной пренатальной диагностики анеуплоидий плода
Способ неинвазивной пренатальной диагностики анеуплоидий плода

 

C40B50/00 -
C40B50/00 -

Владельцы патента RU 2583830:

Закрытое акционерное общество "Геноаналитика" (RU)

Предложенная группа изобретений относится к области медицины. Предложен способ неинвазивной пренатальной диагностики анеуплоидий плода, включающий выделение внеклеточной ДНК из образца крови беременной женщины, приготовление геномных библиотек и их обогащение регионами генома, секвенирование, картирование полученных чтений на референсный геном, корректировку полученного значения покрытия для каждого региона генома на общее покрытие генома, сравнение скорректированного значения покрытия со значениями покрытий, полученных для обучающей выборки и определение наличия анеуплоидий плода. Предложен также способ получения регионов генома, характеризующихся открытостью хроматина между плацентой и клетками крови матери, отличающейся не менее чем на 20%. Предложенная группа изобретений обеспечивает получение более простого и экономичного способа пренатальной диагностики анеуплоидий плода на ранних сроках беременности. 2 н. и 6 з.п. ф-лы, 2 ил., 6 пр.

 

Область техники, к которой относится изобретение

Изобретение относится к области медицины, а именно, неинвазивной пренатальной диагностике анеуплоидий плода по внеклеточной ДНК крови матери, и может быть использовано для определения генетических аномалий плода (анеуплоидий, в т.ч. моносомий и трисомий) на первом триместре беременности безопасными как для ребенка, так и для матери неинвазивными методами.

Анеуплоидия является следствием изменений кариотипа, при котором число хромосом в клетках плода не кратно гаплоидному набору (в отличие от нормального состояния кариотипа, эуплоидии, при котором число хромосом равно двум гаплоидным наборам). Примерами анеуплоидий, которая может быть выявлена с использованием заявленного способа, являются моносомия и трисомия, а также частичная трисомия или частичная моносомия (соответственно, приобретение дополнительных копий или делеция крупных участков хромосом, как правило, одного из хромосомных плеч). Частными примерами являются трисомия по 21-й хромосоме (синдром Дауна), трисомия по 13-й хромосоме (синдром Патау), трисомия по 18-й хромосоме (синдром Эдвардса), моносомия по Х-хромосоме (синдром Шерешевского-Тернера) или наличие более чем двух половых хромосом, например, синдром Клайнфельтера (XXY), и т.д. Перечень связанных с анеуплоидиями заболеваний, которые могут быть диагностированы заявленным способом, не ограничен каким-либо специальным образом.

Уровень техники

Из уровня техники известен способ диагностики геномных аномалий плода, в частности способ диагностики наиболее распространенных анеуплоидий с помощью стандартных инвазивных (например, кариотипирования хорионной жидкости или образца плаценты) и неинвазивных методов (биохимия крови, УЗИ).

Однако стандартные неинвазивные технологии обладают недостаточно точностью и позволяют только сформировать группу риска беременных женщин, а инвазивные методы в небольшом проценте случаев (по разным источникам от 0,5 до 2% в зависимости от опыта врачей) могут привести к выкидышу или инфицированию плода.

Из уровня техники известен также способ неинвазивной пренатальной диагностики анеуплоидий плода по внеклеточной ДНК плода в крови матери методом полногеномного секвенирования всех последовательностей вкДНК крови матери (DanS, WangW, RenJ, Clinical application of massively parallel sequencing-based prenatal noninvasive fetal trisomy test for trisomies 21 and 18 in 11 105 pregnancies with mixed risk factors // Prenat Diagn, 2012; Yuan Yuan, Fuman Jiang, Sang Hua, Feasibility Study of Semiconductor Sequencing for Noninvasive Prenatal Feasibility Study of Semiconductor Sequencing for Noninvasive Prenatal Detection of Fetal Aneuploidy // Clinical Chemistry 59:5, 2013). Этот подход основан на секвенировании всей фракции вкДНК плазмы крови матери и подсчете количества чтений, картируемых на геном. Используя массовое параллельное секвенирование коротких чтений можно получать за один запуск прибора миллионы чтений вкДНК плазмы крови матери, которая состоит из вкДНК матери в сумме с вкДНК плода. Так как полная последовательность генома известна, каждый прочитанный фрагмент можно картировать на референсный геном и выяснить какой хромосоме он принадлежит.При наличии анеуплоидий той или иной хромосомы при подсчете количества чтений, принадлежащих этой хромосоме, будет статистически достоверно увеличено. Увеличение количества чтений при таком подходе будет невелико. Например, при условии наличия трисомии по 21 хромосоме и процентном содержании фракции фетальной ДНК 20%, сравнительное увеличение количества чтений 21 хромосомы будет (0.8×2)+(0.2×3)=2.2 в сравнении с количеством чтений в норме (0.8×2)+(0-2×2)=2 - то есть сравнительное увеличений количества чтений составит 10%.

Именно из-за необходимости детектировать очень небольшое увеличение чтений для достоверного определения трисомии необходимо секвенировать большое количество последовательностей вкДНК (10-12 млн. последовательностей). Получение такого большого количества данных требует дорогостоящего параллельного геномного секвенирования с использованием секвенаторов следующего поколения, что не позволяет внедрить данную технологию в повседневную практику. Поэтому разработка новых подходов, позволяющих снизить стоимость проведения тестирования при сохранении достоверности получаемого результата, критически необходима.

Из уровня техники известен способ диагностики анеуплоидий плода методом полногеномного секвенирования (Патент US 8318430). Данный способ предполагает определение трисомии в результате секвенирования предопределенных последовательностей всего генома. Этот метод учитывает неравномерность секвенирования, связанную с GC-составом читаемой ДНК; таковая зависимость обычно является нелинейной и варьируется не только между разными технологиями секвенирования, но также между разными приборами одной серии и версиями используемых реактивов. А так же, вместо единой кумулятивной метрики по целой хромосоме используется разбиение генома на множество коротких участков (окон), и подсчета количества чтений, приходящихся на каждое такое окно, в результате чего определение анеуплоидии производится посредством сравнения двух выборок: окон с исследуемой хромосомы и окон со всех остальных хромосом.

Однако данный способ также основан на необходимости получения большого количества чтений, что увеличивает время проведения теста.

Наиболее близким к заявляемому является способ диагностики анеуплоидии плода по вкДНК плода в крови матери с использованием диференциального метилирования ДНК матери и плода (Заявка на изобретение RU 2012119187). Данная технология позволяет сократить время проведения анализа за счет выборочного секвенирования только тех фрагментов генома, которые дифференциально метилированы у плода и у матери. Для этого проводят амплификацию специально отобранных дифференциально метилированных регионов (ДМР), после чего проводят бисульфитную конвертацию полученных фрагментов ДНК и определяют последовательность конвертированных фрагментов. Благодаря бисульфитной конвертации возможно точно отделить чтения плода от чтений матери и достоверно определить наличие трисомии с гораздо меньшим, по сравнению с полногеномным методом, набором данных.

Однако профиль метилирования обладает индивидуальными особенностями у каждого человека, что может приводить к снижению точности тестирования и увеличивать минимальное необходимое количество данных, а значит и стоимость теста. Поэтому важной задачей является поиск нового селективного подхода, основанного на отличиях последовательности ДНК матери и плода.

В настоящем изобретении предлагается новый подход к определению анеуплоидии плода с помощью секвенирования целевых участков генома (как и в последнем упомянутом подходе), однако основанный на отличии открытости хроматина между клетками крови матери и плаценты плода.

Раскрытие изобретения

Задачей изобретения является создание нового способа пренатальной диагностики анеуплоидий по вкДНК плода в крови матери.

Ввиду тяжести заболеваний, связанных с анеуплоидией, постановка соответствующего диагноза может являться основанием для проведения аборта, в связи с чем, имеет большое значение скорость проведения такой диагностики, точность постановки результата и возможность проведения исследований в более ранние сроки беременности неинвазивными методами, безопасными как для ребенка, так и для матери.

Техническим результатом является получение более простого и экономичного способа пренатальной диагностики анеуплоидий плода с получением надежного результата при сохранении высокой, сопоставимой с описанными выше подходами, точности определения анеуплоидией на ранних этапах беременности.

Поставленная задача решается тем, что способ неинвазивной пренатальной диагностики анеуплоидий плода включает следующие этапы:

a. выделение внеклеточной ДНК из образца крови, полученного у беременной женщины;

b. приготовление геномных библиотек с использованием выделенной на стадии а) внеклеточной ДНК;

c. обогащение геномных библиотек фрагментами ДНК из набора регионов генома, характеризующихся открытостью хроматина между плацентой и клетками крови матери, отличающейся не менее чем на 20%

d. определение последовательности нуклеотидов (секвенирование) полученных геномных библиотек;

e. картирование полученных чтений на референсный геном или части генома - человека для определения их координат;

f. определение значения покрытия для каждого региона генома из набора;

g. корректировку полученного значения покрытия для каждого региона генома из набора на общее покрытие генома, с последующим сравнением скорректированного значения покрытия со значениями покрытий или их распределений, полученных для обучающей выборки образцов крови беременных женщин при эуплоидии и анеуплоидий плода и определение принадлежности исследуемого образца к одной из данных групп, по которому делают вывод о наличии анеуплоидий плода.

Выбор регионов генома для обогащения геномных библиотек осуществляют из базы данных покрытий кандидатных регионов генома для образцов крови беременных женщин с эуплоидией и анеуплоидией при этом, вычисляют значимость отличия покрытия между образцами с эу- и анеуплоидией для каждого кандидатного региона, характеризующуюся значением p-value с учетом корректировки на общее покрытие образца, и выбирают из кандидатных регионов генома те регионы, которые характеризуются значением p-value не более 0,1, из которых составляют набор регионов генома для определения анеуплоидий плода.

При этом определение принадлежности образца к группе с эуплоидией или анеуплоидией плода осуществляют следующим образом:

a. для каждого региона из набора вычисляют p-value, которое определяет вероятность наблюдать полученное значение покрытия или более экстремальное значение при условии, что данное значение соответствует распределению покрытий для беременности без анеуплоидий, и p-value того, что его покрытие получено из распределения покрытий для беременности с анеуплоидией по данной хромосоме по БД покрытий кандидатных регионов генома для образцов крови беременных женщин с эуплоидией и анеуплоидией;

b. вычисляют произведение по всем регионам полученных значений p-value для вычисления p-value того, что значения покрытия набора регионов получены из распределения покрытий для беременности без анеуплоидий, и p-value того, что значения покрытия набора регионов получены из распределения покрытий для беременности с анеуплоидией по данной хромосоме.

c. по полученным произведениям p-value и априорным вероятностям наличия анеуплоидий у плода (риск по популяции) вычисляют по теореме Байеса вероятности наличия анеуплоидий или эуплоидии в исследуемом образце.

Вывод о наличии или отсутствии анеуплоидий плода делают, если вероятность для одного из вариантов диагноза не превышает порог значимости из интервала 0.01-0.1, а вероятность для другого варианта превышает порог значимости, при этом диагноз ставится по наибольшему значению вероятности, и в случае, если оба p-value выше или оба ниже порога значимости, диагноз не ставится.

К образцу крови, полученному у беременной женщины, непосредственно перед стадией выделения вкДНК может быть добавлена молекулярная метка. Молекулярная метка представляет собой молекулу нуклеиновой кислоты, предпочтительно ДНК, имеющую степень гомологии с известными природными либо технологическими последовательностями ДНК не более 5%, при этом длина молекулярной метки составляет 30-400 нуклеотидов.

Поставленная задача решается также тем, что набор регионов генома для определения анеуплоидии плода методом секвенирования включает записанные на машиночитаемый носитель не менее 10 регионов генома с указанием геномных координат каждого региона, для которых открытость хроматина между плацентой и клетками крови матери отличается не менее чем на 20%. Для входящих в набор регионов генома значимо (p-value<0.1) отличается покрытие между образцами с плодом без анеуплоидии и образцами с анеуплоидией плода по конкретной хромосоме, с учетом корректировки на общее покрытие образца.

Поставленная задача решается также тем, что способ получения набора регионов генома для неинвазивной пренатальной диагностики анеуплоидии плода по вкДНК крови матери методом секвенирования включает следующие этапы:

a. получение данных секвенирования (полногеномного или таргетного) вкДНК крови матери, такого, что бы все кандидатные регионы генома, характеризующиеся открытостью хроматина между плацентой и клетками крови матери и отличающиеся не менее чем на 20%, были прочитаны для образцов крови нескольких беременных женщин без анеуплоидии плода (не менее 5 образцов) и нескольких беременных женщин с анеуплоидией плода по конкретной хромосоме (не менее 5 образцов на каждую анеуплоидию);

b. картирование полученных чтений на референсный геном человека для определения их координат (номера хромосомы и позиции на ней);

c. определение покрытия каждого кандидатного региона каждого полученного образца;

d. вычисление для каждого региона значимости отличия (характеризующейся значением p-value) покрытия между образцами с плодом без анеуплоидии и образцами с анеуплоидией плода по конкретной хромосоме, с учетом корректировки на общее покрытие образца.

e. выбор из кандидатных регионов генома регионов, характеризующихся значением p-value не более 0,1, из которых составляют набор регионов генома для определения анеуплоидии плода.

Этап d осуществляют в предположении отрицательного биномиального распределения покрытия региона в образце, например, с использованием программного обеспечения для определения дифференциальной экспрессии РНК DESeq.

Для регионов, найденных в пункте d, аналогично пунктам b-е может быть вычислено покрытие прочтениями в образцах крови не менее 5 мужчин и для каждого региона определяют значимость, выражающуюся в виде p-value отличий между покрытием ДНК в образцах мужчин и беременных женщин с плодом без анеуплоидий, отбирают участки с p-value не более 0.1.

Упрощение заявляемого способа по сравнению со способом, представленным в материалах заявки на изобретение RU 2012119187, достигается за счет исключения из процесса пробоподготовки стадии бисульфитной конвертации библиотек. Стадия бисульфитной конвертации геномных библиотек необходима для определения статуса метилирования выбранных для анализа регионов геномной ДНК. На основании отличия статуса метилирования последовательностей материнской вкДНК и вкДНК плода происходит разделение чтений матери и ребенка. Возможность разделить чтения матери и ребенка позволяет получить достоверный результат, секвенируя только небольшую часть генома, однако проведение дополнительных манипуляций с исходным материалом вкДНК может вносить погрешность в систему определения анеуплоидий с использованием отличия статуса метилирования, а так же требует дополнительных затрат времени и реактивов, что требует поиска возможности разделять чтения матери и ребенка без проведения дополнительных манипуляций с исходным материалом.

Предлагаемый способ позволяет делать заключение о наличие трисомии, основываясь на дифференциальной доступности хроматина, а не на статусе метилирования отдельных регионов генома. Доступность хроматина влияет на эффективность работы ДНКаз - ферментов, приводящих к расщеплению последовательности ДНК. Степень доступности хроматина зависит от многих факторов, в том числе доступность хроматина выше для регионов генома, в которых находятся активные промотеры работающих генов, а так же для регионов генома, свободных от нуклеосом. Для клеток крови матери и плода, координаты регионов, характеризующиеся повышенной доступностью хроматина, будут отличаться за счет, например того, что в клетках крови взрослого человека и клетках плаценты (как было показано ранее именно плацента является основным источником вкДНК плода в крове матери) активно экспрессируется разный набор генов. При определении нуклеотидной последовательности регионов генома, которые характеризуются высокой степенью доступности хроматина (высокая степень доступности хроматина предполагает, что покрытие данного региона генома не менее чем на 20% выше среднего) для матери и низкой для плода (низкая степень доступности хроматина предполагает, что покрытие данного региона генома не менее чем на 20% ниже среднего) и подсчете количества чтений, относящихся к этим регионам можно ожидать, что все чтения будут относиться именно к вкДНК плода. Соответственно при наличии анеуплоидий будет наблюдаться изменение представленности чтений в этом регионе. Так как эти чтения относятся строго к вкДНК плода, процент изменения количества чтений будет выше, чем процент увеличения общего количества чтений (матери и плода) при определении трисомии полногеномным методом.

Таким образом, заявляемый способ дает возможность разделять чтения матери и ребенка без проведения дополнительных манипуляций с исходным материалом вкДНК, что повышает степень надежности получаемых данных.

Краткое описание чертежей

Изобретение поясняется чертежами. На фиг. 1 представлена краткая схема проведения теста на определение трисомии, основанного на дифференциальной доступности хроматина. На фиг. 2 - представлен график, изображающий усредненное покрытие генома в окрестностях сайтов гиперчувствительности к ДНКазе чтениями, полученными при секвенировании образца свободно циркулирующей в крови ДНК. Заметно снижение покрытия в окрестностях сайтов гиперчувствительности к ДНКазе. По оси x отложены позиции в геноме относительно сайта гиперчувствительности. Средняя часть графика - непосредственно сайт, левая и правая - его окрестности, где каждая точка соответствует отрезку длиной в 10 нуклеотидов. По оси у обозначено суммарное покрытие участка по всем анализируемым образцам, усредненное по всем участкам гиперчувствительности к ДНКазе.

Осуществление изобретения

Способ пренатальной диагностики анеуплоидий по вкДНК плода в крови матери включает исследование сыворотки крови матери. Для исследования кровь забирают в вакуумную пробирку, центрифугируют для отделения плазмы от клеточной массы. Из плазмы крови выделяют вкДНК на колонках и делают геномные библиотеки, после чего проводят обогащение библиотек фрагментами, относящимися к выбранным ранее регионам генома. Далее определяют нуклеотидную последовательность фрагментов геномной библиотеки, которая заключается в цифровом анализе внеклеточной ДНК посредством секвенирования. В основу способа легла методика массового параллельного полногеномного секвенирования, которая позволяет получать до миллиарда коротких чтений за счет случайной фрагментации и последующей амплификации геномной ДНК. Полученные короткие чтения последовательностей ДНК подвергаются статистическому анализу (который может быть реализован программным путем).

Ниже каждый этап заявляемого способа представлен более детально.

Забор крови

Материалом для исследований служит венозная кровь беременной женщины, что позволяет исключить риск инфекции плода или выкидыша, который присутствует при проведении теста стандартными инвазивными методиками, такими, как биопсия хориона или амниоцентез. Переферическую кровь матери собирают, например, в две 9 мл пробирки, содержащие ЭДТА для предотвращения коагуляции. После забора крови содержимое пробирок перемешивают (переворачиванием пробирки вверх - вниз 10 раз). Далее пробирки незамедлительно перевозят в лабораторию для заготовки плазмы. Перезвозка пробирок должна проходить при +4 C° для предотвращения разрушения клеток крови матери и увеличения фракции геномной ДНК матери, содержащейся во вкДНК плазмы крови. Заготовка плазмы должна проводиться не позже чем через 4 часа после забора крови (это необходимо для предотвращения обогащения фракции вкДНК геномной ДНК матери из разрушающихся клеток крови матери).

Заготовка плазмы

Заготовка плазмы может быть реализована известным способом. В частности, для заготовки плазмы необходимо провести первое центрифугирование 9 мл пробирок 1.600g, 10 минут, при +4°C для отделения фракции плазмы богатой клетками. После проведения центрифугирования верхнюю фазу (верхнюю часть) переносят в несколько охлажденных во льду пробирок на 2 мл., не затрагивая интерфазу - в ней могут находятся клетки крови матери. Пробирки подписывают в соответствии с маркировкой первоначального образца. Далее проводят второе центрифугирование 2 мл пробирок при 16.000g, 10 минут, при +4°C для отделения оставшихся в плазме фрагментов клеток. Супернатант переносят в охлажденные 2 мл LoBind пробирки (DNA LoBind Tube 2,0 ml (Eppendorf AG, Cat. no.: 022431048)). Супернатант необходимо отбирать аккуратно, не задевая небольшой осадок клеток. Пробирки подписывают в соответствии с маркировкой первоначального образца.

Добавление молекулярной метки

Согласно настоящему изобретению, к образцу, полученному у беременной женщины, непосредственно перед стадией выделения вкДНК может быть добавлена молекулярная метка. Добавление молекулярной метки позволяет однозначно идентифицировать образец после проведения анализа и обеспечить контроль отсутствия смешения, контаминации или подмены образцов.

Согласно частному варианту реализации настоящего изобретения молекулярная метка может представлять собой молекулу нуклеиновой кислоты, предпочтительно ДНК, имеющую степень гомологии с любыми известными природными либо технологическими последовательностями ДНК не более 5% (включая остальные используемые молекулярные метки). При этом предпочтительно, чтобы молекулярная метка была сходна по размеру с вкДНК и/или могла быть выделена способом, предназначенным для выделения вкДНК. В частности, предпочтительно, чтобы длина молекулярной метки составляла 30-400 нуклеотидов.

Выделение свободно циркулирующей ДНК из крови.

Выделение вкДНК из плазмы проводят согласно стандартному протоколу QIAamp Circulating Nucleic Acid Kit (Catalog no. 55114).

Модификация протокола приготовления геномных библиотек - обогащение образца фрагментами ДНК выбранных регионов генома.

Регион генома - часть последовательности ДНК или фрагмент молекулы ДНК, принадлежащей конкретному месту в геноме (место задается геномными координатами, например обозначение chr21 32925263 32925495 обозначает, что часть молекулы ДНК расположена в геноме на 21 хромосоме, начинается с 32925263 нуклеотида и заканчивается на 32925495 нуклеотиде).

Изменение метода биоинформатической обработки данных позволяет получать надежный результат, получая данные только о небольшом участке генома - выбранных заранее регионов генома, что существенно сокращает время, необходимое для проведения теста (с 1 -2 недель до 3 дней). Для секвенирования отдельных участков генома в процесс приготовления геномных библиотек внесены соответствующие изменения.

Геномная библиотека - приготовленный особым образом образец ДНК, доступный для чтения на секвенаторе. Стандартная процедура приготовления геномных библиотек включает в себя следующие операции с молекулами ДНК: фрагментацию, достройку концов, лигирование адаптеров, отбор по длине и ПЦР-амплификацию.

Согласно настоящему изобретению, в данную процедуру добавлен дополнительный этап обогащения библиотеки, который проводят после стандартного этапа ПЦР-амплификации. Дополнительный этап обогащения библиотеки позволяет увеличить процент целевых регионов генома, выбранных для анализа среди остальных регионов генома, представленных в приготовленной геномной библиотеке. При стандартной методике приготовления геномных библиотек все регионы генома равно представлены в геномной библиотеке. После проведения этапа обогащения библиотеки 60-70% фрагментов ДНК, входящих в геномную библиотеку относятся к небольшому количеству регионов генома, занимающих, например, около 1,5-2% генома. То есть после этапа обогащения библиотеки представленность интересующих нас регионов среди всех фрагментов ДНК в библиотеки возрастает в среднем в 40-70 раз. Для обогащения библиотеки используют стандартные протоколы обогащения геномных библиотек, например, TargetSeq Custom Enrichment (Cat.No: A138230, A14177, A14178, A14227) или Nextera XT DNA (cat. ID: FC-131-1024), Nextera Custom Enrichment Kit (Cat.numb. FC-121-0200).

Секвенирование

Далее полученные геномные библиотеки подвергают секвенированию. Секвенирование проводят на секвенаторах нового поколения, которые дают возможность определять нуклеотидную последовательность большого количества (от сотен до сотен миллионов) чтений за 1 запуск прибора, согласно стандартному протоколу. Частными примерами технологий (приборов), которые могут быть использованы, являются: секвенирование синтезом на молекулярных колониях (Genome Analyzer, HiSeq, MiSeq (Illumina)), лигазное секвенирование с использованием эмульсионного ПЦР (SOLiD4, 5500-series (Life Technologies)), полупроводниковое секвенирование (Ion Torrent, Ion Proton (Life Technologies)), пиросеквенирование (454 (Roche)) и т.д. Заявляемый способ не ограничивается перечисленными технологиями (приборами) секвенирования. Результатом секвенирования геномных библиотек является получения нуклеотидной последовательности всех фрагментов, составляющих секвенируемую геномную библиотеку.

Нуклеотидная последовательность каждого фрагмента геномной библиотеки, определенная с помощью секвенирования называется чтением или ридом.

Для всех полученных чтений определяются их координаты в геноме. Этот процесс называется картированием и выполняется с использованием стандартного программного обеспечения (например, можно использовать программу BWA, Bowtie). Чтение с определенными геномными координатами называется картированным чтением.

Определение покрытия регионов генома

Среди картированных чтений выбираются те, которые пересекаются с исследуемыми регионами генома, то есть имеющие такие координаты по референсному геному, которые перекрываются с координатами исследуемых регионов. Для каждой позиции внутри региона (каждая позиция чтения - каждый следующий нуклеотид чтения) вычисляется ее покрытие - количество прочтений, приходящихся на данную позицию. Затем по всем позициям каждого региона вычисляется среднее значение покрытия. Среднее покрытие нормируется на суммарное количество картированных чтений в образце.

Выбор регионов генома

Предварительно, до этапа обогащения геномных библиотек необходимо провести выбор регионов генома, которые будут использованы для определения анеуплоидий с помощью описываемого метода. Сначала выбирают регионы генома, соответствующие описанным ниже критериям, после чего не менее 10 регионов генома, выбранных случайно из полученного списка регионов генома, формируют набор регионов генома, использующийся для последующего анализа.

При выборе регионов генома, вычисляют распределения значений их покрытия в образцах с нормальной беременностью и с анеуплоидией плода из обучающей выборки. Полученные значение покрытия регионов генома в образцах с нормальной беременностью и с анеуплоидией плода формируют базу данных покрытий кандидатных регионов генома для образцов крови беременных женщин с эуплоидией и анеуплоидией.

После формирования базы данных покрытий кандидатных регионов генома для образцов крови беременных женщин с эуплоидией и анеуплоидией, выбирают регионы генома, которые имеют значимо разную открытость хроматина между плацентой и в другими тканями. В качестве меры открытости хроматина рассматривают данные о покрытии регионов генома прочтениями после обработки ДНКазой (фермент, который разрезает преимущественно открытую ДНК, не связанную с нуклеосомами), опубликованные в проекте ENCODE (https://genome.ucsc.edu/ENCODE/downloads.html). В проекте ENCODE также опубликованы пики, которые детектируется как пик в покрытии ридами после обработки ДНКазами в образцах плаценты и не детектируется в образцах клеток крови.

После нахождения регионов генома на хромосоме 21, являющиеся участками гиперчувствительности в крови, но не являющиеся участками гиперчувствительности в плаценте, формируют набор регионов генома, в который могут входить разное подмножество регионов генома (не менее 10 регионов генома). Для поиска наилучшего подмножества участков используют полногеномный сиквенсы свободно циркулирующей ДНК для образцов трисомии плода по хромосоме 21 и с нормальной беременностью. Для каждого кандидатного региона вычисляют его покрытие прочтениями в каждом образце. При помощи пакета DESeq, обычно используемого для анализа дифференциальной экспрессии генов, для каждого кандидатного региона определяют p-value того, что существует значимое отличие в покрытии отрезка между образцами с трисомией плода и эуплоидией плода. Выбирают участки с наибольшим отличием между образцами с трисомией плода и с нормальной беременностью, таких, что покрытие при трисомии превышает покрытие при нормальной беременности.

Для каждого из участков в каждом образце сохраняют значения его покрытия прочтениями, нормированные на покрытие всего образца в образцах с нормальной беременностью и трисомией плода. Такие участки генома затем используют для построения пренатального теста, при этом сохраненные значения покрытия используют для статистического анализа. Выбирались регионы генома, которые имеют значимо разную открытость хроматина между плацентой и в другими тканями. Рассматривались полногеномные данные ENCODE о гиперчувствительности локусов ДНК к ферменту ДНКазе, которая разрезает преимущественно открытую ДНК, не связанную с нуклеосомами. В качестве меры открытости хроматина рассматривалось покрытие участка генома прочтениями после обработки ДНКазой, опубликованные в проекте ENCODE (https://genome.ucsc.edu/ENCODE/downloads.html).

При анализе геномных последовательностей (чтений) образца крови беременной женщины построенные предварительно распределения используют для определения того, насколько вероятно в образце наличие анэуплоидии или эуплоидии. Для каждого региона генома используют собственные распределения покрытия в обучающей выборке, по которым вычисляют p-value двух нулевых гипотез: «покрытие в данном участке соответствует анэуплоидии» и «покрытие в данном участке соответствует эуплоидии». Р-value вычисляют стандартным образом как вероятность наблюдать более экстремальное (сильнее смещенное от среднего значения) значение относительного покрытия в соответствии с используемым распределением. Полученные P-value для каждого участка хромосомы, тестируемой на анеуплоидию, перемножают отдельно для одной и другой нулевой гипотезы. Таким образом, вычисляют условные вероятности наблюдать полученные значения покрытия при анеуплоидии плода по данной хромосоме и при эуплоидии: P(X\aneuploidy), P(X\euploidy), где X обозначает наблюдаемые в данном образце значения покрытия.

Вероятности наличия анеуплоидий и эуплоидии при условии полученных наблюдений могут быть вычислены по теореме Байеса следующим образом:

P(aneuploidy) - априорная вероятность наличия трисомии у плода, оценивается как вероятность трисомии по исследуемой хромосоме в популяции с учетом возраста матери (например, 2∗10-3). Используется несколько завышенное значение вероятности анеуплоидий для минимизации риска постановки ложноотрицательного (false negative - то есть не определение трисомии в случае беременности с трисомией) диагноза.

Полученные вероятности P(aneuploidy|X) и P(euploidy|X), в отличие от статистических метрик, используемых в других методиках определения трисомии, позволяют производить постановку диагноза без предварительного поиска оптимальных порогов на значение какой-либо метрики. Для постановки одного из диагнозов достаточно, чтобы одна из вероятностей была бы меньше порога значимости (например, 0.05), а другая - больше, тогда отвергается альтернатива с низкой вероятностью и принимается - с высокой. В случае, если ни одна из альтернатив не отвергается и обе вероятности выше порога, метод определяет невозможность постановки диагноза (no call).

Такая особенность также является преимуществом метода по сравнению с аналогами, так как позволяет отказаться от постановки диагноза в случае невозможности сделать это надежно вместо постановки малодостоверного диагноза.

Примеры осуществление изобретения

Пример №1. Сбор материала

У женщины, проходящей пренатальную генетическую диагностику на 11-й неделе беременности, была собрана кровь в пробирки с ЭДТА, объемом 9 мл. Кровь хранили не более трех часов при +4°C. Не позднее, чем через три часа после флеботомии пробирки с кровью центрифугировали в течение 10 мин. при 2000g при +4°C для получения плазмы, богатой тромбоцитами. Далее плазму повторно центрифугировали в течение 15 мин. при 16000g при +4°C для получения плазмы, свободной от целых клеток крови. Внеклеточную ДНК получали из очищенной плазмы крови с помощью набора реактивов QIAamp Circulating Nucleic Acid Kit (Qiagen), руководствуясь инструкцией к набору. Концентрацию полученной вкДНК определяли с помощью флюориметра Qubit 2.0 (Life Technologies).

Пример №2. Приготовление геномной библиотеки и секвенирование

Для приготовления библиотеки взяли 20 нг вкДНК, выделенной из плазмы крови. Приготовление библиотеки проводили с помощью наборов реактивов, совместимых с платформой Illumina: NEBNext DNA library prep reagent set for Illumina и NEBNext multiplex oligos for Illumina (North England Biolabs), руководствуясь инструкциями к набору. Процедура приготовления библиотеки включала в себя достройку и затупление концов вкДНК, лигирование адаптеров (в течение 10 часов) и ПЦР-амплификацию (15 циклов). Концентрацию полученной библиотеки проверяли с помощью флюориметра Qubit 2.0 (Life Technologies), она составила 13,5 нг/мкл. Определение размера и качества приготовления библиотеки проводили с помощью прибора Bioanalyzer 2100 (Agilent), длина составила 290±30 п.н.

Обогащение библиотеки проводили с помощью стандартного набора (Nextera Custom Enrichment Kit), руководствуясь инструкциями к набору. Список регионов, выбранных для обогащения представлен ниже:

Участки 21 хромосомы

chr21 32925263 32925495

chr21 47714750 47715253

chr21 40233983 40234258

chr21 46172865 46173043

chr21 46346149 46348601

chr21 44103334 44103575

chr21 15588264 15588629

Контрольные участки

chr17 4915144 4915761

chr13 111956423 111957048

chr11 117480617 117481261

chr14 70938942 70939356

chr7 127748642 127749527

chr9 127614649 127616112

chr3 32180102 32180284

Процедура обогащения библиотеки выбранными ранее регионами генома включала в себя стадии гибридизации олигов, содержащих биотиновую метку с фрагментами геномной библиотеки, стадию отмывки полученного образца от фрагментов геномной библиотеки, относящихся к регионам генома, не принимающим участие в обсчете.

Полученную библиотеку подвергали геномному секвенированию на приборе HiSeq 1500 (Illumina) с использованием проточной ячейки HiSeq Rapid SR (Illumina). В результате были получены чтения секвенированной библиотеки в формате ∗.fasta.

Пример №3. Добавление молекулярной метки и ее определение в данных секвенирования

В качестве молекулярных меток использовали искусственно синтезированные нуклеотидные последовательности:

Метка А:

CGTACATATTAGATCGACCTTAAGCCTAAAAGGTTTATCATCGTTTTAAGAACGGCTGTAAACGTCTTTCTTCGTATACAGAACATCAAGTTTCATATCCGTGTGTCATAACCACTGCATTTACTTGAGTAGAACCAAGGATTGCCACCGGAAATCTATGTGGAAATGGTCCCGACTTGCCCTCTTTCT

(можно в сокращенном варианте)

Метка Б:

GCAGTTTGTGCCCAATAACTCGCGAGGTTTTTCTTTGTGTAATGGAGAGTAAAGCCCCAGAACGCTGTGCCTGATCTAATAGTTGCGTCAGTACCTAAATAATAATGAAGTGCGATTAAAATGGTTAGGAGTGAGGTTGCATTGAGCTCATTAATTGTAAACCCCAGAGAATCCTATCCCGACAGAG

Два образца вкДНК, №1 и №2, были смешаны с молекулярными метками А и Б, соответственно, в пропорции 10 пг молекулярной метки на 20 нг вкДНК. Из обоих образцов вкДНК приготовили геномные библиотеки, которые поместили в две одинаковые неименованные пробирки и впоследствии секвенировали по отдельности. В результате проведения полногеномного секвенирования двух анонимных образцов было получено 5128319 и 7472622 чтений. Чтения каждого образца картировались с помощью программы bowtie2 на референсную последовательность, состоящую из нуклеотидных последовательностей меток А и Б. В результате этого было определено, что данные секвенирования одного анонимного образца содержали 0 чтений, совпадающих по всей длине с меткой А, и 1125 чтений, совпадающих с меткой Б. Для другого анонимного образца эти количества составили 837 и 0, соответственно. Это позволило сделать заключение, что в первом случае был секвенирован образец №2, а во втором - образец №1.

Пример №4. Определение наличия трисомии

В результате проведения полногеномного секвенирования было получено 797406 прочтений (файл в формате ∗.fasta). Чтения картировались с помощью программы bowtie2 на референсный геном человека hg19 для определения геномных координат. Чтения, для которых было невозможно определить геномные координаты, отбрасывались. Из успешно картированных 610364 чтений для дальнейшего анализа брались только чтения, пересекающиеся с исследуемыми интервалами на 21 хромосоме. Для каждого вычислялось среднее покрытие чтениями. Для каждого покрытия определялись вероятности наблюдать его или более экстремальное значение при условии нормального и анеуплоидийного кариотипа по 21 хромосоме. После перемножения значений и вычисления вероятностей наличия трисомии и нормального кариотипа (см. формулу в описании) были получены значения: P(aneuploidy|X)=0.12 и P(euploidy|X) - 7∗10-5. Принято решение о наличии трисомии по 21 хромосоме у плода.

Пример №5. Поиск кандидатных регионов генома

Выбирались геномы, которые имеют значимо разную открытость хроматина между плацентой и в другими тканями. Рассматривались полногеномные данные ENCODE о гиперчувствительности локусов ДНК к ферменту ДНКазе, которая разрезает преимущественно открытую ДНК, не связанную с нуклеосомами. В качестве меры открытости хроматина рассматривалось покрытие участка генома прочтениями после обработки ДНКазой, опубликованные в проекте ENCODE (https://genome.ucsc.edu/ENCODE/downloads.html). В проекте ENCODE также опубликованы пики, которые детектируется как пик в покрытии ридами после обработки ДНКазами в образцах плаценты и не детектируется в образцах клеток крови.

Были найдены 1500 участков на хромосоме 21 (из 124000 участков на всех хромосомах), являющихся участками гиперчувствительности в крови, но не являющиеся участками гиперчувствительности в плаценте. Данный набор или его подмножество можно использовать для дальнейшего анализа.

Пример №6. Выбор среди регионов на хромосоме 21 с дифференциальной доступностью хроматина регионов, покрытие которых значимо отличается между образцами трисомии и нормы.

Использовались полногеномный сиквенсы свободно циркулирующей ДНК для образцов трисомии плода по хромосоме 21 и с нормальной беременностью. Для каждого кандидатного региона вычислялось его покрытие прочтениями в каждом образце. При помощи пакета DESeq, обычно используемого для анализа дифференциальной экспрессии генов, для каждого кандидатного региона определялось p-value того, что существует значимое отличие в покрытии отрезка между образцами с трисомией плода и эуплоидией. плода. Выбиралось 100 участков с наибольшим отличием между образцами с трисомией плода и с нормальной беременностью, таких, что покрытие при трисомии превышало покрытие при нормальной беременности. Такие участки генома были использованы для построения пренатального теста.

1. Способ неинвазивной пренатальной диагностики анеуплоидий плода, включающий:
a. выделение внеклеточной ДНК из образца крови, полученного у беременной женщины;
b. приготовление геномных библиотек с использованием выделенной на стадии а) внеклеточной ДНК;
c. обогащение геномных библиотек фрагментами ДНК - регионами генома, характеризующимися открытостью хроматина между плацентой и клетками крови матери, отличающейся не менее чем на 20%; при этом выбор регионов генома для обогащения геномных библиотек осуществляют из базы данных покрытий кандидатных регионов генома для образцов крови беременных женщин с эуплоидией и анеуплоидией, при этом вычисляют значимость отличия покрытия между образцами с эу- и анеуплоидией для каждого кандидатного региона, характеризующуюся значением p-value с учетом корректировки на общее покрытие образца, и выбирают из кандидатных регионов генома те регионы, которые характеризуются значением p-value не более 0,1;
d. определение последовательности нуклеотидов (секвенирование) полученных геномных библиотек;
e. картирование полученных чтений на референсный геном или части генома человека для определения их координат;
f. определение значения покрытия для каждого региона генома, характеризующегося открытостью хроматина между плацентой и клетками крови матери, отличающейся не менее чем на 20%;
g. корректировку полученного значения покрытия для каждого региона генома, полученного на этапе f, на общее покрытие генома, с последующим сравнением скорректированного значения покрытия со значениями покрытий или их распределений, полученных для обучающей выборки образцов крови беременных женщин при эуплоидии и анеуплоидий плода и определение принадлежности исследуемого образца к одной из данных групп, по которому делают вывод о наличии анеуплоидий плода.

2. Способ по п.1, характеризующийся тем, что определение принадлежности образца к группе с эуплоидией или анеуплоидией плода осуществляют следующим образом:
a. для каждого региона, характеризующегося открытостью хроматина между плацентой и клетками крови матери, отличающейся не менее чем на 20%, вычисляют р-value, которое определяет вероятность наблюдать полученное значение покрытия или более экстремальное значение при условии, что данное значение соответствует распределению покрытий для беременности без анеуплоидии, и p-value того, что его покрытие получено из распределения покрытий для беременности с анеуплоидией по данной хромосоме по БД покрытий кандидатных регионов генома для образцов крови беременных женщин с эуплоидией и анеуплоидией;
b. вычисляют произведение по всем регионам полученных значений p-value для вычисления p-value того, что значения покрытия регионов, характеризующихся открытостью хроматина между плацентой и клетками крови матери, отличающейся не менее чем на 20%, получены из распределения покрытий для беременности без анеуплоидии, и p-value того, что значения покрытия регионов получены из распределения покрытий для беременности с анеуплоидией по данной хромосоме;
c. по полученным произведениям p-value и априорным вероятностям наличия анеуплоидий у плода (риск по популяции) вычисляют по теореме Байеса вероятности наличия анеуплоидии или эуплоидии в исследуемом образце.

3. Способ по п.2, характеризующийся тем, что вывод о наличии или отсутствии анеуплоидий плода делают, если вероятность для одного из вариантов диагноза не превышает порог значимости из интервала 0,01-0,1, а вероятность для другого варианта превышает порог значимости, при этом диагноз ставится по наибольшему значению вероятности, и в случае, если оба p-value выше или оба ниже порога значимости, диагноз не ставится.

4. Способ по п.1, характеризующийся тем, что к образцу крови, полученному у беременной женщины, непосредственно перед стадией выделения вкДНК добавляют молекулярную метку.

5. Способ по п.4, характеризующийся тем, что молекулярная метка представляет собой молекулу нуклеиновой кислоты, предпочтительно ДНК, имеющую степень гомологии с известными природными либо технологическими последовательностями ДНК не более 5%, при этом длина молекулярной метки составляет 30-400 нуклеотидов.

6. Способ получения регионов генома, характеризующихся открытостью хроматина между плацентой и клетками крови матери, отличающейся не менее чем на 20%, для неинвазивной пренатальной диагностики анеуплоидий плода по п.1 по вкДНК крови матери методом секвенирования, включающий:
a. получение данных секвенирования вкДНК крови матери, такого, чтобы все кандидатные регионы генома, характеризующиеся открытостью хроматина между плацентой и клетками крови матери и отличающиеся не менее чем на 20%, были прочитаны для образцов крови нескольких беременных женщин без анеуплоидий плода и нескольких беременных женщин с анеуплоидией плода по конкретной хромосоме;
b. картирование полученных чтений на референсный геном человека для определения их координат;
c. определение покрытия каждого кандидатного региона каждого полученного образца;
d. вычисление для каждого региона значимости отличия, характеризующейся значением p-value покрытия между образцами с плодом без анеуплоидий и образцами с анеуплоидией плода по конкретной хромосоме, с учетом корректировки на общее покрытие образца;
e. выбор из кандидатных регионов генома регионов, характеризующихся значением p-value не более 0,1.

7. Способ по п.6, характеризующийся тем, что этап d осуществляют в предположении отрицательного биномиального распределения покрытия региона в образце, например, с использованием программного обеспечения для определения дифференциальной экспрессии РНК DESeq.

8. Способ по п.6, характеризующийся тем, что для регионов, найденных в пункте d, аналогично пунктам b-е вычисляют покрытие прочтениями в образцах крови не менее 5 мужчин и для каждого региона определяют значимость, выражающуюся в виде p-value отличий между покрытием ДНК в образцах мужчин и беременных женщин с плодом без анеуплоидии, отбирают участки с p-value не более 0,1.



 

Похожие патенты:

Изобретение относится к способам контроля выбросов отработавших газов при эксплуатации двигателя. Представлен способ обнаружения всасывания углеводородов в двигатель на основании одновременного отслеживания неустойчивости в работе цилиндров и повышенного тепловыделения отработавших газов.

Изобретение относится к технологиям связи. Технический результат заключается в повышении скорости передачи данных в сети.

Изобретение относится к медицинской технике. Система персонифицированной медицины содержит модуль регистрации обследования пациента, базу данных, модуль формирования компонентов риска здоровью, модуль формализованного описания показателей, модуль формирования функций оценивания риска здоровью, модуль определения рангов частных критериев риска здоровью, модуль расчета обобщенных показателей риска здоровью на промежуточных уровнях иерархии, модуль автоматизированного формирования персонифицированных медицинских рекомендаций, первый выход которого подключен к базе данных, а второй - к внешнему устройству вывода результатов пациенту.

Изобретение относится к медицинской технике, а именно к средствам автоматической оценки сигнала фонокардиограммы. Устройство обработки сигналов содержит фонокардиограммный интерфейс, данные которого собраны от пациента в соответствии с соответствующим набором собираемых свойств этого сигнала, выбранных из по меньшей мере одного из места прослушивания, информации о том, дышал пациент или задерживал дыхание, информации о том, был ли пациент в покое или выполнял физические упражнения перед сбором сигнала; процессор, выполненный с возможностью анализа первого сигнала фонокардиограммы, использующего его соответствующий набор собираемых свойств, и обеспечения анализа и доверительного значения анализа; и устройство управления последовательностью операций, выполненное с возможностью определения возможно ли, что последующий сигнал фонокардиограммы, если он собран от пациента в соответствии с другим набором собираемых свойств, повысит точность анализа, и в таком случае координации сбора последующего сигнала фонокардиограммы от пациента в соответствии с другим набором собираемых свойств.

Изобретение относится к области повышения энергетической эффективности машин, оборудованных активным рабочим органом непрерывного действия, который имеет возможность изменять нагрузочный режим в процессе выполнения технологической операции.
Изобретение относится к области медицинской и молекулярной генетики. Способ определения ингибирующей FACT активности у моделей химических соединений с использованием компьютерного моделирования белок-лигандного докинга предусматривает формирование молекулярной модели SptM домена белка FACT, включающего участки а.о.

Изобретение относится к автоматизированным системам и системам автоматического управления и может быть использовано при управлении сложными объектами, а также для решения задач распознавания и анализа данных объектов, ситуаций, процессов или явлений произвольной природы, описываемых слабо формализуемыми признаками.

Изобретение относится к технике телекоммуникационных систем и систем связи и может быть использовано для организации оперативного управления и связи в службах скорой помощи, министерства по чрезвычайным ситуациям, других министерств и ведомств.

Изобретение относится к компьютерным системам визуализации пористых пород. Техническим результатом является повышение точности сегментации данных при построении модели образца пористой среды.

Группа изобретений относится к медицине. Автоматический способ обработки сигнала кровяного давления выполняют с помощью автоматического устройства для обработки сигнала кровяного давления, содержащего средство обработки.

Изобретение относится к областям биологии и генетической инженерии. Предложен выделенный пептид для терапевтических целей, содержащий последовательность, по меньшей мере, на 95% идентичную SEQ ID NO:4 (GG00444), или его фрагмент или вариант, способные связываться со слизью кишечника человека, а также содержащая его ворсинчатая структура, пищевой продукт, фармацевтическая композиция, полинуклеотид, экспрессионный вектор, клетка-хозяин, кластер генов, антитело, способ лечения и способ скрининга пробиотических бактериальных штаммов.

Группа изобретений относится к биосенсорам с системой распознавания недостаточного заполнения. Способ оценки объема образца в биосенсоре содержит подачу регулярной последовательности опроса, обнаружение наличия образца, подачу расширенной последовательности опроса и определение того, является ли объем образца достаточным для анализа.

Изобретение относится к медицине, а именно к онкологии и может быть использовано для уточнения стадий распространенного рака шейки матки. Для этого у пациентки определяют стадию заболеванию по международной гинекологической классификации (FIGO) и относят его к Ib-IIa или IIb-IV клинической стадии по уровню IL-1β в плазме крови.

Изобретение относится к медицине, в частности к способу прогнозирования эффективности лечения злокачественного заболевания у субъекта цисплатином. Способ состоит в том, что у пациентов определяют аллельные варианты полиморфизмов rs1142345 гена ТРМТ и rs3219484 гена MUTYH и в зависимости от аллельного статуса одного или обоих указанных полиморфизмов прогнозируют эффективность лечения цисплатином, где благоприятный прогноз определяется наличием у пациента двух аллелей дикого типа полиморфизма rs1142345 гена ТРМТ (генотип АА) и/или комбинации из аллелей дикого и мутантного типов полиморфзма rs3219484 гена MUTYH (генотип GA).
Изобретение относится к области медицины и предназначено для диагностики трематодозов. При лабораторном исследовании к 2 г фекалий добавляют 10 мл 5%-ной уксусной кислоты.
Изобретение относится к медицине, а именно к трансплантологии, может быть использовано при подготовке детей раннего возраста к АВО-несовместимой трансплантации печени.
Изобретение относится к медицинской аллергологии, иммунологии, медицинской лабораторной диагностике. Сущность способа состоит в том, что в периферической крови обследуемых лиц определяют концентрацию IgE и абсолютное содержание лимфоцитов СD23+.

Изобретение относится к медицине, а именно прогнозированию риска развития неблагоприятных сердечно-сосудистых событий у больных ишемической болезнью сердца (ИБС) с сахарным диабетом 2 типа (СД 2 типа), перенесших стентирование коронарных артерий.

Изобретение относится к выполнению анализа при помощи мобильного устройства. Тестовое устройство для выполнения тестового анализа содержит емкость с реагентом; портативное устройство, включающее процессор и устройство для ввода изображения.

Изобретение относится к медицине, а именно к детской офтальмологии, и может быть использовано для прогнозирования развития ретинопатии недоношенных. Проводят непрямую офтальмоскопию глазного дна в условиях медикаментозного мидриаза.

Изобретение относится к областям биологии и генетической инженерии. Предложен выделенный пептид для терапевтических целей, содержащий последовательность, по меньшей мере, на 95% идентичную SEQ ID NO:4 (GG00444), или его фрагмент или вариант, способные связываться со слизью кишечника человека, а также содержащая его ворсинчатая структура, пищевой продукт, фармацевтическая композиция, полинуклеотид, экспрессионный вектор, клетка-хозяин, кластер генов, антитело, способ лечения и способ скрининга пробиотических бактериальных штаммов.
Наверх