Пробиотическая композиция для здоровья полости рта



Пробиотическая композиция для здоровья полости рта
Пробиотическая композиция для здоровья полости рта
Пробиотическая композиция для здоровья полости рта
Пробиотическая композиция для здоровья полости рта

 


Владельцы патента RU 2584610:

АБ-БИОТИКС С.А. (ES)

Предложены штамм Lactobacillus plantarum СЕСТ 7481 и штамм Lactobacillus brevis СЕСТ 7480. Указанные штаммы имеют способность к выживанию в стрессовых условиях в полости рта, способность к адгезии к тканям полости рта, способность к формированию агрегатов и способность к ингибированию патогенов в полости рта. Штаммы используют для профилактики или лечения расстройства в полости рта в составе композиции или в составе фармацевтической композиции в эффективном количестве. Предложен также пробиотический продукт, содержащий указанную выше композицию и приемлемый ингредиент. Штаммы используют также в пищевом продукте совместно с по меньшей мере одним пищевым ингредиентом для улучшения здоровья полости рта, а также с по меньшей мере одним косметически приемлемым наполнителем в составе косметической композиции для облегчения или профилактики симптомов, вызванных расстройством в полости рта. Эффективное количество фармацевтической композиции, или пищевого продукта, или косметической композиции используют в продукте по уходу за полостью рта. 8 н. и 12 з.п. ф-лы, 1 ил., 9 табл., 9 пр.

 

Настоящее изобретение относится к областям медицины, микробиологии и питания и, в частности, к новой комбинации пробиотических штаммов Lactobacillus и композициям, которые применяются в целях здоровья полости рта.

Уровень техники

Основную часть глобального бремени заболеваний полости рта составляют заболевания, связанные с зубным налетом, в частности гингивит, пародонтит и кариес.

Специфические грамотрицательные анаэробные бактериальные инфекции являются основной причиной заболеваний пародонта (гингивита и периодонтита), которые вызывают первичное разрушение мягкой соединительной ткани и впоследствии приводят к нарушению целостности подлежащей альвеолярной кости и связки, поддерживающей зубы. Основным этиологическим агентом, вызывающим развитие и прогрессирование пародонтита, являются бактерии вида Porphyromonas gingivalis. Воспаление десен также вызывают другие виды, к которым относятся Treponema denticola, Prevotella denticola и Fusobacterium nucleatum. Обзоры Всемирной организации здравоохранения подтверждают признаки гингивита у большинства детей, а также широкое распространение начальных стадий заболеваний пародонта среди взрослых. Например, уровень заболеваемости этим многофакторным заболеванием среди взрослого населения Европы составляет от 15 до 35%.

Кариес зубов (также называемый кариесом) представляет собой заболевание, при котором бактериальные процессы поражают твердую структуру зуба. Некоторые специфические микроорганизмы, одним из которых является Steptococcus mutans, снабжены рецепторами, способствующими улучшению адгезии с поверхностью зубов, таким образом, упомянутые бактерии действуют как ранние колонизаторы поверхности зубов и вносят наиболее значительный вклад в развитие кариеса. При росте и метаболизме этого пионерного вида в полости рта создается кислая среда, что делает высокоминерализованную зубную эмаль уязвимой к кариесу.

В дополнение к упомянутому выше считается, что большая часть населения страдает еще одним расстройством полости рта - галитозом. Неприятный запах изо рта, именуемый галитозом, вызывается рядом летучих соединений, которые образуются вследствие бактериального разложения серосодержащих аминокислот. Причастные к этому расстройству бактерии (в основном Fusobacterium nucleatum, Porphyromonas gingivalis, Porphyromonas intermedia и Treponema denticola) располагаются в застойных зонах полости рта, например, на дорсальной поверхности языка, в периодонтальных карманах и межзубных промежутках. Галитоз в значительной степени влияет на личную и социальную сферу людей, страдающих этим расстройством, и, по оценкам, является третьей по частоте причиной обращения за стоматологической помощью, после кариеса и заболеваний пародонта.

В ротовой полости на всех твердых и мягких тканях бактерии ротовой полости образуют биопленку (зубной налет), которая считается основным этиологическим агентом патологических состояний полости рта. Плохое соблюдение гигиены полости рта способствует накоплению бактерий в биопленке, это предрасполагает к аллогенным сдвигам в микробном сообществе и приводит к началу периодонтального воспаления и возникновению кариеса, а также способствует неприятному запаху изо рта.

Дрожжевые грибки, и в частности Candida Albicans, также могут быть причиной заболеваний полости рта. Пожилые люди предрасположены к инфекции Candida, провоцируемой хроническими заболеваниями, медикаментозным лечением, плохой гигиеной ротовой полости, уменьшением слюноотделения или нарушением иммунной системы. Колонизация грибками Candida может протекать бессимптомно, но вместе с тем, бурный рост Candida обычно вызывает локальный кандидоз с различными симптомами и типами поражения слизистой оболочки.

Изменение патогенного потенциала микрофлоры ротовой полости может представлять собой интересную стратегию в борьбе с этими расстройствами. В этой связи перспективным средством для контроля инфекций ротовой полости является введение пробиотических лактобактерий для частичного замещения патогенных микроорганизмов. Вместе с тем, применение пробиотиков в целях здоровья полости рта остается малоизученным по сравнению с их применением при желудочно-кишечных расстройствах. В настоящее время на рынке представлено очень мало коммерческих продуктов, содержащих пробиотики, применение которых охватывает область здравоохранения.

Одним из таких продуктов является Продентис (Prodentis®) от компании BioGaia. Продентис представляет собой жевательную резинку, содержащую пробиотический штамм L. reuteri ATCC 55730, которая показала эффект уменьшения гингивита в клинических испытаниях (Twetman S., et al. "Short-term effect of chewing gums containing probiotic Lactobacillus reuteri on the levels of inflammatory mediators in gingival crevicular fluid". Acta Odontol. Scand., 2009, вып. 67, стр. 19-24). Известно, что этот штамм L. reuteri ATCC 55730 проявляет сильное антагонистическое действие в отношении кариогенных Streptococcus mutans (Caglar E. et al. "Salivary mutans streptococci and lactobacilli levels after ingestion of the probiotic bacterium Lactobacillus reuteri ATCC 55730 by straws or tablets". Acta Odontol. Scand., 2009, том 64, с. 314-318). Тем не менее, не изучено влияние L. reuteri ATCC 55730 на другие патогены полости рта. К тому же, L. reuteri были выделены в кишечнике, а не в полости рта, и неизвестно, обладает ли этот штамм способностью к образованию биопленок или к другому способу колонизации такой среды для создания продолжительного эффекта. Были выявлены значительные различия способностей Lactobacillus sp. в отношении адгезии к покрытым слюной поверхностям в системе тестовой модели, имитирующей условия ротовой полости (Stamatova I. et al. "In vitro evaluation of yoghurt starter lactobacilli and Lactobacillus rhamnosus GG adhesion to saliva-coated surfaces". Oral Microbiol. Immunol., 2009, том 24, с. 218-223).

Другим коммерческим пробиотиком, предназначенным для применения в полости рта, является Streptococcus salivarius K12. Выделенный из слюны здорового ребенка S. salivarius K12 проявляет антимикробную активность in vitro в отношении различных видов бактерий, которые считаются ответственными за развитие галитоза (Burton JP, et al. "Preliminary study of the effect of probiotic Streptococcus salivarius K12 on oral malodor parameters". J. Appl. Microbiol., 2006, том 100, с. 754-764). Вместе с тем, положительные эффекты этого штамма ограничены улучшением симптомов галитоза.

Таким образом, пробиотики обладают потенциальными благоприятными действиями на состояние полости рта при условии идентификации подходящих пробиотических штаммов. Для этого необходимо учитывать предполагаемые преимущества для организма-хозяина наряду с безопасностью штамма, а также возможные отрицательные эффекты в ротовой полости. Последнее условие приобретает особую актуальность в отношении использования пероральных лактобактерий, поскольку некоторые пероральные лактобактерии считаются кариогенными, что обусловлено их высоким ацидогенным потенциалом, который способствует разрушению твердых тканей, таких как эмаль и дентин.

Несмотря на успехи в области пробиотиков для полости рта, вышеизложенное свидетельствует о необходимости новых пробиотических штаммов, которые имеют широкий спектр полезных свойств в полости рта и не проявляют побочных действий.

Сущность изобретения

Авторы изобретения выделили новые штаммы из микрофлоры ротовой полости человека. Эти штаммы, Lactobacillus plantarum CECT 7481 и Lactobacillus brevis CECT 7480, обладают различными функциональными свойствами, что делает их пригодными для применения в целях улучшения состояния ротовой полости. Эти свойства включают в себя не только хорошие антагонистические действия по отношению к патогенным микроорганизмам ротовой полости, но и способность к колонизации ротовой полости и низкий профиль подкисления. Как рассмотрено ниже, также было обнаружено, что использование обоих штаммов в единой комбинации оказывает выраженные положительные действия на состояние ротовой полости.

Таким образом, в первом аспекте настоящее изобретение относится к композиции, содержащей Lactobacillus plantarum CECT 7481 и Lactobacillus brevis CECT 7480.

Очевидно, что специалист в данной области с помощью депонированных штаммов в качестве исходного материала может рутинным способом путем общепринятого мутагенеза или технологии повторного выделения штаммов создавать дополнительные мутанты или их производные, которые сохраняют или усиливают описанные в изобретении подходящие свойства и преимущества штаммов, образующих композицию по изобретению. Такие мутанты или производные могут быть генетически модифицированными штаммами или иметь природное происхождение. Специалист в данной области сможет выбирать адекватный способ, применяемый для определения функциональной активности штаммов. Примеры возможных способов измерения этой активности представлены в разделе примеров ниже.

Таким образом, термин "Lactobacillus plantarum CECT 7481" обозначает штамм Lactobacillus plantarum, депонированный в испанской коллекции типовых культур под номером доступа CECT 7481, а также мутантные микроорганизмы или производные, которые были получены с помощью существующих известных технологий с использованием депонированного штамма в качестве исходного материала, и такие мутанты или производные по меньшей мере сохраняют описанные в изобретении подходящие свойства и преимущества штамма Lactobacillus plantarum CECT 7481. Термин "Lactobacillus brevis CECT 7480" обозначает штамм Lactobacillus brevis, депонированный в испанской коллекции типовых культур под номером доступа CECT 7480, а также мутантные микроорганизмы или производные, которые были получены с помощью существующих известных технологий с использованием депонированного штамма в качестве исходного материала, и такие мутанты или производные по меньшей мере сохраняют описанные в изобретении подходящие свойства и преимущества штамма Lactobacillus brevis CECT 7480.

Преимущество штаммов настоящего изобретения состоит в том, что они являются особенно полезными в качестве пробиотиков.

Термин «пробиотик» согласно существующему уровню данной области техники означает микроорганизм, который оказывает полезное действие для здоровья хозяина при его введении в достаточных количествах. Пробиотические микроорганизмы должны отвечать ряду требований, связанных с отсутствием токсичности, с жизнеспособностью, адгезивностью и полезным действием. Эти свойства пробиотиков не зависят от штамма, даже среди бактерий одного вида. Таким образом, важной задачей является поиск штаммов, имеющих более хорошие характеристики в отношении всех требований к пробиотикам.

Предпочтительно, штаммы по изобретению являются полезными в качестве пробиотиков полости рта, т.е. в качестве пробиотиков для улучшения состояния полости рта. Было установлено, что Lactobacillus plantarum CECT 7481 и Lactobacillus brevis CECT 7480 проявляют выраженную ингибирующую активность по отношению к широкому ряду патогенов ротовой полости, которые задействованы в развитии таких расстройств, как гингивит, пародонтит, кариес и галитоз, и при этом проявляют минимальный антагонизм по отношению к обычным симбиотическим штаммам микрофлоры ротовой полости человека. В дополнение, эти два штамма демонстрируют отсутствие взаимной ингибирующей активности, что позволяет использовать их совместно в одной рецептуре. Кроме того, как показано в приведенных ниже примерах, имеет преимущество комбинирование указанных штаммов в единой рецептуре (т.е. в композиции по изобретению), и это преимущество состоит в более высокой антагонистической активности по отношению к патогенам ротовой полости, по сравнению с активностью каждого из этих штаммов, используемых по отдельности. Таким образом, штаммы по изобретению проявляют совместное действие против патогенов ротовой полости и являются особенно полезными при использовании в комбинации.

Указанные штаммы оказывают антагонистическое действие на микроорганизмы, которые вовлечены в патологические состояния ротовой полости, например, Streptococcus mutans, Porphyromonas gingivalis, Treponema denticola, Prevotella denticola и Fusobacterium nucleatum, и это действие заключается в изменении микробиологического профиля ротовой полости на более здоровый профиль, тем самым создается полезное действие на состояние здоровья ротовой полости.

Тем не менее, для обеспечения пробиотического действия в ротовой полости отдельная способность бактериального штамма к антагонистическому действию на патогены ротовой полости не является достаточной. Штаммы композиции по изобретению представляют собой хорошие пробиотики ротовой полости, поскольку в дополнение к мощному антагонистическому действию они обладают хорошей способностью к колонизации ротовой полости. Как показано в примере 7 ниже, Lactobacillus plantarum CECT 7481 и Lactobacillus brevis CECT 7480 способны к росту в присутствии лизоцима и перекиси водорода. Преимущество указанных штаммов также состоит в хорошей способности к адгезии к тканям ротовой полости.

Кроме того, преимущество штаммов по изобретению состоит в проявлении высокой способности к образованию агрегатов. Это важно, поскольку таким образом указанные штаммы могут тормозить образование или уменьшать зубной налет, препятствуя образованию биопленок патогенных микроорганизмов. Известно, что пробиотические штаммы молочнокислых бактерий с агрегационной активностью могут тормозить или уменьшать образование зубного налета из патогенных бактерий, которое происходит в результате агрегации патологических бактерий друг с другом, а также с другими микроорганизмами. Как упомянуто выше, биопленка, образуемая патогенами ротовой полости на твердых и мягких тканях ротовой полости, считается важным этиологическим агентом патологических состояний ротовой полости, которые приводят к началу воспаления пародонта, возникновению кариеса и галитоза. Штаммы по изобретению усиливают образование агрегатов, если оба штамма объединяют в композицию, и это означает, что штаммы более эффективно вытесняют патогенные бактерии при их объединении в единой рецептуре.

Авторы изобретения неожиданно обнаружили, что штаммы CECT 7481 и CECT 7480 имеют особенно низкий профиль подкисления. Как большинство молочнокислых бактерий, бактерии вида Lactobacillus отличаются высокой продуктивностью летучих кислот, образующихся в результате брожения сахара, употребляемого человеком. Вместе с тем, ацидогенные свойства указанных бактерий могут быть возможным побочным действием в полости рта, поскольку это повышает риск возникновения кариеса. Фактически, многие молочнокислые бактерии рассматривались в качестве кариогенных. Таким образом, штаммы Lactobacillus, образующие композицию по изобретению, обладают свойством снижать продукцию кислоты, что делает их особенно подходящими для применения в целях здоровья полости рта.

Наилучшим из полезных свойств, описанных выше, является преимущество штаммов по изобретению, состоящее в отсутствии продукции или в очень низкой продукции соединений с неприятным запахом, таких как летучие соединения серы, валериановая кислота, масляная кислота и путресцин. Это также относится к применению композиции по изобретению в ротовой полости.

Дополнительно, в отношении штаммов для использования в качестве пробиотиков, штаммы, образующие композицию по изобретению, относятся к видам бактерий, которые имеют статус "квалифицированной презумпции безопасности" (QPS), согласно определению Европейского управления безопасности пищевых продуктов (EFSA). В дополнение, авторы изобретения обнаружили, что указанные штаммы не проявляют какой-либо значительной устойчивости к антибиотикам, важным для человеческого и/или ветеринарного применения (ампициллин, гентамицин, стрептомицин, эритромицин, тетрациклин, клиндамицин и левомицетин), что исключает риск потенциальной передачи антибиотикоустойчивости патогенным видам.

Учитывая вышеизложенное, штаммы по изобретению имеют более хорошие характеристики по всем параметрам, имеющим значение для пробиотиков полости рта, по сравнению с коммерческими штаммами, которые известны в области пробиотиков полости рта. Как показано в примерах ниже, новые штаммы являются более устойчивыми к условиям полости рта, обладают большей способностью к образованию агрегатов, более высокой (и более широкой) антагонистической активностью, улучшенной адгезией и/или более низким профилем подкисления, чем штаммы Streptococcus salivarius K12, Lactobacillus reuteri ATTC 55730 и Lactobacillus brevis CD2. Ниже приведены протоколы для определения каждого из указанных свойств. Дополнительно, объединение обоих штаммов по изобретению в единой композиции обычно приводит к совместной деятельности штаммов в соответствующих функциональных условиях. Таким образом, композиция, содержащая оба штамма, является особенно подходящей для использования в качестве пробиотика ротовой полости.

Композиция согласно первому аспекту изобретения является полезной в качестве лекарственного средства, поскольку проявляет ряд полезных эффектов для человека-хозяина. В частности, введение композиции, содержащей Lactobacillus plantarum CECT 7481 и Lactobacillus brevis CECT 7480, является полезным для профилактики и/или лечения заболеваний ротовой полости и, предпочтительно, для профилактики и/или лечения заболеваний ротовой полости, вызванных патогенами.

Без связи с какой-либо теорией, полезный эффект штаммов, образующих композицию по изобретению, является результатом улучшения микробиологического профиля полости рта в целях оздоровления микрофлоры полости рта. Рост указанных полезных бактерий в полости рта вызывает давление окружающей среды, которое ингибирует рост обычных и/или оппортунистических патогенных микроорганизмов. Это давление окружающей среды обусловлено конкуренцией за участки адгезии и питательные вещества, выработку антимикробных соединений и перемещение патогенов посредством агрегации пробиотических бактерий.

Дополнительным рассматриваемым аспектом является способность пробиотических бактерий к модуляции иммунного ответа. Механизмы, посредством которых пробиотики модулируют иммунитет, были широко изучены на структурах желудочно-кишечного тракта. Показано, что пробиотические виды способны изменять баланс провоспалительных и противовоспалительных цитокинов, секретируемых эпителиальными клетками. Пробиотики также регулируют иммунные реакции путем усиления врожденного иммунитета и модуляции патоген-индуцированного воспаления посредством сигнальных путей, регулируемых Toll-подобными рецепторами. Усиление местных иммунных реакций, а также системных иммунных ответов с помощью пробиотиков может открыть новые возможности пробиотиков для профилактики инфекций на поверхности периферических слизистых оболочек, например, в ротовой полости.

Соответственно, в третьем аспекте изобретение относится к композиции, содержащей штаммы настоящего изобретения для использования в качестве лекарственного средства.

В четвертом аспекте изобретение относится к композиции, описанной в первом аспекте изобретения, применяемой для профилактики и/или лечения расстройства в ротовой полости у животного, в том числе у человека, которое вызвано патогенами ротовой полости. Кроме того, этот аспект можно сформулировать как использование композиции, описанной в первом аспекте изобретения, для производства лекарственного средства для профилактики и/или лечения расстройства в ротовой полости у животного, в том числе у человека, которое вызвано патогенами ротовой полости.

Изобретение также относится к способу профилактики и/или лечения расстройства в ротовой полости у животного, в том числе человека, которое вызвано патогенами ротовой полости, при этом способ содержит введение указанному животному, нуждающемуся в таком введении, композиции, описанной в первом аспекте изобретения.

Понятие "расстройство в ротовой полости, которое вызвано патогенами ротовой полости" используется в изобретении в самом широком смысле для обозначения любого нарушения или аномалии, которые можно выявить в ротовой полости, вызванное патогеном ротовой полости, например, бактерией, вирусом или дрожжевым грибком. Такое расстройство может представлять собой серьезное патологическое состояние, а также тривиальное состояние или дискомфорт. Иллюстративными неограничивающими примерами "расстройства в ротовой полости, которое вызвано патогеном ротовой полости" являются, среди прочего, кариес, гингивит, пародонтит, кандидоз, герпес и язвы, а также галитоз, пятна на зубах, чувствительные зубы.

В одном варианте осуществления четвертого аспекта изобретения композицию применяют для лечения и/или профилактики расстройства, обусловленного зубным налетом. Предпочтительно, расстройство, обусловленное зубным налетом, выбирают из группы, состоящей из кариеса, чувствительных зубов, гингивита и пародонтит.

В другом варианте осуществления четвертого аспекта изобретения композицию применяют для лечения и/или профилактики галитоза.

В дополнительном варианте осуществления четвертого аспекта изобретения композицию применяют для лечения и/или профилактики кандидоза.

Рецептуру композиции согласно изобретению, содержащую штаммы по изобретению, можно создавать в виде пищевых, косметических или фармацевтических продуктов. Указанная композиция в дополнение к штаммам по изобретению может содержать один или более других активных агентов и/или косметически приемлемых наполнителей (в случае косметической композиции), фармацевтически приемлемых наполнителей (в случае фармацевтической композиции) или подходящие пищевые ингредиенты (в случае пищевой композиции). В конкретном варианте осуществления изобретения композиция по изобретению дополнительно содержит один или более активных агентов. Предпочтительно, дополнительный активный агент или агенты представляют собой другие пробиотические бактерии, которые не проявляют антагонистического действия на штаммы, образующие композицию по изобретению. Более предпочтительно, если дополнительный активный агент или агенты подходят для лечения и/или профилактики галитоза, кандидоза, кариеса, чувствительных зубов и/или заболеваний пародонта. В зависимости от рецептуры можно добавлять эти штаммы в виде очищенных бактерий, в виде бактериальной культуры, в виде части бактериальной культуры, в виде бактериальной культуры после обработки, и добавлять единственными или вместе с подходящими носителями или ингредиентами. Также можно добавлять пребиотики.

Композиция может иметь твердую, жидкую или газообразную форму и может представлять собой, среди прочего, порошки, таблетки, пленочные препараты, растворы, аэрозоли, гранулы, пастилки, пилюли, суспензии, эмульсии, капсулы, сиропы, жидкости, эликсиры, экстракты, настойки или жидкие экстракты, или иметь форму, которая особенно подходит для перорального применения.

В других аспектах изобретение относится к фармацевтической композиции, которая содержит композицию по изобретению вместе с фармацевтически приемлемыми наполнителями. Соответственно, фармацевтический продукт может быть изготовлен в любой приемлемой форме, которая не оказывает отрицательного влияния на биодоступность штаммов, образующих композицию по изобретению. Выбор наполнителей и наиболее подходящих способов создания рецептуры с учетом конкретного назначения композиции входит в компетенции специалиста в области фармацевтических технологий.

Термин "фармацевтически приемлемый", используемый в изобретении, относится к соединениям, материалам, композициям и/или к лекарственным формам, которые, в рамках обоснованного медицинского заключения, являются пригодными для применения в контакте с тканями субъекта (как человека, так и животного нечеловеческого происхождения) без чрезмерной токсичности, раздражения, аллергической реакции или других проблем или осложнений, соизмеримых с разумным соотношением пользы и риска. Каждый носитель, наполнитель и т.д. также должен быть "приемлемым" в плане совместимости с другими ингредиентами рецептуры. Подходящие носители, наполнители и т.д. можно найти в стандартных фармацевтических изданиях.

В другом аспекте изобретение относится к косметической композиции, которая содержит композицию по изобретению вместе с косметически приемлемыми наполнителями. В плане профилактики и/или лечения расстройств в полости рта, вызванных патологическими бактериями, композиция настоящего изобретения является полезной для улучшения и/или профилактики симптомов, вызванных такими расстройствами. Эти симптомы включают в себя без ограничения неприятный запах изо рта и пятна на зубах.

Термин "косметически приемлемый" относится к соединениям, материалам, композициям и/или лекарственным формам, которые, в рамках обоснованного медицинского заключения, являются подходящими для применения в контакте с кожей человека без чрезмерной токсичности, несовместимости, нестабильности и аллергических реакций, среди прочего. Каждый "косметически приемлемый" носитель, наполнитель и т.д. также должен быть "приемлемым" в плане совместимости с другими ингредиентами косметической рецептуры. Подходящие носители, наполнители и т.д. для косметических рецептур можно найти в стандартных изданиях.

Штаммы по изобретению также могут входить в состав различных пищевых продуктов, таких как молочные продукты, йогурт, творог, сыр (например, мягкий сыр, сливки, мягкие и твердые продукты переработки), кисломолочные продукты, сухое молоко, ферментированный продукт на молочной основе, мороженое, ферментированный продукт на зерновой основе, порошок на молочной основе, напиток, приправа и корм для животных. Термин "пищевой продукт" используется в изобретении в самом широком смысле и включает в себя любой вид продукции в любом представленном виде, который животное может поглощать, за исключением косметических, фармацевтических и ветеринарных продуктов. Примерами других пищевых продуктов являются мясные продукты (например, печеночный паштет, сардельки, сосиски и колбасы, или мясные пасты), шоколадный спред, начинки (например, трюфельные, сливочные) и глазурь, шоколад, кондитерские изделия (например, карамель, конфеты, помадки и ириски), выпечка (торты, пирожные), соусы и супы, фруктовые соки и забеливатели кофе. Заготовки для корма животных также входят в объем изобретения. Композиции по изобретению также можно использовать в качестве ингредиента в других пищевых продуктах. Особенный интерес вызывают пищевые продукты, представляющие собой функциональные пищевые продукты и детское питание.

Соответственно, в другом аспекте изобретение относится к пищевой композиции, которая содержит композицию по изобретению вместе с другими пищевыми ингредиентами.

Термин "пищевые ингредиенты" относится к ингредиентам, которые пригодны в пищу, то есть подходят для употребления в качестве пищи для животного, предпочтительно для людей, рогатого скота или домашних животных, но не ограничены вышеперечисленным.

Часто пробиотические бактериальные композиции, такие как описанные в изобретении композиции, рассматриваются как пищевые добавки. Биологически активные добавки, также называемые пищевыми добавками или питательными добавками, обеспечивают полезные ингредиенты, которые обычно не поступают с нормальным рационом. В основном пищевые добавки считаются продуктами питания, но иногда их относят к лекарствам, натуральным лечебным средствам или к продуктам-нутрицевтикам. В контексте настоящего изобретения пищевые добавки также включают в себя нутрицевтики. Пищевые добавки обычно продаются как "OTC" (безрецептурные средства), т.е. без рецепта. В предпочтительном варианте осуществления композиция по изобретению является пищевой добавкой.

Если композиция согласно изобретению представляет собой пищевую добавку, ее можно употреблять как есть, можно смешивать с подходящими питьевыми жидкостями, например с водой, йогуртом, молоком или фруктовым соком, или можно смешивать с твердой или жидкой пищей. В этом плане пищевая добавка может представлять собой таблетки, пилюли, капсулы, драже, гранулы, порошки, суспензии, саше, пастилки, леденцы, батончики, сиропы и иметь соответствующую форму введения, обычно в виде монолитной дозы. Предпочтительно, пищевую добавку, содержащую композицию по изобретению, принимают в виде таблеток, пастилок, капсул или порошков, полученных общепринятыми способами изготовления пищевых добавок.

Из вышеизложенного следует, что продукты, содержащие композиции по изобретению, предназначены для применения в целях здоровья полости рта, как для профилактики или лечения расстройств полости рта, так и для улучшения симптомов, вызванных этими расстройствами. Соответственно, в другом аспекте в настоящем изобретении рассмотрен продукт для гигиены ротовой полости, содержащий упомянутую выше композицию вместе с фармацевтически приемлемыми наполнителями или косметически приемлемыми наполнителями или с другими пищевыми ингредиентами.

В контексте настоящего изобретения композиция вполне может представлять собой продукт для полости рта, который при обычном применении не проглатывается умышленно в целях системного введения конкретных терапевтических агентов, а скорее задерживается в полости рта в течение времени, достаточного для контакта по существу со всеми поверхностями зубов и/или тканей полости рта в целях проявления действия в полости рта. Неограничивающими примерами таких продуктов являются зубные пасты, средства для чистки зубов, зубные порошки, гели для местного применения в полости рта, полоскания для полости рта, продукция для зубных протезов, спреи для рта, жевательные резинки, зубная нить или зубные ленты. Композиция для полости рта может представлять собой однофазную композицию для полости рта или может представлять собой комбинацию из двух или более композиций для полости рта.

В одном варианте осуществления продукт для гигиены полости рта представляет собой жевательную резинку, зубную пасту, спрей для рта, пастилку или диспергируемую во рту таблетку. Предпочтительно, продукты для гигиены полости рта представлены в виде пастилок или диспергируемых во рту таблеток.

Продукты для гигиены полости рта согласно настоящему изобретению также могут содержать другие вещества, действующие в полости рта, такие как активные вещества зубных отбеливателей, включающие в себя отбеливающие или окисляющие агенты, например, пероксиды, пербораты, перкарбонаты, пероксикислоты, персульфаты, хлориты металлов и их комбинации. Вещества, изменяющие цвет зубов, также могут относиться к активным веществам для гигиены полости рта, полезным в настоящем изобретении. Продукты для гигиены полости рта могут дополнительно содержать ароматизирующие соединения, такие как ментол.

Штаммы, образующие композицию по изобретению, предпочтительно представлены в виде жизнеспособных клеток. Вместе с тем, штаммы по изобретению также могут быть нежизнеспособными клетками, такими как убитые культуры или композиции, содержащие полезные факторы, которые вырабатываются штаммами Lactobacillus plantarum CECT 7481 и Lactobacillus brevis CECT 7480. Штаммы по изобретению могут представлять собой термически убитые микроорганизмы или микроорганизмы, убитые посредством сдвига рН, обработки ультразвуком, радиации или воздействия давления. Использование нежизнеспособных клеток облегчает получение продукта, эти клетки можно легко вводить в коммерческие продукты, и требования к их хранению гораздо менее ограничены, чем к хранению жизнеспособных клеток.

При использовании в виде композиции по изобретению значения концентрации указанных штаммов могут иметь любое соотношение, подходящее для предназначенного использования. Например, значения концентрации штаммов могут иметь соотношение, которое находится в диапазоне от 3:1 до 1:3 (Lactobacillus plantarum CECT 7481:Lactobacillus brevis CECT 7480). Предпочтительной концентрацией является соотношение 1:1. Дополнительно, штаммы по изобретению включены в композицию в количестве, эффективном для предназначенного использования.

Термин "эффективное количество", используемое в настоящем документе, обозначает количество колониеобразующих единиц (КОЕ) для каждого штамма в композиции, которое является достаточно высоким, чтобы значительно изменять в положительную сторону состояние, предназначенное для лечения, но при этом достаточно низким, чтобы избежать серьезных побочных эффектов (с разумным соотношением пользы и риска), в рамках обоснованного медицинского заключения. Эффективное количество указанных пробиотических микроорганизмов будет определять специалист в данной области, и количество будет варьировать в зависимости от конкретной цели, предназначенной для достижения, от возраста и физического состояния пациента, которого лечат, от тяжести основного заболевания и от конечной рецептуры. Например, в продуктах для здоровья полости рта присутствует штамм или штаммы в количестве от приблизительно 105 до приблизительно 1012 КОЕ/г, предпочтительно, в количестве от приблизительно 107 до приблизительно 1011 КОЕ/г. Термин "колониеобразующая единица" ("КОЕ") означает количество бактериальных клеток, выявленное путем микробиологического подсчета на агаре. В конкретном варианте осуществления композиция по изобретению представляет собой продукт для гигиены полости рта, содержащий от 107 до 1010 КОЕ/г.

Пищевые добавки обычно содержат пробиотические штаммы в количестве от 105 до 1012 КОЕ/г. В конкретном варианте композиция по изобретению представляет собой пищевую добавку, содержащую от 107 до 1010 КОЕ/г.

Штаммы по изобретению получают путем культивирования бактерий в подходящей среде и при подходящих условиях. Штаммы можно культивировать единственными для образования чистой культуры или в виде смешанной культуры вместе с другими микроорганизмами, или путем раздельного культивирования бактерий разных типов, которые впоследствии соединяют в желательных соотношениях. После культивирования клеточную суспензию восстанавливают и используют как есть, или обрабатывают желательным способом, например, путем выпаривания или сублимационной сушки, для дальнейшего использования при изготовлении продуктов. Иногда пробиотический препарат подвергают иммобилизации или инкапсуляции в целях повышения срока годности. В данной области техники известен ряд способов иммобилизации или инкапсуляции бактерий. В конкретном варианте осуществления штаммы, образующие часть композиции по изобретению, включены в продукт для гигиены полости рта в виде инкапсулированных бактерий.

Специалистам в данной области будет очевидно, что штаммы Lactobacillus plantarum CECT 7481 и Lactobacillus brevis CECT 7480 эффективны не только при объединении их в единую композицию, но и при использовании по отдельности, или при одновременном введении в двух разных композициях, последовательно или раздельно через определенный период времени. Дополнительно, специалисту в данной области техники будет очевидно, что в целях здоровья полости рта можно назначать применение одного из штаммов вместе с другим штаммом для профилактики или лечения расстройств ротовой полости, в частности, расстройств, которые вызываются патогенами ротовой полости, более предпочтительно, галитоза и/или кандидоза, и/или расстройств, обусловленных зубным налетом.

Следовательно, еще в одном аспекте изобретение относится к Lactobacillus plantarum CECT 7481.

Наконец, еще в одном аспекте изобретение относится к Lactobacillus brevis CECT 7480.

Штаммы по изобретению описаны в настоящем документе впервые, таким образом, они являются новыми. Как показано в фиг.1, оба штамма Lactobacillus plantarum CECT 7481 и Lactobacillus brevis CECT 7480 имеют другую картину гель-электрофореза в пульсирующем поле, чем картина близкородственных коммерческих штаммов молочнокислых бактерий, таких как Lactobacillus plantarum 299v, Lactobacillus plantarum VSL#3, Lactobacillus casei VSL#3 и Lactobacillus casei DN 114.001.

Некоторые документы существующего уровня техники описывают композиции, которые содержат штаммы Lactobacillus plantarum и Lactobacillus brevis. Тем не менее, композиция по изобретению является новой в отношении указанных композиций.

В частности, патент KR100780030 раскрывает ферментированное соевое молоко, содержащее штаммы Lactobacillus brevis и Lactobacillus plantarum. Раскрытые штаммы были выделены из блюда кимчи, состоящего из ферментированных овощей, которое является распространенным блюдом в Корее. Напротив, штаммы по изобретению были выделены из слюны детей из развивающегося региона Южной Америки, где не употребляют кимчи. Таким образом, штаммы по изобретению L. brevis и L. plantarum имеют совершенно другое происхождение, и это означает, что или Lactobacillus plantarum CECT 7481, или Lactobacillus brevis CECT 7480 являются аналогичными упомянутым корейским штаммам.

Другая корейская патентная заявка KR100866504 раскрывает ферментированный красный женьшень с использованием Lactobacillus plantarum P2 (номер депонирования микроорганизма KCTC11391BP) и/или Lactobacillus brevis M2 (номер депонирования микроорганизма KCTC11390BP). Указанные штаммы были выделены из женьшеня. Аналогично, раскрытые корейские штаммы имеют совершенно другое происхождение в отличие от штаммов по изобретению, поскольку они были выделены из растений, которые не употребляются в развивающихся регионах Южной Америки. Это делает невозможным считать, что или Lactobacillus plantarum CECT 7481, или Lactobacillus brevis CECT 7480 аналогичны упомянутым корейским штаммам.

Международные патентные заявки WO2005/082157 и WO 02/39825 также раскрывают комбинации штаммов L. plantarum и L. brevis. Штамм L. brevis LBR01, описанный в композиции патента WO2005/082157, был выделен в Тайване из соленых огурцов в горчичной заливке. Штамм L. brevis C21, раскрытый в композиции патента WO 02/39825, был выделен из монгольского тофу. Как указано выше, в связи с совершенно разным происхождением этих штаммов L. brevis, невозможно считать их аналогичными штамму настоящего изобретения. Кроме того, раскрытые штаммы L. brevis LBR01 и L. brevis C21 не представляются доступными для широкого применения.

Кроме того, в патенте WO 2006/080035 раскрыта применяемая в гинекологии композиция, которая содержит штамм Lactobacillus brevis CD2 и неспецифический штамм Lactobacillus plantarum вместе со штаммом L. salivarius. Вместе с тем, штамм L. brevis CD2 отличается от Lactobacillus brevis CECT 7480. Как показано в таблице 4, при объединении штамма Lactobacillus plantarum CECT 7481 со штаммом L. brevis CD2 наблюдался антагонистический эффект в отношении способности к образованию агрегатов. Напротив, комбинация штамма Lactobacillus plantarum CECT со штаммом Lactobacillus brevis CECT 7480 приводила к повышению способности к образованию агрегатов. Дополнительно, было показано, что штамм L. brevis по изобретению имеет значительно более низкий профиль подкисления по сравнению с коммерческим штаммом L. brevis CD2 (смотрите таблицу 5). Таким образом, штамм Lactobacillus brevis CECT 7480 не только отличается от штамма L. brevis CD2, но и лучше подходит для применения в целях здоровья полости рта. В целом, комбинация по изобретению отличается от комбинации, раскрытой в патенте WO 2006/080035, поскольку обладает другими действиями.

Наконец, в патенте WO 02/018542 упомянуто, что штаммы Lactobacillus часто встречаются в сыре чеддер и включают в себя штаммы L. brevis и L. plantarum; также в патентной заявке FR2448865 (стр. 10, строки 11-17) описана композиция, содержащая L. plantarum, в которую можно добавлять L. brevis. Вместе с тем, в этих документах не раскрыта композиция, содержащая конкретный штамм L. brevis и конкретный штамм L. plantarum. Следовательно, композиция по изобретению, которая содержит конкретный штамм L. brevis, а именно Lactobacillus brevis CECT 7480, и конкретный штамм L. plantarum, а именно Lactobacillus plantarum CECT 7481, является новой.

В тексте описания и формулы изобретения слово "содержать" и его варианты не предполагают исключение других технических признаков, добавок, компонентов или этапов. Дополнительные цели, преимущества и признаки изобретения станут очевидными специалистам в данной области техники после изучения описания или могут быть изучены путем практического применения изобретения. Кроме того, настоящее изобретение охватывает все возможные комбинации конкретных и предпочтительных вариантов осуществления, описанных в изобретении. Примеры и чертежи, представленные ниже, служат для иллюстрации и не предназначены для ограничения объема настоящего изобретения.

Краткое описание чертежей

Фиг.1. Изображения электрофореза в пульсирующем поле Sfi-I (A, B) и Sma-I (C, D) рестриктированной геномной ДНК: 1) Lactobacillus plantarum CECT 7481 (F2096); 2) Lactobacillus plantarum 299v; 3) Lactobacillus plantarum VSL#3; 4) Lactobacillus brevis CECT 7480 (I3141); 5) Lactobacillus casei VSL#3; 6) Lactobacillus casei DN 114,001. Молекулярный маркер обозначен буквой М.

ПРИМЕРЫ

В следующих разделах описаны характеристики штаммов по изобретению и их конкретные пробиотические свойства в отношении применений для здоровья полости рта.

1. Выделение микроорганизмов

Новые штаммы F2096 и I2141 выделяли из слюны детей в возрасте от 0 до 5 лет из тропического развивающегося региона Южной Америки. Слюну растворяли в фосфатно-буферном растворе (ФБР), рН 7,4, разделяли на аликвоты и высевали на агар MRS (Man Rogosa Sharp, Sigma-Aldrich Chem, Испания) с добавлением ванкомицина 10 мкг/мл (SIGMA). Штаммы культивировали в микроаэрофильных условиях (5% CO2) при 37ºC. После выращивания выделенные штаммы сохраняли с помощью лиофилизации в ФБР с 0,1× 15% сухого обезжиренного молока.

Штаммы F2096 и I3141 были идентифицированы как Lactobacillus plantarum и Lactobacillus brevis, соответственно (смотрите раздел 2 ниже). Оба штамма были депонированы в Испанской коллекции типовых культур (Universitat de Valencia, Campus de Burjassot, Edif. de Investigación, 46100 Burjassot, Valencia, Spain). Штамм Lactobacillus plantarum (штамм F2096) был депонирован 28.01.2009 г. с присвоением номера доступа 7481. Штамм Lactobacillus brevis (штамм I3141) был депонирован 18.02.2009 г. с присвоением номера доступа 7480. Оба депонированных штамма являются жизнеспособными и сохраняют все свои свойства, относящиеся к их депонированию.

Согласно дальнейшему описанию изобретения, штамм F2096 соответствует Lactobacillus plantarum CETC 7481, и штамм I3141 соответствует Lactobacillus brevis CECT 7480.

Штаммы Pediococcus acidilactici F2019 (здесь и далее называемый P. acidilactici), Lactobacillus paracasei I3152 (здесь и далее называемый L. paracasei) и Pediococcus pentosaceus I54 (здесь и далее называемый P. pentosaceus) выделяли из человеческой слюны, как описано выше. Штамм Streptococcus salivarius K12 выделяли из коммерческого BLIS K12® в ТСБ (триптическом соевом бульоне) и культивировали в аэробных условиях при 37ºC. Штамм Lactobacillus reuteri ATCC 55730 выделяли из коммерческого reuteri Drops®, Lactobacillus plantarum 299v из Poviva®, Lactobacillus brevis CD2 из Inersan®, штаммы Lactobacillus plantarum VSL#3 и Lactobacillus casei VSL#3 выделяли из VSL#3®, и штамм Lactobacillus casei DN 114.001 выделяли из Actimel®. Все упомянутые штаммы выделяли на MRS и культивировали при 37ºC в атмосфере 5% CO2. Потенциально патогенные штаммы Porphyromonas gingivalis CIP 103683, Fusobacterium nucleatum CIP 104988, Treponema denticola CIP 103917 и Prevotella denticola CIP 104478T были получены из Института Пастера и культивированы согласно инструкции поставщика. Штаммы Streptococcus mutans клинического происхождения культивировали на агаре с сердечно-мозговой вытяжкой при 37ºС и 5% СО2. Идентификацию штаммов проводили путем секвенирования.

2. Таксономическая характеристика штаммов

2.1. Родовая и видовая генетическая идентификация

А) Методики

Штаммы по изобретению выращивали в течение ночи на среде MRS (рН 6,4) при 37ºС в атмосфере, содержащей 5% CO2. Бактерии дополнительно собирали, промывали и суспендировали в пред-лизирующем буфере (480 мкл 50 мМ ЭДТА, рН 8,0; 120 мкл лизоцима 10 мг/мл) и после этого инкубировали при 37ºС в течение 60 мин. Экстракцию ДНК проводили с помощью набора для геномной очистки ДНК Wizard (Promega). Предварительно обработанные бактерии центрифугировали при 14000 g в течение 2 минут для удаления супернатанта, после чего следовали протоколу Promega. Коротко, бактерии ресуспендировали в растворе для лизиса ядер и инкубировали при 80ºC в течение 5 минут, затем охлаждали до комнатной температуры. Клеточные лизаты инкубировали в растворе РНКазы при 37ºС в течение 60 минут, затем белки осаждали путем добавления раствора для преципитации белка и перемешивали на вортексе с высокой скоростью. Образцы охлаждали и центрифугировали при 15000 g в течение 3 минут. Супернатанты, содержащие ДНК, переносили в чистые микроцентрифужные пробирки объемом 1,5 мл и смешивали с 600 мкл изопропанола путем переворачивания. ДНК собирали центрифугированием при 15000 g в течение 2 минут и тщательно сливали супернатант. Образцы ДНК промывали 70% этанолом в количестве 600 мкл путем аккуратного многократного переворачивания пробирки. Этанол удаляли путем аспирации после центрифугирования при 15000 g в течение 2 минут. В конце ресуспендировали ДНК в 100 мкл раствора для регидратации путем инкубации при температуре 65ºС в течение 1 часа. Образцы хранились при температуре от 2 до 8ºC.

Амплификацию 16S рРНК способом ПЦР проводили с использованием универсальных праймеров Eub27f и Eub1492r, которые продуцируют фрагмент почти полной последовательности 16S (более 1000 нуклеотидов) (таблица 1). Затем полученную согласно описанию выше ДНК промывали с использованием набора Quiaquick (Quiagene).

Для каждого образца проводили четыре последовательные реакции секвенирования в анализаторе Genetic Analyzer 3130 (Applied Biosystems) с помощью набора BigDye v.3.1, с использованием праймеров, указанных в таблице 1. Сбор данных и хроматограммы получали с помощью программного обеспечения DNA Sequence Analysis v.5.2 (Applied Biosystems) и проверяли посредством визуального анализа с использованием Chromas (Technelysium Pty Ltd) и BioEdit (Ibis Biosciences).

Родовую идентификацию осуществляли с использованием базы данных Ribosomal Database Project (Wang Q., et al., "Naive Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy", Appl. Environ. Microbiol., 2007, том 73, стр. 5261-5267). Видовую идентификацию осуществляли путем сравнения полученных последовательностей с 16S последовательностями известных организмов из двух баз данных: RefSeq (http://www.ncbi.nlm.nih.gov/RefSeq/) с помощью BLASTN и Ribosomal Database Project tool (http://rdp.cme.msu.edu), JR Cole et al, "The Ribosomal Database Project (RDP-II): introducing myRDP space and quality controlled public data", Nucl. Acids Res. 2007, т. 35, стр. 169-172).

Таблица 1
Праймеры, используемые для амплификации и секвенирования
гена 16S
Этап Праймер Ориентация 5'→3' секвенирование
Амплификация Eub27f прямая GAGTTTGATCCTGGCTCAG (SEQ ID NO:1)
Eub1492r обратная TACGGYTACCTTGTTACGACTT (SEQ ID NO:2)
Секвенирование 27f прямая AGAGTTTGATCCTGGCTCAG (SEQ ID NO:3)
357f прямая CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCCCCTACGGGAGGCAGCAG (SEQ ID NO:4)
907r обратная CCGTCAATTCCTTTGAGTTT (SEQ ID NO:5)
1492r обратная GGTTACCTTGTTACGACTT (SEQ ID NO:6)

В) Результаты

С помощью инструмента базы данных RDP (Ribosimal Database Project) идентифицировали принадлежность штамма F2096 к виду Lactobacillus plantarum и принадлежность штамма I3141 к виду Lactobacillus plantarum.

2.2. Генотипирование штамма

А) Методики

Исследование проводили с помощью геномного расщепления и гель-электрофореза в пульсирующем поле. Штаммы F2096 и I3141 исследовали в соответствии с вышеописанным протоколом (Rodas AM, et al. "Polyphasic study of wine Lactobacillus strains: taxonomic implications", Int J Syst Evol Microbiol, 2005, т. 55, стр. 197-207.). В исследование также были включены коммерческие штаммы Lactobacillus plantarum 299v, Lactobacillus plantarum VSL#3, Lactobacillus casei VSL#3 и Lactobacillus casei DN 114.001 в качестве контрольных штаммов. Все штаммы выращивали на чашках с MRS агаром и инкубировали при 37ºC, 5% CO2 в течение 18 часов. Клетки собирали и трижды промывали в 8 мл PET (10 мМ Трис, рН 7,6, 1 M NaCl), затем центрифугировали при 6000 об/мин в течение 10 минут. Полученные осадки ресуспендировали в 700 мкл лизирующего буфера (6 мМ Трис, 1 М NaCl, 0,1 М ЭДТА, 0,5% SLS, 0,2% дезоксихолевая кислота, лизоцим 1 мг/мл, мутанолизин 40 ЕД/мл; РНКаза 20 г/мл). В ресуспендированные клетки добавляли равный объем 1,6% агарозы с низкой температурой плавления (FMC BioProducts, Rockland, ME, USA) и оставляли для затвердевания при 4ºС в течение 1 часа. Вставки переносили в 2 мл лизирующего буфера II (0,5 М ЭДТА, рН 9,2, 1% N-лаурил-саркозин и проназа 1 мг/мл) и инкубировали при 50ºC в течение 48 часов. Затем вставки промывали при комнатной температуре ТЕ-буфером (10 мМ Трис, 1 мМ ЭДТА, рН 8,0). Тотальное расщепление ДНК осуществляли с помощью ферментов рестрикции Sfi-I и Sma-I (Roche Diagnostics).

Электрофорез в пульсирующем поле проводили с использованием оборудования CHEF DRIII (BioRad Laboratories). Вставки помещали в 1% агарозный гель (агароза SeaKem ME, FMC BioProducts, ME, USA). В таблице 2 приведены условия электрофореза для каждого фермента. Маркерами молекулярной массы ДНК являлись Lambda ladder PFG Marker и Low Range PFG Marker (New England Biolabs). После электрофореза гель окрашивали бромидом этидия и УФ с использованием системы GelDoc Systems (BioRad).

Таблица 2
Условия электрофореза для геномной ДНК,
рестриктированной Sfi-I и Sma-I из штаммов F2096 и I3141
Фермент Блок Начальный импульс (сек) Конечный импульс (сек) Время (часы)
Sfi-I 1 2 10 10
2 15 25 6
Sma-I 1 0,5 5 16

В) Результаты

Как показано на фиг.1, картина электрофореза в пульсирующем поле с рестрикцией Sfi-I и Sma-I у штамма F2096 отличается от картины электрофореза у коммерческих штаммов plantarum Lactobacillus 299v и Lactobacillus plantarum VSL#3, при этом рестрикционная карта штамма I3141 отличалась от рестрикционной карты близкородственных коммерческих штаммов Lactobacillus casei. Таким образом, можно сделать вывод, что штаммы F2096 и I3141 являются новыми штаммами.

3. Способность к антагонистическому действию на патогены

А) Методики

Для оценки проявления антагонистического действия проводили исследования штаммов F2096 и I3141 по протоколу Кэмпбелла (Campbell) с использованием чашек с агаром, на которые высевали бактериальные патогены в среде Oxoid. Используемые в этом исследовании патогены выбирали из числа бактерий, обычно присутствующих в ротовой полости человека (смотрите таблицу 1). Коротко, штаммы F2096, I3141 и другой штамм P. acidilactici, выделенный из слюны человека, инкубировали в течение ночи, каждый штамм инкубировали при конкретных условиях, указанных выше. После инкубации культуры стандартизировали до 108 КОЕ/мл, и приготовляли следующие смешанные культуры: F2096+I3141, F2096+P. acidilactici и I3141+P. acidilactici. Указанные смешанные культуры содержали равное количество каждого из содержащихся в них штаммов и, будучи одноштаммовыми культурами, имели одинаковую суммарную концентрацию бактерий, а именно 108 КОЕ/мл. Фиксированные объемы каждой одноштаммовой культуры и смешанных культур равномерно высевали и выращивали до уровня конфлюэнтности при подходящей температуре в инкубаторе с 5% СО2.

Затем цилиндрические срезы одинакового размера с конфлюэнтных агаровых пластинок засевали газоном послойно на чашку с патогеном и инкубировали в течение ночи при 37ºC.

На следующий день зоны ингибирования измеряли путем размещения агаровой пластинки над плоской линейкой. Антагонистические свойства штаммов измеряли по активности ингибирования роста (GIA), которую рассчитывали путем вычитания значения диаметра цилиндра (CD) из значения диаметра зоны ингибирования (IZD) и деления полученной разности на два по следующей формуле GIA=(IZD-CD)/2. Ингибиторные способности штаммов настоящего изобретения сравнивали со способностями коммерческих пробиотических штаммов из полости рта Streptococcus salivarius K12 и Lactobacillus reuteri ATCC 55730.

B) Результаты

Значения активности ингибирования роста штаммов F2096 и I3141 приведены в таблице 3. Результаты являются средними значениями из трех экспериментов.

Таблица 3
Активность ингибирования роста патогенов полости рта
P. gingivalis F. nucleatum T. denticola P. denticola S. mutans F2096 I3141
F2096 1 4 4.5 ОИ 2 - ОИ
I3141 ОИ 7 1 0,5 2 ОИ -
F2096+ I3141 1,5 9 4.5 1 4 - -
F2096+P. acidilactici 0,5 1 4 ОИ 1 - -
I3141+P. acidilactici ОИ 5 0.5 ОИ ОИ - -
S. salivarius ОИ ОИ 1 0.5 1 - -
L. reuteri ОИ 0,5 ОИ 0,75 1 - -
ОИ - отсутствие ингибирования

Полученные результаты свидетельствуют, что штаммы P2096 и I3141 обладают действием подавления широкого спектра патогенов полости рта. Это особенно актуально для P. gingivalis, так как предварительные исследования показали, что антагонистическая активность в отношении этого патогена является редкой (результаты не показаны). Дополнительно, следует отметить более высокую антагонистическую активность в отношении патогенов полости рта при комбинации F2096 и I3141 в смешанной культуре по сравнению с активностью каждого из штаммов, используемых по отдельности в качестве одноштаммовых культур, также необходимо отметить, что концентрация каждого штамма в смешанной культуре составляет половину от его концентрации в одноштаммовой культуре, поэтому антагонистический эффект комбинации превышает суммарный эффект отдельного действия указанных штаммов. Такой синергический эффект не возникал, когда каждый из упомянутых штаммов комбинировали с другим постоянным микроорганизмом ротовой полости P. acidilactici. Таким образом, штаммы по изобретению проявляют синергетическое действие по отношению к патогенам полости рта и являются особенно полезными при использовании их в единой рецептуре.

По сравнению с коммерческими пробиотиками Streptococcus salivarius K12 и Lactobacillus reuteri ATCC 55730 штаммы по изобретению обладают значительно более выраженными антагонистическими способностями. Наконец, штаммы F2096 и I3141 проявляли минимальный антагонизм по отношению друг к другу или к распространенным комменсальным штаммам микрофлоры ротовой полости человека.

4. Образование агрегатов

А) Методики

Способность к образованию агрегатов оценивали путем регистрации снижения оптической плотности, обусловленного образованием агрегатов и осадка, при 620 нм в культурах в течение ночи. Процентное значение способности к агрегации (% AC) рассчитывали по следующей формуле: % AC=(1-(ODtf/ODt0)/100, где ODtf и ODt0 представляют собой значения оптической плотности в конечной и начальной точке времени, соответственно. Значение OD в начальной точке времени корректировали таким образом, чтобы все культуры содержали эквивалентное количество КОЕ/мл. Комбинированные культуры получали путем смешивания соответствующего количества одноштаммовых культур до получения желательного значения КОЕ/мл с содержанием 50% каждого штамма.

В) Результаты

Способность к образованию агрегатов является важной для пробиотических штаммов, применяемых для здоровья полости рта, поскольку она дает возможность указанным штаммам уменьшать зубной налет или тормозить его образование путем противодействия образованию биопленок патогенными микроорганизмами.

В таблице 4 приведены средние значения способности к образованию агрегатов у новых штаммов и их комбинаций между собой или комбинаций с P. acidilactici или L. brevis CD2 по сравнению с контрольными штаммами. Эти результаты наглядно демонстрируют, что новые изоляты проявляют очень хорошую агрегационную активность, которая значительно превышает активность и коммерческих штаммов, и контрольных штаммов S. salivarius K12 и L. reuteri ATTC 55730. Дополнительно, при объединении обоих штаммов в смешанной культуре штаммы по изобретению увеличивают образование агрегатов, и это означает, что объединение этих штаммов в единую композицию повышает эффективность вытеснения патогенных бактерий. Вместе с тем, такая кооперация отсутствует, если штаммы по изобретению по отдельности комбинируют с другими штаммами с хорошей способностью к агрегации, например, со штаммами P. acidilactici и L. brevis CD2. Кроме того, антагонистический эффект наблюдается при комбинации штаммов по изобретению со штаммом L. brevis CD2, и это означает, что штаммы по изобретению в комбинации с L. brevis CD2 обладают меньшей эффективностью по вытеснению патогенных бактерий.

Таблица 4
Способность к агрегации (%)
Штамм Способность к агрегации (%)
F2096 56,00
I3141 22,73
F2096+I3141 64,73
F2096+P. acidilactici 55,50
I3141+P. acidilactici 23,30
L. brevis CD2 24,70
F2096+L. brevis CD2 36,31
I3141+L. brevis CD2 28,50
S. salivarius 16,67
L. reuteri 0,00

5. Выработка кислоты

А) Методики

Оценивали способность новых штаммов вырабатывать кислоту при выращивании в культуральной среде с добавлением различных сахаров, присутствующих в рационе человека. Штаммы выращивали в течение 18 часов при 37ºС и 5% СО2 в следующих средах: в среде MRS и в минимальной среде с добавлением 4% глюкозы, 4% фруктозы, 4% лактозы или 4% сахарозы. Минимальная среда содержит 2 г/л пептонной воды, 2 г/л дрожжевого экстракта, 0,1 г/л NaCl, 0,04 г/л K2HPO4, 0,04 г/л KH2PO, 0,01 г/л MgSO4×7H2O, 0,01 г/л CACl2×6H2O, 2 г/л NaHCO3, 0,05 г/л гемина (растворенного в нескольких каплях 1 моль/л NaOH), 0,5 г/л цистеин-HCl, 0,5 г/л солей желчных кислот, 2 г/л Твин-80 и 10 мкл витамина K1 (все компоненты получены в компании Sigma-Aldrich Chem, Испания). Уровень рН культур доводили до рН 7 при помощи HCl. В конце периода культивирования измеряли уровень рН и количество жизнеспособных клеток (КОЕ/мл). Показатели выработки кислоты (PA) для каждой культуральной среды рассчитывали по следующей формуле: значение PA=рН×log (КОЕ/мл).

В) Результаты

Согласно приведенной выше формуле, низкие значения относятся к высокоацидогенным штаммам. Большая выработка кислоты является нежелательным побочным эффектом для пробиотиков полости рта, поскольку она способствует возникновению кариеса. Показатели выработки кислоты штаммов F2096 и I3141 и ряда контрольных пробиотических штаммов, выращенных на различных сахарах, а также показатели, полученные для коммерческих штаммов, показаны в таблице 5. Минимальная среда обозначена буквами МС.

Таблица 5
Выработка кислоты
штамм среда MRS MC+ глюкоза МС+ фруктоза МС+ лактоза MC+ сахароза
F2096 32,7 30,34 28,56 31,45 31,67
I3141 42,04 48,28 45,24 58,24 59,12
L. brevis CD2 26,45 31,24 24,24 21,45 24,20
S. salivarius 41,37 29,69 31,31 28,03 29,85
L. reuteri 36,75 49,19 45,67 34,01 57,39
L. paracasei 27,38 19,53 8,21 5,98 20,52
P. pentosaceus 24,7 11,34 13,23 12,56 17,45
P. acidilactici 22,6 15,61 11,10 16,45 22,14

Полученные результаты показывают, что рост штаммов F2096 и I3141 в разных сахарах приводит к очень слабой выработке кислоты по сравнению с другими штаммами бактерий, которые выделены также из полости рта, а именно L. paracasei, P. pentosaceus и P. acidilactici. Штаммы по изобретению также являются менее ацидогенными, чем коммерческий пробиотик полости рта S. salivarius K12.

Дополнительно, штамм I3141 имеет более низкий профиль подкисления по сравнению с L. reuteri ATTC 55730, ацидогенность которого считается особенно низкой и который присутствует на современном рынке в качестве противокариесного пробиотика. Также следует отметить, что штамм по изобретению L. brevis I3141 имеет значительно более низкий профиль подкисления по сравнению с коммерческим штаммом L. brevis CD2. Таким образом, штаммы F2096 и I3141 имеют низкий профиль подкисления, и в этой связи подходят для применения в целях здоровья полости рта.

6. Выработка летучих соединений с неприятным запахом

А) Методика

Новые штаммы выращивали в культуральной среде, сходной с рационом человека, и с помощью сенсорных тестов оценивали их на выработку летучих соединений с неприятным запахом. Коротко, штаммы выращивали в среде, содержащей глюкозу (0,5% вес/объем), фруктозу (0,5% вес/объем), дрожжевой экстракт (1% вес/объем), мясной экстракт (1% вес/объем), эукариотические клетки (200 клеток/мл) и пектин (0,5% вес/объем), в течение 48 часов при температуре 37ºС и 5% CO2. В полученных штаммах показано образование неприятного запаха со значениями от 1 до 5, где показатель 1 означает отсутствие запаха, и показатель 5 означает очень неприятный запах.

В) Результаты

Выработка соединений с неприятным запахом является очень нежелательной для пробиотика полости рта. При этом штаммы по изобретению вообще не вырабатывают каких-либо неприятных запахов при выращивании в культуральной среде, которая сходна с рационом человека.

Таблица 6
Выработка неприятных запахов
Штамм Показатель неприятного запаха
F2096 2
I3141 2
S. salivarius 2
L. reuteri 3

7. Выживаемость в условиях полости рта

А) Методика

Изучали выживаемость штаммов в полости рта с помощью воздействия стрессовыми условиями в полости рта. Каждый штамм бактерий в количестве 5×107 КОЕ засевали в 96-луночные культуральные планшеты в 200 мкл среды, используя среду MRS для штаммов F2096, I3141 и L. reuteri ATCC 55730 или триптический соевый бульон (TSB, Oxoid) для штамма S. salivarius K12. В культуры добавляли лизоцим (Sigma-Aldrich Chem, Испания) в физиологической концентрации или перекись водорода (Sigma-Aldrich Chem., Испания). Планшеты инкубировали при 37ºС и 5% СО2 в течение шести часов. Количественное определение роста бактерий проводили путем измерения оптической плотности при 620 нм. Полученные показатели роста бактерий сравнивали с ростом, которого достигает этот штамм в стандартной среде MRS без добавок.

В) Результаты

Процентное значение общей выживаемости (% SV) рассчитывали следующим образом: % SV=[(ODtf-ODt0 (с добавками))/(ODtf-ODt0 (без добавок))]×100, где OD обозначает оптическую плотность, и tf и t0 обозначают конечную точку времени и начальную точку времени, соответственно. Следующие значения являются средними показателями трех результатов:

Таблица 7
Выживаемость в условиях полости рта
Штамм среда MRS/TSB лизоцим
2×105 МЕ/мл
среда MRS/TSB
H2O2 1 мМ
среда MRS/TSB
H2O2 2,5 мМ
F2096 44,41 98,78 62,60
I3141 0,58 42,06 84,28
S. salivarius 0,50 18,89 28,78
L. reuteri -17,46 31,32 -8,03

Новые штаммы F2096 и I3141 показали более высокую устойчивость к стрессовым условиям полости рта, чем коммерческие штаммы S. salivarius K12 и L. reuteri ATCC 55730.

8. Способность к адгезии к тканям полости рта

А) Способы

Проводили тесты in vitro на адгезию штаммов F2096, I3141 и контрольных коммерческих штаммов к свиному кишечнику и языку, к клеткам Caco-2 (для имитации слизистой оболочки, покрывающей альвеолярную часть челюсти) и к шарикам из гидроксиапатита (ГА) (для имитации зубов). Каждый штамм инкубировали в течение ночи с добавлением 10 мкл/мл 5-[3Н]тимидина (1,0 мкКи/мл, Amersham Biosciences, Великобритания). Препараты центрифугировали и полученные осадки ресуспендировали в концентрации 108 КОЕ/мл в ФБР буфере. Излучение тритиевых меток, включенных в микроорганизмы, рассчитывали в сцинтилляционном ридере (Wallac 1410) по исходному тритиевому излучению и излучению супернатанта. Отношение этого числа (излучение от включения в биомассу) и общего количества микроорганизмов в культуре выражается формулой имп/мин/КОЕ (импульс/бактерия).

Измерение адгезии проводили путем добавления 3,3 мл каждого штамма с меткой в количестве 108 КОЕ или к фрагментам свиного языка размером 1,05×0,5 см, или к предварительно инкубированным клеткам Caco-2, или к шарикам ГА в количестве 50 мг (80 мкм в диаметре) на планшеты ELISA. Через 45 минут аккуратно удаляли супернатанты. Шарики ГА (вместе с адгезированными бактериями) восстанавливали с помощью центрифугирования. Фрагменты языка или клетки Caco-2 вместе с адгезированными бактериями отскребали от планшета ELISA. В конце восстановленные бактерии лизировали для подсчета удельной радиоактивности (имп/мин/КОЕ).

Все анализы проводили трижды, и результаты выражали как количество адгезированных бактерий на см2. Штамм S. salivarius показал более высокие результаты в отношении большинства исследуемых свойств (смотрите результаты выше), поэтому указанный штамм использовали в качестве контрольного штамма для анализа адгезии.

В) Результаты

Таблица 8
Адгезия к тканям полости рта
Штамм Язык (КОЕ/см2) Клетки Caco-2 (КОЕ/см2) Шарики ГА (КОЕ/см2)
F2096 8,84E+06 1,00E+06 2,30E+06
I3141 2,70E+06 3,78E+04 5,51E+05
S. salivarius 1,72E+06 8,83E+04 2,34E+05

Эти результаты показывают, что штаммы F2096 и I3141 обладают способностью к адгезии к тканям полости рта, значительно превышающей способности пробиотических штаммов полости рта S. salivarius K12. Способность к адгезии к тканям полости рта является актуальным признаком штаммов, предназначенных для использования в качестве пробиотиков, поскольку этот признак придает указанным бактериям конкурентное преимущество при конкуренции с патогенами за участки адгезии сайтов и способствует сохранению постоянной среды в полости рта. Таким образом, штаммы, проявляющие хорошую адгезию к тканям полости рта, способствуют вытеснению патогенов из полости рта и содействуют оздоровлению микрофлоры полости рта.

9. Чувствительность к антибиотикам

А) Способы

Чувствительность к антибиотикам штаммов F2096 и 12141 исследовали согласно методическому руководству Европейского управления по безопасности пищевых продуктов (EFSA) ("Update of the criteria used in the assessment of bacterial resistance to antibiotics of human or veterinary importance". The EFSA Journal, 2008, том 732, с. 1-15). Применяли следующие условия культивирования штаммов: рост на поверхности чашек с MRS агаром, содержащим рекомендованные EFSA концентрации антибиотиков, при 37ºС и 5% СО2.

В) Результаты

Рост штаммов на среде, содержащей антибиотик, показан в таблице 9. Концентрации каждого исследуемого антибиотика соответствовали рекомендациям EFSA и приведены в мг/мл. Отсутствуют указания по значениям концентрации антибиотиков для видов L. brevis, согласно EFSA, следовательно, устойчивость к антибиотикам штамма L. brevis I3141 анализировали с использованием концентраций, рекомендованных для облигатных гетероферментативных лактобактерий, к группе которых относится указанный вид.

Результаты показывают отсутствие устойчивости к антибиотикам у штаммов F2096 и 12141. Таким образом, они подходят для потребления человеком.

Таблица 9
Устойчивость к антибиотикам штаммов F2096 и I3141
Концентрация L. plantarum по EFSA Рост F2096 Концентрация облигатных гетероферментативных лактобактерий по EFSA Рост I3141
Ампициллин 2 отсутствует 2 отсутствует
Гентамицин 16 отсутствует 16 отсутствует
Канамицин 64 отсутствует 16 отсутствует
Стрептомицин н.р. отсутствует 64 отсутствует
Эритромицин 1 отсутствует 1 отсутствует
Клиндамицин 1 отсутствует 1 отсутствует
Хинупристин/ дальфопристин 4 отсутствует 4 отсутствует
Тетрациклин 32 отсутствует 8 отсутствует
Хлорамфеникол 8 отсутствует 4 отсутствует
н.р. - не рекомендовано EFSA

Библиографические ссылки

Twetman S, et al. “Short-term effect of chewing gums containing probiotic Lactobacillus reuteri on the levels of inflammatory mediators in gingival crevicular fluid”. Acta Odontol Scand, 2009, vol. 67, p. 19-24.

Caglar E, et al. “Salivary mutans streptococci and lactobacilli levels after ingestion of the probiotic bacterium Lactobacillus reuteri ATCC 55730 by straws or tablets”. Acta Odontol Scand, 2009, vol. 64, p. 314-318.

Stamatova I, et al. “In vitro evaluation of yoghurt starter lactobacilli and Lactobacillus rhamnosus GG adhesion to saliva-coated surfaces”. Oral Microbiol Immunol, 2009, vol. 24, p. 218-223.

Burton JP, et al. “Preliminary study of the effect of probiotic Streptococcus salivarius K12 on oral malodor parameters”. J Appl Microbiol, 2006, vol. 100, p. 754-764.

Wang Q, et al., "Naive Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy", Appl Environ Microbiol, 2007, vol. 73, p. 5261-5267.

Ribosomal Database Project: http://rdp.cme.msu.edu/

J.R. Cole et al., "The Ribosomal Database Project (RDP-II): introducing myRDP space and quality controlled public data", Nucl. Acids Res., 2007, vol. 35, p. 169-172.

Rodas AM, et al. "Polyphasic study of wine Lactobacillus strains: taxonomic implications", Int J Syst Evol Microbiol, 2005, vol. 55, p. 197-207.

“Update of the criteria used in the assessment of bacterial resistance to antibiotics of human or veterinary importance”. The EFSA Journal, 2008, vol. 732, p. 1-15.

1. Штамм Lactobacillus plantarum, депонированный в Испанской коллекции типовых культур под номером доступа СЕСТ 7481, имеющий способность к выживанию в стрессовых условиях в полости рта, способность к адгезии к тканям полости рта, способность к формированию агрегатов и способность к ингибированию патогенов в полости рта.

2. Штамм Lactobacillus brevis, депонированный в Испанской коллекции типовых культур под номером доступа СЕСТ 7480, имеющий способность к выживанию в стрессовых условиях в полости рта, способность к адгезии к тканям полости рта, способность к формированию агрегатов и способность к ингибированию патогенов в полости рта.

3. Композиция для профилактики или лечения расстройства в полости рта, содержащая Lactobacillus plantarum по п. 1 и Lactobacillus brevis по п.2.

4. Композиция согласно п.3, где указанное расстройство полости рта вызвано патогенами полости рта у животных, в том числе у человека.

5. Композиция по п.4, в которой расстройством полости рта является расстройство, обусловленное зубным налетом.

6. Композиция по п.5, в которой расстройство, обусловленное зубным налетом, представляет собой гингивит, пародонтит, кариес или чувствительность зубов.

7. Композиция по п.4, в которой расстройство полости рта представляет собой галитоз.

8. Композиция по п.4, в которой расстройство полости рта представляет собой кандидоз.

9. Пробиотический продукт для улучшения здоровья полости рта, содержащий композицию по п.3 и приемлемый ингредиент.

10. Фармацевтическая композиция для профилактики или лечения расстройства в полости рта, содержащая фармацевтически эффективное количество Lactobacillus plantarum по п.1 и Lactobacillus brevis по п.2, по меньшей мере один фармацевтически приемлемый наполнитель.

11. Фармацевтическая композиция согласно п.10, где указанное расстройство полости рта вызвано патогенами полости рта у животных, в том числе у человека.

12. Фармацевтическая композиция по п.11, в которой расстройством полости рта является расстройство, обусловленное зубным налетом.

13. Фармацевтическая композиция по п.12, в которой расстройство, обусловленное зубным налетом, представляет собой гингивит, пародонтит, кариес или чувствительность зубов.

14. Фармацевтическая композиция по п.11, в которой расстройство полости рта представляет собой галитоз.

15. Фармацевтическая композиция по п.11, в которой расстройство полости рта представляет собой кандидоз.

16. Пищевой продукт для улучшения здоровья полости рта, содержащий Lactobacillus plantarum по п.1, Lactobacillus brevis по п.2 и по меньшей мере один пищевой ингредиент.

17. Пищевой продукт по п.16, который представляет собой пищевую добавку.

18. Косметическая композиция для облегчения или профилактики симптомов, вызванных расстройством в полости рта, содержащая Lactobacillus plantarum по п.1, Lactobacillus brevis по п.2 и по меньшей мере один косметически приемлемый наполнитель.

19. Продукт по уходу за полостью рта, содержащий эффективное количество фармацевтической композиции согласно п.10, или пищевого продукта согласно п.16, или косметической композиции согласно п.18.

20. Продукт по уходу за полостью рта согласно п.19, который представляет собой жевательную резинку, зубную пасту, спрей для рта, пастилку или диспергируемую в полости рта таблетку.



 

Похожие патенты:

Изобретение относится к биотехнологии, в частности к штаммам грибам-продуцентам биологически активных веществ. Штамм Laetiporus sulphureus 3Х, обладающий широким спектром различных биологически активных веществ, депонирован во Всероссийской коллекции промышленных микроорганизмов под регистрационным номером ВКПМ F-1188 и может быть использован при производстве биологически активных добавок.

Изобретение относится к биотехнологии и медицинской промышленности. Предложен способ получения террилитина.

Изобретение относится к области биотехнологии, в частности к рекомбинантной продукции белков человека, и может быть использовано для получения белка SLURP-2 человека.

Изобретение относится к биотехнологии и может быть использовано при промышленном получении биомассы диатомовой водоросли Cylindrotheca closterium. Способ предусматривает выращивание культуры диатомовой водоросли Cylindrotheca closterium в течение 7-10 суток в плоскопараллельных культиваторах с рабочей толщиной слоя 2-5 см при круглосуточном освещении 13,5 клк на модифицированной питательной среде до плотности 5-7 г сухой биомассы на 1 л культуры.

Изобретение относится к медицинской микробиологии. Питательная среда для выделения Legionella pneumophila содержит автолизат селезенки КРС, агар микробиологический, уголь активированный, калия фосфат однозамещенный, калия фосфат двузамещенный, мезоинозит, L-цистеин, соль Мора, полимиксин, ванкомицин, амфотерицин и дистиллированную воду в заданном соотношении компонентов.
Изобретение относится к биотехнологии. Штамм Lactobacillus helveticus М-16, обладающий высокой антагонистической активностью, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-11176 и может быть использован при производстве кисломолочных продуктов и пробиотических препаратов.

Изобретение относится к области биотехнологии, конкретно к рекомбинантной продукции белков, и может быть использовано для получения антимикробного пептида аципенсина-1 русского осетра Acipenser gueldenstaedtii.
Изобретение относится к биотехнологии. Штамм Lactobacillus fermentum В1-I, обладающий высокой антагонистической активностью, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-10888 и может быть использован при производстве кисломолочных продуктов и пробиотических препаратов.

Группа изобретений относится к области обработки сточных вод. Предложен способ биологической обработки сточных вод (варианты) и способ с интегрированной фиксированной пленкой активного ила для удаления аммония из сточных вод.

Изобретение относится к области биотехнологии и касается штамма риккетсий "Приморье - 25/81". Охарактеризованный штамм является представителем вида Rickettsia heilongjiangensis.

Изобретение относится к биотехнологии и предназначено для получения биоразрушаемых сополимеров 3-гидроксимасляной и 4-гидроксимасляной кислот [П(3ГБ/4ГБ)], обладающих свойствами эластомеров, перспективных для различных сфер применения: в медицине, в фармакологии.
Изобретение относится к микробиологии. Предлагается способ усиления бактериальной адгезии к вагинальным эпителиоцитам.

Изобретение касается средства, обладающего противовирусной активностью относительно вирусов гриппа, осповакцины (ВОВ), вируса оспы мышей (ВОМ) и вируса герпеса 2-го типа (ВПГ-2) Представлено средство на основе нуклеазы бактерий рода Serratia.

Изобретение относится к медицинской микробиологии. Питательная среда для выделения Legionella pneumophila содержит автолизат селезенки КРС, агар микробиологический, уголь активированный, калия фосфат однозамещенный, калия фосфат двузамещенный, мезоинозит, L-цистеин, соль Мора, полимиксин, ванкомицин, амфотерицин и дистиллированную воду в заданном соотношении компонентов.
Изобретение относится к биотехнологии. Штамм Lactobacillus helveticus М-16, обладающий высокой антагонистической активностью, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-11176 и может быть использован при производстве кисломолочных продуктов и пробиотических препаратов.
Изобретение относится к области биотехнологии. Способ выращивания и разведения чайного гриба предусматривает культивирование чайного гриба в условиях аэрации при температуре 23-25°C в слабом растворе чая с растворенным в нем сахаром, выдержку в течение 5-6 дней, процеживание и слив готового напитка чайного гриба в банку-приемник в количестве 450-500 мл.

Группа изобретений относится к вариантам композиции, способной увеличивать образование масляной кислоты в толстом кишечнике. Предложена неферментированная композиция, включающая по меньшей мере один злак и по меньшей мере один изолированный пробиотический штамм Lactobacillus rhamnosus.

Изобретение относится к ветеринарии и может быть использовано для лечения собак с инфекционными гингивитами, пародонтитами и зубным камнем. Для этого проводят распыление или промывание ротовой полости животных антисептическим раствором.
Наверх