Олигонуклеотидные праймеры, флюоресцентный зонд и способ для выявления генома вируса эпизоотической диареи свиней методом обратной транскрипции - полимеразной цепной реакции

Группа изобретений относится к области молекулярной биологии и генодиагностики, а именно к синтетическим праймерам, комплементарным высококонсервативной области гена N генома вируса эпизоотической диареи свиней (ЭДС) и способу выявления ЭДС. Способ выявления вируса основан на постановке полимеразной цепной реакции с этапом обратной транскрипции с использованием праймеров 5′-accagcaaattgggtactg-3′, 5′-cctgttccgaggtagtagaa-3′ и TaqMan зонда 5′-FAM-ccgtggt(RTQ1)gagcgaattgaacaacc-3′. Далее проводят амплификацию РНК вируса. Затем осуществляют оценку проведения реакции, при этом результат реакции считается положительным, если Ct>33. Использование данных изобретений позволяет повысить чувствительность метода ПЦР. 2 н.п. ф-лы, 4 табл., 1 пр.

 

Изобретение относится к области молекулярной биологии и генодиагностики, а именно к синтетическим праймерам, комплементарным высококонсервативной области гена N генома вируса эпизоотической диареи свиней (ЭДС), использующимся для выявления РНК вируса. Изобретение может быть использовано в ветеринарной вирусологии и генодиагностики.

Эпизоотическая (эпидемическая) диарея свиней (ЭДС) - остро протекающее, контагиозное заболевание свиней, характеризующееся изнурительной диареей, дегидратацией организма и высокой смертностью. Возбудителем ЭДС является РНК-содержащий вирус, принадлежащий порядку Nidovirale, семейству Coronaviridae, подсемейству Coronavirinae. На основе антигенных и генетических критериев вирус ЭДС вместе с коронавирусами человека NL63 и 229Е и несколькими коронавирусами летучих мышей принадлежат роду Alphacoronavirus [2, 5].

Заболеванию подвержены свиньи всех возрастных групп, но наибольшей восприимчивостью обладают новорожденные поросята до двухнедельного возраста, среди которых смертность достигает от 30 до 100%. С послеотъемного возраста летальный исход среди свиней составляет 1-3% [4].

Высокая смертность поросят при заболевании эпизоотической диареей свиней обуславливают необходимость разработки экспресс-методов диагностики ЭДС с целью быстрого и своевременного принятия карантинных мер и профилактических мероприятий. Одним из таких методов является полимеразная цепная реакция (ПЦР), которая уже нашла широкое применение в диагностических исследованиях в ветеринарии.

Известны несколько методов лабораторной диагностики ЭДС, такие как метод флюоресцирующих антител (МФА), прямая электронная микроскопия, реакция иммуноферментного анализа (ИФА). В сомнительных случаях ставят биопробу на безмолозивных поросятах. Однако в некоторых случаях применение этих методов не дает четких результатов, например при исследовании разложившихся патматериалов или объектов ветсаннадзора. Кроме того, перед постановкой реакции требуется предварительное приготовление суспензии органов, что достаточно трудоемко [1, 3].

Аналогом изобретения на Российском рынке может служить тест-система "ЭДС" для выявления вируса эпидемической диареи свиней методом полимеразной цепной реакции (ФБУН ЦЦНИИ Эпидемиологии Роспотребнадзора, г. Москва). В данной тест-системе используется стандартный Taq-man зонд. Преимуществом разработанного нами изобретения является использование зонда с внутренним гасителем флюоресценции, что позволяет увеличить чувствительность и специфичность реакции.

Целью изобретения является разработка более специфичного, чувствительного экспресс-метода для выявления вируса ЭДС с помощью ОТ-ПЦР в режиме реального времени с использованием пары синтезированных олигонуклеотидных праймеров и TaqMan зонда, комплементарных к консервативной области гена N генома вируса, позволяющего амплифицировать фрагмент комплементарной ДНК размером 102 п. о.

Для достижения поставленной цели были подобраны и синтезированы (ООО «Евроген», г. Москва) специфические праймеры и зонд для идентификации возбудителя ЭДС, которые используются для синтеза кДНК и постановки ПНР:

Способ обнаружения РНК вируса ЭДС в пробах органов, образцах крови инфицированных свиней включает предварительный этап денатурации РНК и отжига праймеров при 94°C в течение 5 мин с последующим синтезом кДНК при 42°C в течение 30 мин. Реакция ПЦР включает 40 циклов амплификации: 94°C - 10 с, 60°C - 15 с, 72°C - 15 с. Затем проводят оценку и учет результатов реакции.

Техническим результатом изобретения является общедоступность, безопасность, чувствительность, а также сокращение времени проведения диагностической работы с целью выявления генома вируса эпизоотической диареи свиней.

Сущность изобретения заключается в том, что выявление генома вируса ЭДС проводят методом полимеразной цепной реакции в режиме реального времени, предусматривающим амплификацию кДНК вируса и учет результатов реакции. При наличии в исследуемых образцах вируса ЭДС синтезируется ДНК-фрагмент длиной 102 п.о. Результат считается положительным при Ct>33.

Существенным отличием заявляемого способа является то, что:

1. Данный способ позволяет определять наличие возбудителя у инфицированных животных на ранних сроках после заражения.

2. Применение данного способа позволяет сократить трудозатраты и время исследования.

Расчет первичной структуры олигонуклеотидных праймеров.

Для идентификации вируса эпизоотической диареи свиней методом полимеразной цепной реакции необходимо было определить участок генома, нуклеотидная последовательность которого позволяла бы дифференцировать данный вирус от других представителей рода Coronavirus и Rotaviridae и одновременно являлась бы достаточно консервативной для различных штаммов и изолятов вируса ЭДС. Проанализировав данные литературы, мы пришли к выводу, что геномом, подходящим для идентификации ЭДС, является ген N.

Подбор праймеров осуществляли на основе анализа нуклеотидных последовательностей штаммов и изолятов возбудителя ЭДС, имеющихся в базе данных GeneBank [http://www.ncbi.nlm.nih.gov/genbank]. Множественное выравнивание и анализ последовательностей осуществляли с помощью компьютерной программы «BioEdit 6.0». Для расчета праймеров был выбран участок высококонсервативной области гена N (233 п.о. - 335 п.о). Расчет и анализ олигонкулеотидов проводили с использованием компьютерной программы «OLIGO 6.0». Для подбора и анализа праймеров использовали референтную последовательность гена N штамма CV777 вируса эпизоотической диареи свиней (Porcine epidemic diarrhea virus strain CV777 nucleocapsid protein (N) gene, complete cds. - DQ355221.1).

Постановка реакции обратной транскрипции и ПЦР в режиме реального времени.

Проводят отжиг праймеров, для чего в предварительно промаркированные пробирки объемом 0,2 мл вносят по 8 мкл РНК, по 1 мкл каждого праймера и 5 мкл бидистиллированной воды.

Денатурацию РНК и отжиг праймеров проводят в амплификаторе при температуре 94°C в течение 5 минут.

В отдельной пробирке готовят общую реакционную смесь на N образцов, в число которых входят положительный контроль (с водным раствором РНК вируса ЭДС) и отрицательный контроль (с бидистиллированной водой). Реактивы вносят в последовательности, приведенной в таблице. Фермент добавляют в последнюю очередь.

Пробы инкубируют при температуре 42°C 30 минут в амплификаторе. После окончания инкубации кДНК используют для дальнейшего анализа или хранят при -20°C 2 недели.

В отдельной пробирке объемом 0,2 мл готовят общую реакционную смесь на N образцов, в число которых входят положительный и отрицательный контроли. Реактивы вносят в последовательности, приведенной в таблице. Фермент добавляют в последнюю очередь.

В реакции ПЦР используют 5 мкл кДНК, полученной в ходе реакции обратной транскрипции.

Синтетические олигонуклеотидные праймеры были проверены на специфичность и чувствительность. Установлено, что тест-система не амплифицирует кДНК других бактерий и вирусов. Тест-система показала диагностическую специфичность и чувствительность на уровне 100%.

Примеры конкретного выполнения

Пример 1

Выявление фрагментов генома вируса ЭДС включает в себя следующие этапы.

Выделение РНК из вируссодержащего материала (методами нуклеосорбции или с использованием коммерческих наборов).

Проведение реакции обратной транскрипции. На N количество образцов изготовляют реакционную смесь для обратной транскрипции согласно таблице 2. Обратная транскрипция проводится в течение 30 минут при температуре 42°C.

Продукт реакции обратной транскрипции используется как матрица в реакции ПЦР в режиме реального времени.

Постановка ПЦР в режиме реального времени. На N количество образцов изготовляют реакционную смесь согласно таблице 3. Амплификация и детекция флюоресценции производятся согласно температурным режимам, указанным в таблице 4.

Учет результатов амплификации. Образец считается положительным на наличие генома вируса ЭДС при значении Ct<33. Образцы, не пересекающие пороговую линию, и образцы со значением Ct>33 считаются отрицательными.

Источники информации

1. DeBouck, P. The diagnosis of coronavirus-like agent (CVLA) diarrhea in suckling pigs. / DeBouck P., Callebaut P., Pensaert M. // Curr. Top. Vet. Med. Anim. Sci. - 1981a. - V. 13. - P. 59-61.

2. Gonzales, J.M. A comparative sequence analysis to revise the current taxonomy of the family Coronaviridae. / Gonzales J.M., Gomez-Puertas P., Cavanagh D., Gorbalenya A.E., Enjuanes L. // Arch. Virol. - 2003. - V. 148. - P. 2207-2235.

3. Guscetti, F. Immunohistochemical detection of porcine epidemic diarrhea virus compared to other methods. / Guscetti F, Bernasconi C, Tobler K, Van Reeth K, Pospischil A, Ackermann M. // Clin. Diagn. Lab. Immunol. 1998. 5:412-414.

4. Pensaert, M. Porcine epidemic diarrhea. / Pensaert M. // In: B.E. Straw et al. Diseases of Swine (9th Ed., Blackwell, Ames, 2006), P.367-372.

5. Sanchez, C.M. Antigenic homology among coronaviruses related to transmissible gastroenteritis virus/ / Sanchez С.М., Jimenez G., Laviada M.D., Correa I., Sune C., Bullido M.J., Gebauer F., Srnerdou C., Callebaut P., Escribano J.M., Enjuanes L. // Virology. - 1990. - V. 174. - P. 410-417.

1. Синтетические олигонуклеотидные праймеры и Taq-Man зонд, комплементарные высококонсервативной области гена N генома вируса эпизоотической диареи свиней, используемые для выявления РНК вируса ЭДС, имеющие следующий нуклеотидный состав:
Fw 5′ ACCAGCAAATTGGGTACTG 3′
Rw 5′ CCTGTTCCGAGGTAGTAGAA 3′
Ζ 5′ FAM-CCGTGGT(RTQ1)GAGCGAATTGAACAACC 3′

2. Способ выявления вируса ЭДС, включающий постановку полимеразной цепной реакции, амплификацию РНК вируса, отличающийся тем, что для постановки ПЦР используют праймеры и зонд по п. 1, далее проводят предварительную денатурацию вирусной РНК при 94°С в течение 4 мин, синтез кДНК проводят при 42°С в течение 30 мин, с 40 циклами амплификации при температуре денатурации 94°С 10 с, отжига 60°С 15 с, элонгации 72°С 15 с, затем проводят оценку результатов реакции, при этом результат реакции считается положительным, если Ct>33.



 

Похожие патенты:

Изобретения относятся к области биотехнологии и касаются набора синтетических олигонуклеотидных праймеров и способа его использования. Представленный набор включает две пары праймеров, имеющих следующую структуру - FIV F: 5′-AAGAGTCCCAAATATGCCATAGG-3′ и FIV R: 5′-TCCATCCAAATTGCTACTGTTC-3′; FeLV F: 5′-GAATAAACCTCTTGCTGTTTGC-3′ и FeLV R: 5′-AATCAGATCGAATGACAGAGACAC-3′.

Изобретение относится к биотехнологии и молекулярной генетике. Способ предусматривает картирование положений ряда метилированных нуклеотидных последовательностей Pu(5mC)GPy в протяженной ДНК для построения эпигенетического профиля и выявления аномально метилированных участков ДНК.

Изобретение относится к области биохимии, в частности к применению Axl в качестве биомаркера для распознавания наступления эпителиально-мезенхимального перехода (EMT) у субъекта, где показателем наступления EMT является повышающая регуляция экспрессии Axl.

Изобретение относится к области биотехнологии, конкретно к влиянию мутаций гена KRAS на восприимчивость к химиотерапии, и может быть использовано в предсказании терапевтического эффекта химиотерапии.

Изобретение относится к области биохимии и может быть использовано при разработке методов молекулярно-генетической диагностики. Заявлен способ селективного отбора целевых участков ДНК.

Изобретение относится к области медицины, в частности к травматологии, и предназначено для прогнозирования нарушения консолидации при переломах костей конечностей.

Изобретение относится к биохимии. Описана выделенная молекула нуклеиновой кислоты для обнаружения вируса иммунодефицита человека (ВИЧ), которая содержит: 5′-agg pnn tgn atg pan tgg atg-3′ (SEQ ID NO: 10) или 5′-agg pnn tgn ntg ptn tgg atg-3′ (SEQ ID NO: 11) и набор, содержащий данную молекулу и инструкцию, где p = универсальный нуклеотид, который представляет собой 3-нитропиррол, 2′-дезоксинуклеозид и 5-нитроиндол или 6Н,8Н-3,4-дигидропиримидо[4,5-с][1,2]оксазин-7-он, и n = аналог цитидина, имеющий модификацию С-5.

Изобретение относится к области молекулярной генетики и микологии и предназначено для диагностики онихомикоза. Осуществляют выделение ДНК из биологического материала ногтей, проведение ПЦР и детекцию полученных результатов с помощью электрофореза в агарозном геле.

Изобретение относится к области медицины и предназначено для ПЦР-детекции Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens и Eggerthella spp. в клиническом материале.

Изобретение относится к области молекулярной биологии и медицины, в частности к онкологии. Из образца опухолевой ткани головного мозга выделяют суммарный пул РНК (в том числе содержащий и микроРНК) любым из известных способов.
Изобретение относится к области биотехнологии и предназначено для неинвазивной диагностики колоректального рака. Осуществляют забор и транспортировку образцов стула пациента, выделение из стула пациента общей ДНК и определение целостности ДНК методом ПЦР-анализа. Для оценки качества и количества выделенной ДНК проводят ПЦР-анализ двух фрагментов ДНК в дуплексном режиме: первый фрагмент длиной 141 н.п., расположенный в кодирующей области гена ТР53, второй фрагмент 153 н.п., расположенный в кодирующей области гена BLM. Для оценки целостности геномной ДНК методом ПЦР-анализа используют первый фрагмент длиной 800 н.п., содержащий 7, 8 и 9 экзоны гена ТР53, и второй фрагмент длиной 2340 н.п., содержащий 14 и 15 экзоны гена MLH1. Обнаружение хотя бы одного из этих двух фрагментов в продуктах ПЦР свидетельствует о наличии колоректального рака у пациента. Изобретение обеспечивает эффективную диагностику колоректального рака на ранних стадиях. 4 з.п. ф-лы, 1 пр.

Изобретение относится к области медицины, в частности к онкологии и молекулярной биологии, и предназначено для диагностики плоскоклеточного рака легкого (ПКРЛ). Осуществляют получение исходной пары образцов ткани от пациента, где один из образцов получен из предположительно пораженной раком ткани, а второй - из прилегающей гистологически нормальной ткани, выделение и очистку препаратов РНК, синтез кДНК на матрице РНК, амплификацию фрагмента гена CALL и сравнение количества амплифицированного фрагмента ДНК CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани. Уменьшение содержания мРНК гена CALL от 3 до 44 раз служит диагностическим признаком ПКРЛ. Изобретение обеспечивает раннюю диагностику ПКРЛ. 4 з.п. ф-лы, 1 ил., 4 табл., 6 пр.

Изобретение относится к биохимии. Описан способ ПЦР-секвенирования, включающий следующие стадии: получение образца; амплификация; смешивание; фрагментация; секвенирование и сплайсинг. Настоящее изобретение также относится к праймерным меткам, используемым в указанном способе, а также к способу генотипирования, в частности, в анализе HLA. Настоящее изобретение также относится к ПЦР-праймерам для HLA-A/B, HLA-C и HLA-DQB1. Изобретение позволяет повысить длину продукта ПЦР, который может быть секвенирован секвенатором, без повышения цены и/или редукции. 3 н. и 16 з.п. ф-лы, 18 ил., 13 табл., 12 пр.

Изобретение относится к биотехнологии и молекулярной генетике. Описан способ определения нуклеотидной последовательности (сайта) 5'-R(5mC)GY-3'/3'-YG(5mC)R-5' в заданном положении протяженной ДНК. Способ включает гидролиз высокоочищенной геномной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI, лигирование универсального олигонуклеотидного адаптера с последующей амплификацией в реальном времени с использованием геномного праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен 3' концу ДНК от заданного места гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности и составление заключения о наличии последовательности R(5mC)GY (где 5mC - 5-метилцитозин, R - А или G, Y - Τ или С) по появлению флуоресцентного сигнала. Адаптерная последовательность - 5'-CCTGCTCTTTCATCG-3'/3'-p-GGACGAGAAAGTAGC-p-5'. Способ проводят в единой реакционной смеси с добавлением состава компонентов, обеспечивающих восстанавление S-S связей в белках, стабилизирующих ферменты и являющихся донором метальных групп. Изобретение упрощает способ определения нуклеотидной последовательности R(5mC)GY в заданном положении протяженной ДНК, расширяет его функциональные возможности и сокращает время анализа. 2 з.п.ф-лы, 2 ил., 2 пр.

Группа изобретений относится к области биотехнологии, в частности к детекции нуклеиновокислотной последовательности-мишени в анализе с РОСН (расщеплением и гибридизацией РО) на твердой подложке. Осуществляют детекцию нуклеиновокислотной последовательности-мишени с использованием РОСН-анализа, согласно которому РО (зондирующий олигонуклеотид), гибридизованный с нуклеиновокислотной последовательностью-мишенью, расщепляется, и детекцию расщепления РО осуществляют, используя гибридизацию с СО (захватывающим олигонуклеотидом). При этом нерасщепленный РО гибридизуется с СО, иммобилизованным на твердой подложке. Конструирование РО и СО является удобной процедурой, и оптимизация реакционных условий обычно осуществляется легко. Когда детекцию сигнала на твердой подложке осуществляют непрерывно вместе с повторением циклов расщепления РО, число расщепленных РО увеличивается по мере повторения числа реакций расщепления, и сигнал изменяется параллельно с изменением числа расщепленных РО. В этом случае детекцию нуклеиновокислотной последовательности-мишени можно осуществить в режиме реального времени. В противоположность этому, в отсутствие нуклеиновокислотной последовательности-мишени изменения сигнала не наблюдается. Использование изобретений группы позволяет осуществить одновременную детекцию множества нуклеиновокислотных последовательностей-мишеней с использованием метки даже одного типа. 4 н. и 38 з.п. ф-лы, 24 ил., 7 табл., 7 пр.

Предложенная группа изобретений относится к области медицины. Предложены способ, машиночитаемый носитель и система для определения генетической аномалии плода, которая представляет собой анеуплоидию. Из образца периферической крови беременной женщины получают последовательности множества полинуклеотидных фрагментов, соотносят их с хромосомами путем сравнения с референсной геномной последовательностью человека, вычисляют глубину покрытия и GC содержание хромосомы и сравнивают глубину покрытия хромосомы с аппроксимированной глубиной покрытия, где различие между ними указывает на анеуплоидию. Предложенная группа изобретений обеспечивает эффективные средства и методы для неинвазивного обнаружения анеуплоидии плода. 3 н. и 10 з.п. ф-лы, 21 ил., 1 табл., 1 пр.

Изобретение относится к области биотехнологии и вирусологии. Описаны способ прогнозирования раннего снижения вирусной нагрузки у человека, инфицированного вирусом гепатита С (ВГС), в ответ на лечение без применения интерферона, способ выбора длительности лечения без интерферона и способ прогнозирования ответа человека, инфицированного ВГС, на лечение без применения интерферона. Способы предусматривают выявление в образце, полученном от субъекта, нуклеотида, находящегося в положении однонуклеотидного полиморфизма rs12979860, и интерпретацию полученных результатов на основе наличия в данном положении аллелей С или Т. Предложенная группа изобретений может быть использована в медицине. 3 н. и 12 з.п. ф-лы, 2 ил., 3 табл., 1 пр.

Изобретение относится к области биохимии. Представлены варианты молекулы нуклеиновой кислоты, связывающейся с SDF-1. Молекула нуклеиновой кислоты содержит первый фрагмент нуклеотидов, центральную нуклеотидную последовательность и второй фрагмент нуклеотидов, где указанный первый и указанный второй фрагмент нуклеотидов имеют достаточную для гибридизации друг с другом степень обратной комплементарности, и при гибридизации образуется двунитевая структура. Также изобретение относится к применению указанных молекул нуклеиновой кислоты для лечения и профилактики, а также диагностики заболеваний или нарушений, обусловленных повышенным количеством и/или активностью SDF-1. Изобретение позволяет ингибировать хемотаксис, индуцируемый SDF-1. 6 н. и 32 з.п. ф-лы, 40 ил., 16 табл., 15 пр.

Изобретение относится к биотехнологии и касается набора олигонуклеотидов-праймеров для получения первичной структуры F гена вирусов болезни Ньюкасла класса I. Представленный набор состоит из трех пар олигонуклеотидов, имеющих следующую структуру (5′→3′): Представленные олигонуклеотиды не дают перекрестных реакций с родственными видами, позволяют ограничивать манипуляции одноступенчатой процедурой проведения полимеразной цепной реакции (ПЦР). Разработанные праймеры позволяют получить полную информацию о F генах вирусов болезни Ньюкасла, их принадлежности к той или иной генетической линии вируса, наличии нуклеотидных/аминокислотных замен в геноме патогена. Изобретение может быть использовано в диагностических целях идентификации вируса болезни Ньюкасла в вирусологии и ветеринарии, а также для решения научно-исследовательских задач по изучению данного вируса. 1 ил., 2 табл., 3 пр.
Изобретение относится к области медицины, в частности к хирургии, и предназначено для дифференциации природы происхождения рецидивных кист при цистном эхинококкозе. Осуществляют выделение ДНК из клеток герминативного слоя оболочки первичной и рецидивной эхинококковых кист. Методом полимеразной цепной реакции получают фрагменты маркерного участка гена cox1 Е. granulosus. Проводят анализ полиморфизма длин рестрикционных фрагментов. При обнаружении сходства длин рестрикционных фрагментов первичной и рецидивной эхинококковых кист устанавливают, что рецидивная киста имеет имплантационную природу происхождения. При нахождении различий устанавливают резидуальную или реинвазивную причину возникновения рецидивной кисты. Изобретение обеспечивает получение новых критериев дифференциации природы происхождения послеоперационных рецидивов цистного эхинококкоза. 2 пр.

Группа изобретений относится к области молекулярной биологии и генодиагностики, а именно к синтетическим праймерам, комплементарным высококонсервативной области гена N генома вируса эпизоотической диареи свиней и способу выявления ЭДС. Способ выявления вируса основан на постановке полимеразной цепной реакции с этапом обратной транскрипции с использованием праймеров 5′-accagcaaattgggtactg-3′, 5′-cctgttccgaggtagtagaa-3′ и TaqMan зонда 5′-FAM-ccgtggtgagcgaattgaacaacc-3′. Далее проводят амплификацию РНК вируса. Затем осуществляют оценку проведения реакции, при этом результат реакции считается положительным, если Ct>33. Использование данных изобретений позволяет повысить чувствительность метода ПЦР. 2 н.п. ф-лы, 4 табл., 1 пр.

Наверх