Антагонисты неурегулина и применение их в лечении злокачественного новообразования



Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования
Антагонисты неурегулина и применение их в лечении злокачественного новообразования

 


Владельцы патента RU 2587619:

ДЗЕ БОРД ОФ ТРАСТИЗ ОФ ДЗЕ ЛЕЛЭНД СТЭНФОРД ДЖУНИОР ЮНИВЕРСИТИ (US)
ДЖЕНЕНТЕК, ИНК. (US)

Изобретение относится к области биотехнологии, конкретно к способу увеличения периода времени до рецидива опухоли, и может быть использовано в медицине. Получают антагонисты неурегулина, представляющие собой анти-NRG1 антитело, siPHK или shPHK, нацеленные на NRG1, или иммуноадгезин к NRG1 для введения пациенту, ранее получавшему противораковую терапию, в комбинации с терапевтическим средством, выбранным из паклитаксела, цисплатина или их комбинации для отсрочки времени до рецидива опухоли или предотвращения развития резистентности раковых клеток к лечению терапевтическим агентом. Изобретение позволяет увеличить период времени до рецидива опухоли, что повышает выживаемость пациентов. 9 з.п. ф-лы, 8 ил., 1 табл., 8 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННЫЕ ЗАЯВКИ

По данной заявке испрашивается приоритет на основании Предварительной заявки США № 61/305878, зарегистрированной 18 Февраля 2010, содержание которой включено в данное описание посредством ссылки в полном ее объеме.

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

Настоящее изобретение относится к лечению злокачественного новообразования с помощью антагонистов неурегулина.

ПРЕДПОСЫЛКИ СОЗДАНИЯ ИЗОБРЕТЕНИЯ

В последние годы областью интенсивных исследований были идентификация и свойства раковых стволовых клеток (CSC). Накапливаются доказательства того, что опухоли представляют собой гетерогенную смесь клеток с различными биологическими свойствами. Изолирование отдельной клеточной популяции с уникальной способностью инициировать рост опухоли было описано для многочисленных гематологических злокачественных новообразований и солидных опухолей. Тем не менее, появились противоречия при использовании специфических маркеров клеточной поверхности для проспективной идентификации CSC. Например, в корне отличные данные о фенотипе стволовых клеток были описаны для лейкемии, рака поджелудочной железы, колоректального рака, рака мозга и рака молочной железы (обзор у Brennan and Matsui 2009). Более того, предварительный подсчет частоты CSC значительно отличается между типами опухолей и пациентами. Роль CSC в поддержании роста развившейся опухоли, или в повторной инициации опухоли после химиотерапии, либо в первичной, либо в отдаленной локализации, еще предстоит выяснить.

Для большинства онкологических пациентов, рецидив заболевания после химиотерапии представляет собой основную причину смертности. Соответственно, более глубокие знания о клетках, повторно инициирующих опухоль (TRIC), ответственных за рецидив заболевания, необходимы для более эффективного лечения пациентов, у которых развился рецидив онкологического заболевания после первоначальной реакции на химиотерапевтическое лечение. Это в особенности имеет отношение к немелкоклеточному раку легких (NSCLC), поскольку более чем две трети пациентов с NSCLC не являются кандидатами для хирургической резекции. Большинство пациентов страдают прогрессирующим заболеванием и подвержены химиотерапии, лучевой терапии или комбинации этих двух подходов (принципы и практические приемы при раке легких). Тем не менее, 5-летняя частота выживания при местнораспространенном заболевании составляет 23,7% и при поздней стадии заболевания составляет 3,5%, несмотря на хороший первоначальный ответ на терапию (Horner et al. SEER).

Было продемонстрировано, что дерегулирование сигнального пути EGFR посредством сверхэкспрессии или активирующих мутаций, является частым событием при NSCLC (обзор у Dahabreh et al., 2010). EGFR представляет собой прототипный член семейства HER тирозинкиназ, которое включает в себя EGFR (Her1), Her2, Her3 и Her4. У Her2 отсутствует функциональный лиганд-связывающий домен (Graus-Porta 1997) и у Her3 отсутствует тирозинкиназная активность (Guy 1994), таким образом, эти рецепторы должны действовать как гетеродимеры. Последние данные показывают, что другие члены семейства Her могут также играть определенную роль в NSCLC. Однако их вклад в развитие данного заболевания менее характерен и исследования часто сфокусированы на их взаимоотношениях с активацией EGFR (Kuyama et al. 2008, Hirsch 2009, Zhou 2006, Johnson 2006, Ding 2008).

Неурегулин представляет собой лиганд для рецептора Her3 и Her4 тирозинкиназ. Известны четыре члена семейства неурегулина, NRG1, NRG2, NRG3, и NRG4 (Falls 2003). Транскрипт NRG1 подвергается экстенсивному альтернативному сплайсингу, что в результате приводит к образованию, по меньшей мере, 15 различных изоформ. Все активные изоформы делят EGF-подобный домен, который является необходимым и достаточным для активности (Holmes 1992, Yarden 1991). Показано, что аутокринный сигнальный путь NRG1 регулирует пролиферацию эпителиальных клеток легких (Jinbo 2002), и играет важную роль в развитии легких человека (Patel 2000), и вовлечен в невосприимчивость NSCLC к ингибиторам EGFR (Zhou 2006).

Существует необходимость в обеспечении терапевтическими средствами, эффективными при лечении резистентных злокачественных новообразований у пациентов, у которых развился рецидив злокачественного новообразования.

КРАТКОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Один аспект данного изобретения предусматривает способ увеличения периода времени до развития рецидива опухоли у онкологического пациента, включающий введение в организм данного пациента эффективного количества антагониста неурегулина. В одном варианте осуществления, данный способ дополнительно включает введение терапевтического средства в организм данного пациента. В одном варианте осуществления данным терапевтическим средством является химиотерапевтическое вещество или антитело. В некоторых вариантах осуществления данное химиотерапевтическое средство представляет собой паклитаксал или цисплатин, или комбинацию паклитаксала и цисплатина.

В некоторых вариантах осуществления данное антитело представляет собой антитело EGFR, HER2, HER3, или HER4. В некоторых вариантах осуществления данным злокачественным новообразованием, которым страдает данный пациент, является немелкоклеточный рак легких, рак молочной железы, рак яичников, рак области головы и шеи, рак шейки матки, рак мочевого пузыря, рак пищевода, рак предстательной железы или колоректальный рак.

В одном варианте осуществления, увеличение периода времени до рецидива опухоли, по меньшей мере, в 1,25 раз больше, чем период времени до рецидива опухоли без применения данного антагониста неурегулина. В одном варианте осуществления, увеличение периода времени до рецидива опухоли, по меньшей мере, в 1,50 раз больше, чем период времени до рецидива опухоли без применения антагониста неурегулина.

В некоторых вариантах осуществления данный антагонист неурегулина представляет собой антитело, малую молекулу, иммуноадгезин или РНК. В одном варианте осуществления, данный антагонист неурегулина представляет собой антагонист NRG1. В одном варианте осуществления данный антагонист NRG представляет собой анти-NRG1 антитело.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На Фиг. 1 представлено схематическое изображение in vivo модели для исследования клеток, повторно инициирующих опухоль (TRIC).

На Фиг. 2A представлена модель ксенотрансплантата Calu3 NSCLC человека на бестимусных голых мышах, где химиотерапия имеет в своем составе пактитаксель и цисплатин. Данные представлены как средний размер опухоли ±SEM, n=12 мышей/группа.

На Фиг. 2B представлена модель ксенотрансплантата H441 NSCLC человека на бестимусных голых мышах, где химиотерапия имеет в своем составе пактитаксель и цисплатин. Данные представлены как средний размер опухоли ±SEM, n=12 мышей/группа.

На Фиг. 2C представлена модель опухоли молочной железы KPL4 человека с ортротропной трансплантацией опухолевых клеток в скопление жировой ткани молочной железы мыши SCID/beiz, где химиотерапия имеет в своем составе паклитаксель. Данные представлены как средний размер опухоли ±SEM, n=12 мышей/группа.

На Фиг. 2D показано лечение с помощью циспатина модели NSCLC у созданной методами генетической инженерии мыши K-rasLSLG12D, CAG-LSL-GFP. Результаты представлены как среднее число GFP-положительных клеток на легкое ±SEM, n=6 мышей/группа.

На Фиг. 3A показано увеличение мРНК NRG1 в TRIC в модели ксенотрансплантата Calu3 продемонстрировано с помощью двух независимых зондов в анализе с использованием микрочипов. Увеличение было подтверждено посредством количественной ПЦР в режиме реального времени (кПЦР) для NRG1a и NRG1b, с использованием РНК, выделенной из несвязанных друг с другом опухолевых образцов.

На Фиг. 3B показано увеличение мРНК NRG1 в TRIC в модели ксенотрансплантата Н441 продемонстрировано с помощью двух независимых зондов в анализе с использованием микрочипов. Это было подтверждено посредством кПЦР для NRG1a и NRG1b, с использованием РНК из тех же опухолевых образов, что и в анализе с использованием микрочипов.

На Фиг. 3C показано увеличение мРНК NRG1в TRIC в модели ксенотрансплантата рака молочной железы KPL4, показанное посредством двух независимых микрочиповых зонда.

На Фиг. 3D показано увеличение мРНК NRG1 в TRIC в модели NSCLC на мышах K-rasLSLG12D, показанное посредством одного микрочипового зонда и подтвержденное с помощью кПЦР.

На Фиг. 4 показано, что увеличение NRG1 является специфичным для резидуальных клеток, о чем свидетельствует анализ кПЦР уровней мРНК NRG1 опухолевых клеток в опухолях разных размеров и в разное время после химиотерапии.

На Фиг. 5A представлен график, демонстрирующий кривые роста опухолей у мышей с прижившимися ксенотрансплантатами опухолей Calu3-shNRG1, получавших инертный наполнитель (сахароза) или dox (2 г/л) в питьевой воде в свободном доступе. Объем опухоли измеряли два раза в неделю на протяжении данного исследования. Результаты представлены как линейная модель со смешанными эффектами (LME), сгенерированная в соответствии с объемом опухоли, изображенной графически как кубические сплайны с самоопределяемыми узлами.

На Фиг. 5B представлен график, демонстрирующий кривые роста опухолей у мышей с прижившимися ксенотрансплантатами опухолей Calu3-shNRG1, получавших химиотерапия+сахароза или химиотерапия+dox. Результаты представлены как модель LME, сгенерированная в соответствии с объемом опухоли, изображенной графически как кубические сплайны с самоопределяемыми узлами.

На Фиг.6A представлен график, демонстрирующий кривые роста опухолей у мышей с прижившимися ксенотрансплантатами опухолей Н441-shNRG1, получавших сахарозу или dox (n=12/группа). Результаты представлены как LME, сгенерированная в соответствии с объемом опухоли, изображенной графически как кубические сплайны с самоопределяемыми узлами.

На Фиг. 6B представлен график, демонстрирующий кривые роста опухолей у мышей с прижившимися ксенотрансплантатами опухолей Н441-shNRG1, получавших химиотерапия+сахароза или химиотерапия+dox (n=12/группа). Результаты представлены как LME, сгенерированная в соответствии с объемом опухоли, изображенной графически как кубические сплайны с самоопределяемыми узлами.

На Фиг. 7A представлен график, демонстрирующий кривые роста опухолей у мышей с прижившимися ксенотрансплантатами опухолей Н1299-shNRG1, получавших сахарозу или dox (n=12/группа). Результаты представлены как LME, сгенерированная в соответствии с объемом опухоли, изображенной графически как кубические сплайны с самоопределяемыми узлами.

На Фиг. 7B представлен график, демонстрирующий кривые роста опухолей у мышей с прижившимися ксенотрансплантатами опухолей Н1299-shNRG1, получавших химиотерапия+сахароза или химиотерапия+dox (n=12/группа). Результаты представлены как LME, сгенерированная в соответствии с объемом опухоли, изображенной графически как кубические сплайны с самоопределяемыми узлами.

На Фиг. 8A представлен график, демонстрирующий средний объем опухоли ±SEM для мышей LSL-K-rasG12D; p53Fl/+, получавших инертный наполнитель+контрольный IgG (n=6), цисплатин+контрольный IgG (n=6), или цисплатин+HER4ECD-Fc (n=8). Амброзия, контрольное антитело IgG2a мыши.

На Фиг. 8B представлен график, демонстрирующий ежедневную кратность изменения опухолевой массы в результате использования лечебной схемы, с 95% доверительными интервалами.

На Фиг. 8C представлен график, демонстрирующий среднее процентное изменение опухолевой массы от исходного уровня ±SEM для мышей LSL-K-rasG12D; p53F1/F1, получавших инертный наполнитель+контрольный IgG (n=10), цисплатин+контрольный IgG (n=11), цисплатин+HER4-ECD (n=8) или инертный наполнитель+HER4-ECD (n=7).

ПОДРОБНОЕ ОПИСАНИЕ ВАРИАНТОВ ОСУЩЕСТВЛЕНИЯ ДАННОГО ИЗОБРЕТЕНИЯ

I. ОПРЕДЕЛЕНИЯ

Используемое здесь выражение «акцепторная каркасная область человека» относится к каркасной области, включающей в себя аминокислотную последовательность каркасной области вариабельного домена (VL) легкой цепи, или каркасной области вариабельного домена тяжелой цепи (VH), происходящей из каркасной области иммуноглобулина человека, или консенсусной каркасной области человека, как определено далее. Акцепторная каркасная область человека «происходящая из» каркасной области иммуноглобулина человека, или консенсусной каркасной области человека, может включать в себя ту же самую аминокислотную последовательность, или может содержать в себе изменения аминокислотной последовательности. В некоторых вариантах осуществления число аминокислотных изменений составляет 10 или менее, 9 или менее, 8 или менее, 7 или менее, 6 или менее, 5 или менее, 4 или менее, 3 или менее, или 2 или менее. В некоторых вариантах осуществления данная акцепторная каркасная область VL человека является идентичной по последовательности с последовательностью VL каркасной области иммуноглобулина человека, или последовательностью консенсусной каркасной области человека.

«Аффинность» относится к силе совокупности нековалентных взаимодействий между единственным сайтом связывания молекулы (например, антитело) и его партнером по связыванию (например, антиген). Если не указано иное, используемый здесь термин «аффинность связывания» относится к внутренней аффинности связывания, которая отображает 1:1 взаимодействие между членами пары связи (например, антитело и антиген). Аффинность молекулы Х к ее партнеру Y может быть в целом представлена посредством константы диссоциации (Kd). Аффинность может быть измерена посредством обычных методов, известных в данной области, в том числе тех, которые описаны здесь. Специфические иллюстративные и примерные варианты осуществления для измерения аффинности связывания описаны далее.

Антитело «зрелой аффинности» означает антитело с одним или несколькими изменениями в одном или нескольких гипервариабельных участках (HVR), в сравнении с исходным антителом, которое не имеет таких изменений, такие изменения в результате приводят к повышению аффинности данного антитела к антигену.

Термины «анти-NRG антитело» и «антитело, которое связывается с NRG» относятся к антителу, которое способно связываться с NRG с достаточной аффинностью, так что данное антитело является применимым в качестве диагностического и/или терапевтического агента, нацеленного на NRG. В одном варианте осуществления степень связывания анти-NRG антитела с неродственным, не-NRG белком, составляет менее, чем приблизительно 10% связывания данного антитела с NRG, как измерено, например, посредством радиоиммуннологического анализа (РИА). В некоторых вариантах осуществления антитело, которое связывается с NRG, имеет константу диссоциации (Kd) ≤1 мкМ, ≤100 нМ, ≤10 нМ, ≤1 нМ, ≤0,1 нМ, ≤0,01 нМ, или ≤0,001 нМ (например, 10-8M или менее, например, от 10-8M до 10-13M, например, от 10-9M до 10-13M). В некоторых вариантах осуществления анти-NRG антитело связывает эпитоп NRG, который является консервативным среди NRG различных биологических видов.

Термин «антитело» используется здесь в широком смысле и охватывает различные антительные структуры, в том числе, но не ограничиваясь этим, моноклональные антитела, поликлональные антитела, мультиспецифические антитела (например, биспецифические антитела), и фрагменты антител, при условии, что они проявляют необходимую антиген-связывающую активность.

«Фрагмент антитела» относится к молекуле, отличной от интактного антитела, которая включает в себя часть интактного антитела, которая связывает антиген, с которым связывается интактное антитело. Примеры фрагментов антитела включают в себя, но не ограничиваются этим, Fv, Fab, Fab', Fab'-SH, F(ab')2; диатела; линейные антитела; одноцепочечные антительные молекулы (например, scFv); и мультиспецифические антитела, сформированные из фрагментов антител.

«Антитело, которое связывается с тем же эпитопом», что и референсное антитело, относится к антителу, которое блокирует связывание данного референсного антитела с его антигеном в анализе конкурентного связывания на 50% или более, и наоборот, данное референсное антитело блокирует связывание данного антитела с его антигеном в анализе конкурентного связывания на 50% или более. Здесь приведен пример анализа конкуретного связывания.

Термин «химерное» антитело относится к антителу, в котором часть тяжелой и/или легкой цепи получена из определенного источника или биологических видов, в то время как оставшаяся часть данной тяжелой и/или легкой цепи происходит из другого источника или биологических видов.

Термины «рак» и «раковый» относятся к, или описывают физиологическое состояние у млекопитающих, которое обычно характеризуется нерегулируемым клеточным ростом/пролиферацией. Примеры рака включают в себя, но не ограничиваются этим, карциному, лимфому (например, Ходжкинская и неходжкинская лимфома), бластому, саркому и лейкемию. Более конкретные примеры таких раков включают в себя плоскоклеточный рак, мелкоклеточный рак легких, немелкоклеточный рак легких, аденокарциному легких, плоскоклеточную карциному легких, рак брюшины, печеночно-клеточный рак, рак желудочно-кишечного тракта, рак поджелудочной железы, глиому, рак шейки матки, рак яичников, рак печени, рак мочевого пузыря, гепатому, рак молочной железы, рак толстой кишки, колоректальный рак, курциному эндометрия или матки, карциному слюнных желез, рак почки, рак печени, рак предстательной железы, рак вульвы, рак щитовидной железы, гепатоцеллюлярную карциному, лейкемию и другие лимфопролиферативные заболевания, и различные типы рака области головы и шеи.

«Класс» антитела относится к типу константного домена или константной области, которая находится на его тяжелой цепи. Существует пять основных классов антител: IgA, IgD, IgE, IgG, и IgM, и некоторые из них могут быть дополнительно разделены на подклассы (изотипы), например, IgG1, IgG2, IgG3, IgG4, IgA1, и IgA2. Константные домены тяжелой цепи, которые соответствуют различным классам иммуноглобулинов, называют α, δ, ε, γ и µ, соответственно.

Используемый здесь термин «цитотоксическое средство» относится к субстанции, которая ингибирует или препятствует клеточной функции и/или вызывает клеточную гибель или деструкцию. Цитотоксические средства включают в себя, но не ограничены этим, радиоактивные изотопы (например, At211, I131, I125, Y90, Re186, Re188, Sm153, Bi212, P32, Pb212 и радиоактивные изотопы Lu); химиотерапевтические вещества или лекарственные препараты (например, метотрексат, адриамицин, алкалоиды барвинка (винкристин, винбластин, этопозид), доксорубицин, мелфалан, митомицин C, хлорамбуцил, даунорубицин или другие интеркалирующие агенты); ингибиторы роста; ферменты и их фрагменты, такие как нуклеолитические ферменты; антибиотики; токсины, такие как низкомолекулярные токсины или ферментативно активные токсины бактериального, грибкового, растительного или животного происхождения, в том числе их фрагменты и/или варианты; и различные противоопухолевые и противораковые средства, раскрытые ниже.

«Эффекторные функции» относятся к тем биологическим активностям, связанным с Fc-областью антитела, которые изменяются в зависимости от изотипа антитела. Примеры эффекторных функций антитела включают в себя: C1q связывание и кимплементзависимую цитотоксичность (CDC); связывание Fc-рецептора; антителозависимую клеточноопосредованную цитотоксичность (ADCC); фагоцитоз; понижающую регуляцию рецепторов клеточной поверхности (например, рецептора В-клетки); и В-клеточную активацию.

«Эффективное количество» агента, например, фармацевтической композиции, относится к количеству, эффективному, при дозах и в течение необходимых периодов времени, для достижения желаемого терапевтического или профилактического результата.

Термин «Fc-область» используется здесь для определения С-концевой области тяжелой цепи иммуноглобулина, которая содержит в себе, по меньшей мере, часть данной константной области. Данный термин включает в себя нативные последовательности Fc-областей и варианты Fc-областей. В одном варианте осуществления Fc-область тяжелой цепи IgG человека простирается от Cys226 или от Pro230, до карбоксильного конца данной тяжелой цепи. Тем не менее, C-концевой лизин (Lys447) данной Fc-области может присутствовать или может отсутствовать. Если не указано иначе, нумерация аминокислотных остатков в Fc-области или константной области, соответствует системе нумерации EU, также называемой индекс EU, как описано у Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991.

«Каркасный участок» или «FR» относится к остаткам вариабельного домена, кроме остатков гепервариабельного участка (HVR). FR вариабельного домена обычно имеет в своем составе четыре домена FR: FR1, FR2, FR3 и FR4. Соответственно, последовательности HVR и FR в основном представлены в следующей последовательности в VH (или VL): FR1-H1(L1)-FR2-H2(L2)-FR3-H3(L3)-FR4.

Термины «полноразмерное антитело», «интактное антитело» и «цельное антитело» используются здесь взаимозаменяемо и относятся к антителу, имеющему структуру в значительной степени похожую на структуру нативного антитела, или имеющему тяжелые цепи, которые содержат в себе Fc-область, как определено здесь.

Термины «клетка-хозяин», «линия клетки-хозяина» и «культура клетки-хозяина» используются здесь взаимозаменяемо и относятся к клеткам, в которые была встроена экзогенная нуклеиновая кислота, в том числе, к потомству таких клеток. Клетки-хозяева включают в себя «трансформантов» и «трансформированные клетки», которые включают в себя первично трансформированные клетки и потомство, полученное от них, без учета количества переносов. Потомство может не быть полностью идентичным по содержанию нуклеиновой кислоты с родительской клеткой, но может содержать мутации. Здесь учтено мутантное потомство, которое имеет такую же функцию или биологическую активность, по которой был проведен скрининг или отбор исходной трансформированной клетки.

«Антитело человека» представляет собой то, которое обладает аминокислотной последовательностью, которая соответствует таковой антитела, продуцируемого у человека или человеческой клеткой, или получено из источника, не относящегося к человеческому роду, которое использует спектр антител человека, или другим последовательностям, кодирующим антитело человека. Это определение человеческого антитела полностью исключает гуманизированное антитело, содержащее в себе антиген-связывающие остатки, не относящиеся к человеческому роду.

«Консенсусная каркасная область человека» является каркасной областью, которая представляет собой чаще всего встречающиеся аминокислотные остатки в селекции последовательностей каркасной области VL или VH иммуноглобулина человека. Как правило, отбор последовательностей VL или VH иммуноглобулина человека происходит из подгруппы последовательностей вариабельного домена. Обычно, данная подгруппа последовательностей представляет собой подгруппу, как указано у Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, NIH Publication 91-3242, Bethesda MD (1991), vols. 1-3. В одном варианте осуществления, для VL, данная подгруппа представляет собой подгруппу каппа I, как представлено у Kabat et al., supra. В одном варианте осуществления, для VH, данная подгруппа представляет собой подгруппу III, как представлено у Kabat et al., supra.

«Гуманизированное» антитело относится к химерному антителу, содержащему в себе аминокислотные остатки из HVR, не относящихся к человеческому роду, и аминокислотные остатки из FR человека. В некоторых вариантах осуществления гуманизированное антитело будет содержать в себе по существу все из, по меньшей мере, одного, и типично двух, вариабельных доменов, в которых все или по существу все HVR (например, CDR) соответствуют таковым нечеловеческого антитела, и все или по существу все FR соответствуют таковым антитела человека. Гуманизированное антитело, необязательно, может содержать в себе, по меньшей мере, часть константной области антитела, происходящей из антитела человека. «Гуманизированная форма» антитела, например, нечеловеческого антитела, относится к антителу, которое подвергается гуманизации.

Используемый здесь термин «гипервариабельный участок» или «HVR» относится к каждому из участков вариабельного домена антитела, которые имеют гипервариабельные последовательности и/или формируют структурно определенные петли («гипервариабельные петли»). Обычно, нативные четырех-цепочечные антитела содержат в себе шесть HVR; три в VH (H1, H2, H3), и три в VL (L1, L2, L3). HVR, как правило, содержат в себе аминокислотные остатки из гипервариабельных петель и/или из «областей, определяющих комплементарность» (CDR), последние имеют наивысшую вариабельность последовательностей и/или заняты в распознавании антигена. Типичные гипервариабельные петли возникают в аминокислотных остатках 26-32 (L1), 50-52 (L2), 91-96 (L3), 26-32 (H1), 53-55 (H2) и 96-101 (H3). (Chothia and Lesk, J. Mol. Biol. 196: 901-917 (1987)). Типичные CDR (CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2 и CDR-H3) встречаются в аминокислотных остатках 24-34 в L1, 50-56 в L2, 89-97 в L3, 31-35B в H1, 50-65 в H2 и 95-102 в H3. (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (1991)). За исключением CDR1 в VH, как правило, CDR содержат в себе аминокислотные остатки, которые формируют данные гипервариабельные петли. CDR также содержат в себе «остатки, определяющие специфичность», или «SDR», которые представляют собой остатки, образующие контакт с антигеном. SDR содержатся в пределах областей в CDR, которые называются укороченные-CDR, или a-CDR. Типичные a-CDR (a-CDR-L1, a-CDR-L2, a-CDR-L3, a-CDR-H1, a-CDR-H2, и a-CDR-H3) встречаются в аминокислотных остатках 31-34 в L1, 50-55 в L2, 89-96 в L3, 31-35B в H1, 50-58 в H2, и 95-102 в H3. (См. Almagro and Fransson, Front. Biosci. 13: 1619-1633 (2008)). Если не указано иначе, остатки HVR и другие остатки в данном вариабельном домене (например, остатки FR) пронумерованы в соответствии с Kabat et al., supra.

«Иммуноконъюгат» представляет собой антитело, конъюгированное с одной или несколькими гетерологичными молекулами, в том числе, но не ограничиваясь этим, с цитотоксическим агентом.

«Индивидуум», или «объект», или «пациент» является млекопитающим. Млекопитающие включают в себя, но не ограничиваются этим, одомашненных животных (например, коровы, овцы, кошки, собаки и лошади), приматов (например, человек и не принадлежащие к человеческому роду приматы, такие как обезьяны), кроликов и грызунов (например, мыши и крысы). В некоторых вариантах осуществления данным индивидуумом, объектом или пациентом является человек.

«Изолированное» антитело представляет собой то, которое было отделено от компонентов его естественной среды. В некоторых вариантах осуществления антитело является очищенным до степени более чем 95% или 99% чистоты, как определено, например, электрофоретически (например, SDS-PAGE, изоэлектрическое фокусирование (IEF), капиллярный электрофорез), или хроматографически (например, ионобменная или обращенно-фазовая ВЭЖХ). Для обзора методов оценки чистоты антитела, см., например, Flatman et al., J. Chromatogr. B 848: 79-87 (2007).

«Изолированная» нуклеиновая кислота означает молекулу нуклеиновой кислоты, которая была отделена от компонентов ее естественной среды. Изолированная нуклеиновая кислота включает в себя молекулу нуклеиновой кислоты, содержащуюся в клетках, которые обычно содержат в себе молекулу данной нуклеиновой кислоты, но данная молекула нуклеиновой кислоты представлена экстрахромосомно или в хромосомном положении, которое отличается от ее естественного хромосомного положения.

«Изолированная нуклеиновая кислота, кодирующая анти-NRG антитело» относится к одной или нескольким молекулам нуклеиновой кислоты, кодирующей тяжелую и легкую цепи антитела (или их фрагменты), включая такую молекулу (молекулы) нуклеиновой кислоты в одном векторе или раздельных векторах, и такая молекула (молекулы) нуклеиновой кислоты представлена в одной или нескольких локализациях в клетке-хозяине.

Используемый здесь термин «моноклональное антитело» относится к антителу, получаемому из популяции практически гомогенных антител, т.е. составляющие популяцию отдельные антитела одинаковы, за исключением возможных вариантных антител, например, встречающихся в природе мутаций или возникающих во время производства композиции моноклонального антитела, такие варианты обычно присутствуют в незначительных количествах. В отличие от композиций поликлональных антител, которые обычно включают в себя различные антитела, направленные против различных детерминант (эпитопов), каждое моноклональное антитело в композиции моноклонального антитела направлено против единственной детерминанты на антигене. Определитель «моноклональное» указывает на характер этого антитела, как полученного из по существу гомогенной популяции антител, и не должен расцениваться как требование получения этого антитела каким-либо конкретным способом. Например, моноклональные антитела для применения в соответствии с данным изобретением могут быть получены различными способами, включающими в себя, но не ограничиваясь этим, гибридомный метод, методы рекомбинантных ДНК, методы фагового дисплея, и методы, в которых используются трансгенные животные, у которых имеются все или часть локусов иммуноглобулина человека, такие методы и другие иллюстративные методы получения моноклональных антител, описанные здесь.

«Несвязанное антитело» относится к антителу, которое не конъюгировано с гетерологичной молекулой (например, цитотоксичной молекулой) или радиоактивной меткой. Несвязанное антитело может присутствовать в фармацевтической композиции.

«Нативные антитела» относятся к встречающимся в природе молекулам имуноглобулинов с различными структурами. Например, нативные антитела IgG представляют собой гетеротетрамерные гликопротеины приблизительно 150000 дальтон, состоящие из двух идентичных легких цепей и двух идентичных тяжелых цепей, которые связаны дисульфидными связями. От N- до C-конца, каждая тяжелая цепь имеет вариабельный участок (VH), также называемый вариабельный тяжелый домен или вариабельный домен тяжелой цепи, за которым следуют три константных домена (CH1, CH2, и CH3). Схожим образом, от N- до C-конца, каждая легкая цепь имеет вариабельный участок (VL), также называемый вариабельный легкий домен или вариабельный домен легкой цепи, за которым следует константный легкий домен (CL). Легкая цепь антитела может быть отнесена к одному из двух типов, называемых каппа (κ) и лямбда (λ), в зависимости от аминокислотной последовательности ее константного домена.

Термин «листовка-вкладыш в упаковке» используется для обозначения инструкций, стандартно входящих в состав коммерческих упаковок лекарственных препаратов, которые содержат в себе информацию о показаниях к применению, применении, дозах, пути введения, комбинированной терапии, противопоказаниях и/или предупреждения, касающиеся применения таких лекарственных препаратов.

«Процент(%) идентичности аминокислотной последовательности» в отношении референсной полипептидной последовательности определен как процент аминокислотных остатков в кандидатной последовательности, которые являются идентичными аминокислотным остаткам в референсной последовательности, после выравнивания данных последовательностей и введения разрывов, при необходимости, для достижения максимального процента идентичности последовательностей, и не учитывая любые консервативные замены как часть данной идентичности последовательности. Выравнивание для определения процента идентичности аминокислотных последовательностей может быть осуществлено различными способами, известными в данной области, например, используя находящееся в открытом доступе компьютерное программное обеспечение, такое как программное обеспечение BLAST, BLAST-2, ALIGN или Megalign (DNASTAR). Специалист в данной области может определить подходящие параметры для выравнивания последовательностей, в том числе любые алгоритмы, необходимые для достижения максимального выравнивания по всей длине сравниваемых последовательностей. Однако, для целей данного изобретения, значения % идентичности аминокислотных последовательностей генерируются с помощью компьютерного программного обеспечения для сравнения последовательностей ALIGN-2. Программное обеспечение для сравнения последовательностей ALIGN-2 было разработано Genentech, Inc., и исходная программа была предоставлена с документацией пользователя в Бюро регистрации авторских прав США, Washington D.C., 20559, где была зарегистрирована под № TXU510087 регистрации авторского права США. Программа ALIGN-2 находится в открытом доступе в Genentech, Inc., South San Francisco, California, или может быть скомпилирована из исходной программы. Программа ALIGN-2 должна быть скомпилирована для использования на операционной системе UNIX, в том числе цифровой UNIX V4.0D. Все параметры сравнения последовательностей установлены в программе ALIGN-2 и не меняются.

В случаях, когда для сравнения аминокислотных последовательностей используется ALIGN-2, % идентичности аминокислотной последовательности данной аминокислотной последовательности А с, или по отношению к, данной аминокислотной последовательностью В (что можно альтернативно сформулировать как данная аминокислотная последовательность А, которая имеет или содержит в себе некоторый % идентичности аминокислотной последовательности с, или по отношению к данной аминокислотной последовательности В) рассчитывается следующим образом:

100 умножить на дробь X/Y

где X представляет собой число аминокислотных остатков, оцененных как совпадения посредством программы для выравнивания последовательностей ALIGN-2 в этом программном выравнивании А и В, и где Y представляет собой общее число аминокислотных остатков в В. Следует принимать во внимание, что если длина аминокислотной последовательности А отличается от длины аминокислотной последовательности В, то % идентичности аминокислотной последовательности А по отношению к В отличается от % идентичности аминокислотной последовательности В по отношению к А. Если не указано иное, все значения % идентичности аминокислотных последовательностей, используемые здесь, получены как описано в непосредственно предшествующем параграфе с использованием компьютерной программы ALIGN-2.

Термин «фармацевтическая композиция» относится к составу, который находится в такой форме, которая позволяет биологической активности активного ингредиента, содержащегося в ней, быть эффективной, и который не содержит в себе дополнительных компонентов, которые являются недопустимо токсичными для объекта, которому данная композиция будет введена.

«Фармацевтически приемлемый носитель» относится к ингредиенту в фармацевтической композиции, отличному от активного ингредиента, который является не токсичным для объекта. Фармацевтически приемлемые носители включают в себя, но не ограничиваются этим, буфер, инертный наполнитель, стабилизирующее вещество или консервант.

Используемый здесь термин «NRG» относится к любому нативному неурегулину (также известен как херегулин), полученному от любого позвоночного животного, включая млекопитающих, таких как приматы (например, человек) и грызунов (например, мыши и крысы), если не указано иное. Данный термин охватывает «полноразмерный», непроцессированный NRG, а также любую форму NRG, полученную в результате процессинга в клетке. Данный термин также охватывает встречающиеся в природе варианты NRG, например, сплайс-варианты или аллельные варианты. Известны четыре формы NRG: NRG1 (Holmes, W.E. et al., Science 256: 1205-1210 (1992)); NRG2 (Caraway, K.L. et al., Nature 387: 512-516 (1997)); NRG3 (Zhang, E. et al., Proc Natl Acad Sci USA 94: 9562-9567)); и NRG4 (Harari, D. et al., Oncogene 18: 2681-2689)). Вследствие альтернативного сплайсинга, существуют две активные изоформы EGF-подобного домена NRG1, который необходим для связывания рецептора, называемые NRG1 альфа (NRG1α) и NRG1 бета (NRGβ). Последовательности иллюстративных NRG1 человека представлены в базе данных Genbank под регистрационным № BK000383 (Falls, D. L., Ex Cell Res, 284: 14-30 (2003) в Патенте США № 5367060.

Используемый здесь термин «лечение» (и его грамматические вариации, такие как «лечить» или «проводить лечение») относится к клиническому вмешательству в попытке изменить естественное течение заболевания у объекта, подвергающегося лечению, и может быть осуществлено либо для профилактики, или в рамках течения клинической патологии. Желательные эффекты лечения включают в себя, но не ограничиваются этим, предотвращение появления или возврата болезни, облегчение симптомов, уменьшение любых прямых или опосредованных патологических последствий болезни, предотвращение развития метастаз, снижение степени прогрессирования заболевания, улучшение состояния или временное улучшение проявления болезни, и ремиссию или улучшенный прогноз заболевания. В некоторых вариантах осуществления, антагонисты NRG по данному изобретению используют для отсрочки развития заболевания, замедления прогрессирования заболевания, предотвращения рецидива, или для увеличения периода времени до рецидива опухоли. В некоторых вариантах осуществления, результатом лечения является уменьшение числа, или полное отсутствие, клеток, вызывающих повторное появление опухоли; уменьшение числа клеток, вызывающих повторное появление опухоли, в солидной опухоли по сравнению с клетками в данной опухоли, не являющимися клетками, вызывающими повторное появление опухоли; и/или ингибирование пролиферации клеток, вызывающих повторное появление опухоли. В некоторых вариантах осуществления лечение с помощью антагониста NRG приводит в результате к увеличению периода времени до рецидива опухоли, по меньшей мере, в 1,25, 1,50, 1,75, 2,0 раза большего, чем период времени до рецидива опухоли без лечения антагонистом NRG.

Термин «вариабельный участок» или «вариабельный домен» относится к домену тяжелой или легкой цепи антитела, который вовлечен в связывание данного антитела с антигеном. Вариабельные домены тяжелой цепи и легкой цепи (VH и VL, соответственно) нативного антитела, как правило, имеют схожие структуры, каждый домен содержит в себе четыре консервативные каркасные области (FR) и три гипервариабельных участка (HVR). (См., например, Kindt et al. Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91 (2007)). Единственный домен VH или VL может быть достаточным для придания антиген-связывающей специфичности. Более того, антитела, которые связывают определенный антиген, могут быть изолированы с использованием домена VH или VL от антитела, которое связывает данный антиген, для проведения скрининга библиотеки комплементарных доменов VL или VH, соответственно. См., например, Portolano et al., J. Immunol. 150: 880-887 (1993); Clarkson et al., Nature 352: 624-628 (1991).

Используемый здесь термин «вектор» относится к молекуле нуклеиновой кислоты, способной репродуцировать другую нуклеиновую кислоту, с которой она связана. Данный термин включает в себя вектор в качестве самореплицируемой структуры нуклеиновой кислоты, а также вектор, введенный в геном клетки-хозяина, в которую он был встроен. Некоторые векторы способны контролировать экспрессию нуклеиновых кислот, с которыми они функционально связаны. Такие векторы называются здесь «экспрессирующие векторы».

II. КОМПОЗИЦИИ И СПОСОБЫ

Настоящее изобретение основывается на данных, что аутокринный сигнальный путь NRG играет важную роль в выживаемости и пролиферации небольшой популяции опухолевых клеток после химиотерапии опухоли, в остальном чувствительной к химиотерапии. Эти выжившие опухолевые клетки, обозначенные здесь как «клетки, вызывающие повторное возникновение опухоли», или «TRIC», являются ответственными за рецидив и возвращение злокачественного новообразования у пациентов, чей рак был ранее подвержен лечению терапевтическим средством. В одном варианте осуществления, данное терапевтическое средство, используемое для лечения данного пациента, представляет собой антиген-связывающее средство, например, антитело или его фрагмент.

Ингибирование сигнального пути NRG приводит в результате к отсрочке или предотвращению рецидива или повторного возникновения опухоли после лечения с помощью терапевтического средства. Соответственно, данное изобретение обеспечивает антагонисты NRG, которые ингибируют индуцированный NRG сигнальный путь. В одном варианте осуществления, данный антагонист NRG представляет собой антагонист NRG1. Нашли применение антагонистам NRG при лечении рака и предотвращении резистентности и/или рецидива рака после лечения с помощью терапевтического средства. Другой аспект данного изобретения предусматривает способ предотвращения резистентности к лечению с помощью терапевтического средства у пациента, посредством введения в организм данного пациента антагониста NRG. Другой аспект данного изобретения предусматривает предотвращение рецидива рака после лечения с помощью терапевтического средства посредством введения в организм пациента антагониста NRG. В еще одном аспекте данное изобретение обеспечивает модель, характеризующую TRIC. Как описано в Примерах и на сопутствующих Фигурах, эта модель состоит из клеток, которые демонстрируют сильную реакцию на лечение, приводящую в результате к значительному уменьшению опухоли с последующим рецидивом заболевания после прекращения данного лечения. Данную модель применяют для скрининга соединений, которые могут быть использованы для нацеливания на TRIC и для определения молекулярной основы данных TRIC.

Специфические аспекты включают в себя способ предотвращения рецидива опухоли или увеличения периода времени до рецидива опухоли, включающий в себя введение в организм данного пациента эффективного количества антагониста NRG. В одном варианте осуществления, данный пациент получал лечение терапевтическим средством, таким как химиотерапевтическое средство, или антиген-связывающим средством, таким как антитело. В одном варианте осуществления данное злокачественное новообразование содержит в себе клетки, повторно вызывающие развитие опухоли. В одном варианте осуществления, данным злокачественным новообразованием является немелкоклеточный рак легких. В одном варианте осуществления, данным злокачественным новообразованием является рак молочной железы. В одном варианте осуществления данный пациент получал лечение химиотерапевтическим средством. В одном варианте осуществления данное химиотерапевтическое средство представляет собой средство, используемое как стандартное средство лечения рака. В одном варианте осуществления, данным химиотерапевтическим средством является паклитаксал или цисплатин, или комбинация паклитаксала и цисплатина. В одном варианте осуществления данное химиотерапевтическое средство не является ингибитором тирозинкиназы. В другом варианте осуществления данное химиотерапевтическое средство представляет собой ингибитор тирозинкиназы. В одном варианте осуществления данное химиотерапевтическое средство представляет собой ингибитор EGFR, HER2, HER3 и/или HER4. Другой вариант осуществления включает в себя дополнительное введение в организм пациента химиотерапевтического средства в комбинации с антагонистом NRG.

В другом варианте осуществления данный пациент получал лечение антителом. В одном варианте осуществления данное антитело представляет собой анти-тирозинкиназное антитело. В одном варианте осуществления данное антитело представляет собой антитело EGFR, HER2, HER3 и/или HER4. Другой вариант осуществления включает в себя дополнительное введение в организм пациента антитела в сочетании с антагонистом NRG.

В некоторых вариантах осуществления, период времени до рецидива опухоли, по меньшей мере, в 1,25, 1,50, 1,75, 2,0, 2,5, 5,0, 10, 20, или 50 раз больше, чем период времени до рецидива опухоли без лечения с помощью данного антагониста неурегулина.

Другой аспект обеспечивает способ лечения пациента с резистентным злокачественным новообразованием, включающий в себя введение в организм данного пациента эффективного количества антагониста NRG. В одном варианте осуществления данное злокачественное новообразование содержит в себе клетки, повторно вызывающие опухоль. В одном варианте осуществления, данным злокачественным новообразованием является немелкоклеточный рак легких. В одном варианте осуществления, данным злокачественным новообразованием является рак молочной железы. В одном варианте осуществления данное злокачественное новообразование является резистентным к лечению химиотерапевтическими средствами. В одном варианте осуществления данное злокачественное новоборазование является резистентным к лечению паклитаксалом или цисплатином, или комбинацией паклитаксала и цисплатина. В одном варианте осуществления данное злокачественное новообразование является резистентным к лечению ингибитором тирозинкиназы. В одном варианте осуществления данное злокачественное новообразование является резистентным к лечению ингибитором EGFR, HER2, HER3 и/или HER4. Другой вариант осуществления включает в себя дополнительное введение в организм пациента химиотерапевтического средства. В одном варианте осуществления данным химиотерапевтическим средством является паклитаксал или цисплатин, или комбинация паклитаксала и цисплатина. В одном варианте осуществления данным химиотерапевтическим средством является ингибитор EGFR, HER2, HER3 и/или HER4.

В одном варианте осуществления данное злокачественное новообразование является резистентным к лечению с помощью терапевтического антитела. В одном варианте осуществления данное злокачественное новообразование является резистентным к лечению с помощью антитела EGFR, HER2, HER3 или HER4. Другой вариант осуществления включает в себя дополнительное введение антитела в организм пациента. В одном варианте осуществления данным антителом является трастузумаб или пертузумаб.

Другой аспект предусматривает способ предотвращения резистентности злокачественного новообразования, включающий в себя введение в организм онкологического пациента эффективного количества антагониста NRG и терапевтического средства. В одном варианте осуществления данное злокачественное новообразование содержит в себе клетки, повторно вызывающие опухоль. В одном варианте осуществления, данным злокачественным новообразованием является немелкоклеточный рак легких. В одном варианте осуществления, данным злокачественным новообразованием является рак молочной железы. В одном варианте осуществления данное злокачественное новообразование является резистентным к лечению химиотерапевтическими средствами. В одном варианте осуществления данное злокачественное новоборазование является резистентным к лечению паклитаксалом или цисплатином, или комбинацией паклитаксала и цисплатина. В одном варианте осуществления данное химиотерапевтическое средство не является ингибитором тирозинкиназы. В другом варианте осуществления данное химиотерапевтическое средство представляет собой ингибитор тирозинкиназы. В одном варианте осуществления данное химиотерапевтическое средство представляет собой ингибитор EGFR, HER2, HER3 и/или HER4. Другой вариант осуществления включает в себя дополнительное введение в организм пациента химиотерапевтического средства. В одном варианте осуществления данным химиотерапевтическим средством является паклитаксал или цисплатин, или комбинация паклитаксала и цисплатина.

В одном варианте осуществления данное злокачественное новообразование является резистентным к лечению с помощью терапевтического антитела. В одном варианте осуществления данное злокачественное новообразование является резистентным к лечению с помощью антитела EGFR, HER2, HER3 или HER4. Другой вариант осуществления включает в себя дополнительное введение в организм пациента антитела. В одном варианте осуществления данным антителом является трастузумаб или пертузумаб.

В этих способах терапевтического применения, данный антагонист NRG представляет собой антитело, малую молекулу, иммуноадгезин, или РНК. В одном варианте осуществления данный антагонист NRG представляет собой антагонист NRG1. В одном варианте осуществления данный антагонист NRG представляет собой анти-NRG1 антитело.

В еще одном аспекте данное изобретение предусматривает использование антагониста неурегулина в производстве или получении лекарственного препарата. В одном варианте осуществления данный антагонист неурегулина или лекарственный препарат, произведенный с антагонистом неурегулина, используется для увеличения периода времени до рецидива опухоли у пациента. В другом варианте осуществления данный антагонист неурегулина или лекарственный препарат, произведенный с антагонистом неурегулина, используется для лечения злокачественного новообразования, которое является резистентным к терапевтическому средству.

A. Антагонисты NRG

Антагонисты NRG, используемые в методах лечения по данному изобретению, включают в себя полипептиды, которые специфически связываются с NRG, антитела NRG (анти-NRG антитела), РНК, например, iРНК, siPHK, shPHK, и тому подобное, малые молекулы, рецепторные молекулы и производные, такие как иммуноадгезины, которые специфически связываются с NRG (см., например, Патенты США 6696290 и 7659368, Публикации США 2010055093 и 20100278801) и слитые белки. Антагонисты NRG также включают в себя антагонистические варианты полипептидов NRG, аптамеры РНК и пептитела против NRG. Примеры каждого из них описаны ниже. В одном варианте осуществления антагонисты NRG представляют собой антагонисты NRG1. В других вариантах осуществления данные антагонисты NRG представляют собой антагонисты NRG2, NRG3, или NRG4.

1. Антитела

Анти-NRG антитела, используемые в способах по данному изобретению, включают в себя антитела, которые связываются с достаточной аффинностью и специфичностью с NRG, и могут снижать или ингибировать сигнальный путь NRG. Антитела NRG описаны в WO1992020798, патенте США № 6953842 и Патенте США № 6252051.

a) Аффинность антитела

В некоторых вариантах осуществления антитела, представленные здесь, имеют константу диссоциации (Kd) ≤1 мкМ, ≤100 нМ, ≤10 нМ, ≤1 нМ, ≤0,1 нМ, ≤0,01 нМ или ≤0,001 нМ (например, 10-8M или менее, например, от 10-8M до 10-13M, например, от 10-9M до 10-13M).

В одном варианте осуществления Kd оценивают посредством анализа связывания радиомеченного антитела (RIA), осуществленного с вариантом Fab представляющего интерес антитела, и его антигена, как описано в следующем анализе. Аффинность связывания Fab с его антигеном в растворе оценивают посредством уравновешивания Fab с минимальной концентрацией (125I)-меченного антигена в присутствии титрационных групп немеченного антигена, затем осуществляя захват связанного антигена с помощью планшета с покрытием анти-Fab антитела (см., например, Chen et al., J. Mol. Biol. 293: 865-881(1999)). Для создания условий для данного анализа в течение ночи осуществляли покрытие мульти-луночных планшетов MICROTITER® (Thermo Scientific) с помощью 5 мкг/мл захватывающего анти-Fab антитела (Cappel Labs) в 50 мМ карбоната натрия (pH 9,6), и впоследствие блокируя с помощью 2% (вес/объем) альбумина бычьей сыворотки в PBS в течение от двух до пяти часов при комнатной температуре (приблизительно 23° C). В неадсорбирующем планшете (Nunc #269620), 100 пМ или 26 пМ [125I]-антиген смешивали с серийными разведениями представляющего интерес Fab (например, следуя оценке анти-VEGF антитела, Fab-12, у Presta et al., Cancer Res. 57:4593-4599 (1997)). Данный представляющий интерес Fab затем инкубируют в течение ночи; однако, инкубирование может продолжаться в течение более длительного периода времени (например, приблизительно 65 часов) для гарантии того, что равновесие достигнуто. Затем, данные смеси переносят на захватывающий планшет для инкубирования при комнатной температуре (например, в течение одного часа). Затем данный раствор удаляют, и планшет отмывают восемь раз с использованием 0,1% полисорбат 20 (TWEEN-20®) в PBS. После высушивания данных планшетов, добавляют 150 мкл/лунка сцинтилляторной жидкости (MICROSCINT-20™; Packard), и производят считывание данных планшетов с помощью гамма-счетчика TOPCOUNT™ (Packard) в течение десяти минут. Концентрации каждого Fab, которые дают меньше чем, или эквивалентно, 20% от максимального связывания, выбраны для использования в анализе конкурентного связывания.

В соответствии с другим вариантом осуществления Kd измеряют с помощью анализа поверхностного плазмонного резонанса с применением BIACORE®-2000 или BIACORE®-3000 (BIAcore, Inc., Piscataway, NJ) при 25° C с использованием чипов с иммобилизированным антигеном СМ5 при ~10 единицах ответа (RU). Вкратце, биосенсорные чипы с карбоксиметилированным декстраном (CM5, BIACORE, Inc.) активировали с помощью N-этил-N'-(3-диметиламинопропил)-карбодиимид гидрохлоридом (EDC) и N-гидроксисукцинимидом (NHS) в соответствии с инструкциями поставщика. Антиген разбавляли с помощью 10 мМ ацетата натрия, pH 4,8, до 5 мкг/мл (~0,2 мкМ) перед инъекцией при скорости тока 5 мкл/минуту, для получения приблизительно 10 единиц ответа (RU) связанного белка. После инъекции антигена, вводили этаноламин для блокады непрореагировавших групп. Для измерения кинетики двухкратные серийные разведения Fab (от 0,78 нМ до 500 нМ) впрыскивали в PBS с 0,05% полисорбат 20 (TWEEN-20™) сурфактант (PBST) при 25°C при скорости потока приблизительно 25 мкл/мин. Скорости ассоциации (kon) и скорости диссоциации (kOff) подсчитывали с использованием взаимооднозначной модели связывания Ленгмюра (BIACORE® Evaluation Software version 3.2) посредством одновременной аппроксимации сенсограмм ассоциации и диссоциации. Равновесную константу диссоциации (Kd) рассчитывали как соотношение koff/kon. См., например, Chen et al., J. Mol. Biol. 293: 865-881 (1999). Если скорость ассоциации превышает 106M-1 с-1 в вышеприведенном анализе поверхностного плазмонного резонанса, тогда можно определить скорость ассоциации с использованием технологии блокирования флуоресценции, которая оценивает повышение или понижение интенсивности флуоресценции (возбуждение=295 нм; эмиссия=340 нм, полоса пропускания 16 нм) при 25° C анти-антигенного антитела 20 нМ (форма Fab) в PBS, pH 7,2, в присутствии возрастающих концентраций антигена, как измерено на спектрофотометре, таком как спектрофотометр с остановкой потока (Aviv Instruments) или спектрофотометр 8000-серии SLM-AMINCO™ (Thermo Spectronic) с кюветой с мешалкой.

b) Фрагменты антител

В некоторых вариантах осуществления антитело, обеспеченное здесь, представляет собой фрагмент антитела. Фрагменты антител включают в себя, но не ограничиваются этим, фрагменты Fab, Fab', Fab'-SH, F(ab')2, Fv и scFv, и другие фрагменты, описанные ниже. Для обзора некоторых фрагментов антител см. Hudson et al. Nat. Med. 9: 129-134 (2003). Для обзора фрагментов scFv см., например, Pluckthun, в The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., (Springer- Verlag, New York), pp. 269-315 (1994); также см. WO 93/16185; и Патенты США №№ 5571894 и 5587458. Для пояснений о фрагментах Fab и F(ab')2, содержащих в себе остатки эпитопа связывания с фагоцитарным рецептором, и имеющие увеличенное время полужизни in vivo, см. Патент США № 5869046.

Диатела представляют собой фрагменты антител с двумя антиген-связывающими центрами антитела, которые могут быть бивалентными или биспецифическими. См., например, EP 404097; WO 1993/01161; Hudson et al., Nat. Med. 9: 129-134 (2003); и Hollinger et al., Proc. Natl. Acad. Sci. USA 90: 6444-6448 (1993). Триатела и тетратела также описаны у Hudson et al., Nat. Med. 9: 129-134 (2003).

Однодоменные антитела представляют собой фрагменты антител, содержащие в себе весь или часть вариабельного домена тяжелой цепи или весь, или часть, вариабельного домена легкой цепи антитела. В некоторых вариантах осуществления однодоменное антитело представляет собой однодоменное антитело человека (Domantis, Inc., Waltham, MA; см., например, патент США № 6248516 B1).

Фрагменты антител можно получить с помощью различных способов, включающих в себя, но не ограничиваясь этим, протеолитическое расщепление интактного антитела, а также продукцию рекомбинантными клетками-хозяевами (например, E.Coli или фаг), как описано здесь.

c) Химерные и гуманизированные антитела

В некоторых вариантах осуществления антитело, обеспеченное здесь, представляет собой химерное антитело. Некоторые химерные антитела описаны, например, в Патенте США № 4816567; и Morrison et al., Proc. Natl. Acad. Sci. USA, 81: 6851-6855 (1984)). В одном примере химерное антитело содержит в себе вариабельный участок, не относящийся к человеческому роду (например, вариабельный участок, полученный от мыши, крысы, хомяка, кролика или примата, не являющегося человеком, например, обезьяны) и константную область, принадлежащую человеку. В еще одном примере, химерное антитело представляет собой антитело «с переключенным синтезом классов», в котором класс или подкласс отличается от исходного антитела. Химерные антитела включают в себя их антигенсвязывающие фрагменты.

В некоторых вариантах осуществления химерное антитело представляет собой гуманизированное антитело. Обычно антитело, не являющееся человеческим, гуманизируют для уменьшения иммуногенности для человека, одновременно сохраняя специфичность и аффинность исходного антитела, не являющегося человеческим. Как правило, гуманизированные антитела содержат в себе один или несколько вариабельных доменов, в которых HVR, например, CDR, (или их части) происходят из антитела, не являющегося человеческим, и FR (или их части) происходят из последовательностей антител человека. Гуманизированное антитело, при желании, также может содержать в себе, по меньшей мере, часть константной области антитела человека. В некоторых вариантах осуществления, некоторые остатки FR в гуманизированном антителе заменены на соответствующие остатки антитела, не являющегося человеческим, (например, антитело, из которого происходят остатки HVR), например, для восстановления или повышения специфичности или аффинности антитела.

Гуманизированные антитела и способы их получения описаны, например, у Almagro and Fransson, Front. Biosci. 13: 1619-1633 (2008), и дополнительно описаны, например, у Riechmann et al., Nature 332: 323-329 (1988); Queen et al., Proc. Natl Acad. Sci. USA 86: 10029-10033 (1989); Патентах США №№ 5821337, 7527791, 6982321 и 7087409; Kashmiri et al, Methods 36: 25-34 (2005) (описывает трансплантацию SDR (a-CDR)); Padlan, Mol. Immunol. 28: 489-498 (1991) (описывает «восстановление поверхности»); Dall'Acqua et al., Methods 36: 43-60 (2005) (описывает «перетасовку FR»); и Osbourn et al., Methods 36: 61-68 (2005) и Klimka et al., Br. J. Cancer, 83: 252-260 (2000) (описывает подход «управляемой селекции» для перетасовки FR).

Каркасные области иммуноглобулина человека, которые могут быть использованы для гуманизации, включают в себя, но не ограничены этим: каркасные области, выбранные с помощью метода «максимального соответствия» (см., например, Sims et al. J. Immunol. 151:2296 (1993)); каркасные области, полученные из консенсусной последовательности антител человека определенной подгруппы вариабельных областей легкой или тяжелой цепи (см., например, Carter et al. Proc. Natl. Acad. Sci. USA, 89: 4285 (1992); и Presta et al. J. Immunol, 151: 2623 (1993)); зрелые каркасные области (соматически мутированные) человека или зародышевые каркасные области человека (см., например, Almagro and Fransson, Front. Biosci. 13: 1619-1633 (2008)); и каркасные области, полученные в результате скрининга библиотек FR (см., например, Baca et al., J Biol. Chem. 272: 10678-10684 (1997) и Rosok et al., J. Biol. Chem. 271: 22611-22618 (1996)).

d) Антитела человека

В некоторых вариантах осуществления антитело, обеспеченное здесь, представляет собой антитело человека. Антитела человека можно получить, используя различные способы, известные в данной области. Антитела человека описаны, в общем смысле, у van Dijk and van de Winkel, Curr. Opin. Pharmacol. 5: 368-74 (2001) и Lonberg, Curr. Opin. Immunol. 20: 450-459 (2008).

Антитела человека могут быть получены в результате введения иммуногена трансгенному животному, которое было модифицировано для производства интактных антител человека или интактных антител с вариабельными областями антитела человека в ответ на введение антигена. У таких животных, как правило, имеются все или часть локусов иммуноглобулина человека, которые замещают локусы эндогенного иммуноглобулина, или которые присутствуют экстрахромосомно или интегрированы случайным образом в хромосомы данного животного. У таких трансгенных мышей локусы эндогенного иммуноглобулина, как правило, инактивированы. Для обзора способов получения антител человека у трансгенных животных, см. Lonberg, Nat. Biotech. 23: 1117-1125 (2005). Также см. Патенты США №№ 6075181 и 6150584, в которых описана технология XENOMOUSE™; Патент США № 5770429, в котором описана технология HUMAB®; Патент США № 7041870, в котором описана технология K-M MOUSE®, и Публикацию патентной заявки США № US 2007/0061900, в котором описана технология VELOCIMOUSE®). Вариабельные области иммуноглобулина человека из интактных антител, выработанных у таких животных, могут быть дополнительно модифицированы, например, посредством объединения с другой константной областью иммуноглобулина человека.

Антитела человека также можно получить, используя методы на основе гибридомы. Были описаны клеточные линии миеломы человека и гетеромиеломы мышь-человек для продукции моноклональных антител человека. (См., например, Kozbor J. Immunol, 133: 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987); и Boerner et al., J. Immunol., 147: 86 (1991)). Антитела человека, выработанные с помощью технологии В-клеточной гибридомы человека, также описаны у Li et al. Proc. Nail Acad. Sci. USA, 103: 3557-3562 (2006). Дополнительные способы включают в себя те, которые описаны, например, в Патенте США № 7189826 (описывается получение моноклональных антител IgM человека из гибридомных клеточных линий) и Ni, Xiandai Mianyixue, 26(4): 265-268 (2006) (описываются гибридомы человек-человек). Технология гибридомы человека (технология Trioma) также описана у Vollmers and Brandlein, Histology and Histopathology, 20(3): 927-937 (2005) и Vollmers and Brandlein, Methods and Findings in Experimental and Clinical Pharmacology, 27(3): 185-91 (2005).

Антитела человека также могут быть получены посредством выделения последовательностей вариабельного домена клона Fv, отобранных из библиотек фагового дисплея, полученных от человека. Такие последовательности вариабельных доменов могут быть затем скомбинированы с необходимым константным доменом иммуноглобулина человека. Технологии отбора антител человека из библиотек антител описаны ниже.

e) Антитела, полученные из библиотек

Антитела по данному изобретению могут быть изолированы в результате скрининга комбинаторных библиотек на антитела с необходимой активностью или активностями. Например, в данной области известны различные способы для создания библиотек фаговых дисплеев и скрининга таких библиотек на антитела, обладающие необходимыми характеристиками связывания. Такие методы описаны, например, у Hoogenboom et al. в Methods in Molecular Biology 178: 1-37 (O'Brien et al., ed., Human Press, Totowa, NJ, 2001) и дополнительно описаны, например, у McCafferty et al., Nature 348: 552-554; Clackson et al., Nature 352: 624-628 (1991); Marks et al., J. Mol. Biol. 222: 581-597 (1992); Marks and Bradbury, в Methods in Molecular Biology 248: 161-175 (Lo, ed., Human Press, Totowa, NJ, 2003); Sidhu et al., J. Mol. Biol. 338(2): 299-310 (2004); Lee et al., J. Mol. Biol. 340(5): 1073-1093 (2004); Fellouse, Proc. Natl. Acad. Sci. USA 101(34): 12467-12472 (2004); и Lee et al., J. Immunol. Methods 284(1-2): 119-132 (2004).

В некоторых технологиях фаговых дисплеев спектры генов VH и VL раздельно клонировали посредством полимеразной цепной реакции (ПЦР) и рекомбинировали случайным образом в фаговые библиотеки, затем проводили их скрининг на антиген-связывающий фаг, как описано у Winter et al., Ann. Rev. Immunol, 12: 433-455 (1994). Фаг обычно воспроизводит фрагменты антител, либо в виде одноцепочечных Fv (scFv) фрагментов, либо в виде фрагментов Fab. Библиотеки, полученные из иммунизированных источников, обеспечивают высокоаффинные антитела к данному иммуногену без необходимости создания гибридом. Альтернативно, не подвергнутый какому-либо воздействию спектр может быть клонирован (например, человеческий) для обеспечения единственного источника антител к широкому ассортименту «не своих», а также аутоантигенов без какой-либо иммунизации, как описано у Griffiths et al., EMBO J, 12: 725-734 (1993). Наконец, не подвергнутые какому-либо воздействию библиотеки также можно создать синтетически посредством клонирования неперегруппированных сегментов V-гена из стволовых клеток, и используя праймеры для ПЦР, содержащие в себе случайную последовательность для кодирования высоковариабельных областей CDR3 и для осуществления перегруппировки in vitro, как описано у Hoogenboom and Winter, J. Mol. Biol, 227: 381-388 (1992). Патентные публикации, в которых описываются фаговые библиотеки антител человека, включают в себя, например: Патент США № 5750373, и Патентные публикации США №№ 2005/0079574, 2005/0119455, 2005/0266000, 2007/0117126, 2007/0160598, 2007/0237764, 2007/0292936 и 2009/0002360.

Антитела или фрагменты антител, выделенные из библиотек антител человека, здесь рассматриваются как антитела человека или фрагменты антител человека.

f) Мультиспецифические антитела

В некоторых вариантах осуществления антитело, обеспеченное здесь, представляет собой мультиспецифическое антитело, например, биспецифическое антитело. Мультиспецифические антитела представляют собой моноклональные антитела, которые имеют специфическое связывание, по меньшей мере, для двух участков. В некоторых вариантах осуществления одна из специфичностей связывания является для NRG и другая - для любого другого антигена. В некоторых вариантах осуществления, биспецифические антитела могут связываться с двумя различными эпитопами NRG. Биспецифические антитела также можно использовать для локализации цитотоксических агентов в клетках, которые экспрессируют NRG. Биспецифические антитела могут быть получены в виде полноразмерных антител или в виде фрагментов антител.

Технологии получения мультиспецифических антител включают в себя, но не ограничиваются этим, рекомбинантную совместную экспрессию двух пар тяжелая цепь-легкая цепь иммуноглобулинов, имеющих различные специфичности (см. Milstein and Cuello, Nature 305: 537 (1983)), WO 93/08829, и Traunecker et al., EMBO J. 10: 3655 (1991)), и технология «выступ-во-впадину» (см., например, патент США № 5731168). Мультиспецифические антитела также можно получить в результате конструирования электростатических управляемых эффектов для создания Fc-гетеродимерных молекул антител (WO 2009/089004A1); перекрестное сшивание двух или нескольких антител или фрагментов (см., например, Патент США № 4676980, и Brennan et al., Science, 229: 81 (1985)); использование лейциновых застежек для получения биспецифических антител (см., например, Kostelny et al., J. Immunol, 148(5): 1547-1553 (1992)); использование технологии «диатело» для получения фрагментов биспецифических антител (например, см., Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993)); и использование одноцепочечных Fv (sFv) димеров (см., например, Gruber et al., J. Immunol, 152: 5368 (1994)); и получение триспецифических антител, как описано, например, у Tutt et al. J. Immunol. 147:60 (1991).

Сконструированные антитела с тремя или более функциональными антиген-связывающими участками, в том числе «антитела Octopus», также учтены здесь (см., например, US 2006/0025576A1).

Антитело, или его фрагмент, также включает в себя «FAb двойного действия», или «DAF», содержащий в себе антиген-связывающий участок, который связывает NRG, так же как и другой, отличный антиген (см., US 2008/0069820, например).

g) Варианты антител

В некоторых вариантах осуществления предусмотрены варианты аминокислотных последовательностей антител, обеспеченных здесь. Например, может существовать необходимость в улучшении аффинности связывания и/или других биологических свойств данного антитела. Варианты аминокислотной последовательности антитела могут быть получены в результате введения соответствующих модификаций в нуклеотидную последовательность, кодирующую данное антитело, или в результате пептидного синтеза. Такие модификации включают в себя, например, делеции из, и/или вставки в, и/или замены остатков в пределах аминокислотных последовательностей данного антитела. Любые комбинации делеции, вставки и замены могут быть осуществлены для получения конечной конструкции, при условии, что данная конечная конструкция обладает желаемыми характеристиками, например, связывание антигена.

h) Варианты замен, вставок и делеций

В некоторых вариантах осуществления обеспечены варианты антител, имеющие одну или несколько аминокислотных замен. Участки, представляющие интерес для замещающего мутагенеза, включают в себя HVR и FR. Консервативные замены представлены в Таблице 1 под заголовком «консервативные замены». Более значительные замены представлены в Таблице 1 под заголовком «примеры замен», и как дополнительно описано ниже, по отношению к классам боковых цепей аминокислот. Аминокислотные замены могут быть введены в представляющее интерес антитело и проведен скрининг продуктов на требуемую активность, например, восстановление/улучшение связывания антигена, сниженную иммуногенность или улучшенную ADCC или CDC.

Аминокислоты могут быть сгруппированы на основании общих свойств боковых цепей:

(1) гидрофобные: Norleucine, Met, Ala, Val, Leu, Ile;

(2) нейтральные гидрофильные: Cys, Ser, Thr, Asn, Gin;

(3) кислые: Asp, Glu;

(4) основные: His, Lys, Arg;

(5) остатки, которые оказывают влияние на ориентацию цепи: Gly, Pro;

(6) ароматические: Trp, Tyr, Phe.

Неконсервативные замены влекут за собой замену члена одного из этих классов на другой класс.

Один тип вариантов замен предусматривает замену одного или нескольких остатков гипервариабельной области исходного антитела (например, гуманизированного антитела, или антитела человека). Как правило, получившийся вариант (варианты), отобранный для дальнейшего изучения, будет иметь модификации (например, улучшения) некоторых биологических свойств (например, повышенная аффинность, сниженная иммуногенность) по сравнению с исходным антителом, и/или будет иметь в значительной степени сохраненные некоторые биологические свойства данного исходного антитела. Примером варианта замены является антитело с созревшей аффинностью, которое может быть удобно сгенерировано, например, с помощью технологий созревания аффинности на основе фагового дисплея, таких как описаны здесь. Вкратце, один или несколько остатков HVR изменены и данные вариантные антитела воспроизводятся на фаге и проводится их скрининг на определенную биологическую активность (например, аффинность связывания).

Изменения (например, замены) можно осуществить в HVR, например, для улучшения аффинности антитела. Такие изменения можно осуществить в «горячих точках» HVR, а именно остатках, кодируемых кодонами, которые подвержены мутациям с высокой частотой во время процесса соматического созревания (см., например, Chowdhury, Methods Mol. Biol. 207: 179-196 (2008)), и/или SDR (a-CDR), с последующим исследованием аффинности связывания полученного варианта VH или VL. Созревание аффинности в результате конструирования и повторного отбора из вторичных библиотек, описано, например, у Hoogenboom et al. в Methods in Molecular Biology 178: 1-37 (O'Brien et al., ed., Human Press, Totowa, NJ, (2001)). В некоторых вариантах осуществления созревания аффинности, разнообразие введено в вариабельные гены, выбранные для созревания, посредством любого из множества способов (например, ПЦР сниженной точности, смешение цепей, или сайт-направленный мутагенез с использованием олигонуклеотидов). После этого создана вторичная библиотека. Затем проводят скрининг данной библиотеки для идентификации любых вариантов антител с требуемой аффинностью. Другой способ введения разнообразия предусматривает HVR-направленные подходы, где несколько остатков HVR (например, 4-6 остатков единовременно) расположены случайным образом. Остатки HVR, вовлеченные в связывание антигена, могут быть идентифицированы, например, с помощью сканирующего аланином мутагенеза или моделирования. CDR-H3 и CDR-L3, в частности, зачастую представляют собой цель.

В некоторых вариантах осуществления, замены, вставки или делеции могут быть осуществлены в пределах одного или нескольких HVR, при условии, что такие изменения не снижают в значительной степени способность данного антитела связывать антиген. Например, консервативные изменения (например, консервативные замены, как представлено здесь), которые не снижают значительно аффинность связывания, могут быть образованы в HVR. Такие изменения могут находиться вне «горячих точек» HVR или SDR. В некоторых вариантах осуществления вариантов последовательностей VH и VL, представленных выше, каждый HVR, либо неизменен, либо содержит в себе не более чем одна, две или три аминокислотные замены.

Удобный метод идентификации остатков или областей антитела, которые могут представлять собой мишень для мутагенеза, называется «сканирующий аланином мутагенез», как описано у Cunningham and Wells (1989) Science, 244: 1081-1085. В этом способе остаток или группа остатков-мишеней (например, заряженные остатки, такие как arg, asp, his, lys, и glu) идентифицированы и заменены нейтральными или отрицательно заряженными аминокислотами (например, аланин или полиаланин) для определения того, не подвергнуто ли влиянию взаимодействие данного антитела с антигеном. Дополнительные замены могут быть введены в данные аминокислотные позиции, демонстрирующие функциональную чувствительность к исходным заменам. Альтернативно, или дополнительно, кристаллическая структура комплекса антиген-антитело для идентификации точек контакта между данным антителом и антигеном. Такие контактные остатки и близлежащие остатки могут быть намечены или исключены как кандидаты для замены. Может быть проведен скрининг вариантов для выявления того, содержат ли они в себе требуемые свойства.

Вставки аминокислотных последовательностей содержат в себе амино- и/или гидрокси-концевые слияния, варьирующие по длине от одного остатка до полипептидов, содержащих в себе сотни или более остатков, а также вставки одного или множественных аминокислотных остатков внутри последовательности. Примеры концевых вставок включают в себя антитело с N-концевым остатком метионина. Другие варианты молекул антитела с вставками включают в себя слияние N- или C-концом данного антитела с ферментом (например, для ADEPT) или полипептидом, который увеличивает время полужизни данного антитела в сыворотки крови.

i) Варианты гликозилирования

В некоторых вариантах осуществления антитело, обеспеченное здесь, изменено для повышения или снижения степени гликолизирования данного антитела. Дополнение или удаление участков гликолизирования в антитела может быть удобно осуществлено путем изменения аминокислотной последовательности таким образом, что один или несколько участков гликозилирования созданы или удалены.

Если антитело содержит в себе Fc-участок, карбогидрат, прикрепленный к нему, может быть изменен. Нативные антитела, продуцируемые клетками млекопитающих, обычно содержат в себе разветвленный, двухантенный олигосахарид, который, как правило, прикреплен посредством N-связи к Asn297 домена СН2 данного Fc-участка. См., например, Wright et al. TIBTECH 15: 26-32 (1997). Данный олигосахарид может включать в себя различные углеводы, например, маннозу, N-ацетилглюкозамин (GlcNAc), галактозу, и сиаловую кислоту, а также фукозу, прикрепленную к GlcNAc в «стволе» данной двухантенной олигосахаридной структуры. В некоторых вариантах осуществления, модификации данного олигосахарида в антителе по данному изобретению может быть осуществлена для создания вариантов антитела с определенными улучшенными свойствами.

В одном варианте осуществления, обеспечены варианты антитела, имеющие углеводную структуру, в которой существует недостаток фукозы, прикрепленной (напрямую или опосредованно) к Fc-участку. Например, количество фукозы в таком антителе может составлять от 1% до 80%, от 1% до 65%, от 5% до 65% или от 20% до 40%. Количество фукозы определяется путем расчета среднего количества фукозы в сахарной цепи в Asn297, по отношению к сумме всех гликоструктур, присоединенных к Asn297 (например, комплексы, гибриды и структуры с высоким содержанием маннозы), что оценено с помощью масс-спектрометра MALDI-TOF, как описано в WO 2008/077546, например. Asn297 относится с остатку аспарагина в положении приблизительно 297 в Fc-области (нумерация Eu остатков Fc-участка); однако, Asn297 также может быть расположен приблизительно ±3 аминокислоты выше или ниже положения 297, а именно, между положениями 294 и 300, по причине минорных изменений последовательностей в антителах. Такие варианты фукозилирования могут иметь улучшенную функцию ADCC. См., например, Публикации Патентов США №№ US 2003/0157108 (Presta, L.); US 2004/0093621 (Kyowa Hakko Kogyo Co., Ltd). Примеры публикаций, посвященных «дефукозилированным» или «с дефицитом фукозы» вариантам антител, включают в себя: US 2003/0157108; WO 2000/61739; WO 2001/29246; US 2003/0115614; US 2002/0164328; US 2004/0093621; US 2004/0132140; US 2004/0110704; US 2004/0110282; US 2004/0109865; WO 2003/085119; WO 2003/084570; WO 2005/035586; WO 2005/035778; WO 2005/053742; WO2002/031140; Okazaki et al. J. Mol. Biol. 336: 1239-1249 (2004); Yamane-Ohnuki et al. Biotech. Bioeng. 87: 614 (2004). Примеры клеточных линий, способных продуцировать дефукозилированные антитела, включают в себя клетки Lec13 CHO с дефицитом фукозилирования белка (Ripka et al. Arch. Biochem. Biophys. 249: 533-545 (1986); Патентная заявка США № US 2003/0157108 A1, Presta, L; и WO 2004/056312 Al, Adams et al., в особенности Пример 11), и нокаут-клеточные линии, такие как нокаут-клетки СНО по гену альфа-1,6-фукозилтрансферазы, FUT8, (см., например, Yamane-Ohnuki et al. Biotech. Bioeng. 87: 614 (2004); Kanda, Y. et al., Biotechnol. Bioeng., 94(4): 680-688 (2006); и WO2003/085107).

Варианты антител дополнительно обеспечены с разделенными пополам олигосахаридами, например, в которых двухантенный олигосахарид, прикрепленный к Fc-участку данного антитела, разделен пополам посредством GlcNAc. Такие варианты антител могут иметь уменьшенное фукозилирование и/или улучшенную функцию ADCC. Примеры таких вариантов антител приведены, например, в WO 2003/011878 (Jean-Mairet et al.); Патент США № 6602684 (Umana et al.); и US 2005/0123546 (Umana et al.). Также обеспечены варианты антител с, по меньшей мере, одним остатком галактозы в олигосахариде, прикрепленном к Fc-участку. Такие варианты антител могут иметь улучшенную функцию CDC. Такие варианты антител описаны, например, в WO 1997/30087 (Patel et al.); WO 1998/58964 (Raju, S.); и WO 1999/22764 (Raju, S.).

j) Варианты Fc-области

В некоторых вариантах осуществления одна или несколько аминокислотных модификаций могут быть введены в Fc-область обеспеченного здесь антитела, там самым генерируя вариант Fc-области. Данный вариант Fc-области может включать в себя последовательность Fc-области человека (например, Fc-область IgG1, IgG2, IgG3 или IgG4 человека), содержащую в себе аминокислотную модификацию (например, замену) в одной или нескольких аминокислотных позициях.

В некоторых вариантах осуществления данное изобретение предусматривает вариант антитела, который обладает некоторыми, но не всеми эффекторными функциями, что делает его подходящим кандидатом для применений, для которых время полужизни данного антитела in vivo является важным, хотя некоторые эффекторные функции (такие как комплемент и ADCC) являются излишними или вредными. Анализы цитотоксичности in vitro и/или in vivo могут быть проведены для подтверждения снижения/истощения активностей CDC и/или ADCC. Например, анализ связывания Fc-рецептора (FcR) может быть проведен для уверенности в том, что у данного антитела отсутствует связывание с FcγR (следовательно, вероятно отсутствует активность ADCC), но сохранена способность связывания с FcRn. Первичные клетки, опосредующие ADCC, клетки NK, экспрессируют только FcγRIII, тогда как моноциты экспрессируют FcγRI, FcγRII и FcγRIII. Экспрессия FcR гематопоэтическими клетками, суммирована в Таблице 3 на странице 464 публикации Ravetch and Kinet, Annu. Rev. Immunol. 9: 457-492 (1991). Неограничивающие примеры анализов in vitro для оценки активности ADCC представляющей интерес молекулы, описаны в Патенте США № 5500362 (см., например, Hellstrom, I. et al. Proc. Natl Acad. Sci. USA 83: 7059-7063 (1986)) и Hellstrom, I et al., Proc. Natl Acad. Sci. USA 82: 1499-1502 (1985); 5821337 (см. Bruggemann, M. et al., J. Exp. Med. 166: 1351-1361 (1987)). Альтернативно, нерадиоактивные методы анализа могут быть использованы (см., например, нерадиоактивный анализ цитотоксичности ACTI™ для проточной цитометрии (CellTechnology, Inc. Mountain View, CA; и нерадиоактивный анализ цитотоксичности CytoTox 96® (Promega, Madison, WI). Пригодные эффекторные клетки для таких исследований включают в себя мононуклеары периферической крови (PBMC) и натуральные клетки-киллеры (NK). Альтернативно или дополнительно, активность ADCC представляющей интерес молекулы может быть оценена in vivo, например, на экспериментальной модели на животном, как, например, раскрыто в Clynes et al. Proc. Natl Acad. Sci. USA 95: 652-656 (1998). Анализ связывания C1q также может быть осуществлен для подтверждения того, что данное антитело не способно связываться с C1q, и следовательно у него отсутствует активность CDC. См., например, ELISA связывания C1q и C3c в WO 2006/029879 и WO 2005/100402. Для оценки активации комплемента, анализ CDC может быть осуществлен (см., например, Gazzano-Santoro et al., J. Immunol. Methods 202: 163 (1996); Cragg, M.S. et al., Blood 101: 1045-1052 (2003); и Cragg, M.S. and M.J. Glennie, Blood 103:2738-2743 (2004)). Связывание FcRn и in vivo определения клиренса/времени полужизни, также могут быть осуществлены с использованием методов, известных в данной области (см., например, Petkova, S.B. et al., Int'l. Immunol. 18(12): 1759-1769 (2006)).

Антитела с ослабленными эффекторными функциями включают в себя таковые с заменами одного или нескольких из остатков Fc-области 238, 265, 269, 270, 297, 327 и 329 (Патент США № 6737056). Такие мутанты Fc включают в себя мутантов Fc с заменами в двух или нескольких аминокислотных положениях 265, 269, 270, 297 и 327, включая так называемый мутант Fc «DANA» с заменой остатков 265 и 297 на аланин (патент США № 7332581).

Описаны некоторые варианты антител с усиленным или ослабленным связыванием с FcR. (см., например, Патент США № 6737056; WO 2004/056312, и Shields et al., J. Biol. Chem. 9(2): 6591-6604 (2001)).

В некоторых вариантах осуществления вариант антитела содержит в себе Fc-область с одной или несколькими аминокислотными заменами, которые улучшают ADCC, например, замены в положениях 298, 333, и/или 334 в Fc-области (нумерация остатков по EU).

В некоторых вариантах осуществления изменения осуществлены в Fc-области, что в результате привело к измененному (а именно, усиленному или ослабленному) связыванию C1q и/или комплементзависимой цитотоксичности (CDC), например, как описано в Патенте США № 6194551, WO 99/51642, и Idusogie et al. J. Immunol. 164: 4178-4184 (2000).

Антитела с увеличенным временем полужизни и улучшенным связыванием с неонатальным Fc-рецептором (FcRn), который отвечает за перенос материнских IgG плоду (Guyer et al., J. Immunol. 117:587 (1976) и Kim et al., J. Immunol. 24: 249 (1994)), описаны в US2005/0014934A1 (Hinton et al.). Такие антитела содержат в себе Fc-область с одной или несколькими заменами, что улучшает связывание данной Fc-области с FcRn. Такие варианты Fc включают в себя таковые с заменами в одной или нескольких позициях в Fc-области: 238, 256, 265, 272, 286, 303, 305, 307, 311, 312, 317, 340, 356, 360, 362, 376, 378, 380, 382, 413, 424 или 434, например, замену в позиции 434 Fc-области (Патент США № 7371826).

См., также, Duncan & Winter, Nature 322: 738-40 (1988); Патент США № 5648260; Патент США № 5624821; и WO 94/29351, относительно других примеров вариантов Fc-области.

k) Варианты антител, сконструированные с цистеином

В некоторых вариантах осуществления, может быть целесообразно создание антител, сконструированных с цистеином, например, «thioMAb», в которых один или несколько остатков антитела заменены на остатки цистеина. В конкретных вариантах осуществления замещенные остатки встречаются в доступных участках данного антитела. В результате замены этих остатков на цистеин, реактивные тиоловые группы помещаются в доступные участки данного антитела, и могут быть использованы для конъюгирования данного антитела с другими молекулами, такими как лекарственные молекулы или линкер-лекарственные молекулы, для создания иммуноконъюгата, как описано далее. В некоторых вариантах осуществления, любой один или несколько из следующих остатков может быть замещен на цистеин: V205 (нумерация по Kabat) легкой цепи; A118 (нумерация EU) тяжелой цепи; и S400 (нумерация EU) тяжелой цепи Fc-области. Сконструированные с цистеином антитела могут быть сгенерированы, как описано, например, в Патенте США № 7521541.

I) Производные антител

В некоторых вариантах осуществления, обеспеченное здесь антитело может быть дополнительно изменено, таким образом, чтобы содержать в себе дополнительные небелковые молекулы, которые известны в данной области и легко доступны. Данные вещества, подходящие для дериватизации данного антитела, включают в себя, но не ограничиваются этим, водорастворимые полимеры. Неограничивающие примеры водорастворимых полимеров включают в себя, но не ограничиваются этим, полиэтиленгликоль (PEG), сополимеры этиленгликоля/пропиленгликоля, карбоксиметилцеллюлозу, декстран, поливиниловый спирт, поливинилпирролидон, поли-1,3-диоксолан, поли-1,3,6-триоксан, сополимер этилен/малеиновый ангидрид, полиаминокислоты (либо гомополимеры, либо случайные сополимеры), и декстран или поли(n-винилпирролидон)полиэтиленгликоль, гомополимеры пропиленгликоля, сополимеры пролипропиленоксида/этиленоксида, полиоксиэтилированные полиолы (например, глицерин), поливиниловый спирт и их смеси. Полиэтиленгликоль пропиональдегид может иметь преимущества при производстве вследствие его стабильности в воде. Данный полимер может иметь любой молекулярный вес, и может быть разветвленным или неразветвленным. Число полимеров, прикрепленных к данному антителу, может различаться, и если более одного полимера прикреплено, они могут быть одинаковыми или различными молекулами. Как правило, число и/или тип полимеров, используемых для дериватизации, могут быть определены, учитывая факторы, включающие в себя, но не ограничивающиеся этим, специфические свойства или функции данного антитела, которые будут улучшены, будет ли данное антитело использоваться для лечения при определенных условиях, и тому подобное.

В другом варианте осуществления обеспечены конъюгаты антитела и небелковой молекулы, которые могут быть избирательно нагреты в результате воздействия радиации. В одном варианте осуществления данная небелковая молекула представляет собой углеродную нанотрубку (Kam et al., Proc. Natl. Acad. Sci. USA 102: 11600-11605 (2005)). Радиационное излучение может быть любой длины волны, и включает в себя, но не ограничивается этим, длины волн, которые не повреждают обычные клетки, но которые нагревают данную небелковую молекулу до температуры, при которой клетки, близлежащие к данной антитело-небелковой молекуле, погибают.

m) Рекомбинантные методы и композиции

Антитела могут быть получены с использованием рекомбинантных методов и композиций, например, как описано в Патенте США № 4816567. В одном варианте осуществления обеспечена выделенная нуклеиновая кислота, кодирующая анти-NRG антитело, описанное здесь. Такая нуклеиновая кислота может кодировать аминокислотную последовательность, содержащую в себе VL и/или аминокислотную последовательность, содержащую в себе VH данного антитела (например, легкую и/или тяжелую цепи данного антитела). В дополнительном варианте осуществления обеспечены один или несколько векторов (например, экспрессирующие векторы), содержащие в себе такую нуклеиновую кислоту. В еще одном варианте осуществления обеспечена клетка-хозяин, содержащая в себе такую нуклеиновую кислоту. В одном таком варианте осуществления клетка-хозяин (например, была трансформирована с): (1) вектором, содержащим в себе нуклеиновую кислоту, которая кодирует аминокислотную последовательность, содержащую в себе VL данного антитела и аминокислотную последовательность VH данного антитела, или (2) первым вектором, содержащим в себе нуклеиновую кислоту, которая кодирует аминокислотную последовательность, содержащую в себе VL данного антитела, и вторым вектором, содержащим в себе нуклеиновую кислоту, которая кодирует аминокислотную последовательность, содержащую в себе VH данного антитела. В одном варианте осуществления данная клетка-хозяин является эукариотической, например, клетка яичников китайского хомячка (СНО) или лимфоидная клетка (например, клетка Y0, NS0, Sp20). В одном варианте осуществления обеспечен способ получения анти-NRG антитела, где данный способ включает в себя культивирование клетки-хозяина, содержащей в себе нуклеиновую кислоту, кодирующую данное антитело, как представлено выше, в условиях, подходящих для экспрессии данного антитела, и, необязательно, восстановление данного антитела из данной клетки-хозяина (или культуральной среды клетки-хозяина).

Для рекомбинантного производства анти-NRG антитела, нуклеиновую кислоту, кодирующую антитело, например, как описано выше, выделяют и встраивают в один или несколько векторов для дальнейшего клонирования и/или экспрессии в клетке-хозяине. Такие нуклеиновые кислоты можно с легкостью изолировать и секвенировать, используя стандартные процедуры (например, используя олигонуклеотидные зонды, которые способны связываться специфически с генами, кодирующими тяжелую и легкую цепи данного антитела).

Подходящие клетки-хозяева для клонирования или экспрессии векторов, кодирующих антитело, включают в себя прокариотические или эукариотические клетки, как описано здесь. Например, антитела могут продуцироваться бактериями, в частности, когда нет необходимости в гликозилировании и эффекторной функции Fc. Для экспрессии фрагментов антител и полипептидов в бактериях, см., например, Патенты США №№ 5648237, 5789199 и 5840523. (см. также Charlton, Methods in Molecular Biology, Vol. 248 (B.K.C. Lo, ed., Humana Press, Totowa, NJ, 2003), pp. 245-254, где описывается экспрессия фрагментов антител в E.Coli.). После экспрессии данное антитело может быть выделено из данной бактериальной клеточной массы в растворимую фракцию и может быть дополнительно очищено.

В дополнение прокариотам, эукариотические микроорганизмы, такие как мицеллярные грибы или дрожжи, являются пригодными клонирующими или экспрессирующими хозяевами для векторов, кодирующих антитело, в том числе грибы и дрожжевые штаммы, чьи пути гликозилирования были «гуманизированы», в результате приводя к продукции антитела с характером гликозилирования частично или полностью человеческим. См. Gerngross, Nat. Biotech. 22: 1409-1414 (2004), и Li et al., Nat. Biotech. 24: 210-215 (2006).

Подходящие клетки-хозяева для экспрессии гликозилированного антитела также получают из многоклеточных организмов (беспозвоночных и позвоночных). Примеры клеток беспозвоночных включают в себя клетки растений и насекомых. Были установлены многочисленные штаммы бакуловируса, которые могут быть использованы в сочетании с клетками насекомых, в частности, для трансфекции клеток Spodoptera frugiperda.

Культуры растительных клеток также можно использовать в качестве хозяев. См., например, Патенты США №№ 5959177, 6040498, 6420548, 7125978 и 6417429 (где описывается технология PLANTIBODIES™ для продукции антител в трансгенных растениях).

Клетки позвоночных также можно использовать в качестве хозяев. Например, могут быть использованы клеточные линии млекопитающих, адаптированные для роста в суспензии. Другие примеры клеточных линий млекопитающих, пригодных в качестве хозяев, включают в себя клеточную линию CV1 почек обезьян, трансформированую с помощью SV40 (COS-7); клеточную линию почки эмбриона человека (клетки 293 или 293, как описано, например, у Graham et al., J. Gen Virol. 36: 59 (1977)); клетки почки новорожденного хомяка (BHK); клетки Сертоли мыши (клетки TM4, как описано, например, у Mather, Biol. Reprod. 23: 243-251 (1980)); клетки почки обезьяны (CV1); клетки почки африканской зеленой мартышки (VERO-76); клетки карциномы шейки матки человека (HELA); клетки почек собаки (MDCK); клетки печени крыс buffalo (BRL 3A); клетки легких человека (W138); клетки печени человека (Hep G2); опухоль молочной железы мыши (MMT 060562); клетки TRI, как описано, например, у Mather et al., Annals N.Y. Acad. Sci. 383: 44-68 (1982); клетки MRC 5; и клетки FS4. Другие пригодные линии клеток-хозяев млекопитающих включают в себя клетки яичников китайского хомяка (CHO), в том числе клетки DHFR-CHO (Urlaub et al., Proc. Natl. Acad. Sci. USA 77: 4216 (1980)); и клеточные линии миеломы, такие как Y0, NS0 и Sp2/0. Для обзора некоторых клеточных линий-хозяев млекопитающих, пригодных для продукции антител, см., например, Yazaki and Wu, Methods in Molecular Biology, Vol. 248 (B.K.C. Lo, ed., Humana Press, Totowa, NJ), pp. 255-268 (2003).

n) Методы

Антагонисты NRG, предусмотренные здесь, можно идентифицировать, провести скрининг на, охарактеризовать их физические/химические свойства и/или биологические действия, с помощью различных способов, известных в данной области.

В одном аспекте проведена проверка антитела по данному изобретению на его антиген-связывающую активность, например, посредством известных методов, таких как ELISA, вестерн-блоттинг, и тому подобное.

В другом аспекте, испытания служат для установления антагонистов NRG, имеющих биологическую активность. Биологическая активность может включать в себя, например, ингибирование сигнального пути рецептора тирозинкиназы, индуцированного NRG, ингибирование роста опухоли, ингибирование клеточной пролиферации, и тому подобное. Также предусмотрены антагонисты, имеющие такую биологическую активность in vivo и/или in vitro.

В некоторых вариантах осуществления проводится проверка такой биологической активности антагониста по данному изобретению. В одном варианте осуществления, способность антагониста ингибировать сигнальный путь рецептора тирозинкиназы, индуцированный NRG, может быть оценена в результате определения уровня NRG-индуцированного фосфорилирования тирозиновых остатков рецептора тирозинкиназы в присутствии и отсутствии потенциального антагониста NRG. Holmes, et al. 1992. Следующее является иллюстративным тестом для определения уровня фосфорилирования рецептора тирозинкиназы. Клетки, экспрессирующие Her2 и Her3 (такие, как клетки Caov3, или клетки, сконструированные для экспрессии Her2 и Her3), стимулируют с помощью 10 нМ NRG после 60 минут преинкубирования либо с потенциальным антагонистом NRG, либо с буфером (контроль). Цельноклеточные лизаты исследовали посредством вестерн-блоттинга с анти-фосфотирозиновым антителом для определения уровня фосфорилирования тирозина. Данные блоты могут быть сканированы для количественного определения анти-фосфотирозонового сигнала. Антагонисты NRG будут снижать уровни фосфорилирования тирозина по сравнению с контрольным буфером. В одном варианте осуществления данный антагонист NRG ингибирует NRG-индуцированный сигнальный путь тирозинкиназы, по меньшей мере, на 30%, 40%, 50%, 60% 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% или 99% по сравнению с необработанным контролем.

В некоторых вариантах осуществления антитело по данному изобретению тестируют на его способность ингибировать клеточный рост или пролиферацию in vitro. Тесты на ингибирование клеточного роста или пролиферации хорошо известны в данной области. Некоторые тесты клеточной пролиферации, примером которых является описанный здесь анализ «клеточного киллинга», оценивают жизнеспособность клетки. Одним из таких анализов является люминисцентный анализ жизнеспособности клетки CellTiter-Glo™, доступный на коммерческой основе в компании Promega (Madison, WI). В данном анализе определяется число жизнеспособных клеток в культуре, исходя из количественного определения присутствующего АТФ, что является индикатором метаболически активных клеток. См. Crouch et al (1993) J. Immunol. Meth. 160: 81-88, Патент США № 6602677. Данный анализ можно провести в 96- или 384-луночном формате, что делает его поддающимся автоматизированому высокопроизводительному скринингу (HTS). См. Cree et al (1995) Anticancer Drugs 6: 398-404. Процедура данного анализа предусматривает добавление единственного реагента (реагент CellTiter-Glo®) непосредственно к культивируемым клеткам. Это приводит в результате к клеточному лизису и генерации люминисцентного сигнала, вырабатываемого в результате люциферазной реакции. Данный люминисцентный сигнал является пропорциональным количеству присутствующего АТФ, что прямо пропорционально количеству жизнеспособных клеток, присутствующих в культуре. Результаты могут быть зарегистрированы с помощью люминометра или устройства, формирующего изображение, оборудованного ПЗС-камерой. Выход люминесценции выражается в виде относительных световых единиц (RLU).

Другим анализом клеточной пролиферации является анализ «МТТ», колориметрический анализ, который оценивает окисление 3-(4,5-диметилтиазол-2-ил)-2,5-дифенилтетразолин бромида до формазана посредством митохондриальной редуктазы. Подобно анализу CellTiter-Glo™, этот анализ выявляет количество метаболически активных клеток, присутствующих в клеточной культуре. См., например, Mosmann (1983) J. Immunol. Meth. 65: 55-63, и Zhang et al. (2005) Cancer Res. 65: 3877-3882.

В одном аспекте антагонист NRG тестируют на его способность индуцировать клеточную гибель in vitro. Анализы индукции клеточной гибели хорошо известны в данной области. В некоторых вариантах осуществления такие анализы оценивают, например, утрату целостности мембраны, о чем свидетельствует поглощение пропидиум иодида (PI), трипанового синего (см. Moore et al. (1995) Cytotechnology, 17: 1-11), или 7AAD. В образцовом анализе поглощения PI, клетки культивируют в модифицированной по способу Дульбекко среде Игла (D-MEM): Ham's F-12 (50:50) с добавлением 10% инактивированного нагреванием FBS (Hyclone) и 2 мМ L-глутамина. Таким образом, данный анализ осуществляется в отсутствии комплемента и иммунных эффекторных клеток. Клетки высевают на 100×20 мм плашки при плотности 3×106 на плашку, и оставляют для прикрепления в течение ночи. Данную среду удаляют и заменяют на свежую среду в чистом виде, или среду, содержащую в себе различные концентрации данного антитела или иммуноконъюгата. Данные клетки инкубируют в течение 3 дней. После обработки, монослои отмывают с помощью PBS и отделяют посредством трипсинизации. Затем клетки центрифугируют при 1200 об/мин в течение 5 минут при 4° C, осадок ресуспендируют в 3 мл холодного Са2+-связывающего буфера (10 мМ Hepes, pH 7,4, 140 мМ NaCl, 2,5 мМ CaCl2) и аликвоты переносят в пробирки 12×75 мм с крышкой-фильтром 35 мм (1 мл на пробирку, 3 пробирки на обрабатываемую группу) для удаления клеточных скоплений. Затем в пробирки добавляют PI (10 мкг/мл). Проводят анализ образцов с помощью проточного цитометра FACSCAN™ и программного обеспечения FACSCONVERT™ CellQuest (Becton Dickinson). Таким образом идентифицируют антитела, которые индуцируют статистически значимые уровни клеточной гибели, определенные по поглощению PI.

В одном аспекте проводится анализ антагониста NRG на его способность индуцировать апоптоз (запрограммированная гибель клеток) in vitro. Образцовым анализом антител или иммуноконъюгатов, индуцирующих апоптоз, является анализ связывания аннексина. В образцовом анализе связывания аннексина клетки культивируют и высевают в плашки, как обсуждалось в предшествующем параграфе. Среду удаляют и заменяют на свежую среду в чистом виде или среду, содержащую в себе 0,001-10 мкг/мл данного антитела или иммуноконъюгата. После трехдневного инкубационного периода, монослои отмывали с помощью PBS и отделяли посредством трипсинизации. Затем клетки центрифугировали, ресуспендировали в Ca2+-связывающем буфере, и аликвоты помещали в пробирки, как обсуждалось в предшествующем параграфе. Затем в пробирки помещали меченный аннексин (например, аннексин V-FITC) (1 мкг/мл). Проводят анализ образцов с помощью проточного цитометра FACSCAN™ и программного обеспечения FACSCONVERT™ CellQuest (BD Biosciences). Таким образом идентифицируют антитела, которые индуцируют статистически значимые уровни связывания аннексина по сравнению с контролем. Другим образцовым анализом антител или иммуноконъюгатов, которые индуцируют апоптоз, является колориметрический ELISA анализ гистоновой ДНК для определения межнуклеосомной деградации геномной ДНК. Такой анализ может быть осуществлен с использованием, например, набора Cell Death Detection ELISA (Roche, Palo Alto, CA).

Клетки для применения в любом из вышеприведенных анализов in vitro включают в себя клетки или клеточные линии, которые естественным образом экспрессируют NRG, или которые были сконструированы для экспрессии NRG. Такие клетки включают в себя клетки опухоли, которые сверхсекретируют NRG по сравнению с нормальными клетками, происходящими из той же ткани. Такие клетки также включают в себя клеточные линии (в том числе опухолевые клеточные линии), которые экспрессируют NRG, и клеточные линии, которые естественным образом не экспрессируют NRG, но были трансфецированы нуклеиновой кислотой, кодирующей NRG.

В одном аспекте проводится анализ антагониста NRG на его способность ингибировать клеточный рост или пролифирацию in vivo. В некоторых вариантах осуществления проводится анализ антагониста NRG на его способность ингибировать рост опухоли in vivo. In vivo модели систем, такие как модели ксенотрансплантата, можно использовать для такого анализа. В образцовой системе ксенотрансплантата, опухолевые клетки человека введены в соответствующим образом иммунологически «скомпроментированного» животного, не являющегося человеком, например, бестимусную «голую» мышь. Антитело по данному изобретению вводят в организм данного животного. Оценивают способность данного антитела ингибировать или снижать рост опухоли. В некоторых вариантах осуществления вышеупомянутой системы ксенотрансплантата, данные опухолевые клетки человека представляют собой опухолевые клетки от больного человека. Такие модели ксенотрансплантата являются доступными на коммерческой основе в компании Oncotest GmbH (Frieberg, Germany). В некоторых вариантах осуществления, данные опухолевые клетки человека представляют собой клетки из клеточной линии опухоли человека. В некоторых вариантах осуществления данные опухолевые клетки человека введены в соответствующим образом иммунологически «скомпроментированного» животного посредством подкожной инъекции, или посредством трансплантации в соответствующую область, например, скопление жировой ткани в области молочной железы.

В некоторых вариантах осуществления, данный антагонист NRG ингибирует клеточную пролиферацию, по меньшей мере, на 30%, 40%, 50%, 60% 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% или 99% по сравнению с необработанным контролем. В других вариантах осуществления, данный антагонист NRG ингибирует рост опухоли, по меньшей мере, на 30%, 40%, 50%, 60% 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% или 99% по сравнению с необработанным контролем.

2. NRG-связывающие полипептиды

NRG-связывающие полипептиды, или их фрагменты, которые специфически связываются с NGR, можно использовать в способах по данному изобретению, например, для связывания с, и секвестрации белка NGR, тем самым предотвращая его передачу сигнала. Предпочтительно, данные NRG полипептиды, или их фрагменты, находятся в растворимой форме. В некоторых вариантах осуществления, растворимая форма данного полипептида оказывает ингибирующий эффект на биологическую активность данного NGR, посредством связывания NGR, тем самым предотвращая его соединение с его природными связывающими партнерами.

3. Аптамеры

Аптамеры представляют собой молекулы нуклеиновой кислоты, которые формируют третичные структуры, специфически связывающиеся с молекулой-мишенью, такой как полипептид NRG. Создание и терапевтическое применение аптамеров общеприняты в данной области. См., например, Патент США № 5475096. Дополнительную информацию об аптамерах можно найти в Публикации патентной заявки США № 20060148748.

4. Пептитела

Пептитело представляет собой пептидную последовательность, соединенную с аминокислотной последовательностью, кодирующей фрагмент или часть молекулы иммуноглобулина. Полипептиды могут быть получены из рандомизированных последовательностей, выбранных любым способом для специфического связывания, включая, но не ограничиваясь этим, технологию фагового дисплея. В предпочтительном варианте осуществления, данный отобранный полипептид может быть соединен с аминокислотной последовательностью, кодирующей участок Fc иммуноглобулина. Пептитела, которые специфически связывают и противодействуют NRG, также являются пригодными для использования в способах по данному изобретению.

5. Антагонистические аминокислоты

Другие антагонисты NRG представляют собой антисмысловые конструкции РНК или ДНК, полученные с использованием методов антисмысловых нуклеиновых кислот, где, например, молекула антисмысловой РНК или ДНК действует, чтобы блокировать непосредственно трансляцию мРНК посредством гибридизации с мРНК-мишенью, и предотвращая трансляцию белка. Метод антисмысловых нуклеиновых кислот можно использовать для контроля экспрессии гена через образование тройной спирали, или антисмысловой ДНК или РНК, оба метода основаны на связывании полинуклеотида с ДНК или РНК. Например, 5'-кодирующий участок данной полинуклеотидной последовательности, которая кодирует зрелый полипептид NRG, можно использовать для конструкции антисмыслового олигонуклеотида РНК длиной приблизительно от 10 до 40 пар оснований. Олигонуклеотид ДНК конструируют таким образом, чтобы он был комплементарным участку гена, участвующего в транскрипции (тройная спираль - см. Lee et al., Nucl. Acids Res.. 6: 3073 (1979); Cooney et al., Science. 241: 456 (1988); Dervan et al., Science. 251: 1360 (1991)), тем самым препятствуя транскрипции и продукции полипептида NRG. Данный антисмысловой РНК-олигонуклеотид гибридизуется с мРНК in vivo и блокирует трансляцию молекулы РНК в полипептид NRG (антисмысловой - Okano, Neurochem.. 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton, FL, 1988). Олигонуклеотиды, описанные выше, могут быть доставлены в клетки, таким образом, что данная антисмысловая РНК или ДНК может быть экспрессирована in vivo для ингибирования продукции полипептида NRG. Когда используется антисмысловая ДНК, олигодезоксирибонуклеотиды, происходящие из участка инициации трансляции, например, между -10 и +10 положениями в нуклеотидной последовательности гена-мишени, являются предпочтительными.

Малые интерферирующие РНК (siPHK) представляют собой молекулы двухцепочечных РНК, как правило, менее 30 нуклеотидов в длину, которые снижают экспрессию гена-мишени. Доказано, что siPHK эффективны в качестве инструмента исследования модуляции экспрессии гена, когда применение традиционных антагонистов, таких как малые молекулы или антитела, не увенчались успехом. (Shi Y., Trends in Genetics 19(1): 9-12 (2003)). Синтезированные in vitro, двухцепочечные РНК, которые в длину составляют 21-23 нуклеотида, могут действовать в качестве интерферирующих РНК (iРНК) и могут специфически ингибировать экспрессию гена (Fire A., Trends in Genetics 391: 806-810 (1999)). Эти iРНК действуют, опосредуя деградацию их РНК-мишеней, поскольку их длина менее 30 нуклеотидов, однако они не запускают противовирусный защитный механизм клетки. В некоторых вариантах осуществления данного изобретения, данная siPHK имеет, по меньшей мере, приблизительно 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или 100% идентичность нуклеиновой кислоты с частью кодирующей последовательности полинуклеотида, кодирующего NRG, или его комплемента.

6. Олигопептиды

NRG-связывающие олигопептиды по данному изобретению представляют собой олигопептиды, которые связываются, предпочтительно специфически, с NRG, как описано здесь. NRG-связывающие олигопептиды могут быть химически синтезированы с использованием известных способов синтеза олигопетидов, или могут быть получены и очищены с использованием рекомбинантной технологии. NRG-связывающие олигопептиды обычно имеют, по меньшей мере, приблизительно 5 аминокислот в длину, альтернативно, по меньшей мере, приблизительно 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100 аминокислот в длину, или более, где такие олигопептиды способны связываться, предпочтительно специфически, с NRG, как описано здесь. NRG-связывающие олигопептиды могут быть идентифицированы без проведения чрезмерной экспериментальной работы, используя хорошо известные технологии. В этой связи, следует отметить, что технологии скрининга олигопептидных библиотек на олигопептиды, которые способны специфически связываться с полипептидом-мишенью, хорошо известны в данной области (см., например, Патенты США №№ 5556762, 5750373, 4708871, 4833092, 5223409, 5403484, 5571689, 5663143; Публикации PCT №№ WO 84/03506 и WO84/03564; Geysen et al., Proc. Natl. Acad. Sci. U.S.A., 81: 3998-4002 (1984); Geysen et al., Proc. Natl. Acad. Sci. U.S.A., 82: 178-182 (1985); Geysen et al., in Synthetic Peptides as Antigens, 130-149 (1986); Geysen et al., J. Immunol. Meth., 102: 259-274 (1987); Schoofs et al., J. Immunol. 140: 611-616 (1988), Cwirla, S. E. et al. (1990) Proc. Natl. Acad. Sci. USA. 87: 6378; Lowman, H.B. et al. (1991) Biochemistry, 30: 10832; Clackson, T. et al. (1991) Nature, 352: 624; Marks, J.D. et al. (1991), J. Mol. Biol., 222: 581; Kang, A.S. et al. (1991) Proc. Natl. Acad. Sci. USA. 88: 8363, и Smith, G. P. (1991) Current Opin. Biotechnol., 2: 668).

В этом смысле, бактериофаговый (фаговый) дисплей представляет собой одну из известных технологий, которая делает возможным скрининг больших олигопептидных библиотек для выявления члена(членов) таких библиотек, который способен специфически связываться с полипептидом-мишенью. Фаговый дисплей представляет собой метод, с помощью которого вариантные полипептиды воспроизводятся в виде слитых белков с белком оболочки на поверхности частиц бактериофага (Scott, J.K. and Smith, G. P. (1990) Science. 249: 386). В основе удобства применения фагового дисплея лежит тот факт, что большие библиотеки выборочно рандомизированных белковых вариантов (или случайным образом клонированных кДНК) могут быть быстро и эффективно рассортированы по тем последовательностям, которые связываются с молекулой-мишенью с высокой аффинностью. Воспроизведение библиотек пептидов (Cwirla, S. E. et al. (1990) Proc. Natl. Acad. Sci. USA, 87: 6378) или белков (Lowman, H.B. et al. (1991) Biochemistry, 30: 10832; Clackson, T. et al. (1991) Nature, 352: 624; Marks, J.D. et al. (1991), J. Mol. Biol., 222: 581; Kang, A.S. et al. (1991) Proc. Natl. Acad. Sci. USA. 88: 8363) на фаге использовали для скрининга миллионов полипептидов или олигопептидов для выявления таковых со специфическими свойствами связывания (Smith, G.P. (1991) Current Opin. Biotechnol. 2: 668). Для сортинга фаговых библиотек случайных мутантов требуется стратегия для конструирования и размножения большого количества вариантов, процедуры для аффинной очистки с использованием рецептора-мишени, и способов оценки результатов обогащения связывания. Патенты США №№ 5223409, 5403484, 5571689 и 5663143.

Способы создания пептидных библиотек и скрининга этих библиотек также описаны в Патентах США №№ 5723286, 5432018, 5580717, 5427908, 5498530, 5770434, 5734018, 5698426, 5763192 и 5723323.

7. Малые молекулы

NRG-связывающие малые молекулы представляют собой, в некоторых вариантах осуществления, органические молекулы, отличные от олигопептидов или антител, как определено здесь, которые связываются, предпочтительно специфически, с NRG, как описано здесь. NRG-связывающие органические малые молекулы могут быть идентифицированы и синтезированы с использованием известных способов (см., например, Публикации PCT №№ WO00/00823 и WO00/39585). NRG-связывающие органические молекулы обычно имеют размер менее чем приблизительно 2000 Дальтон, альтернативно, менее, чем приблизительно 1500, 750, 500, 250 или 200 Дальтон, где такие органические малые молекулы, которые способны связываться, предпочтительно специфически, с NRG, как описано здесь, могут быть идентифицированы без проведения чрезмерной экспериментальной работы, с помощью хорошо известных технологических приемов. В этой связи следует отметить, что способы скрининга библиотек органических малых молекул на выявление молекул, которые способны связываться с полипептидом-мишенью, хорошо известны в данной области (см., например, Публикации PCT №№ WO00/00823 и WO00/39585). NRG-связывающие молекулы могут представлять собой, например, альдегиды, кетоны, оксимы, гидразоны, семикарбазоны, карбазиды, первичные амины, вторичные амины, третичные, N-замещенные гидразины, гидразиды, спирты, эфиры, тиолы, тиоэфиры, дисульфиды, карбоновые кислоты, сложные эфиры, амиды, мочевины, карбаматы, карбонаты, кетали, тиокетали, ацетали, тиоацетали, арилгалогениды, арилсулфонаты, алкилгалогениды, алкилсульфонаты, ароматические соединения, гетероциклические соединения, анилины, алкены, алкины, диолы, аминоспирты, оксазолидины, оксазолины, тиазолидины, тиазолины, энамины, сульфонамиды, эпоксиды, азиридины, изоцианаты, сульфонилхлориды, диазосоединения, хлорангидриды, и тому подобное.

8. Иммуноконъюгаты

Данное изобретение также обеспечивает иммуноконъюгаты, содержащие в себе антагонист NRG, конъюгированный с одним или несколькими цитотоксическими агентами, такими как химиотерапевтические вещества или лекрственные средства, ингибиторы роста, токсины (например, белковые токсины, ферментативно активные токсины бактериального, грибкового, растительного или животного происхождения, или их фрагменты) или радиоактивными изотопами.

В одном варианте осуществления иммуноконъюгат представляет собой конъюгат антитело-лекарственное средство (ADC), в котором антитело сконъюгировано с одним или несколькими лекарственными средствами, включающими в себя, но не ограничиваясь этим, майтансиноид (см. Патенты США №№ 5208020, 5416064 и Европейский Патент EP 0425235 B1); ауристатин, например монометилауристатиновые лекарственные молекулы DE и DF (MMAE и MMAF) (см. Патенты США №№ 5635483 и 5780588 и 7498298); доластатин; калихеамицин или его производные (см. Патенты США №№ 5712374, 5714586, 5739116, 5767285, 5770701, 5770710, 5773001 и 5877296; Hinman et al., Cancer Res. 53: 3336-3342 (1993); и Lode et al., Cancer Res. 58: 2925-2928 (1998)); антрациклин, например, дауномицин или доксорубицин (см. Kratz et al., Current Med. Chem. 13: 477-523 (2006); Jeffrey et al., Bioorganic & Med. Chem. Letters 16: 358-362 (2006); Torgov et al., Bioconj. Chem. 16: 717-721 (2005); Nagy et al., Proc. Natl. Acad. Sci. USA 97: 829-834 (2000); Dubowchik et al., Bioorg. & Med. Chem. Letters 12: 1529-1532 (2002); King et al., J. Med. Chem. 45: 4336-4343 (2002); и Патент США № 6630579); метотрексат; виндезин; таксан, например, доцетаксел, паклитаксел, ларотаксель, тесетаксель и ортатаксель; трихотецен; и CC1065.

В другом варианте осуществления, иммуноконъюгат содержит в себе антитело, как описано здесь, сконъюгированное с ферментативно активным токсином или его фрагментом, включающим в себя, но не ограничивающимся этим, А-цепь дифтерии, несвязывающиеся активные фрагменты дифтерийного токсина, А-цепь экзотоксина (из Pseudomonas aeruginosa), А-цепь рицина, А-цепь арбина, А-цепь модеццина, альфа-сарцин, белки Aleurites fordii, белки диантина, белки Phytolaca americana (PAPI, PAPII и PAP-S), ингибитор Momordica charantia, курцин, кротин, ингибитор Sapaonaria officinalis, гелонин, митогеллин, рестриктоцин, феномицин, эномицин и трикотецены.

В другом варианте осуществления иммуноконъюгат содержит в себе антитело, как описано здесь, сконъюгированное с радиоактивным атомом для образования радиоконъюгата. Различные радиоактивные изотопы доступны для получения радиоконъюгатов. Примеры включают в себя At211, I131, I125, Y90, Re186, Re188, Sm153, Bi212, P32, Pb212 и радиоактивные изотопы Lu. Когда данный радиоконъюгат используют для детекции, он может содержать в себе радиоактивный атом для сцинтиграфических исследований, например, tc99m или I123, или спин-метку для ядерно-магнитно-резонансной визуализации (ЯМР) (также называемая магнитно-резонансная визуализация, ЯМР), такие как, опять же, йод-123, йод-131, индий-111, фтор-19, углерод-13, азот-15, кислород-17, гадолиний, марганец или железо.

Конъюгаты антитела и цитотоксического агента могут быть получены, используя разнообразные бифункциональные белок-связующие вещества, такие как N-сукцинимидил-3-(2-пиридилдитио)пропионат (SPDP), сукцинимидил-4-(N-малеимидометил)циклогексан-1-карбоксилат (SMCC), иминотиолан (IT), бифункциональные производные имидоэфиров (например, диметиладипимидат HCl), активные эстеры (например, дисукцинимидил суберат), альдегиды (например, глутаральдегид), бис-азидо соединения (например, бис(р-азидобензоил)гександиамин), производные бис-диазония (например, бис-(p-диазониумбензоил)-этилендиамин), диизоцианаты (например, толуол 2,6-диизоцианат), и бис-активные фтористые соединения (например, 1,5-дифтор-2,4-динитробензол). Например, рициновый иммунотоксин может быть получен, как описано у Vitetta et al., Science, 238: 1098 (1987). 1-изотицианатобензил-3-метилдиэтилен триаминпентауксусная кислота меченая углеродом-14 (MX-DTPA) представляет собой пример хелатирующего агента для конъюгирования радионуклеотида с данным антителом. См. W094/11026. Данный линкер может представлять собой «расщепляемый линкер», облегчающий высвобождение цитотоксического лекарственного средства в данной клетке. Например, можно использовать кислото-разлагаемый линкер, пептидаза-чувствительный линкер, фотолабильный линкер, диметиловый линкер или дисульфид-содержащий линкер (Chari et al., Cancer Res. 52: 127-131 (1992); Патент США № 5208020).

Здесь рассматриваются в явной форме иммуноконъюгаты или ADC, но не ограничиваются такими конъюгатами, приготовленными с помощью перекрестносшивающих агентов, включающих в себя, но не ограничивающиеся этим, BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, сульфо-EMCS, сульфо-GMBS, сульфо-KMUS, сульфо-MBS, сульфо-SIAB, сульфо-SMCC, и сульфо-SMPB, и SVSB (сукцинимидил-(4-винилсульфон)бензоат), которые являются коммерчески доступными (например, Pierce Biotechnology, Inc., Rockford, IL., U.S.A).

B. Методы и композиции для диагностики и детекции

В некоторых вариантах осуществления антагонисты NRG, предусмотренные здесь, являются эффективными для выявления присутствия NRG в биологическом образце. Используемый здесь термин «определение» охватывает количественное и качественное определение. В некоторых вариантах осуществления биологический образец включает в себя клетку или ткань, например, ткань легкого или ткань молочной железы.

В одном варианте осуществления предусмотрено анти-NRG антитело для использования в методах диагностики или детекции. В дополнительном аспекте предусмотрен способ выявления присутствия NRG в биологическом образце. В некоторых вариантах осуществления данный способ включает в себя контакт данного биологического образца с анти-NRG антителом, как описано здесь, в условиях, допускающих связь данного анти-NRG антитела с NRG, и определения того, образовался ли комплекс между анти-NRG антителом и NRG. Таким способом может быть in vitro или in vivo способ. В одном варианте осуществления анти-NRG антитело применяют для отбора субъектов, удовлетворяющих критериям отбора для терапии анти-NRG антителом, например, где NRG является биомаркером для отбора пациентов.

В одном варианте осуществления пациент выбран для лечения антагонистом NRG, если данный пациент имеет злокачественное новообразование, которое является или которое вероятно станет, невосприимчивым к терапии. В одном аспекте данного изобретения предусмотрен анализ, в котором определяется, страдает ли пациент злокачественным новообразованием, которое является, или которое вероятно станет невосприимчивым к терапии. В одном варианте осуществления, данный анализ включает в себя исследование опухолевых клеток, полученных от данного пациента, на экспрессию NRG, где экспрессия NRG указывает на то, что данный пациент имеет злокачественное новообразование, которое является, или которое вероятно станет, невосприимчивым к терапии. В одном варианте осуществления данный пациент выбран, как имеющий злокачественное новообразование, которое является или которое вероятно станет невосприимчивым к терапии, если данный уровень экспрессии NRG в данной опухоли ниже, чем уровень экспрессии NRG в TRIC данной опухоли.

В одном варианте осуществления пациент выбран для лечения антагонистом NRG, если данный пациент имеет злокачественное новообразование, которое вероятно рецидивирует после лечения терапевтическим агентом. Один аспект данного изобретения предусматривает анализ, в котором определяется, страдает ли пациент злокачественным новообразованием, которое вероятно рецидивирует после лечения терапевтическим агентом. В одном варианте осуществления, данный анализ включает в себя исследование опухолевых клеток, полученных от данного пациента, на экспрессию NRG, где экспрессия NRG указывает на то, что данный пациент имеет злокачественное новообразование, которое вероятно рецидивирует после лечения терапевтическим агентом. В одном варианте осуществления данный пациент выбран, как имеющий злокачественное новообразование, которое вероятно рецидивирует после лечения терапевтическим агентом, если данный уровень экспрессии NRG в данной опухоли ниже, чем уровень экспрессии NRG в данных TRIC данной опухоли.

В некоторых вариантах осуществления, диагностический анализ включает в себя определение экспрессии неурегулина в опухолевых клетках, используя, например, иммуногистохимию, гибридизацию in situ, или ПЦР в режиме реального времени. В других вариантах осуществления, диагностический анализ включает в себя определение уровней экспрессии неурегулина в опухолевых клетках, используя, например, количественную ПЦР в режиме реального времени. В некоторых вариантах осуществления, диагностический анализ дополнительно включает в себя определение уровней экспрессии неурегулина по сравнению с контрольной тканью, такой как, например, сопредельная незлокачественная ткань.

В некоторых вариантах осуществления предусмотрены меченые анти-NRG антитела. Метки включают в себя, но не ограничиваются этим, метки или молекулы, которые выявляются непосредственно (такие как флуоресцентные, хромоформные, электронноплотные, хемилюминесцентные и радиоактивные метки), а также молекулы, такие как ферменты или лиганды, которые выявляются опосредованно, например, в результате ферментативной реакции или молекулярного взаимодействия. Примеры меток включают в себя, но не ограничиваются ими, радиоизотопы 32P, 14C, 125I, 3H и 131I, флуорофоры, такие как редкоземельные хелаты, или флуоресцеин и его производные, родамин и его производные, дансил, умбеллиферон, люцериферазы, например, люцифераза жука-светляка и бактериальная люцифераза (Патент США № 4737456), люциферин, 2,3-дигидрофталазиндионы, пероксидаза из хрена (HRP), щелочная фосфатаза, β-галактозидаза, глюкоамилаза, лизозим, сахаридоксидазы, например, глюкозо-оксидаза, галактозо-оксидаза, и глюкозо-6-фосфат дегидрогеназа, гетероциклические оксидазы, такие как уриказа и ксантиноксидаза, соединенные с ферментом, который задействует перекись водорода для окисления предшественника красителя, например, HRP, лактопероксидаза или микропероксидаза, биотин/авидин, спиновые метки, бактериофаговые метки, стабильные свободные радикалы и тому подобное.

C. Терапевтические методы и композиции

Антагонисты NRG, предусмотренные здесь, можно использовать в терапевтических методах.

В одном аспекте предусмотрен антагонист NRG для использования в качестве лекарственного средства. В дополнительных аспектах предусмотрен антагонист NRG для лечения злокачественного новообразования. В некоторых вариантах осуществления предусмотрен антагонист NRG для использования в способе лечения. В некоторых вариантах осуществления данное изобретение обеспечивает антагонист NRG для использования в способе лечения индивидуума, имеющего злокачественное новообразование, где способ включает введение в организм данного индивидуума эффективного количества антагониста NRG. В одном таком варианте осуществления, данный способ включает в себя введение в организм данного индивидуума эффективного количества, по меньшей мере, одного дополнительного терапевтического средства, например, как описано далее. В дополнительных вариантах осуществления данное изобретение предусматривает антагонист NRG для использования в лечении пациента, который пережил рецидив рака. В некоторых вариантах осуществления данное изобретение предусматривает антагонист NRG для использования в способе предотвращения невосприимчивости к лечению терапевтическим средством у индивидуума, включающем в себя введение в организм данного индивидуума эффективного количества данного антагониста NRG для предотвращения развития невосприимчивости к данному терапевтическому средству.

В дополнительном аспекте данное изобретение предусматривает антагонист NRG для использования в производстве или приготовлении лекарственного средства. В одном варианте осуществления данное лекарственное средство предназначено для лечения злокачественного новообразования. В дополнительном варианте осуществления данное лекарственное средство предназначено для использования в способе лечения злокачественного новообразования, включающем в себя введение в организм индивидуума, имеющего злокачественное новообразование, эффективного количества данного лекарственного средства. В одном таком варианте осуществления данный способ включает в себя введение в организм данного индивидуума эффективного количества, по меньшей мере, одного дополнительного терапевтического средства, например, как описано далее. В еще одном варианте осуществления данное лекарственное средство предназначено для предотвращения развития у пациента резистентности к лечению терапевтическим средством. В еще одном варианте осуществления, данное лекарственное средство предназначено для предотвращения рецидива злокачественного новообразования у пациента.

В еще одном аспекте данное изобретение предусматривает фармацевтические композиции, содержащие в себе любой из обеспеченных здесь антагонистов NRG, например, для применения в любом из вышеуказанных терапевтических способов. В одном варианте осуществления, фармацевтическая композиция содержит в себе любой из предусмотренных здесь антагонистов NRG и фармацевтически приемлемый носитель. В другом варианте осуществления, фармацевтическая композиция содержит в себе любой из предусмотренных здесь антагонистов NRG и, по меньшей мере, одно дополнительное терапевтическое средство, как описано далее.

Один вариант осуществления предусматривает фармацевтические композиции или лекарственные средства, содержащие в себе антагонист NRG и терапевтически инертный носитель, разбавитель или наполнитель, а также способы применения соединений по данному изобретению для приготовления таких композиций и лекарственных средств. В одном примере, соединения могут быть созданы посредством смешивания при температуре окружающей среды и соответствующем значении рН, и при желаемой степени чистоты, с физиологически приемлемыми носителями, а именно, носителями, которые являются нетоксичными для реципиента в дозах и концентрациях, используемых в галеновых препаратах. Значение рН данной композиции зависит, главным образом, от конкретного применения и концентрации соединения, но предпочтительно находится в пределах от приблизительно 3 до приблизительно 8. В одном примере, соединение получено в ацетатном буфере при рН 5. В другом варианте осуществления данные соединения являются стерильными. Соединение может храниться, например, в виде твердой или аморфной композиции, как лиофилизированная композиция или водный раствор.

Фармацевтические композиции антагониста NRG, как описано здесь, получены посредством смешивания такого антагониста, имеющего необходимую степень чистоты, с одним или несколькими необязательными фармацевтически приемлемыми носителями (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), в форме лиофилизированных композиций или водных растворов. Фармацевтически приемлемые носители, как правило, являются нетоксичными для реципиентов в применяемых дозах и концентрациях, и включают в себя, но не ограничиваются этим: буферы, такие как фосфатный, цитратный и других органических кислот; антиоксиданты, в том числе аскорбиновая кислота и метионин; консерванты (такие как, октадецилдиметилбензил аммония хлорид; гексаметоний хлорид; бензалконий хлорид; бензетония хлорид; фенол, бутиловый или бензиловый спирт; алкилпарабены, такие как метил- или пропилпарабен; катехин; резорцин; циклогексанол; 3-пентанол; и m-крезол); низкомолекулярные пептиды (менее, чем приблизительно 10 остатков); белки, такие как сывороточный альбумин, желатин, или иммуноглобулины; гидрофильные полимеры, такие как поливинилпирролидон; аминокислоты, такие как глицин, глутамин, аспарагин, гистидин, аргинин, или лизин; моносахариды, дисахариды и другие углеводы, включая глюкозу, маннозу или декстрины; хелатообразующие агенты, такие как ЭДТА; сахара, такие как сахароза, маннитол, трегалоза или сорбитол; солеобразующие противоионы, например, натрий; комплексные соединения металла (например, комплексы Zn-белок); и/или неионные сурфактанты, такие как полиэтиленгликоль (PEG). Примеры фармацевтически приемлемых носителей здесь дополнительно включают в себя интерстициальные агенты, диспергирующие лекарственные средства, такие как растворимые нейтрально-активные гиалуронидазные гликопротеины (sHASEGP), например, растворимые гиалуронидазные гликопротеины PH-20 человека, например, rHuPH20 (HYLENEX®, Baxter International, Inc.). Некоторые примеры sHASEGP и способы их применения, в том числе rHuPH20, описаны в Публикации Патентов США №№ 2005/0260186 и 2006/0104968. В одном аспекте sHASEGP скомбинирован с одним или несколькими дополнительными глюкозаминогликанами, например, хондроитиназами.

Примеры лиофилизированных композиций антител описаны в Патенте США № 6267958. Водные композиции антител включают в себя те, которые описаны в Патенте США № 6171586 и WO2006/044908, последнии композиции включают в себя гистидин-ацетатный буфер.

Композиции сформулированы, дозированы и применяются в манере, соответствующей целесообразной медицинской практике. Рассматриваемые факторы, в данном случае, включают в себя конкретное заболевание, подвергающееся лечению, конкретный пациент, клиническое состояние данного пациента, причина заболевания, место доставки данного агента, способ применения, схема применения, и другие факторы, известные практикующим врачам.

Фармацевтическая композиция (или состав) для применения может быть упакована различными способами, в зависимости от способа, используемого для введения данного лекарственного средства. Обычно изделие для распространения включает в себя контейнер, в который помещена данная фармацевтическая композиция в соответствующей форме. Подходящие контейнеры хорошо известны специалисту в данной области, и включают в себя, например, бутыли (пластиковые и стеклянные), порционные пакеты, ампулы, пластиковые пакеты, металлические цилиндры и тому подобное. Данный контейнер также может включать в себя систему с защитой для предотвращения неосторожного обращения с содержимым данного контейнера. Кроме того, на данном контейнере помещена этикетка, на которой описано содержание контейнера. На данной этикетке также может быть помещено соответствующие предупреждения.

Могут быть получены препараты с замедленным высвобождением. Подходящие примеры препаратов с замедленным высвобождением включают в себя полупроницаемые матрицы твердых гидрофобных полимеров, содержащие в себе соединение, каковые матрицы находятся в форме профилированных изделий, например, пленок или микрокапсул. Примеры матриц с замедленным высвобождением включают в себя сложные полиэфиры, гидрогели (например, поли(2-гидроксиэтил-метакрилат), или поли(виниловый спирт)), полилактиды, сополимеры L-глутаминовой кислоты и гамма-этил-L-глутамата, неразлагающийся этилен-винил ацетат, разлагающиеся сополимеры молочная кислота-гликолевая кислота, такие как LUPRON DEPOT™ (микросферы для инъекций, состоящие из сополимера молочная кислота-гликолевая кислота и лейпрорелид ацетата), и поли-D-(-)-3-гидроксимасляную кислоту.

В одном примере фармацевтически эффективное количество антагониста NRG, вводимого в организм парентерально, на дозу, будет в пределах приблизительно 0,01-100 мг/кг, альтернативно, приблизительно 0,1-20 мг/кг массы тела пациента в день, с начальным диапазоном используемого соединения, типично, 0,3-15 мг/кг/день. В другом варианте осуществления формы, содержащие одноразовую дозу, для перорального применения, такие как таблетки и капсулы, предпочтительно содержат в себе приблизительно 5-100 мг данного соединения по данному изобретению.

Антагонисты NRG можно вводить в организм любым подходящим образом, включая пероральное, местное (в том числе трансбуккальное или подъязычное), ректальный, вагинальный, чрескожный, парентеральный, подкожный, внутрибрюшинный, внутрилегочный, внутрикожный и эпидуральный и интраназальный, и, если необходимо для местного лечения, введение внутрь лезии. Парентеральное введение включает в себя внутримышечное, внутривенное, внутриартериальное, внутрибрюшинное или подкожное введение.

Введение доз может быть осуществлено любым подходящим способом введения, например, посредством инъекций, таких как внутривенные или подкожные инъекции, отчасти в зависимости от того, является ли данное введение непродолжительным или затяжным. Здесь предусмотрены различные схемы введения доз, включающие в себя, но не ограничивающиеся этим, однократные или многократные введения в течение различных моментов времени, болюсное введение, и импульсную инфузию.

Антагонист NRG может быть введен в организм в любой удобной форме применения, например, в форме таблеток, порошков, капсул, растворов, сиропов, спреев, суппозиторий, гелей, эмульсий, пластырей и тому подобного. Такие композиции могут содержать в себе компоненты, традиционные в фармацевтических препаратах, например, разбавители, носители, модификаторы рН, подсластители, агенты-наполнители и дополнительные активные вещества.

Типичная композиция получена в результате смешивания соединения по настоящему изобретению и носителя или инертного наполнителя. Подходящие носители и инертные наполнители хорошо известны специалисту в данной области и подробно описаны, например, у Ansel, Howard C, et al, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems. Philadelphia: Lippincott, Williams & Wilkins, 2004; Gennaro, Alfonso R., et al. Remington: The Science and Practice of Pharmacy. Philadelphia: Lippincott, Williams & Wilkins, 2000; и Rowe, Raymond C. Handbook of Pharmaceutical Excipients. Chicago, Pharmaceutical Press, 2005. Данные композиции также могут включать в себя один или несколько буферов, стабилизирующих веществ, сурфактантов, смачивающих агентов, замасливателей, эмульсирующих веществ, суспендирующих веществ, консервантов, антиоксидантов, непрозрачных агентов, глидантов, веществ для улучшения технологических свойств, красителей, подсластителей, ароматизирующих веществ, вкусовых добавок, разбавителей и других известных добавок для обеспечения изящной подачи данного лекарственного средства (например, соединение по настоящему изобретению или его фармацевтическую композицию) или содействия в производстве данного фармацевтического продукта (например, лекарственного средства).

Примером подходящей лекарственной формы для перорального применения является таблетка, содержащая в себе приблизительно 25 мг, 50 мг, 100 мг, 250 мг или 500 мг соединения по данному изобретению, смешанного с приблизительно 90-30 мг безводной лактозы, приблизительно 5-40 мг кроскармеллозы натрия, приблизительно 5-30 мг поливинилпирролидона (PVP) K30, и приблизительно 1-10 мг стеарата магния. Сначала порошкообразные ингредиенты смешивают вместе, а затем смешивают с раствором PVP. Полученную композицию можно высушить, гранулировать, смешать со стеаратом магния и спрессировать до формы таблетки, используя соответствующее оборудование. Образец аэрозольной композиции можно получить посредством растворения соединения по данному изобретению, например, 5-400 мг, в подходящем буферном растворе, например, фосфатном буфере, добавляя вещество, регулирующее тоничность, например, соль, такую как хлорид натрия, при необходимости. Данный раствор может быть профильтрован, например, используя 0,2-микронный фильтр, для удаления загрязняющих примесей и контаминантов.

Один вариант осуществления, в этой связи, включает в себя фармацевтические композиции, содержащие в себе соединение, или стереоизомер, или фармацевтически приемлемую его соль. Еще один вариант осуществления включает в себя фармацевтическую композицию, содержащую в себе соединение или стереоизомер, или фармацевтически приемлемую его соль, вместе с фармацевтически приемлемым носителем или наполнителем.

В случае использования антитела, данное антитело соответственно вводится в организм пациента однократно или на протяжении последовательных курсов лечения. В зависимости от типа и тяжести заболевания, начальной возможной дозой антитела может быть приблизительно от 1 мкг/кг до 15 мг/кг (например, 0,1 мг/кг - 10 мг/кг) для введения в организм данного пациента, либо, например, посредством одного или нескольких раздельных введений, либо посредством продолжительного вливания. Типичная дневная доза может находиться в диапазоне от приблизительно 1 мкг/кг до 100 мг/кг, или более, в зависимости от вышеупомянутых факторов. Для повторных введений в течение нескольких дней или более, в зависимости от состояния, данное лечение, как правило, будет поддерживаться до тех пор, пока не произойдет необходимая супрессия симптомов заболевания. Образцовая доза данного антитела будет в диапазоне от приблизительно 0,05 мг/кг до приблизительно 10 мг/кг. Следовательно, одна или несколько доз приблизительно 0,5 мг/кг, 2,0 мг/кг, 4,0 мг/кг или 10 мг/кг (или любая их комбинация) может быть введена данному пациенту. Такие дозы могут быть введены с промежутками, например, раз в неделю, или один раз каждые три недели (например, таким образом, чтобы пациент получил от приблизительно двух до приблизительно двадцати или, например, приблизительно, шесть доз данного антитела). Начальная наивысшая ударная доза, с последующими одной или несколькими более низкими дозами, может быть введена. Однако можно применять другие режимы дозирования. Прогресс данной терапии легко отслеживать с помощью традиционных методов и анализов.

Следует понимать, что любую из вышеприведенных композиций или терапевтических способов можно осуществить с использованием иммуноконъюгата по данному изобретению, вместо или дополнительно к антагонисту NRG.

Антагонисты NRG по данному изобретению можно применять либо сами по себе, либо в комбинации с другими агентами в лечении. Например, антагонист NRG по данному изобретению можно применять совместно с, по меньшей мере, одним дополнительным терапевтическим средством.

В некоторых вариантах осуществления дополнительное терапевтическое средство представляет собой средство, которое ингибирует метаболический путь рецептора тирозинкиназы. В одном варианте осуществления, данное дополнительное терапевтическое средство ингибирует метаболический путь HER. В одном варианте осуществления данное дополнительное терапевтическое средство представляет собой ингибитор EGFR, HER2, HER3 и/или HER4.

Используемый здесь термин «ингибитор EGFR» относится к соединениям, которые связываются с, или иным образом взаимодействуют непосредственно с EGFR, и предотвращают или снижают его сигнальную активность, и альтернативно упоминается как «антагонист EGFR». Примеры таких агентов включают в себя антитела и малые молекулы, которые связываются с EGFR. Примеры антител, которые связываются с EGFR, включают в себя MAb 579 (ATCC CRL HB 8506), MAb 455 (ATCC CRL HB8507), MAb 225 (ATCC CRL 8508), MAb 528 (ATCC CRL 8509) (см. Патент США № 4943533, Mendelsohn et al.) и их варианты, такие как химеризированный 225 (C225 или Cetuximab; ERBUTIX®) и видоизмененный 225 человека (H225) (см. WO 96/40210, Imclone Systems Inc.); IMC-11F8, полностью человеческое, EGFR-направленно антитело (Imclone); антитела, которые связывают мутантный EGFR тип II (Патент США № 5212290); гуманизированные и химерные антитела, которые связываются с EGFR, как описано в Патенте США № 5891996; и антитела человека, которые связывают EGFR, такие как ABX-EGF или Панитумумаб (см. WO98/50433, Abgenix/Amgen); EMD 55900 (Stragliotto et al. Eur. J. Cancer 32A: 636-640 (1996)); EMD7200 (матузумаб) гуманизированное EGFR антитело, нацеленное против EGFR, которое конкурирует и с EGF, и с TGF-альфа, за связывание с EGFR (EMD/Merck); EGFR антитело человека, HuMax-EGFR (GenMab); полностью человеческие антитела, известные как E1.1, E2.4, E2.5, E6.2, E6.4, E2.11, E6.3 и E7.6.3 и описаны в Патенте США № 6235883; MDX-447 (Medarex Inc); и mAb 806, или гуманизированное mAb 806 (Johns et al, J. Biol. Chem. 279(29): 30375-30384 (2004)). Анти-EGFR антитело может быть конъюгировано с цитотоксическим средством, следовательно, образуя иммуноконъюгат (см., например, EP659,439A2, Merck Patent GmbH). Антагонисты EGFR включают в себя малые молекулы, такие как соединения, описанные в Патентах США №№: 5616582, 5457105, 5475001, 5654307, 5679683, 6084095, 6265410, 6455534, 6521620, 6596726, 6713484, 5770599, 6140332, 5866572, 6399602, 6344459, 6602863, 6391874, 6344455, 5760041, 6002008, и 5747498, а также в следующих публикация PCT: W098/14451, WO98/50038, WO99/09016, и WO99/24037. Конкретные малые молекулы-антагонисты EGFR включают в себя OSI-774 (CP-358774, эрлотиниб, TARCEVA® Genentech/OSI Pharmaceuticals); PD183805 (CI 1033, 2-пропенамид, N-[4-[(3-хлор-4-фторфенил)амино]-7-[3-(4-морфолинил)пропокси]-6-хиназолин]-, дигидрохлорид, Pfizer Inc.); ZD1839, гефитиниб (IRESSA™)4-(3'-хлор-4'-фторанилино)-7-метокси-6-(3-морфолинпропокси)хиназолин, AstraZeneca); ZM105180 ((6-амино-4-(3-метилфенил-амино)-хиназолин, Zeneca); BIBX-1382 (N8-(3-хлор-4-фтор-фенил)-N2-(1-метил-пиперидин-4-ил)-пиримидо[5,4-d]пиримидин-2,8-диамин, Boehringer Ingelheim); PKI-166 ((R)-4-[4-[(1-фенилэтил)амино]-1H-пирроло[2,3-d]пиримидин-6-ил]-фенол);(R)-6-(4-гидроксифенил)-4-[(1-фенилэтил)амино]-7H-пирроло[2,3-d]пиримидин); CL-387785 (N-[4-[(3-бромфенил)амино]-6-хиназолинил]-2-бутинамид); EKB-569 (N-[4-[(3-хлор-4-фторфенил)амино]-3-циано-7-этокси-6-хинолинил]-4-(диметиламино)-2-бутенамид) (Wyeth); AG1478 (Pfizer); AG1571 (SU 5271; Pfizer); двойные ингибиторы тирозинкиназы EGFR/HER2, такие как лапатиниб (TYKERB®, GSK572016 или N-[3-хлор-4-[(3 фторфенил) метокси]фенил]6[5[[[2метилсульфонил)этил]амино]метил]-2-фуранил]-4-хиназолинамин; Glaxo-SmithKline).

Используемый здесь термин «ингибитор HER2» относится к соединениям, которые связываются с, или иным образом взаимодействуют непосредственно с HER2, и предотвращают или снижают его сигнальную активность, и альтернативно обозначается как «антагонист HER2». Примеры таких агентов включают в себя антитела и малые молекулы, которые связываются с HER2. Конкретные антитела HER2 включают в себя пертузумаб и трастузумаб. Используемый здесь термин «ингибитор HER3» относится к соединениям, которые связываются с, или иным образом взаимодействуют непосредственно с HER3, и предотвращают или снижают его сигнальную активность, и альтернативно обозначается как «антагонист HER3». Примеры таких агентов включают в себя антитела и малые молекулы, которые связываются с HER3. Используемый здесь термин «ингибитор HER4» относится к соединениям, которые связываются с, или иным образом взаимодействуют непосредственно с HER4, и предотвращают или снижают его сигнальную активность, и альтернативно обозначается как «антагонист HER4». Примеры таких агентов включают в себя антитела и малые молекулы, которые связываются с HER4.

Патентные Публикации, относящиеся к антителам HER, включают в себя: Патент США № 5677171, Патент США № 5720937, Патент США № 5720954, Патент США № 5725856, Патент США № 5770195, Патент США № 5772997, Патент США № 6165464, Патент США № 6387371, Патент США № 6399063, US2002/0192211A1, Патент США № 6015567, Патент США № 6333169, Патент США № 4968603, Патент США № 5821337, Патент США № 6054297, Патент США № 6407213, Патент США № 6719971, Патент США № 6800738, US2004/0236078A1, Патент США № 5648237, Патент США № 6267958, Патент США № 6685940, Патент США № 6821515, W0 98/17797, Патент США № 6333398, Патент США № 6797814, Патент США № 6339142, Патент США № 6417335, Патент США № 6489447, WO 99/31140, US2003/0147884A1, US2003/0170234A1, US2005/0002928A1, Патент США № 6573043, US2003/0152987A1, W0 99/48527, US2002/0141993A1, WO 01/00245, US2003/0086924, US2004/0013667A1, WO 00/69460, WO 01/00238, WO 01/15730, Патент США № 662719681, Патент США № 6632979B1, WO01/00244, US2002/0090662A1, WO 01/89566, US2002/0064785, US2003/0134344, WO 04/24866, US2004/0082047, US2003/0175845A1, WO 03/087131, US2003/0228663, WO 2004/008099A2, US2004/0106161, WO 2004/048525, US2004/0258685A1, Патент США № 5985553, Патент США № 5747261, Патент США № 4935341, Патент США № 5401638, Патент США № 5604107, WO 87/07646, WO 89/10412, WO 91/05264, EP 412116 B1, EP 494,135 B1, Патент США № 5824311, EP 444181 B1, EP 1006194 A2, US 2002/0155527A1, WO 91/02062, Патент США № 5571894, Патент США № 5939531, EP 502812 B1, WO 93/03741, EP 554441 B1, EP 656367 A1, Патент США № 5288477, Патент США № 5514554, Патент США № 5587458, WO 93/12220, WO 93/16185, Патент США № 5877305, WO 93/21319, WO 93/21232, Патент США № 5856089, WO 94/22478, Патент США № 5910486, Патент США № 6028059, WO 96/07321, Патент США № 5804396, Патент США № 5846749, EP 711565, WO 96/16673, Патент США № 5783404, Патент США № 5977322, Патент США № 6512097, WO 97/00271, Патент США № 6270765, Патент США № 6395272, Патент США № 5837243, WO 96/40789, Патент США № 5783186, Патент США № 6458356, WO 97/20858, WO 97/38731, Патент США № 6214388, Патент США № 5925519, WO 98/02463, Патент США № 5922845, WO 98/18489, WO 98/33914, Патент США № 5994071, WO 98/45479, Патент США № 6358682 B1, US 2003/0059790, WO 99/55367, WO 01/20033, US 2002/0076695 A1, WO 00/78347, WO 01/09187, WO 01/21192, WO 01/32155, WO 01/53354, WO 01/56604, WO 01/76630, WO 02/05791, WO 02/11677, Патент США № 6582919, US2002/0192652A1, US 2003/0211530A1, WO 02/44413, US 2002/0142328, Патент США № 6602670 B2, WO 02/45653, WO 02/055106, US 2003/0152572, US 2003/0165840, WO 02/087619, WO 03/006509, WO 03/012072, WO 03/028638, US 2003/0068318, WO 03/041736, EP 1357132, US 2003/0202973, US 2004/0138160, Патент США № 5705157, Патент США № 6123939, EP 616812 B1, US 2003/0103973, US 2003/0108545, Патент США № 6403630 B1, WO 00/61145, WO 00/61185, Патент США № 6333348 B1, WO 01/05425, WO 01/64246, US 2003/0022918, US 2002/0051785 A1, Патент США № 6767541, WO 01/76586, US 2003/0144252, WO 01/87336, US 2002/0031515 A1, WO 01/87334, WO 02/05791, WO 02/09754, US 2003/0157097, US 2002/0076408, WO 02/055106, WO 02/070008, WO 02/089842, WO 03/86467 и US 2010/0255010.

В некоторых вариантах осуществления дополнительное терапевтическое средство представляет собой химиотерапевтическое средство. «Химиотерапевтическое средство» относится к химическому соединению, используемому при лечении злокачественного новообразования. Примеры химиотерапевтических средств включают в себя алкилирующие препараты, такие как тиотепа и циклофосфамид (CYTOXAN®); алкилсульфонаты, такие как бусульфан, импросульфан и пипосульфан; азиридины, такие как бензодопа, карбоквон, метуредопа и уредопа; этиленимины и метиламеламины, в том числе альтретамин, триэтиленмеламин, триэтиленфосфорамид, триэтилентиофосфорамид и триметиломеламин; ацетогенины (в особенности буллатацин и буллатацинон); дельта-9-тетрагидроканнабинол (дронабинол, MARINOL®); бета-лапахон; лапахол; колхицины; бетулиновую кислоту; камптотецин (в том числе, синтетический аналог топотекан (HYCAMTIN®), CPT-11 (иринотекан, CAMPTOSAR®), ацетилкамптотецин, скополектин, и 9-аминокамптотецин); бриостатин; каллистатин; CC-1065 (в том числе его синтетические аналоги адолезин, карзелезин и бизелезин); подофиллотоксин; подофиллиновую кислоту; тенипозид; криптофицины (в особенности, криптофицин 1 и криптофицин 8); доластатин; дуокармицин (в том числе синтетические аналоги, KW-2189 и CB1-TM1); элеутеробин; панкратистатин; саркодиктиин; спонгистатин; азотистые иприты, такие как хлорамбуцил, хлорнафазин, холофосфамид, эстрамустин, ифосфамид, мехлоретамин, гидрохлорид оксида мехлоретамина, мелфалан, новембихин, фенестерин, преднимустин, трофосфамид, урамустин; нитрозомочевины, такие как кармустин, хлорозотоцин, фотемустин, ломустин, нимустин и ранимнустин; антибиотики, такие как энедииновые антибиотики (например, калихимицин, особенно калихимицин-гамма1I и калихимицин-омегаI1 (см., например, Nicolaou et al., Angew. Chem Intl. Ed. Engl, 33: 183-186 (1994)); CDP323, пероральный ингибитор альфа-4 интегрина; динемицин, в том числе динемицин A; эсперамицин; а также хромофор неокарциностатина и родственные ему хромофоры хромопротеинового энедиинового антибиотика), аклациномизины, актиномицин, аутрамицин, азасерин, блеомицины, кактиномицин, карабицин, карминомицин, карцинофилин, хромомицины, дактиномицин, даунорубицин, деторубицин, 6-диазо-5-оксо-L-норлейцин, доксорубицин (в том числе ADRIAMYCIN®, морфолинодоксорубицин, цианоморфолинодоксорубицин, 2-пирролиндоксорубицин, доксорубицин HCl для липосомных инъекций (DOXIL®), липосомальный доксорубицин TLC D-99 (MYOCET®), пегилированный липосомальный доксорубицин (CAELYX®), и деоксидоксорубицин), эпирубицин, эзорубицин, идарубицин, марцелломицин, митомицины, такие как митомицин C, микофеноловая кислота, ногаламицин, оливомицины, пепломицин, порфиромицин, пуромицин, квеламицин, родорубицин, стрептонигрин, стрептозоцин, туберцидин, убенимекс, зиностатин, зорубицин; антиметаболиты, такие как метотрексат, гемцитабин (GEMZAR®), тегафур (UFTORAL®), капецитабин (XELODA®), эпотилон, и 5-фторурацил (5-FU); аналоги фолиевой кислоты, такие как деноптерин, метотрексат, птероптерин, триметрексат; аналоги пурина, такие как флударабин, 6-меркаптопурин, тиамиприн, тиогуанин; аналоги пиримидина, такие как анцитабин, азацитидин, 6-азауридин, кармофур, цитарабин, дидеоксиуридин, доксифлуридин, эноцитабин, флоксуридин; андрогены, такие как калустерон, пропионат дромостанолона, эпитиостанол, мепитиостан, тестолактон; противоадреналовые средства, такие как аминоглутетимид, митотан, трилостан; компенсатор фолиевой кислоты, такой как фолиновая кислота; ацеглатон; гликозид альдофосфамида; аминолевулиновую кислоту; энилурацил; амсакрин; бестрабуцил; бисантрен; эдатрексат; дефофамин; демеколцин; диазиквон; элфорнитин; ацетат эллиптиния; эпотилон; этоглуцид; нитрат галлия; гидроксимочевину; лентинан; лонидаинин; майтанзиноиды, такие как майтанзин и ансамитоцины; митогуазон; митоксантрон; мопиданмол; нитраэрин; пентостатин; фенамет; пирарубицин; лозоксантрон; 2-этилгидразид; прокарбазин; полисахаридный комплекс PSK® (JHS Natural Products, Eugene, OR); разоксан; ризоксин; сизофиран; спирогерманий; тенуазоновую кислоту; триазиквон; 2,2',2'-трихлортриэтиламин; трихотецены (особенно токсин T-2, верракурин A, роридин A и ангуидин); уретан; виндезин (ELDISINE®, FILDESIN®); дакарбазин; манномустин; митобронитол; митолактол; пипоброман; гацитозин; арабинозид ("Ara-C"); тиотепу; таксоиды, например, паклитаксел (TAXOL®), сконструированный с альбумином препарат наночастиц паклитаксела (ABRAXANE™) и доксетаксел (TAXOTERE®); хлоранбуцил; 6-тиогуанин; меркаптопурин; метотрексат; платиносодержащие средства, такие как цисплатин, оксалиплатин (например, ELOXATIN®), и карбоплатин; алкалоиды барвинка, которые препятствуют полимеризации тубулина из формирующихся микротрубочек, в том числе, винбластин (VELBAN®), винкристин (ONCOVIN®), виндесин (ELDISINE®, FILDESIN®), и винорелбин (NAVELBINE®); этопозид (VP-16); ифосфамид; митоксантрон; лейковорин; новантрон; эдатрексат; дауномицин; аминоптерин; ибандронат; ингибитор топоизомеразы RFS 2000; дифторметилорнитин (DMFO); ретиноиды, такие как ретиноевая кислота, в том числе бексаротен (TARGRETIN®); бисфосфонаты, такие как хлодронат (например, BONEFOS® или OSTAC®), этидронат (DIDROCAL®), NE-58095, золедроновая кислота/золедронат (ZOMETA®), алендронат (FOSAMAX®), памидронат (AREDIA®), тилудронат (SKELID®) или ризедронат (ACTONEL®); троксацитабин (аналог 1,3-диоксолана нуклеозида цитозина); антисмысловые олигонуклеотиды, в особенности те, которые ингибируют экспрессию генов в сигнальных путях, вовлеченных в ошибочную пролиферацию клеток, таких как, например, PKC-альфа, Raf, H-Ras, и рецептор эпидермального фактора роста (EGF-R); вакцины, такие как вакцина THERATOPE® и вакцины для генотерапии, например, вакцина ALLOVECTIN®, вакцина LEUVECTIN® и вакцина VAXID®; rIL-2 PROLEUKIN®; ингибитор топоизомеразы 1 (например,LURTOTECAN®); rmRH (например, ABARELIX®); BAY439006 (сорафениб; Bayer); SU-11248 (сунитиниб, SUTENT®, Pfizer); перифозин, ингибитор COX-2 (например, целекоксиб или эторикоксиб), ингибитор протеосом (например, PS341); бортезомиб (VELCADE®); CCI-779; типифарниб (R11577); орафениб, ABT510; ингибитор Bcl-2, такой как облимерсен натрий (GENASENSE®); пиксантрон; ингибиторы EGFR (см. определение ниже); ингибиторы тирозинкиназы (см. определение ниже); ингибиторы мерин-треонин киназы, такие как рапамицин (сиролимус, RAPAMUNE®); ингибиторы фарнезилтрансферазы, такие как лонафарниб (SCH 6636, SARASAR™); и фармацевтически приемлемые соли, кислоты или производные любого из указанного выше; а также комбинации двух или нескольких из указанного выше, например, CHOP, сокращенное наименование комбинированной терапии циклофосфамидом, доксорубицином, винкристином и преднизолоном; и FOLFOX, сокращенное наименование лечебной схемы с применением оксалиплатина (ELOXATIN™) в комбинации с 5-FU и лейковорином.

Химиотерапевтические средства, как определено здесь, включают в себя «противогормональные средства» или «эндокринные лекарственные средства», чье действие направлено на регулирование, уменьшение, блокирование или ингибирование эффектов гормонов, которые могут способствовать развитию злокачественного новообразования. Они могут представлять собой гормоны, в том числе, но не ограничиваясь этим: анти-эстрогены со смешанным агонист/антагонист профилем, в том числе, тамоксифен (NOLVADEX®), 4-гидроксинамоксифен, торемифен (FARESTON®), идоксифен, дролоксифен, ралоксифен (EVISTA®), триоксифен, кеоксифен и селективные регуляторы рецептора эстрогена (SERM), такие как SERM3; чистые анти-эстрогены без агонистических свойств, такие как фулвестран (FASLODEX®), и EM800 (такие средства могут блокировать димеризацию рецептора эстрогена (ER), ингибировать связывание ДНК, повышать метаболизм ER, и/или супрессировать уровни ER); ингибиторы ароматазы, включающие в себя стероидные ингибиторы ароматазы, такие как форместан и экземестан (AROMASIN®), и нестероидные ингибиторы ароматазы, такие как анастразол (ARIMIDEX®), летрозол (FEMARA®) и аминоглутетимид, и другие ингибиторы ароматазы, в том числе ворозол (RIVISOR®), мегестрол ацетат (MEGASE®), фадрозол и 4(5)-имидазолы; агонисты фактора, высвобождающего лютеинизирующий гормон, в том числе, лейпролид (LUPRON® и ELIGARD®), гозерелин, бузерелин, и триптерелин; половые стероиды, в том числе, прогестины, такие как мегестрол ацетат и медроксипрогестерон ацетат, эстрогены, такие как диэтилстильбэстрол и премарин, и андрогены/ретиноиды, такие как флуоксиместерон, полностью транс-ретиноевая кислота и фенретинид; онапристон; анти-прогестероны; супрессоры эстрогеновых рецепторов (ERD); анти-андрогены, такие как флутамид, нилутамид и бикалутамид; и фармацевтически приемлемые соли, кислоты или производные любого из указанного выше; а также комбинации двух или нескольких из указанного выше.

Такая комбинированная терапия также включает в себя: (i) ингибиторы липидкиназы; (ii) антисмысловые олигонуклеотиды, в частности те, которые ингибируют экспрессию генов в сигнальных путях, вовлеченных в патологическую клеточную пролиферацию, такие как, например, PKC-альфа, Ralf и H-Ras; (iii) рибозимы, такие как ингибитор экспрессии VEGF (например, рибозим ANGIOZYME®) и ингибитор экспрессии HER2; (iv) вакцины, такие как вакцины для генотерапии, например, вакцина ALLOVECTIN®, вакцина LEUVECTIN, и вакцина VAXID®; PROLEUKIN® rIL-2; ингибитор топоизомеразы 1 LURTOTECAN®; ABARELIX® rmRH; (v) анти-ангиогенные средства, такие как бевацизумаб (AVASTIN®, Genentech); и фармацевтически приемлемые соли, кислоты или производные любого из указанного выше.

Такие комбинированные схемы лечения, как упоминались выше, включают в себя совместное введение (когда два или несколько терапевтических средств включены в одну и ту же, или раздельные композиции), и раздельное введение, в таком случае, введение антагониста NRG по данному изобретению может быть осуществлено перед, одновременно, или после введения данного дополнительного терапевтического средства и/или адъюванта. Антагонисты NRG по данному изобретению также можно применять в комбинации с лучевой терапией.

D. Готовые изделия

В другом аспекте данного изобретения предусмотрены готовые изделия, содержащие в себе вещества, подходящие для лечения, профилактики и/или диагностики заболеваний, описанных выше. Данное готовое изделие включает в себя контейнер и этикетку, или листовку-вкладыш в, или на данном контейнере. Подходящие контейнеры включают в себя, например, бутылки, флаконы, шприцы, пакеты для в/в растворов, и тому подобное. Данные контейнеры могут быть изготовлены из различных материалов, таких как стекло или пластик. В данный контейнер помещена композиция, которая сама по себе, или в сочетании с другой композицией, является эффективной для лечения, профилактики или диагностики данного состояния, и может иметь стерильное входное отверстие (например, данный контейнер может быть мешком для внутривенного раствора или сосудом, имеющим пробку, прокалываемую с помощью иглы для подкожной инъекции). По меньшей мере один активный агент в данной композиции представляет собой антитело по данному изобретению. На этикетке, или листовке-вкладыше, указано, что данная композиция предназначена для использования при лечении выбранного состояния. Более того, готовое изделие может содержать в себе (a) первый контейнер с композицией, содержащейся в нем, где данная композиция содержит в себе антитело по данному изобретению; и (b) второй контейнер с композицией, содержащейся в нем, где данная композиция содержит в себе дополнительное цитотоксическое или иное терапевтическое средство. Данное готовое изделие в этом варианте осуществления данного изобретения может дополнительно содержать в себе листовку-вкладыш в упаковке, в которой указано, что данные композиции можно использовать при лечении определенного состояния. Альтернативно, или дополнительно, данное готовое изделие может дополнительно включать в себя второй (или третий) контейнер, содержащий в себе фармацевтически приемлемый буфер, такой как бактериостатическая вода для инъекций (BWFI), забуференный фосфатом физиологический раствор, раствор Рингера и раствор Д-глюкозы. Также может включать в себя другие материалы и вещества, необходимые с коммерческой и потребительской точки зрения, в том числе другие буферы, разбавители, фильтры, иглы и шприцы.

III. ПРИМЕРЫ

Следующее представляет собой примеры способов и композиций по данному изобретению. Следует понимать, что различные другие варианты осуществления могут быть применены на практике, учитывая общее описание, приведенное выше.

Пример 1: Методы

Клеточные линии

NSCLC-клеточные линии Calu3, H441, H1299, H1993, A549 и H596, и клеточная линия рака молочной железы KPL4, были получены из Американской коллекции типовых культур (ATCC), Manassas, VA. Эти клеточные линии поддерживали в RPMI, содержащем в себе 10% FBS, Pen/Strep и L-глутамин. Calu3 культивировали в среде ATCC, вместо RPMI. Клеточные линии Calu3, H441 и KPL4 были преобразованы с использованием TZV-b-актин-eGFP лентивируса. После многократных пассирований, клетки, экспрессирующие высокие уровни GFP, отделяли и амплифицировали для получения ~95% GFP-положительных клеток, и эти сублинии были описаны как Calu3-GFP и H441-GFP и KPL4-GFP. NSCLC-клеточные линии LKPH1 и LKPH2 мыши были получены из двух несвязанных опухолей от KrasLSL-G12D/+; p53FL/+; Z/EG мышей, страдающих опухолью легких. Клеточные линии изначально были созданы в среде DMEM/F12, содержащей в себе 5% FBS, экстракт гипофиза быка, добавку N2, EGF, FGF, Pen/Strep и L-глутамин. LKPH1 и LKPH2 культивировали в среде DMEM с высокой концентрацией глюкозы, содержащей в себе 10% FBS, Pen/Strep и L-глутамин.

Индуцируемый shPHK лентивирус: В этом исследовании использовали следующие шпилькообразные олигонуклеотиды:

shNRG1: 5'-GATCCCCCATGGTGAACATAGCGAATTTCAAGAGAATTCGCTATGTTCACCATGTTTTTTGGAAA-3' (смысловой) (SEQ ID №: 1)

и

5'-AGCTTTTCCAAAAAACATGGTGAACATAGCGAATTCTCTTGAAATTCGCTATGTTCACCATGGGG-3' (антисмысловой) (SEQ ID №: 2).

shNRG1.2: 5'-GATCCCCGAGTATATGTGCAAAGTGATTCAAGAGATCACTTTGCACATATACTCTTTTTTGGAAA-3' (смысловой) (SEQ ID №: 3) и

5'-AGCTTTTCCAAAAAAGAGTATATGTGCAAAGTGATCTCTTGAATCACTTTGCACATATACTCGGG-3' (антисмысловой) (SEQ ID №: 4).

shErbB4: 5'-GATCCCCGATCACAACTGCTGCTTAATTCAAGAGATTAAGCAGCAGTTGT GATCTTTTTTGGAAA-3'' (смысловой) (SEQ ID №: 5) и

5'-AGCTTTTCCAAAAAAGATCACAACTGCTGCTTAATCTCTTGAATTAAGCAGCAGTTGTGATCGGG-3' (антисмысловой) (SEQ ID №: 6).

shErbB3: 5'-GATCCCCAAGAGGATGTCAACGGTTATTCAAGAGATAACCGTTGACATCCTCTTTTTTTTGGAAA-3' (смысловой) (SEQ ID №: 7) и

5''-AGCTTTTCCAAAAAAAAGAGGATGTCAACGGTTATCTCTTGAATAACCGTTGACATCCTCTTGGG-3'' (антисмысловой) (SEQ ID №: 8).

shNRG1 мыши:

5''-GATCCCCCATGGTGAACATAGCGAATTTCAAGAGAATTCGCTATGTTCACCATGTTTTTTGGAAA-3'' (смысловой) (SEQ ID №: 9) и

5'-AGCTTTTCCAAAAAACATGGTGAACATAGCGAATTCTCTTGAAATTCGCTATGTTCACCATGGGG-3'' (антисмысловой) (SEQ ID №: 10).

Комплиментарные двухцепочечные shPHK олигонуклеотиды встраивали в Tet-индуцибельный вирусный вектор для переноса генов, как описано (Hoeflich et al. Cancer Res. 2006). Данная векторная система состоит из шаттл-вектора и dsRed-экспрессирующего вирусного векторного скелета, который содержит в себе кодон-оптимизированный внутренний сайт связывания рибосом Tet-репрессора - dsRed кассету, для обеспечения Tet-регулируемой экспрессии shPHK. Люциферазная конструкция shPHK была ранее описана (Hoeflich et al.).

Упаковка вируса и создание клеточной линии: Конструкции лентивируса, несущие в себе индуцибельную shPHK, были созданы на основе ранее описанных способов посредством совместной трансформации конструкций pHUSH-Lenti-dsRed, содержащих в себе необходимую shPHK, с плазмидами, экспрессирующими гликопротеин оболочки вируса везикулярного стоматита (VSV-G) и белки упаковки HIV-1 (GAG-POL), в клетках НЕК293Т, используя Липофектамин (Invitrogen, Carlsbad, CA). Клетки-мишени были преобразованы с помощью этих вирусов. После >3 пассажей, использовали сортинг с помощью FACS, для отбора ~20% наиболее экспрессирующих dsRed опухолевых клеток, которые были собраны, объединены в общий пул и размножены.

Исследования in vitro: Для индукции экпрессии shPHK, стабильные клеточные линии, несущие в себе доксициклин-индуцируемый shNRG1 или shLuciferase, выращивали в 1 мкг/мл доксициклина в общей сложности 6 дней. В первый день индукции клетки выращивали в 10% FBS, с последующим титрованием FBS в течение еще 4 дней. Затем данные клетки полностью лишили сыворотки на протяжении последних 6 часов роста. Затем клетки обрабатывали для выделения РНК или вестерн-блоттинга. Для исследований HER4ECD в клеточных линиях опухоли легких мыши, клетки LKPH выращивали в условиях без содержания сыворотки в течение 24 часов перед добавлением HER4ECD в концентрации 2 мг/мл. Клетки LKPH затем инкубировали в течение еще 48 часов перед обработкой для вестерн-блоттинга. Добавление экзогенного NRG1 к клеткам Н441 осуществляли следующим образом: клетки Н441 были лишены сыворотки в течение 18 часов перед добавлением 1 мкМ рекомбинантного NRG1 бета-1 внеклеточного домена человека (R&D systems) или 1 мкМ IgG2A против агглютинина амброзии в качестве контроля. Через десять минут после добавления NRG1 или контроля, клетки обрабатывали для вестерн-блоттинга.

Выделение РНК, приготовление кДНК и кПЦР: РНК выделяли с использованием набора Qiagen RNeasy Micro Kit. Комплементарную ДНК получали из общей РНК, используя набор ABI для высокой точности воспроизведения, в соответствии с инструкциями изготовителя. Экспрессию NRG1 альфа, NRG1 бета, HER3, HER4 определяли, используя ABI ген-специфические праймеры/зонды посредством количественной ПЦР в режиме реального времени (ABI 7500). Экспрессия генов была нормализована с использованием генов домашнего хозяйства GAPDH или RAB14.

Исследования ксенотрансплантатов опухоли in vivo : Опухолевые клетки (10-20 миллионов) трансплантировали в правый бок бестимусных голых мышей. Когда размер опухоли достигал ~200 мм3, мышей разделяли на две независимые группы обработки. Затем мышей подвергали либо обработке инертным наполнителем, либо химиотерапии (пактитаксел, в/в+цисплатин, в/б) для начальных исследований. Режим дозирования при химиотерапии был следующий: паклитаксель 20 мг/кг в/в через день, 5 доз, и цисплатин 5 мг/кг в/б в день 1 и 7 - для модели Calu3, и в день 1 и 14 - для модели Н441. Регрессированные опухоли и совпадающие по времени контроли, обработанные инертным наполнителем, собирали, по меньшей мере, через 1 неделю после последней дозы химиотерапии. Опухоли были разделены с помощью диспазы/коллагеназы, и образцы были рассортированы с помощью FACS, для отбора GFP-положительных опухолевых клеток. Для исследований нокдаун NRG1, группы обработки были следующие: сахароза, доксициклин (dox), химиотерапия+сахароза, и химиотерапия+доксициклин. Обработку с использованием сахарозы или доксициклина начинали в то же самое время, что и первую дозу химиотерапии, и продолжали на всем протяжении данного исследования. Вода с 5% сахарозы была в свободном доступе в неограниченном количестве в группах, получавших инертный наполнитель, и 1 мг/мл доксициклина в 5% сахарозе был обеспечен в группах, получавших доксициклин.

Анализ роста ксенотрансплантата опухоли: Для надлежащего анализа повторных измерений объемов опухоли у тех же самых животных с течением времени, использовали метод смешанного моделирования воздействия (Pinheiro et al. 2009). С помощью этого метода можно изучать и повторные измерения, и степень умеренного выпадения вследствие выбывания животного из исследования, не связанного с обработкой, перед окончанием исследования. Исспользовали многозвенники кубической регрессии для выравнивания нелинейного профиля с зависимостью от времени log2 объема опухоли для каждой группы обработки.

Исследования in vivo LSL-K-ras G12D ;p53 Fl/+ и LSL-K-ras G12D ;p53 Fl/Fl Her4ECD: LSL-K-rasG12D;p53Fl/+ инфецировали вирусом Adeno-Cre и выжидали до возраста 16 недель после индукции опухоли. Базовые сканы КТ были проведены на 16 неделе после индукции опухоли (день 0 исследования) и мышей делили на группы, таким образом чтобы средний начальный объем опухоли на группу был равным. Мышам раз в неделю на протяжении трех недель вводили дозу цисплатина (7 мг/кг) или забуференного фосфатом физиологического раствора, и раз в две недели дозу HER4ECD-Fc (25 мг/кг) или IgG2A против агглютинина амброзии (25 мг/кг) на протяжении данного исследования. Серийные сканы КТ осуществляли на 14, 45 и 66 дни.

Рентгеновская микро-компьютерная томография (микро-КТ): Две микро-КТ системы (vivaCT 40 и vivaCT 75, Scanco Medical, Switzerland) использовали для продольной визуализации легких. Животных случайным образом разделили для использования одной из двух систем микро-КТ, и повторное сканирование проводили с помощью той же системы, которую использовали для получения базовых сканов. Результат получали при изотопном размере воксела 38 мкм (vivaCT 40) или 50 мкм (vivaCT 75), 1000 проекций, продолжительности интегрирования 250 мс (vivaCT 40) или 200 мс (vivaCT 75), фотонной энергии 45 кэВ, и силе тока 177 мА. На протяжении in-vivo визуализации животные находились под наркозом 2% изофлюрана во вдыхаемом воздухе, и поддерживались при постоянной температуре 37° C с помощью регулируемого теплого потока воздуха. Время томографирования для каждого сеанса составляло приблизительно 15 минут (vivaCT 75) или 25 минут (vivaCT 40) на животного, и расчетная доза облучения составляла приблизительно 0,2 Гр (vivaCT 75) или 0,1 Гр (vivaCT 40). Данные визуализации оценивали во фронтальной плоскости, используя систему программного обеспечения Analyze для анализа изображения (AnalyzeDirect, Inc., Lenexa, KS, USA). После выявления самой крупной плоскости поперечного сечения для каждой опухоли, были определены максимальный диаметр опухоли (d1) и наибольший вертикальный диаметр опухоли (d2). Общую опухолевую массу рассчитывали как сумму скрещенного произведения данных направленных оценок (d1×d2) всех опухолей. Микро-КТ in-vivo анализ опухоли ранее был проверен и обнаружена его хорошая корреляция с общей опухолевой массой, что определено в ходе микро-КТ ex-vivo анализа (Singh et al., 2010).

Анализ с использованием микрочипов: Количество общей РНК, использованное в двух цикла Т7 амплификации, находится в диапазоне от 10 нг до 50 нг на образец. Первый цикл амплификации и второй цикл синтеза кДНК осуществляли с использованием набора Message Amp II aRNA Amplification (Applied Biosystems, Foster City, CA). Затем краситель Cye-5 был введен в результате реакции IVT с помощью набора Agilent's Quick Amp Labeling (Agilent Technologies, Palo Alto, CA). Каждый Cy-5-меченный пробный образец был объединен с Cy-3-меченной универсальной референсной РНК человека (Universal Human Reference RNA) (Agilent Technologies, Palo Alto, CA) и гибридизован на чипы Agilent's Whole Human Genome 4×44K, как описано в протоколе изготовителя. Данные чипы отмывали, высушивали и сканировали на сканере ДНК-микрочипов Agilent's DNA microarray scanner. Программное обеспечение Agilent's Feature Extraction software 9.5 использовали для анализа полученных изображений чипов, и получили индивидуальные соотношения log2 интенсивности сигнала за вычетом фона. Модифицированный кибер-Т тест (Baldi and Long, 2001) осуществляли для сравнения профилей экпрессии между группами, получавшими инертный наполнитель и химиотерапию. Уровень ложноположительных результатов (qvalue) был применен для поправки множественных сравнений (Storey and Tibshirani, 2003).

siPHK: Пулы олиго малых интерферирующих РНК (siPHK) для HER3 (M-003127-03), HER1 (M-003114-01), HER2, HER4 и ненаправленный контроль (D-001206-14-20) были получены в Dharmacon Lafayette, CO. siPHK вводили в клетки H522 посредством обратной трансфекции. Клетки/лунка высевали в 96-луночные титрационные микропланшеты, содержащие в себе преинкубированную смесь объединенных олигов РНК в концентрации 50 ммоль/л и реагента для трансфекции DharmaFECT# (T-2001-02, Dharmacon), разбавленного в OPTI-MEM (Invitrogen), в соответствии с рекомендациями производителя. Через 96 ч после трансфекции эффект на клеточную пролиферацию был оценен посредством окрашивания AlamarBlue.

Вестерн-блоттинг: Для вестерн-блоттинга клеточной культуры in vitro, прилипающие клетки отмывали три раза с помощью ледяного забуференного фосфатом физиологического раствора 1х (PBS) и лизировали в коктейле буфер RIPA (Pierce Biotechnology), ингибитор протеазы Halt и ингибитор фосфатазы Halt (Thermo Scientific). Лизат собирали, гомогенизировали, и очищали от примесей посредством центрифугирования в течение 10 минут. Первичные лизаты опухоли мыши готовили, как указано выше, без отмывания в PBS. Белки супернатанта фракционировали на 4-12% бис-трис геле NuPAGE Novex bis-tris gel (Invitrogen). Блоттинг проводили, используя систему для сухого блоттинга iBlot (Invitrogen), в соответствии со спецификацией изготовителя. Блокирование нитроцеллюлозной мембраны и окрашивание антителами проводили с использованием системы для вестерн-блоттинга и формирования ИК-изображения Odyssey (Li-Cor Biosciences), в соответствии с инструкциями изготовителя. Блоты визуализировали с помощью сканера Odyssey (Li-Cor Biosciences).

Антитела: Следующие первичные антитела использовали в вестерн-блоттинге: анти-актин (612656, BD Biosciences), анти-GAPDH (sc-25778, Santa Cruz Biotechnology), анти-EGF рецептор (2232, Cell Signaling Technology), анти-Neu (sc-284, Santa Cruz Biotechnology), анти-ErbB3 (sc-285, Santa Cruz Biotechnology), анти-фосфо-HER3 (4791, Cell Signaling Technology), анти-ErbB4 (sc-283, Santa Cruz Biotechnology), анти-фосфо-HER4 (4757, Cell Signaling Technology), анти-Akt (4691, Cell Signaling Technology), анти-фосфо-Akt (4058, Cell Signaling Technology), набор Stat/phospho-Stat antibody sampler kit (9939/9914, Cell Signaling Technology), анти-MEK 1/2 (9126, Cell Signaling Technology), анти-фосфо-MEK 1/2 (2338, Cell Signaling Technology). Использовали следующие вторичные антитела от Li-Cor Biosciences: IRDye 680 конъюгированное антитело козла против IgG мыши, IRDye 800 CW конъюгированное антитело козла против IgG кролика.

Пример 2: Оптимизация моделей in vivo для изучения остаточных явлений болезни и рецидива

Для изучения клеток, которые ответственны за повторное возникновение опухоли, были созданы и использовались несколько моделей злокачественных новообразований, которые демонстрируют значительный регресс в ответ на химиотерапию, с последующим рецидивом опухоли после прекращения терапии (Фиг.1). Эти клетки представляют собой клетки, повторно вызывающие опухоль (TRIC). Для создания данных моделей, опухолевые клетки человека, меченные GFP, трансплантировали подкожно мышам, и когда размер опухоли достигал ~200 мм3, мышей подвергали воздействию либо инертного наполнителя, либо химиотерапии, как показано в соответствующих моделях. GFP+ опухолевые клетки выделяли из регрессирующих или обработанных инертным наполнителем опухолей посредством FACS-сортинга после ферментативного переваривания и диссоциации. Опухоли были собраны, как минимум, через одну неделю после последней дозы химиотерапии и перед возобновлением роста опухоли.

GFP-экспрессирующие сублинии клеточных линий Calu3 и H441 немелкоклеточного рака легких человека (NSCLC) были трансплантированы бестимусным голым мышам для создания моделей ксенотрансплантатов. Для модели Calu3, химиотерапия состояла из паклитакселя (20 мг/кг, в/в, через день, 5 доз) и цисплатина (5 мг/кг, в/б, каждые 7 дней 2 дозы). Фиг. 2A (результаты представлены как средний объем опухоли ±SEM, n=15/группа). Для модели Н441, химиотерапия состояла из паклитакселя (20 мг/кг, в/в, через день, 5 доз) и цисплатина (5 мг/кг, в/б, каждые 14 дней 2 дозы). Фиг. 2В (результаты представлены как средний объем опухоли ±SEM, n=9/группа - для получавших инертный наполнитель, и n=14/группа - для получавших химиотерапию).

GFP-экспрессирующие сублинии клеточной линии рака молочной железы KPL4 человека были трансплантированы ортотопно в скопление жировой ткани молочной железы мышей SCID/beiz. Для модели KPL4, химиотерапия состояла из Паклитакселя (20 мг/кг, в/в через день 5 доз). Фиг 2C (результаты представлены как средний объем опухоли ±SEM, n=12/группа).

После завершения химиотерапевтического режима, опухоли у мышей, получавших химиотерапию, были значительно меньше, чем у мышей, получавших инертный наполнитель. Регрессия сохранялась в течение нескольких недель после последней дозы химиотерапии, но опухоли впоследствии рецидивировали. Фиг. 2A-C.

Кроме того, LSL-K-rasG12D созданная методом генетической инженерии модель NSCLC на мышах (Jackson et al., 2001) была скрещена с Z/EG Cre-репортерным штаммом (Novak et al., 2000) и использована в этом исследовании. Цисплатин (7 мг/кг, в/б, каждые 7 дней 3 дозы) начали применять через 12 недель после инфецирования легких AdenoCre (то есть, инициации опухоли). Легкие извлекали через 1 неделю после последней дозы химиотерапии, и опухолевые клетки изолировали посредством FACS после ферментативного переваривания и диссоциации. Анализ FACS GFP-положительных опухолевых клеток, присутствующих в легком через одну неделю после финальной дозы цисплатина, выявил значительное уменьшение числа опухолевых клеток у мышей, получавших лечение цисплатином, по сравнению с контрольными мышами, получавших инертный наполнитель. Фиг. 2D (данные представлены как среднее количество GFP-положительных клеток на легкое ±SEM, n=6/группа). Таким образом, лечение цисплатином мышей LSL-K-rasG12D в результате привело к значительному уменьшению опухолевой массы, но не повлекло за собой пролонгированное выживание, что свидетельствует о рецидиве опухоли после терапии (Oliver et al., 2010).

Несмотря на то, что каждая из моделей, описанных выше, реагировала на химиотерапию, опухоли рецидивировали в разное время после терапии, вопреки почти полной редукции количества клеток. GFP-меченные клетки, которые выживали при химиотерапии перед началом повторного роста опухоли, включают в себя TRIC, и были изолированы для дальнейшего изучения.

Пример 3. Увеличение NRG1 в TRIC

Исходя из предрасчетных кривых роста для каждой модели, уменьшенные, или обработанные инертным наполнителем, опухоли извлекали в период между 1-3 неделями после последней обработки, но перед началом повторного роста опухолей в группе, получавшей химиотерапию. Опухолевые ткани были ферментативно переварены и диссоциированы, и GFP-положительные опухолевые клетки были выделены посредством клеточного сортера с возбуждением флуоресценции (FACS).

Для описания различий в профилях экспрессии генов клетками, обработанными инертным наполнителем, и клетками резидуальных опухолей, РНК выделяли из опухолевых клеток (PI- & GFP+) и осуществляли анализ профиля экспрессии. Анализ обеих моделей Calu3 и H441 с использованием микрочипов выявил, что экспрессия NRG1 была значительно выше в резидуальных опухолевых клетках, получавших химиотерапию, по сравнению с опухолевыми клетками, обработанных инертным наполнителем (Фиг. 3A-B). Увеличение в резидуальных клетках, обработанных химиотерапией, было установлено с использованием двух независимых микрочиповых зондов. Для модели ксенотрансплантата Calu3, 8,6-кратное увеличение (р=0,003, q=0,003) было установлено с использованием первого зонда (Фиг. 3A, левая панель микрочипа) и 5,3-кратное увеличение (p=0,001, q=0,002 (n=8/группа)) было установлено с использованием второго зонда (Фиг. 3A, левая панель микрочипа). Для модели ксенотрансплантата H441, 4,9-кратное увеличение (p<0,001, q=0,009) было установлено с использованием первого зонда ((Фиг. 3B, левая панель микрочипа)) и 2,8-кратное увеличение (p=0,001, q=0,013 (n=8/группа)) было установлено с использованием второго зонда ((Фиг. 3B, правая панель микрочипа)).

Вследствие альтернативного сплайсинга, существуют две активные изоформы EGF-подобного домена NRG1, который необходим для связывания с рецептором, обозначаемые как NRG1 альфа (NRG1 α) и NRG1 бета (NRGβ). Авторы данного изобретение доказали увеличение NRG1α и NRG1β с помощью количественной ПЦР в режиме реального времени (кПЦР) (Фиг. 3A-B). Для модели ксенотрансплантата Calu3, экспрессия NRG1α была увеличена 4,7-кратно (p=0,02) (Фиг. 3A, левая панель кПЦР) и экспрессия NRG1β была увеличена 3,4-кратно (p=0,04) (Фиг. 3A, правая панель кПЦР) (n=6/группа), с использованием независимых опухолевых образцов. Для модели ксенотрансплантата H441, NRG1α увеличен 11,4-кратно (Фиг. 3B, левая панель кПЦР) и NRG1β увеличен 12,1-кратно (Фиг. 3B, правая панель кПЦР), использовались те же опухолевые образцы, что и для анализа с использованием микрочипов.

мРНК NRG1 увеличена в TRIC из модели ксенотрансплантата KPL4 рака молочной железы. Увеличение было установлено с использованием двух независимых микрочиповых зондов (Фиг. 3C).

Для модели LSL-K-rasG12D, на основании микрочипового анализа, экспрессия NRG1 была значительно выше в клетках резидуальных опухолей после химиотерапии, по сравнению с группой опухолевых клеток после обработки инертным наполнителем. С помощью анализа с использованием микрочипов было установлено 13,7-кратное увеличение (p<0,001, q=1) (n=6/группа) (Фиг. 3D, панель микрочипа). Увеличение было подтверждено с помощью кПЦР независимых образцов, демонстрируя 9-кратное увеличение (p=0,04) (Фиг. 3D, панель кПЦР).

NRG1 был одним из немногочисленных генов, значительно увеличенных в резидуальных обработанных клетках во всех 3 моделях, Calu3, H441 и LSL-K-rasG12D. Интересно, что экспрессия ни рецептора HER3, ни рецептора HER4 не была сопоставимо увеличена во всех трех моделях.

Активация рецептора NRG1, HER3, была достигнута посредством иммуноокрашивания опухолей фосфо-HER3. Большинство опухолевых клеток в резидуальных опухолях были p-HER3-положительными, тогда как опухоли, обработанные инертным наполнителем, демонстрировали только разбросанные кластеры p-HER3-положительных клеток. Экспрессия другого лиганда HER3, NRG2, не была выявлена в клетках резидуальных опухолей. Таким образом, клетки резидуальных опухолей экспрессируют NRG1 и проявляют увеличенную активацию рецептора, демонстрируя тем самым увеличенную аутокринную активность NRG1.

Пример 4 - Регуляция экспрессии NRG1

Повышенная экспрессия NRG1, наблюдаемая в клетках резидуальных опухолей, может быть результатом увеличения субпопуляции клеток, экспрессирующих NRG1, представленных в первичной опухоли. Альтернативно, химиотерапия может индуцировать экспрессию NRG1 в клетках, которые затем являются устойчивыми к ее цитотоксическим действиям, или на уровни экспрессии может влиять размер опухоли или кинетика роста. Для того чтобы провести различие между этими возможностями, уровни экспрессии NRG1 оценивали посредством кПЦР в опухолях различных объемов и в разные моменты времени после химиотерапии (Фиг. 4). Уровни мРНК NRG1 не были повышены после однократной дозы химиотерапии (цисплатин+паклитаксель). В действительности, за исключением резидуальных опухолей, уровни NRG1 были одинаковыми во все моменты времени и во всех протестированных объемах. Эти результаты демонстрируют, что экспрессия NRG1 не индуцируется химиотерапией, и не находится под влиянием размера опухоли, и находятся в соответствии с увеличением предсуществующей субпопуляции клеток, экспрессирующих NRG1.

Пример 5 - Аутокринный сигнальный путь NRG1-HER в NSCLC

Для выявления моделей, которые совместно экспрессируют и лиганд, и его рецепторы, исследовали экспрессию NRG1 и его рецепторов в исходных клетках Calu3 и H441, а также в панели дополнительных клеточных линий NSCLC человека. Несмотря на то, что уровни экспрессии транскриптов NRG1α и NRG1β были различными среди клеточных линий, они были значительно выше в большинстве клеточных линий при сравнении с нормальным легким. Удивительно, что в клетках H441 транскрипт NRG1 присутствовал только когда клетки росли как опухоли in vivo. Культивированные клетки Н441 не экспрессировали выявляемые транскрипты NRG1α или NRG1β, особо подчеркивая различия в свойствах клеток, выращиваемых in vitro и in vivo. Вестерн-блоттинг четырех рецепторов HER выявил разнородную экспрессию среди 6 линий NSCLC человека. Calu3 имеет наивысший уровень экспрессии in vitro всех четырех рецепторов, по сравнению с другими клеточными линиями.

Для оценки возможных нижележащих медиаторов аутокринного сигнального пути NRG1, были созданы стабильные сублинии исходных клеточных линий Calu3, H441 и H1299, несущие в себе доксициклин-индуцибельную shPHK (Gray et al., 2007) к NRG1 (shNRG1), и конститутивно экспрессирующие репортерный ген dsRED. Данный ген NRG-1 содержит в себе многочисленные промоторы и подвержен экстенсивному альтернативному сплайсингу, результатом которого являются, по меньшей мере, 15 различных изоформ. Все активные изоформы содержат в себе EGF-подобный домен, который необходим и достаточен для активации RTK (Holmes et al., 1992; Yarden and Peles, 1991). shNRG1 был нацелен на общий EGF-подобный домен для выключения всех возможных изотипов. Подходящие стабильные клеточные линии с доксициклин-индуцируемой shPHK к люциферазе (shLuc) были созданы в качестве контролей. Наблюдали эффективное и специфическое уменьшение транскриптов NRG1α и NRG1β (~90%) только в клетках Calu3-shNRG1, когда культивирование происходило в присутствии доксициклина (dox). Было установлено сопутствующее снижение уровней p-HER3, p-AKT и небольшое снижение p-HER4 в клетках Calu3-shNRG1 без содержания сыворотки, культивированных в присутствии dox. Не было обнаруживаемых изменений уровней p-Stat3 или p- Mek1/2 в этих лизатах.

Поскольку клетки H441 не экспрессируют никаких транскриптов NRG1 in vitro, медиаторы сигнального пути NRG1 в этих клетках оценивали посредством стимулирования экзогенным лигандом NRG1. В условиях стимуляции NRG1 клеток, лишенных сыворотки, наблюдали повышение p-HER3 и p-AKT. Не было поддающихся выявлению изменений уровней p-Stat3 или p-Mek1/2.

Эффекторные пути NRG1 также оценивали в клетках рака легких мыши. Две независимые клеточные линии были получены из LSL-K-rasG12D;p53Fl/+ опухолей легких, LKPH1 и LKPH2, в собирательном значении называемые линии LKPH (см. Пример 1). Были созданы стабильные сублинии, несущие в себе dox-индуцируемый shNrg1 или shLuc. Уменьшение транскриптов NRG1 наблюдали только в клеточных линиях LKPH shNrg1 в присутствии dox. Более того, наблюдали снижение уровней p-HER3 и p-AKT в клетках, лишенных сыворотки, культивированых в присутствии dox. Изменения уровней p-Mek1/2 и p-Stat3 в культурах, лишенных мРНК Nrg1, не поддавались выявлению посредством вестерн-блоттинга, что указывает на то, что эти эффекторные пути не затронуты данным Nrg1.

Совместно, результаты стимуляции посредством NRG1 клеток Н441 и выключение NRG1в клетках Calu3 и LKPH1/2, показывают, что путь PI3K является главным нижележащим эффектором сигнального пути NRG1 в клетках NSCLC. Повышенная экспрессия транскриптов NRG1 и рецепторов HER в обеих моделях NSCLC человека и мыши, и сниженная активность сигнального пути HER3 в культивированных клетках при выключенном NRG1, показывают, что существует аутокринная сигнальная петля NRG1-HER3 в NSCLC. Кроме того, его повышенная экспрессия в клетках резидуальных опухолей (Фиг. 3), указывает на то, что аутокринный сигнальный путь NRG1 может играть роль в развитии химиорезистентности и/или рецидива заболевания.

Пример 6 - Выключение NRG1 откладывает рецидив опухоли после химиотерапии

Эффект выключения NRG1 на рост первичной опухоли и рецидив после химиотерапии был определен в результате оценки эффектов только выключения NRG1, или в сочетании с химиотерапией. В этом исследовании использовали три модели NSCLC человека, демонстрирующие различный характер экспрессий рецепторов семейства HER. Модель Calu3 имеет высокобелковые уровни всех данных рецепторов, Н441 демонстрирует высокую экспрессию HER2 и HER3, и умеренную HER1, и H1299 демонстрирует умеренные уровни HER1, 2 и 3.

Для определения эффективности NRG1 - нацеливания в модели Calu3, мыши, несущие в себе опухоль Calu3-shNRG1, были разделены на четыре группы: 1) инертный наполнитель+сахароза, 2) инертный наполнитель+dox, 3) химиотерапия+сахароза, и 4) химиотерапия+dox. Такие же схемы химиотерапии, как описаны выше в Примере 2, были использованы, и сахарозу 5%, или dox (2 г/л) вводили перорально в питьевой воде в свободном доступе. Объем опухоли измеряли два раза в неделю на всем протяжении исследования. Кривые роста опухоли были сгенерированы для каждой мыши, использованной в этом исследовании (n=12 мышей в группе инертный наполнитель+сахароза, и n=13 мышей в группе инертный наполнитель+dox) и представлены как линейная модель со смешанными эффектами (LME), сгенерированная в соответствии с объемом опухоли, изображенной графически как кубические сплайны с самоопределяемыми узлами на Фиг. 5A и 5B. Наблюдали значительную отсрочку времени удвоения объема опухоли в группе инертный наполнитель+dox (время до удвоения (TDT)=44,5 дней) по сранению с группой инертный наполнитель+сахароза (TDT=17 дней), что указывает на то, что выключение NRG1 частично ингибирует рост опухоли (Фиг. 5A).

Эффект NRG1 на рецидив опухоли оценивали посредством сравнения роста опухолей в группах химиотерапия+сахароза и химиотерапия+dox. Наблюдали значительную отсрочку рецидива опухоли в группе химиотерапия+dox (TDT >181 дней, не достигли к концу исследования) по сравнению с группой химиотерапия+сахароза (TDT=124 дней) (Фиг. 5B). Более того, многие из рецидивировавших опухолей у мышей, обработанных dox, как в сочетании с химиотерапией, так и без нее, состояли главным образом, из светло-бурой/черной слизеподобной жидкости с лишь очень небольшой областью жизнеспособной опухолевой ткани. В этой связи, измеренные объемы были значительно больше, чем фактический объем опухоли в группах, обработанных dox. Не было выявлено различий между какими-либо группами в контрольном исследовании Calu3-shLuc. Дополнительно была осуществлена иммуногистохимия (IHC) опухолей Calu3 на маркер пролиферации Ki67 через 3 дня после последней дозы химиотерапии. Было выявлено значительно более низкое соотношение Ki67-положительных клеток в опухолях, обработанных химиотерапия+dox, по сравнению с опухолями, обработанных химиотерапия+сахароза, что свидетельствует о том, что сигнальный путь NRG1 стимулирует пролиферацию клеток резидуальных опухолей после химиотерапии.

Были определены уровни мРНК изоформ NRG1α и NRG1β опухолевых клеток, собранных в ранний и позний моменты времени. Транскрипты NRG1 увеличены в поздний момент времени, что свидетельствует о том, что выключение не поддерживается in vivo.

Также был исследован эффект выключения NRG1 на модели ксенотрансплантата H441. Несмотря на то, что был минимальный эффект на рост первичной опухоли (Фиг. 6A (n=12 /группа) кривые роста опухолей, представлены как LME, сгенерированная в соответствии с объемом опухоли, изображенной графически как кубические сплайны с самоопределяемыми узлами), наблюдали значительную отсрочку рецидива опухоли в группе химиотерапия+dox (TDT >150 дней, не достигли к концу исследования) по сравнению с группой химиотерапия+сахароза (TDT=94 дней) (Фиг. 6B ((n=12/группа)). Не было такого различия в объеме опухоли в H441-shLuc в исследовании in vivo. Подобно модели ксенотрансплантата Calu3l, модель H441 также демонстрировала повышенные уровни транскриптов NRG1 на поздних моментах времени.

Для изучения механизма после восстановления уровней NRG1, проводили анализ клеток опухоли на экспрессию генов, измененных с помощью лентивируса. Вследствие того, что лентивирус, использованный для изменения клеток с shPHK, также включает в себя маркерный ген dsRed, соотношение dsRED-положительных опухолевых клеток на ранних и поздних сроках сравнивали посредством проточной цитометрии. Утрата in vivo лентивирусной экспрессии генов была оценена на ранних сроках (5 дней) и поздних сроках (>100 дней) посредством анализа FACS, исследующего количественное соотношение опухолевых клеток (человеческие специфические -ESA положительные), которые экспрессируют лентивирусный dsRed трансген. Мыши на ранних сроках получали сахарозу или dox, и мыши на позднем сроке получали химиотерапия+сахароза или химиотерапия+dox. Наблюдали значительное снижение количественного соотношения dsRed-положительных клеток на позднем сроке и в опухолях, обработанных сахарозой, и в опухолях, обработанных dox, данное снижение было значительно больше в опухолях, обработанных dox (1,8-кратное по сравнению с 4,1-кратным, p=0,007). Это дает основание полагать, что утрата вирусной трансгенной экспрессии коррелирует с восстановлением уровней NRG1.

И клетки Calu3, и клетки H441 демонстрирует повышенные уровни белка HER3, в связи с этим возникает вопрос является ли роль NRG1 в рецидиве опухоли специфической для опухолей со сверхпродукцией рецептора. Для ответа на этот вопрос использовали модель ксенотрансплантата Н441, которая имеет значительно более низкие уровни HER3. Только выключение NRG1 имело умеренный эффект на рост первичной опухоли, аналогично модели Н441. В отличие от этого и вопреки очень агрессивному росту опухолей Н1299, выключение NRG1 приводит к усиленному ответу на химиотерапию, что врезультате приводит к значительной отсрочке рецидива опухоли в группе химиотерапия+dox (TDT=30,45 дней) по сравнению с группой химиотерапия+сахароза (TDT=11,5 дней) (n=12/группа) (Фиг. 7 A, B).

Более того, была создана стабильная сублиния Н1299, экспрессирующая другую shPHK к NRG1 (shNRG1.2), что в результате приводит к более умеренному снижению уровней мРНК NRG1. Исследования in vivo с H1299-shNRG1.2 также продемонстрировали усиленный ответ на химиотерапию при выключенном NRG1. Однако интенсивность ингибирования роста была меньше в этой модели, сопоставимо с меньшей степенью выключения NRG1. Не было различия в объемах опухолей между группами, получавших обработку сахарозой и dox, с или без химиотерапии в исследованиях in vivo H1299-shLuc.

Ингибирование аутокринного сигнального пути NRG1 посредством shPHK опосредованного выключения, имело только от умеренных до средних эффектов на рост первичной опухоли, но значительно задерживало рецидив опухоли после химиотерапии. Несмотря на невозможность поддерживать догосрочное выключение NRG1 в моделях ксенотрансплантатов, авторы настоящего изобретения наблюдали значительную отсрочку рецидива опухоли в условиях выключения NRG1. Эти результаты указывают на то, что существуют различия в ключевых путях регулирования роста первичной опухоли, и химиорезистентности и рецидива.

Пример 7 - Ингибироваие сигнального пути NRG1 с использованием ловушки лиганда задерживает рецидив опухоли

Для исследования роли сигнального пути NRG1 в стимуляции рецидива после химиотерапии на модели на мышах LSL-K-rasG12D;p53Fl/+, применяли подход ловушки лиганда для изолирования NRG1 и предотвращения его связывания с рецепторами in vivo. Создали гибрид внеклеточного домена HER4 человека (HER4-ECD), слитого с Fc IgG2A мыши. HER4 демонстрирует высокую аффинность связывания с NRG1 (Tzahar et al., 1994). При добавлении HER4-ECD к клеткам LKPH1 и LKPH2, лишенным сыворотки, in vitro, наблюдали ингибирование сигнального пути NRG1/HER3, что продемонстрировано сниженными уровнями p-HER3. Таким образом, данная молекула in vitro вела себя, как ожидалось, препятствуя аутокринно-опосредованному сигнальному пути NRG1.

Мышей, несущих опухоль легких LSL-K-rasG12D;p53Fl/+, в начале исследования (день 0) подвергли рентгенографической микро-компьютерной томографии (микро-КТ), разделили на три группы по равным начальным опухолевым нагрузкам, и обрабатывали следующим образом: 1) PBS+контрольный IgG2A; 2) цисплатин+контрольный IgG2A; и 3) цисплатин+HER4-ECD. Мышей подвергли продольной микро-КТ для оценки изменений опухолевых нагрузок. Анализ средней опухолевой нагрузки (Фиг.8 А (график представляет средний объем опухоли ± SEM, амброзия, контрольное антитело IgG2a мыши)) и скорости роста опухоли ((Фиг. 8B (график, демонстрирующий ежедневную кратность изменения опухолевой массы в результате использования лечебной схемы, с 95% доверительными интервалами)) выявил, что только комбинация цисплатин+HER4-ECD, но не один цисплатин, в результате приводит к значительному ингибированию роста опухоли. Несмотря на то, что у мышей, обработанных цисплатином, наблюдали задержку роста опухоли на первом срезе микро-КТ после химиотерапии, средняя опухолевая нагрузка после завершения исследования и общая скорость роста опухоли не были достоверно различны между группами, обработанными инертным наполнителем и цисплатином (Фиг. 8A-B).

Второе исследование проводили на мышах LSL-K-rasG12D ;p53Fl/Fl, как описано выше. Однако, это исследование включало в себя применение единственного агента HER4-ECD в дополнение к группам, описанным выше. Анализ опухолевой нагрузки посредством микро-КТ на День 28 выявил значительное снижение опухолевой нагрузки у мышей, обрабатываемых цисплатин+HER4-ECD по сравнению с мышами, обрабатываемых цисплатин+инертный наполнитель и всеми другими группами (Фиг. 8C). В отличие от этого, обработка только HER4-ECD не оказывает эффекта на рост опухоли, что дополнительно доказывает уникальную роль аутокринного сигнального пути NRG1 в развитии химиорезистентности и/или повторного роста опухоли. В этом исследовании мышей LSL-K-rasG12D; p53Fl/Fl обрабатывали инертный наполнитель+контрольный IgG (n=10), цисплатин+контрольный IgG (n=11), цисплатин+HER4-ECD (n=8) или инертный наполнитель+HER4-ECD (n=7). На диаграмме Фиг. 8С представлено среднее изменение процентного содержания опухолевой нагрузки от начального ±SEM. Критерий множественного сравнения Дуннетта использовали для сравнения всех групп обработок с контрольным инертным наполнителем **p=0,0016. Комбинированную активность оценивали с использованием непарного t-критерия против монотерапии *p<0,05, **p<0,01.

Пример 8 - Использование рецептора NRG1 в NSCLC

Для того, чтобы понять, какие рецепторы HER задействованы в аутокринном сигнальном пути NRG1 в NSCLC, авторы данного изобретения оценили эффекты выключения HER3 и HER4 на пролиферацию опухолевых клеток. Модель Calu3 NSCLC, экспрессирующую высокие уровни всех рецепторов семейства HER, сравнивали с другими клеточными линиями. Были созданы стабильные dox-индуцируемые shHER3 (Calu3-shHER3) и shHER4 (Calu3-shHER4) сублинии клеток Calu3, а также контрольные клеточные линии, несущие в себе dox-индуцируемую shPHK к люциферазе. Уровни транскриптов HER3 и HER4 были снижены в Calu3-shHER3 и Calu3-shHER4, соответственно, в присутствии dox (2 мкг/мл), что измерено посредством кПЦР, что привело в результате к сниженным уровням белка, что измерено посредством вестерн-блоттинга. Интересно, что степень супрессирующего эффекта р-АКТ в Calu3-shHER3 в присутствии dox, была значительно больше, чем в Calu3-shHER4, что свидетельствует о том, что HER3 представляет собой доминирующий рецептор, опосредующий аутокринный сигнальный путь NRG1 в модели Calu3.

Для подтверждения этой роли in vivo, были проведены исследования с использованием моделей ксенотрансплантатов Calu3-shHER3 и Calu3-shHER4, обработанных любо сахарозой, либо dox. Мышам с развившимися ксенотрансплантатами опухолей Calu3-shHER3 или Calu3-shHer4, вводили инертный наполнитель (сахароза) или dox (2 г/л) в их питьевой воде в открытом доступе (n=14/группа). Наблюдали значительное ингибирование роста опухоли Calu3-shHER3 у мышей, получавших dox (TDT=19 дней) по сравнению с мышами, получавшими сахарозу (TDT=11 дней). Однако, не было заметного ингибирования роста опухоли в Calu3-shHER4 в исследовании in vivo.

Рецепторный анализ in vitro и исследования in vivo показывают, что несмотря на высокие уровни HER4, аутокринный сигнальный путь NRG1 осуществляется, главным образом, посредством HER3 в этой модели.

Аутокринный сигнальный путь NRG1 оценивали в клеточной линии Н522 NSCLC человека, которая экспрессирует высокие уровни HER4, но не экспрессирует определяемые уровни HER3. Была создана сублиния H522-shNRG1. Применение dox на клетках H522-shNRG1, лишенных сыворотки, в результате приводит к сниженным уровням фосфо-HER4 и фосфо-S6. Различия не выявлены в контрольных клетках H522-shLuc. siPHK-опосредованное выключение использовали для анализа необходимости каждого члена семейства HER в клеточной пролиферации. Только выключение HER4, но не других рецепторов семейства HER, приводит в результате к сниженной клеточной пролиферации. Эти данные указывают на то, что аутокринный сигнальный путь NRG1 осуществляется посредством HER4 в клетках H522. Таким образом, аутокринный сигнальный путь NRG1 в NSCLC может быть опосредован как HER3, так и HER4.

Несмотря на то, что вышеизложенное изобретение описано подробно с помощью иллюстраций и примеров для ясности понимания, данные описания и примеры не должны рассматриваться как ограничивающие диапазон данного изобретения. Раскрытия всех патентов и научной литературы, процитированные здесь, включены здесь посредством ссылки в полном их объеме.

Цитированная литература

1) Lung Cancer Principles and Practice, Third edn (2005) (Philadelphia: Lippincott Williams & Wilkins).

2) Agus, D.B., et al. (2002). Targeting ligand-activated ErbB2 signaling inhibits breast and prostate tumor growth. Cancer cell 2, 127-137.

3) al Moustafa, A.E., et al (1999). Expression of P185erbB-2, P160erbB-3, P180erbB-4, and heregulin alpha in human normal bronchial epithelial and lung cancer cell lines. Anticancer Res 19, 481-486.

4) Baldi, P., and Long, A.D. (2001). A Bayesian framework for the analysis of microarray expression data: regularized t-test and statistical inferences of gene changes. Bioinformatics 17, 509-519.

5) Bao, S., et al. (2006). Stem cell-like glioma cells promote tumor angiogenesis through vascular endothelial growth factor. Cancer research 66, 7843-7848.

6) Brennan, S.K., and Matsui, W. (2009). Cancer stem cells: controversies in multiple myeloma. Journal of molecular medicine (Berlin, Germany) 87, 1079-1085.

7) Carey, K.D., et al. (2006). Kinetic analysis of epidermal growth factor receptor somatic mutant proteins shows increased sensitivity to the epidermal growth factor receptor tyrosine kinase inhibitor, erlotinib. Cancer research 66, 8163-8171.

8) Costello, R.T., et al. (2000). Human acute myeloid leukemia CD34+/CD38- progenitor cells have decreased sensitivity to chemotherapy and Fas-induced apoptosis, reduced immunogenicity, and impaired dendritic cell transformation capacities. Cancer research 60, 4403-4411.

9) Dahabreh, I.J., et al. (2010). Somatic EGFR mutation and gene copy gain as predictive biomarkers for response to tyrosine kinase inhibitors in non-small cell lung cancer. Clin Cancer Res 16, 291-303.

10) Dean, M., Fojo, T., and Bates, S. (2005). Tumour stem cells and drug resistance. Nature reviews 5, 275-284.

11) Ding, L., et al. (2008). Somatic mutations affect key pathways in lung adenocarcinoma. Nature 455, 1069-1075.

12) Doebele, R.C, et al. (2010). New strategies to overcome limitations of reversible EGFR tyrosine kinase inhibitor therapy in non-small cell lung cancer. Lung Cancer 69, 1-12.

13) Dylla, S.J., et al. (2008). Colorectal cancer stem cells are enriched in xenogeneic tumors following chemotherapy. PloS one 3, e2428.

14) Goffin, J., et al. (2010). First-line systemic chemotherapy in the treatment of advanced non- small cell lung cancer: a systematic review. J Thorac Oncol 5, 260-274.

15) Gollamudi, M., et al. (2004). Autocrine activation of ErbB2/ErbB3 receptor complex by NRG-1 in non-small cell lung cancer cell lines. Lung Cancer 43, 135-143.

16) Gray, D.C, et al. (2007). pHUSH: a single vector system for conditional gene expression. BMC Biotechnol 7, 61.

17) Hirsch, F.R., et al. (2007). Combination of EGFR gene copy number and protein expression predicts outcome for advanced non-small-cell lung cancer patients treated with gefitinib. Ann Oncol 18, 752-760.

18) Holmes, W.E., et al. (1992). Identification of heregulin, a specific activator of p185erbB2. Science (New York, NY 256, 1205-1210.

19) Horner MJ, et al (eds) SEER Cancer Statistics Review, 1975-2006. In, (National Cancer Institute. Bethesda, MD).

20) Jackson, E.L., et al. (2001). Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras. Genes Dev 15, 3243-3248.

21) Johnson, B.E., and Janne, P.A. (2006). Rationale for a phase II trial of pertuzumab, a HER-2 dimerization inhibitor, in patients with non-small cell lung cancer. Clin Cancer Res 12, 4436s- 4440s.

22) Junttila, T.T., et al. (2009). Ligand-independent HER2/HER3/PI3K complex is disrupted by trastuzumab and is effectively inhibited by the PI3K inhibitor GDC-0941. Cancer cell 15, 429- 440.

23) Kosaka, T., et al. (2004). Mutations of the epidermal growth factor receptor gene in lung cancer: biological and clinical implications. Cancer research 64, 8919-8923.

24) Kuyama, S., et al. (2008). Impact of HER2 gene and protein status on the treatment outcome of cisplatin-based chemoradiotherapy for locally advanced non-small cell lung cancer. J Thorac Oncol 3, 477-482.

25) Li, Q., et al. (2004). Development of an autocrine neuregulin signaling loop with malignant transformation of human breast epithelial cells. Cancer research 64, 7078-7085.

26) Liu, L.Z., et al. (2007). AKT1 amplification regulates cisplatin resistance in human lung cancer cells through the mammalian target of rapamycin/p70S6K1 pathway. Cancer research 67, 6325-6332.

27) Lynch, T.J., et al. (2004). Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 350, 2129- 2139.

28) Marchetti, A., et al. (2005). EGFR mutations in non-small-cell lung cancer: analysis of a large series of cases and development of a rapid and sensitive method for diagnostic screening with potential implications on pharmacologic treatment. J Clin Oncol 23, 857-865.

29) Matsui, W., et al. (2004). Characterization of clonogenic multiple myeloma cells. Blood 103, 2332-2336.

30) Novak, A., et al. Z/EG, a double reporter mouse line that expresses enhanced green fluorescent protein upon Cre-mediated excision. Genesis 28, 147-155.

31) Oliver, T.G., et al. (2010). Chronic cisplatin treatment promotes enhanced damage repair and tumor progression in a mouse model of lung cancer. Genes Dev 24, 837-852.

32) Paez, J.G., et al. (2004). EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science (New York, NY 304, 1497-1500.

33) Pao, W., et al (2005). Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain. PLoS Med 2, e73.

34) Patel, N.V., et al. (2000). Neuregulin-1 and human epidermal growth factor receptors 2 and 3 play a role in human lung development in vitro. American journal of respiratory cell and molecular biology 22, 432-440.

35) Phillips, T.M., et al. (2006). The response of CD24(-/low)/CD44+ breast cancer-initiating cells to radiation. Journal of the National Cancer Institute 98, 1777-1785.

36) Reissmann, P.T., et al. (1999). Amplification and overexpression of the cyclin Dl and epidermal growth factor receptor genes in non-small-cell lung cancer. Lung Cancer Study Group. J Cancer Res Clin Oncol 125, 61-70.

37) Schaefer, G., et al. (1997). Gamma-heregulin: a novel heregulin isoform that is an autocrine growth factor for the human breast cancer cell line, MDA-MB-175. Oncogene 15, 1385-1394.

38) Sheng, Q., et al. (2010). An Activated ErbB3/NRG1 Autocrine Loop Supports In Vivo Proliferation in Ovarian Cancer Cells. Cancer cell 17, 298-310.

39) Shi, D., et al. (1992). Overexpression of the c-erbB-2/neu-encoded p185 protein in primary lung cancer. Mol Carcinog 5, 213-218.

40) Shigematsu, H., Lin, L., et al. (2005). Clinical and biological features associated with epidermal growth factor receptor gene mutations in lung cancers. Journal of the National Cancer Institute 97, 339-346.

41) Singh, M., Lima, et al. (2010). Assessing therapeutic responses in Kras mutant cancers using genetically engineered mouse models. Nat Biotechnol 28, 585-593.

42) Sinnberg, T., et al. (2009). Inhibition of PI3K-AKT-mTOR signaling sensitizes melanoma cells to cisplatin and temozolomide. J Invest Dermatol 129, 1500-1515.

43) Storey, J.D., and Tibshirani, R. (2003). Statistical significance for genomewide studies. Proceedings of the National Academy of Sciences of the United States of America 100, 9440-9445.

44) Tzahar, E., et al. (1994). ErbB-3 and ErbB-4 function as the respective low and high affinity receptors of all Neu differentiation factor/heregulin isoforms. J Biol Chem 269, 25226-25233.

45) Weiner, D.B., et al. (1990). Expression of the neu gene-encoded protein (P185neu) in human non-small cell carcinomas of the lung. Cancer research 50, 421-425.

46) Yarden, Y., and Peles, E. (1991). Biochemical analysis of the ligand for the neu oncogenic receptor. Biochemistry 30, 3543-3550.

47) Yuste, L., et al. (2005). Activation of ErbB2 by overexpression or by transmembrane neuregulin results in differential signaling and sensitivity to herceptin. Cancer research 65, 6801-6810.

48) Zhou, B. B., et al. (2006). Targeting ADAM-mediated ligand cleavage to inhibit HER3 and EGFR pathways in non-small cell lung cancer. Cancer cell 10, 39-50.

1. Способ увеличения периода времени до рецидива опухоли у онкологического пациента, который ранее получал противораковую терапию, включающий введение пациенту эффективного количества антагониста неурегулина 1 (NRG1) и терапевтического средства, где антагонист NRG1 представляет собой анти-NRGl антитело, siPHK или shPHK, нацеленные на NRG1, или иммуноадгезин к NRG1, и терапевтическое средство выбирают из группы, состоящей из паклитаксела, цисплатина и их комбинации паклитаксела и цисплатина.

2. Способ по п. 1, где рак выбран из группы, состоящей из немелкоклеточного рака легких, рака молочной железы, рака яичников, рака области головы и шеи, рака шейки матки, рака мочевого пузыря, рака пищевода, рака предстательной железы и колоректального рака.

3. Способ по п. 1, где увеличение периода времени до рецидива опухоли по меньшей мере в 1,25 раз больше, чем период времени до рецидива опухоли без применения антагониста неурегулина.

4. Способ по п. 1, где увеличение периода времени до рецидива опухоли по меньшей мере в 1,50 раз больше, чем период времени до рецидива опухоли без применения антагониста неурегулина.

5. Способ по п. 1, где данный антагонист неурегулина NRG1 представляет собой анти-NRG1 антитело.

6. Способ по п. 1, где данный антагонист неурегулина NRG1 представляет собой siPHK или shPHK, нацеленные на NRG1.

7. Способ по п. 1, где данный антагонист неурегулина NRG1 представляет собой иммуноадгезин к NRG1.

8. Способ по п. 1, где терапевтическое средство представляет собой паклитаксел.

9. Способ по п. 1, где терапевтическое средство представляет собой цисплатин.

10. Способ по п. 1, где терапевтическое средство представляет собой комбинацию паклитаксела и цисплатина.



 

Похожие патенты:

Изобретение относится к биотехнологии, а именно к способу очистки G-CSF (гранулоцитарный колониестимулирующий фактор) в последовательности очистки, применяющей хроматографию.

Настоящее изобретение относится к области биотехнологии. Предложено терапевтическое антитело и терапевтический фрагмент антитела для повышения продукции тромбоцитов, включающие пептид-миметик тромбопоэтина (ТРО), содержащий последовательность IEGPTLRQWLAARA и встроенный как дополнение к С-концу константной области легкой цепи и/или в положении менее 20 аминокислот ниже С-конца шарнирной области тяжелой цепи.

Настоящее изобретение относится к области биотехнологии, конкретно к созданию лекарственных препаратов с замедленным высвобождением белковых или пептидных лекарственных средств, и может быть использовано в медицине.

Изобретение относится к области биотехнологии, а именно к способу получения очищенного рекомбинантного GDF-5-подобного белка. .

Изобретение относится к области молекулярной биологии, конкретно, к белкам, регулирующим клеточную дифференцировку путем ингибирования белка семейства Wnt, и может быть использовано в медицине для профилактики и лечения связанных с нарушениями активности Wnt сигнального пути заболеваний, например рака толстой кишки, меланомы, карциномы.

Изобретение относится к области биохимии. .

Изобретение относится к области биотехнологии, конкретно к пептиду, который обладает ростостимулирующей активностью фактора роста гепатоцитов HGF. .

Изобретение относится к области молекулярной биологии, конкретно к белкам, регулирующим клеточную дифференцировку путем ингибирования белков надсемейства TGF-beta. .

Группа изобретений относится к медицине и касается способа определения резистентности субъекта к лечению рака с использованием 2,2-диметил-N-((S)-6-оксо-6,7-дигидро-5Н-дибензо[b,d]-азепин-7-ил)-N′-(2,2,3,3,3-пентафторпропил)малонамида, включающего измерение уровня биомаркера, присутствующего в биологическом образце, полученном у упомянутого субъекта, где биомаркер представляет собой IL6 и/или IL8, и где повышенный уровень IL6 и/или IL8 свидетельствует о наличии резистентности к указанному лечению.

Изобретение относится к цитотоксическим пентапептидам формулы (I), к их конъюгатам антитело-лекарственное средство и фармацевтическим композициям. Соединения обладают противоопухолевой активностью и предназначены для лечения рака.

Настоящее изобретение относится к медицине, а именно онкологии, и может быть использовано для лечения рака предстательной железы. Для этого источник полипептида, содержащего ограниченный классом I МНС- и/или классом II МНС Т-клеточный эпитоп нативной блестящей оболочки (zona pellucida) 3 (ZP3) используют для изготовления лекарственного средства для лечения рака предстательной железы.

Группа изобретений относится к медицине и может быть использована для лечения приобретенного расстройства, устойчивого к метотрексату, у субъекта. Для этого указанному субъекту, страдающему приобретенным расстройством, устойчивым к метотрексату, вводят фармацевтически эффективное количество композиции, которая содержит 10-пропаргил-10-деазааминоптерин или его фармацевтически приемлемые соли.

Предложен способ получения твердой лекарственной формы прокарбазина, обладающей противоопухолевым действием, в котором при температуре 40-45°С смешивают маннитол, прокарбазина гидрохлорид и стеарат магния, увлажняют крахмальным водным раствором.

Изобретение относится к способу получения ценного для фармацевтической промышленности кристаллического гидрохлорида эпирубицина. В предложенном способе проводят: (a) получение гидрохлорида эпирубицина, (b) получение смеси, которая содержит полученный гидрохлорид эпирубицина и по меньшей мере один спирт, который выбирают из группы, которая состоит из 1-бутанола, 2-бутанола и 1-пентанола, и (c) кристаллизацию гидрохлорида эпирубицина из данной смеси, причем смесь на стадии (b) дополнительно содержит воду и доля эпирубицина гидрохлорида находится в диапазоне от 10 до 50 г/л по отношению к объему смеси, и смесь выдерживают при 50-75°С в течение, по меньшей мере, двух часов.
Изобретение относится к медицине, а именно к онкологии, и может быть использовано при лечении рака прямой кишки. Химиотерапию 5-фторурацилом проводят за 4-6 часов перед сеансами гамма-терапии укрупненными фракцияи по 4 Гр по схеме динамического фракционирования дозы в течение первых 3 дней.

Изобретение относится к области органической химии, а именно к 9-этил-6,6-диметил-8-(4-морфолин-4-ил-пиперидин-1-ил)-11-оксо-6,11-дигидро-5Н-бензо[b]карбазол-3-карбонитрилу. Также изобретение относится к лекарственному средству, ингибитору ALK и фармацевтической композиции на основе указанного соединения.

Изобретение относится к области биотехнологии, конкретно к влиянию мутаций гена KRAS на восприимчивость к химиотерапии, и может быть использовано в предсказании терапевтического эффекта химиотерапии.

Изобретение относится к области биохимии, в частности к комбинированной терапии афукозилированным антителом против CD20 и ингибитором mTOR для лечения рака. Заявлено применение афукозилированного гуманизированного антитела против CD20 В-Ly1 для изготовления лекарственного средства для лечения В-клеточной неходжкинской лимфомы в комбинации с ингибитором mTOR, таким как темсиролимус или эверолимус.

Изобретение относится к медицине. Композиционная коллагеновая губка предназначена для остановки кровотечения, а также для стимулирования роста и пролиферации клеток.
Наверх