Трансгенное растение березы с устойчивостью к гербицидам



Трансгенное растение березы с устойчивостью к гербицидам
Трансгенное растение березы с устойчивостью к гербицидам
Трансгенное растение березы с устойчивостью к гербицидам
Трансгенное растение березы с устойчивостью к гербицидам
Трансгенное растение березы с устойчивостью к гербицидам

 

C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2587623:

Федеральное государственное бюджетное учреждение науки Институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова Российской академии наук (ИБХ РАН) (RU)

Изобретение относится к области биохимии, в частности к трансгенному растению березы вида Betula pendula, обладающему устойчивостью к действию гербицидов на основе фосфинотрицина по сравнению с аналогом дикого типа, а также к способу его получения. Изобретение позволяет эффективно получать трансгенное растение березы, обладающее устойчивостью к действию гербицидов на основе фосфинотрицина. 2 н. и 1 з.п. ф-лы, 3 ил., 3 табл., 6 пр.

 

Настоящее изобретение относится к области генной инженерии и биотехнологии растений, в частности к трансгенным растениям березы, проявляющих высокую устойчивость к гербицидам на основе фосфинотрицина.

Уровень техники

Основным способом защиты агробиоценозов от сорняков является использование синтетических гербицидов. Хлорорганические гербициды - высокотоксичные агенты. Фосфорорганические гербициды, в частности фосфинотрицин и глифосат - менее токсичны, обладают системным действием, поэтому они получили широкое распространение [1].

Фосфинотрицин - это модифицированный продукт метаболизма актиномицетов Streptomyces (S. hygroscopious, S. viridichromogenus) [2]. Фосфинотрицин блокирует фермент глутаминсинтетазу, который катализирует реакцию превращения α-кетоглутаровой кислоты и аммония в глутамин, действует как конкурентный ингибитор, так как по химической структуре близок к глутамину. При ингибировании глутаминсинтетазы происходит накопление аммонийного азота и прекращается синтез глутамина. Накопления ионов аммония ведет к соответствующему изменению pH в полостях тилакоидов, что приводит к нарушению и остановке процессов фотосинтеза, а недостаток глутамина приводит к прекращению синтеза ряда аминокислот [3, 4].

Поскольку многие гербициды, в том числе и на основе фосфинотрицина, проявляют неселективное действие, они угнетают не только сорняки, но и целевые культуры, поэтому получение растений, устойчивых к действию гербицидов является актуальной задачей.

Для получения устойчивых к действию гербицидов растений путем генетической трансформации используется три подхода: 1) сверхэкспрессия белка-мишени гербицида, когда белка синтезируется больше, чем поражается гербицидом и клетка выживает; 2) изменение белка-мишени гербицида, когда вследствие мутации ослабляется способность белка связываться с гербицидом; 3) встраивание генов, которые детоксицируют гербицид.

Основным недостатком первых двух способов является накопление гербицида в растениях, что может негативно отразиться на их дальнейшем применении, например в пищевых целях. Третий способ наиболее эффективен, так как происходит инактивация гербицида до нетоксичных соединений, что является экологически безопасным.

Фосфинотрицин относится к новому классу высокоэффективных и безопасных для животных и окружающей среды гербицидов, которые ингибируют специфический путь биосинтеза аминокислот в растениях. Из них наиболее известны гербициды «Basta», «Herbiace», «Liberty», «Фозат», «Торнадо», «Алаз», «Вихрь», «Дефолт» и др.

В настоящее время получен ряд трансгенных растений, таких как хлопок, рапс, кукуруза, соя, сахарная свекла, рис, устойчивых к действию гербицидов на основе фосфинотрицина. Это обеспечивается путем переноса в растения гена bar из S. Hygroscopicus, кодирующего синтез фермента фосфинотрицинацетилтрансферазы, которая переводит фосфинотрицин в неактивную форму [5, 6].

Но использование гербицидов для борьбы с сорняками не ограничивается их применением только в отношении сельскохозяйственных травянистых культур. Они также могут применяться и для лесных древесных пород.

Несмотря на все достижения химической промышленности, потребность в древесине постоянно возрастает и, по прогнозам специалистов, она будет увеличиваться и впредь. В отличие от других видов промышленного сырья и топлива древесина является возобновляемым ресурсом. С целью сохранения природных лесов повсеместно наблюдается переход к плантационному лесоводству, которое требует использования ценных генотипов с определенными свойствами. Получение посадочного материала для таких плантаций также представляет собой определенные сложности, так как древесные породы в первые годы жизни отличаются медленным ростом и в питомниках легко угнетаются сорняками. Эта проблема может быть решена с помощью применения в лесоводстве современных методов биотехнологии - генной инженерии, а именно получения древесных растений устойчивых к действию гербицидов.

Сущность изобретения

Задачей изобретения было получение трансгенных растений березы, обладающих повышенной устойчивостью к действию гербицидов на основе фосфинотрицина.

Используемый в настоящем описании термин «растение» охватывает целые растения, предшественники и потомство растений и части растений, включая семена, побеги, стебли, листья, корни, цветки и ткани и органы, причем все они содержат нуклеотидную последовательность с SEQ ID NO: 1. Термин «растение» также охватывает клетки растений, суспензионные культуры, каллусную ткань, зародыши, меристемы, гаметофиты, спорофиты, пыльцу и микроспоры, причем все они, опять же, содержат нуклеотидную последовательность с SEQ ID NO: 1.

Поставленная задача решается путем проведения трансформации растений березы методом агробактериальной трансформации с использованием бинарного вектора, содержащего ген bar, кодирующий фосфинотрицин ацетилтрансферазу. При этом растения березы принадлежат к виду Betula pendula. Кроме того, способ получения трансгенных растений березы, обладающих повышенной устойчивостью к действию гербицидов на основе фосфинотрицина, включает в себя стадии: генетической

трансформации растительной ткани; регенерации трансформированных клеток в целое растение; экспрессии гена bar в регенерированном растении; отбора трансформированных растений, проявляющих высокую устойчивость к гербицидам на основе фосфинотрицина, по сравнению с соответствующими растениями дикого типа или нетрансформированным.

Примеры в детальном описании приводятся для генотипа березы бб31 (Betula pendula).

Однако перечень растений для использования в данном изобретении не ограничивается указанными растениями.

В качестве эксплантов для трансформации используют листья березы in vitro.

Пример 1. Подготовка растительного материала

Для трансформации растений березы используют листовые экспланты с растений in vitro. Размножение культуры березы проводят на питательной среде WPM, содержащей 0,6 мг/л БАП, 0,1 мг/л ИМК, 20 г/л сахарозы и 7 г/л агара. Компонентный состав минеральных солей питательных сред приведен в Табл. 1, состав комплекса витаминов - в Табл. 2. Растения выращивают при фотопериоде 16/8 часов, температуре 22-24°C и освещенности 3000-3500 люкс.

Пример 2. Подготовка штаммов бактерий A. tumefaciens СВЕ21 (рСВЕ21, pBIBAR) для трансформации растений

Для трансформации растений используют ночную культуру бактерий A. tumefaciens. Для этого 100 мкл суспензии клеток бактерий A. tumefaciens СВЕ21 (рСВЕ21, pBIBAR) (Фиг. 1) добавляют к 50 мл жидкой среды LB (Табл. 3), содержащей 50 мг/л канамицина и инкубируют в течение ночи на термостатируемом орбитальном шейкере при 28°C и 120-150 об/мин, после чего центрифугируют полученную суспензию 5 минут при 4000 об/мин, осадок промывают жидкой средой MS (Табл. 1) и повторяют центрифугирование и промывание. После осаждения клеток их заливают 50 мл жидкой среды MS и ресуспендируют.

Пример 3. Трансформация растений березы клетками бактерий А. tumefaciens СВЕ21 (рСВЕ21, pBIBAR)

Для трансформации используют листья с растений in vitro возрастом 1 месяц. У листьев удаляют черешки и верхушки (у крупных листьев - также и боковые стороны) и наносят несколько надрезов перпендикулярно центральной жилке, не доводя их до краев листа. Подготовленные таким образом экспланты помещают на 40-50 минут в суспензию агробактерий, после чего осушают стерильными фильтрами и размещают на фильтрах, расположенных в чашках Петри на поверхности среды для кокультивации, содержащей минеральные соли MS, 5 мг/л зеатина, 5 мг/л БАП, 0,2 мг/л ИМК, 30 г/л сахарозы и 7 г/л агара. В каждую чашку помещают по 10-15 эксплантов. Начиная с двух суток периодически проверяют наличие колоний агробактерий на поверхности среду под проекцией эксплантов. Кокультивацию эксплантов с агробактериями проводят в темноте при температуре 23°C в течение 2 суток. После периода кокультивации экспланты промывают в дистиллированной воде с добавлением 1 г/л цефотаксима в течение 20-30 минут и затем дважды в воде без цефотаксима. Отмытые экспланты подсушивают на фильтрах и переносят на среду для регенерации и селекции трансформантов того же состава, содержащую дополнительно 50 мг/л канамицина и 500 мг/л цефотаксима. На этой среде экспланты выдерживают в условиях 16-часового светового дня при 22-23°C с пересадкой каждые 4 недели. Регенерированные побеги пересаживают на среду для размножения, содержащую 50 мг/л канамицина и 250 мг/л цефотаксима.

Пример 4. Полимеразная цепная реакция (ПЦР) на присутствие фрагмента последовательности гена bar

Присутствие гена bar в трансгенных растениях березы подтверждают методом ПЦР с праймерами, специфичными для кодирующей области трансгенной конструкции:

1) SEQ ID NO: 2;

2) SEQ ID NO: 3.

Для экстракции геномной ДНК и березы использовался растительный материал in vitro. Из условий in vitro для растирания в жидком азоте брались кусочки листовой ткани растений. Выделение проводилось по модифицированному нами протоколу. За основу бралась стандартная методика Rogers и Bendich (1994) [7] с применением 2-кратного СТАВ-буфера:

1. 50-200 мг листовой ткани охлаждают жидким азотом и тщательно растирают в ступке до пылеобразного состояния.

2. Растертую ткань переносят в предварительно охлажденные пробирки емкостью 2 мл, добавляют 600 мкл разогретого до 65°C 2х СТАБ буфера для экстракции. Осторожно перемешивают и разбивают комки, помещают пробирки в водяную баню на 30 мин при 56°C.

3. Добавляют равный объем смеси хлороформ:изоамиловый спирт (24:1) и эмульгируют встряхиванием. Центрифугируют 1.5 мин при 13 тыс. g. Супернатант переносят в новую пробирку

4. Промывают интерфазу в исходной пробирке 100 мкл 2х СТАБ буфера для экстракции. Вновь центрифугируют, удаляют верхнюю фазу и соединяют ее с первой.

5. Добавляют 1/10 объема 10% раствора СТАБ к собранной верхней фазе и перемешивают. Повторяют экстракцию смесью хлороформ:изоамиловый спирт (24:1). Центрифугируют 1 мин при 13 тыс. g.

6. Переносят супернатант в новую пробирку и осаждают выделенную ДНК изопропанолом (0.6 объема) в течение ночи при -20°C. Осадок осаждают центрифугированием 1,5 мин при 8 тыс. g. Удаляют супернатант и подсушивают осадок.

7. Препарат ДНК растворяют в 400 мкл высокосолевого буфера ТЭ, содержащем 1М NaCl. После растворения осадка добавляют 800 мл этанола для осаждения. Оставляют на ночь при -20°C.

8. Осадок осаждают центрифугированием 2 мин при 10 тыс. об. После удаления супернатанта осадок последовательно промывают в 65% и 85% этаноле (0.5-1.0 мл) по 2 раза в течение 1 мин.

9. Сливают этанол, подсушивают осадок и обрабатывают РНКазой А растворенной в ТЭ буфере в течение 1 часа при 37°C. Добавляют к препарату равный объем смеси хлороформ:фенол (1:1), тщательно перемешивают и центрифугируют 2 мин при 8-10 тыс. g.

10. Верхнюю фазу переносят в новую пробирку, добавляют 2 объема этанола и осаждают ДНК в течение ночи при -20°C. ДНК растворяют в 50-100 мкл буфера ТЭ и определяют ОП препарата при длине волн 230, 260 и 280 нм.

Продукты ПЦР анализировали методом электрофореза. Электрофорез ДНК проводили в агарозных гелях концентрацией 1% в электрофорезной камере фирмы "Labnet". Для приготовления геля агарозу (1 г) расплавляли в 100 мл буферного раствора (электролит для электрофоретической системы) «ТВ x1», остужали до 55-60°С, добавляли 1 мкл раствора бромистого этидия (10 мг/мл) и заливали гель в собранную кассету для приготовления гелей. После застывания геля гребенку аккуратно вынимали, лунки промывали буферным раствором для электрофореза, доводили его уровень до отметки -2-3 мм над верхней поверхностью геля и приступали к нанесению в лунки геля анализируемых проб. Раствор ДНК (не более 10 мкл) смешивали с буферным раствором для нанесения проб (3 мкл) «б-Orange». Образцы наносили на гель автоматическими пипетками со сменными одноразовыми насадками.

Электрофорез проводили в 0,5х ТВЕ буфере (20 × ТВЕ буфер: 0,89 М Трис-OH, 0,89 М борная кислота, 50 мМ ЭДТА) с добавлением бромистого этидия в течение 40-60 мин при напряженности электрического поля 5-10 В/см. Промежуточный результат анализа снимали после достижения сигнальным красителем отметки длины пробега дорожки, помещая гель на трансиллюминатор. При необходимости, продолжали электрофоретическое разделение образцов ДНК до требуемого качества. Визуализацию ДНК проводили с помощью трансиллюминатора и фотографировали в проходящем ультрафиолетовом свете.

Появление продукта ПЦР (ДНК размером 310 н.п.) при использовании указанных праймеров, а также при условии отсутствия его в реакциях, поставленных на контрольной ДНК, свидетельствует о присутствии искомого гена в ДНК исследуемых растений (Фиг. 2).

Пример 5. Адаптация и укоренения трансгенных растений березы в условиях in vivo

Укорененные в условиях in vitro растения березы высаживали в стеллажные обогреваемые теплицы в пластиковые кассеты с ячейками диаметром 40 мм. В качестве субстрата использовали пропаренную смесь торфа и песка (3:1), обогащенную 20 г комплексного минерального удобрения "Кристаллин" на 1 кг смеси. На период адаптации растений накрывали полиэтиленовой пленкой, которую снимали через один месяц.

Пример 6. Оценка устойчивости растений к фосфинотрицину

Эксперимент по оценке устойчивости линий к фосфинотрицину (РРТ) проводили на горшечных растениях. Растения были обработаны 1% гербицидом Basta (15% РРТ) в дозе, эквивалентной 5 л/га. На листьях трансгенной линии B37Barla полностью полностью отсутствовали признаки поражения (Фиг. 3).

Краткое описание фигур

Фиг. 1. Карта плазмиды pBIBAR, использованной для трансфомации растений березы.

Фиг. 2. ПЦР-анализ трансгенных растений березы, содержащих ген bar.

Обозначения: 1-3 - ДНК трансформантов березы различных линий, -К - ДНК нетрансгенного растения (отрицательный контроль), H2O - вода, +К - ДНК плазмиды pBIBAR (положительный контроль), М - маркер молекулярной массы ДНК.

Фиг. 3. Вид растений березы после обработки гербицидом, содержащим фосфинотрицин (слева - контроль, справа - трансгенная линия).

Список источников литературы

1. Афонин, А.А. Эколого-генетические риски использования химических средств защиты растений [Электрон, ресурс].

2. Murakami, Т., Anzai, H, Imai, S., Satoh, A., Nagaoka, K. and Thompson, C.J. (1986) Mol. Gen. Genet., 205, 42-50.

3. Tachibana, K., Watanabe, T., Sekizawa, Y. and Takematsu, T. (1986) J. Pesticide Sci., 11, 33-37.;

4. De Block, M. et al. (1987) EMBO J., 6, 2513-2518.

5. Comai, L., Facciotti, D., Hiatt, W.R., Thompson, G., Rose, R.E. and Stalker, D.M. (1985) Nature, 317, 741-744.

6. Shah, D., Horsch, R., Klee, H., Kishore, G., Winter, J., Tumer, N., Hironaka, C, Sanders, P., Gasser, C, Aykent, S., Siegel, N., Rogers, S.G. and Fraley, R.T. (1986) Science, 233, 478-481.

7. Rogers, S.O.; Bendish, A.J. Extraction of DNA from milligram amounts of fresh herbarium and minifield plant tissues (1985) Plant Mol. Biol., 5, 69-76.

Перечень последовательностей

SEQ ID NO: 1. Нуклеотидная последовательность гена bar:

GAATCCGGACAGAATTCCCAACCCGCCCTTCGATTTTTCTGATCATGCAGTACCCTGTCCGGCCACGAGGGGAGGCGGGATGCCGTCGGAACGTACAGAGGTGCAGGTCAGGTCGGGAGTCGAGGCCGACCTCAAAGCCCTCACCGACATCTACAACCACTATGTACGTGAGACGCCCATCACATTCGATACCGCCGCCTTCACGCCGGAAGAGCGCCGCCCTTGGCTGCTCTCCCACCCTGAAGACGGACCGCACCGGCTGATGGTTGCCACGGGCGCGGACTCACAGGAGATTCTTGGGTACGCCACCAGCAGTCCTTTCCGCGCCAAGCCCGCCTACACCACCTCCGTCGAGGTGACCGTCTACGTCGCCCCGGACGCGGCTGGCCGTGGCATCGGCACGCTCCTCTACGGCGCCCTCTTCGAGGCGCTGGCGGGCGAGGATCTCCACCGCGCCTACGCGGGCATCGCCCAGCCCAACGAAGCGTCCACGCGGCTGCATGAACGCTTCGGGTTCCGGCATGTCGGCACCTACCGGGAGGTGGGCCGCAAGTTCGGACGGTACTGGGACGTGGCCTGGTACGAGAGGGAGCTGTAGCCGTACGCCGACCAGCAGCCGTACGCCGTTCAGCCGAACTGCACCGACCGCTTCGCCAGCCCCAGCCAGAAGCCGTC

SEQ ID NO: 2. Праймер №1, специфичный для гена bar:

5′-TGCACCATCGTCAACCACTA-3′

SEQ ID NO: 3. Праймер №2, специфичный для гена bar:

5′-ACAGCGACCACGCTCTTGAA-3′.

1. Трансгенное растение березы вида Betula pendula, обладающее устойчивостью к действию гербицидов на основе фосфинотрицина по сравнению с аналогом дикого типа, обусловленной экспрессией рекомбинантного гена bar, кодирующего фосфинотрицин ацетилтрансферазу с SEQ ID NO: 1.

2. Растение по п. 1, полученное методом агробактериальной трансформации с использованием бинарного вектора, содержащего ген bar.

3. Способ получения трансгенного растения по п. 1, где способ включает стадии:
а) генетической трансформации растительной ткани геном bar с SEQ ID NO: 1;
б) регенерации трансформированных клеток в целое растение;
в) экспрессии гена bar с SEQ ID NO: 1 в регенерированном растении;
г) отбора трансформированных растений, проявляющих высокую устойчивость к гербицидам на основе фосфинотрицина, по сравнению с соответствующими растениями дикого типа или нетрансформированным.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к получению антагомиров микроРНК, и может быть использовано в медицине для лечения сосудистого заболевания, выбранного из группы, включающей периферическое сосудистое окклюзионное заболевание, коронарную болезнь сердца, цереброваскулярное заболевание, васкулит, атеросклероз, ремоделирование сосудов в ответ на повреждение или рестеноз.

Изобретение относится к области биотехнологии, конкретно к способу лечения метаболического расстройства у субъекта путем введения средств, которые модулируют активность и экспрессию микроРНК, и может быть использовано в медицине.

Изобретение относится к области молекулярной биологии и диагностической медицины. Предложен способ выделения микроРНК из биологических жидкостей.

Изобретение относится к антисмысловому олигонуклеотиду, представляющему собой фосфотиоатный аналог длиной от 19 до 30 нуклеотидов, который представляет собой соединение, гибридизующееся с природным антисмысловым полинуклеотидом гена Атонального гомолога 1 (АТОН1) и увеличивает экспрессию указанного гена АТОН1 in vivo или in vitro по сравнению с нормальным контролем.

Группа изобретений относится к области биотехнологии. Двухцепочечный олигорибонуклеотид содержит последовательность антисмысловой цепи SEQ ID NO: 28: 5′ AGUAGUUUCCAUAGGUCUG 3′ и последовательность смысловой цепи SEQ ID NO: 5: 5′ CAGACCUAUGGAAACUACU 3′.

Настоящее изобретение относится к иммуностимулирующим олигодезоксинуклеотидам общей формулы: где х = 3-20, z = 0-10, n = 2-100, и может быть использовано в медицине, конкретно в ветеринарии.

Изобретение относится к биохимии. Описан некодирующий ДНК конструкт для иммунномодуляции, содержащий мотив последовательности N1N2CGN3N4, где N представляет собой нуклеотид, выбранный из группы, состоящей из С, G, А и Т, а С представляет дезоксицитидин, G представляет дезоксигуанозин, А представляет дезоксиаденозин, и Т представляет дезокситимидин, и, по меньшей мере, два из пяти терминальных нуклеотидов, расположенных на 5′- и/или 3′-конце ДНК конструкта, представлены в L-конфигурации, при этом в мотиве последовательности N1N2CGN3N4 отсутствуют нуклеотиды в L-конфигурации.

Группа изобретений относится к области биотехнологии, в частности к миРНК и ее применениям для лечения легочного фиброза и рака легких. миРНК имеет полную длину от 17 до 23 нуклеотидов и нацелена на последовательность, содержащую от 17 до 23 идущих подряд оснований, выбранных из группы, состоящей из оснований в положениях с 1285 по 1318, оснований в положениях с 1398 по 1418, оснований в положениях с 1434 по 1463, оснований в положениях с 1548 по 1579, оснований в положениях с 1608 по 1628, оснований в положениях с 1700 по 1726, оснований в положениях с 1778 по 1798, оснований в положениях с 1806 по 1826 и оснований в положениях с 1887 по 1907 последовательности SEQ ID NO: 1, для использования в эффективном ингибировании и подавлении экспрессии гена TGF-β1, при гибридизации.

Изобретение относится к области биохимии. Заявлен набор дифференцирующих олигонуклеотидов для анализа полиморфизма в генах АВ0, HLA-DQA1, AMEL, DARC, NAT2 с помощью технологии гидрогелевых ДНК-микрочипов (биочипов).

Штаммы spnk // 2580015
Изобретения относятся к области молекулярной генетики и касаются способов преобразования продуцирующего спиносад штамма Saccharopolyspora spinosa в штамм, продуцирующий предшественника спинеторама (варианты), и генетически модифицированной клетки-хозяина Saccharopolyspora spinosa.

Изобретение относится к области биохимии, в частности к способу борьбы с самосевными растениями сои, содержащими арилоксиалканоат диоксигеназу (AAD-12) на поле, включающем однодольные растения.

Изобретение относится к области биотехнологии и генной инженерии и представляет собой способ получения генетически модифицированных древесных растений, включающий: а) получение и подготовку к инокуляции растительных эксплантов штамма А.

Изобретение относится к области биохимии, в частности к трансгенному растению, которое имеет устойчивость к кукурузному корневому жуку (Diabrotica spp.), содержащему ДНК, кодирующую белок Cry34Ab, ДНК, кодирующую белок Cry35Ab, и ДНК, кодирующую белок Cry6Aa, его семени и клетке, а также к способу замедления развития устойчивости к белкам Cry34Ab, Cry35Ab и Cry6Aa у кукурузного корневого жука с его использованием.

Изобретение относится к области биохимии, в частности к трансгенному растению, которое демонстрирует увеличенную биомассу по сравнению с аналогом дикого типа или нетрансформированным растением, содержащему трансген глутамин-фенилпируват-трансаминазы и трансген глутаминсинтетазы, где каждый GPT трансген и GS трансген операбельно связан с растительным промотором, а также к семени для его получения.

Изобретение относится к области биохимии, в частности к трансгенному растению, которое имеет устойчивость к кукурузному корневому жуку (Diabrotica spp.), содержащему ДНК, кодирующую белок Cry34Ab1, ДНК, кодирующую белок Cry35Ab1, и ДНК, кодирующую белок Cry3Аа, его семени и клетке, а также к способу замедления развития устойчивости к белкам Cry34Ab1, Cry35Ab1 и Cry3Aa у кукурузного корневого жука с его использованием.

Изобретение относится к области биохимии, в частности к трансгенному растению, которое обладает устойчивостью к насекомым-вредителям кукурузным мотылькам, содержащее ДНК, кодирующую белок Cry1Fa, ДНК, кодирующую второй белок, выбираемый из группы, состоящей из Cry2Aa и Cry1I, а также к его семени.

Изобретение относится к области биохимии, в частности к трансгенному растению, которое имеет устойчивость к кукурузному корневому жуку (Diabrotica spp.), содержащему ДНК, кодирующую белок Cry3Aa, и ДНК, кодирующую белок Cry6Aa, его семени и клетке, а также к способу замедления развития устойчивости к белкам Cry3Aa и Cry6Aa у кукурузного корневого жука с его использованием.

Изобретение относится к области биохимии, в частности к трансгенному растению, которое устойчиво к насекомым-вредителям: кукурузной листовой совке и европейскому кукурузному мотыльку, и содержит ДНК, кодирующую инсектицидный белок Cry1Be, и ДНК, кодирующую инсектицидный белок Cry1Fa, а также к его семени.

Изобретение относится к биотехнологии и представляет собой трансгенное растение, которое является устойчивым к насекомому кукурузной листовой совке, содержащее ДНК, кодирующую обладающий инсектицидным действием белок Vip3Ab, состоящий из SEQ ID NO: 1, и ДНК, кодирующую обладающий инсектицидным действием белок Cry1Ca, состоящий из SEQ ID NO: 2.

Изобретение относится к области биохимии, в частности к трансгенному растению для получения гаплоидного потомства. Также раскрыта выделенная экспрессирующая нуклеотидная конструкция, содержащая промотор, функционально соединенный с полинуклеотидом, кодирующем полипептид, где указанный полипептид содержит гетерологичную аминокислотную последовательность из по меньшей мере 5 аминокислот, соединенную с хвостовым доменом гистона, соединенным с N-концом белка, содержащего домен гистоновой складки CENH3, где гетерологичная аминокислотная последовательность гетерологична домену гистоновой складки CENH3, или хвостовой домен гистона, соединенный с N-концом белка, содержащего домен гистоновой складки CENH3, где хвостовой домен гистона гетерологичен домену гистоновой складки CENH3.

Изобретение относится к области биохимии, в частности к способу борьбы с однодольными самосевными растениями, содержащими AAD-1 (арилоксиалканоат диоксигеназы), на поле, содержащем двудольные растения, где указанные самосевные растения содержат ген AAD-1. При этом указанный способ включает нанесение гербицида, выбранного из группы, состоящей из циклогександиона и имидазолинона, на вышеуказанные самосевные растения, где указанные самосевные растения являются восприимчивыми к указанному гербициду, и указанные двудольные растения являются толерантными к указанному гербициду. Изобретение позволяет эффективно бороться с однодольными самосевными растениями, содержащими AAD-1. 6 з.п. ф-лы, 7 табл., 6 пр.
Наверх