Триплетный антиген treponema pallidum



Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum
Триплетный антиген treponema pallidum

 


Владельцы патента RU 2588656:

ОРТО-КЛИНИКАЛ ДАЙЭГНОСТИКС, ИНК. (US)

Изобретение относится к биохимии. Описана конструкция триплетного антигена Treponema pallidum, которая включает три антигена к Treponema pallidum (TP15, TP17 и TP47), а также лидерную последовательность из десяти аминокислот (метка 261) и медь-цинк содержащую супероксиддисмутазу (hSOD) человека. Данная конструкция оптимизирована для диагностики сифилитической инфекции in vitro. Также описаны плазмиды, содержащие ДНК, кодирующую триплетный антиген, клетки-хозяева, способы получения, способы обнаружения и наборы. Изобретение расширяет арсенал средств и методов для определения сифилиса. 10 н. и 35 з.п. ф-лы, 19 ил., 8 табл., 4 пр.

 

ПЕРЕКРЕСТНЫЕ ССЫЛКИ НА СМЕЖНЫЕ ЗАЯВКИ

Настоящая заявка испрашивает преимущество по предварительной заявке на патент США № 61/432570, поданной 13 января 2011 г.

ИСПОЛЬЗОВАНИЕ В ДАННОМ ИССЛЕДОВАНИИ ФЕДЕРАЛЬНОГО ФИНАНСИРОВАНИЯ

Не применимо.

ОБЛАСТЬ ПРИМЕНЕНИЯ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к области рекомбинантных антигенов, и в частности к конструкции триплетного антигена Treponema pallidum, и его применению в иммунологических анализах для определения сифилиса.

ПРЕДПОСЫЛКИ СОЗДАНИЯ ИЗОБРЕТЕНИЯ

За последние полвека благодаря эффективным схемам лечения антибиотиками сифилис стал сравнительно редким заболеванием в США, при этом в 2003 г. было диагностировано менее 7100 первичных и вторичных случаев. Однако последние данные показывают, что число регистрируемых случаев в некоторых группах населения снова растет, и в течение десятилетий наблюдались периодические вспышки эпидемий сифилиса. Число новых случаев заболевания сифилисом в мире в 1995 г. по оценкам достигло 12 млн. в год. Без лечения сифилис может развиваться от первичных поражений (шанкры) до диссеминированных, хронических инфекций, включая вторичные, латентные и третичные формы.

Поскольку сифилитическая инфекция у людей проявляется в широком диапазоне различных симптомов, для точной постановки диагноза инфекции часто требуются лабораторные тесты. Из-за невозможности культивировать патогенный микроорганизм, Treponema pallidum (T. pallidum) (TP), in vitro существует потребность в разработке и оптимизации способов для определения T. pallidum in vitro в различных клинических образцах [Morse, Salud Publica Mex 5 (Suppl 45): 698-708, 2003 г.]. Хотя на рынке доступны твердофазные иммуноферментные анализы (ИФА) для Treponema, они демонстрируют разную эффективность на разных стадиях заболевания [Schmidt et al., J Clin Microbiol 38: 1279-1282 (2000 г.)]. Было разработано несколько вариантов ИФА на основе цельноклеточного лизата, которые обеспечивали чувствительность от 93,3% до 100% и специфичность от 95,5% до 99,8% [Castro et al., J Clin Microbiol 41: 250-253 (2003 г.)].

В последнее время у пациентов, страдающих сифилисом, а также у младенцев с врожденным сифилисом были идентифицированы несколько иммунодоминантных и предположительно патоген-специфичных мембранных липопротеинов T. pallidum. У данных пациентов и младенцев вырабатывались антиген-специфичные антитела, которые можно было обнаружить иммуноблоттингом и иммуноферментным анализом. Следовательно, в современных способах обнаружения в тестах ИФА с Treponema применяют рекомбинантные антигены, главным образом интегрированные мембранные белки 47 кДа, 17 кДа и 15 кДа (TP47, TP17 и TP15 соответственно). Хотя TP47 был идентифицирован самым первым, а также присутствует в наибольших количествах и является высоко иммуногенным [Norgard et al., Infect Immun 54: 500-506 (1986 г.)], идентифицированные позже TP15 и TP17, которые присутствуют в меньших количествах, также являются сильно иммуногенными [Purcell et al., Infect Immun 57: 3708-3714 (1989 г.); Akins et al., Infect Immun 61: 1202-1210 (1993 г.)].

В условиях роста регистрируемых случаев сифилиса и периодических эпидемий, а также с учетом степени тяжести заболевания сохраняется потребность в чувствительных и специфичных методах иммуноанализа для обнаружения Treponema pallidum.

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

В данных целях настоящее изобретение представляет рекомбинантную плазмиду, кодирующую триплетный антиген Treponema pallidum. Плазмида представляет собой нуклеиновую кислоту, кодирующую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 и SEQ ID NO:12.

Настоящее изобретение дополнительно представляет рекомбинантную плазмиду, кодирующую триплетный антиген Treponema pallidum и выбранную из группы, состоящей из: плазмиды, обозначенной p261nS-TP17-15-47 и депонированной в Американской коллекции типовых культур (ATCC) с № доступа ATCC PTA-11590 12 января 2011 г.; плазмиды, обозначенной p261nS-TP47-17-15 и депонированной в Американской коллекции типовых культур с № доступа ATCC PTA-11589 12 января 2011 г.; плазмиды, обозначенной p261nS-TP17-47-15; плазмиды, обозначенной p261nS-TP47-15-17; плазмиды, обозначенной p261nS-TP15-17-47; и плазмиды, обозначенной p261nS-TP15-47-17.

Также представлены данные о векторах, клетках-хозяевах и способы получения триплетного антигена с использованием клеток-хозяев.

Кроме того, настоящее изобретение представляет триплетный антиген Treponema pallidum с аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 и SEQ ID NO:12. Также дополнительно представлен способ обнаружения присутствия антител Treponema pallidum в образце, в котором используется триплетный антиген Treponema pallidum, а также наборы для такого обнаружения.

Дополнительные особенности и преимущества настоящего изобретения будут очевидны из следующего описания при рассмотрении в совокупности с приложенными фигурами.

КРАТКОЕ ОПИСАНИЕ ФИГУР

На фиг. 1 представлена схема реакции при проведении теста VITROS® Syphilis TPA.

На фиг. 2 представлена карта плазмиды pUC57-TP15.

На фиг. 3 представлена карта плазмиды pUC57-TP17.

На фиг. 4 представлена карта плазмиды pUC57-TP47.

На фиг. 5 представлена карта плазмиды pUC57-hSOD.

На фиг. 6 представлена конструкция TP для клонирования в pB10G.

На фиг. 7 представлена конструкция hSOD для клонирования в плазмиду триплета pB10G.

На фиг. 8 представлена карта плазмиды pB10G.

На фиг. 9 представлена карта плазмиды pB10G-TP(1).

На фиг. 10 представлена карта плазмиды pB10G-TP(2).

На фиг. 11 представлена карта плазмиды pB10G-TP(3).

На фиг. 12 представлена конструкция TP(1) для клонирования в pB10G-TP(2).

На фиг. 13 представлена карта плазмиды pB10G-TP(1-2).

На фиг. 14 представлена конструкция TP(3) для клонирования в pB10G-TP(1-2).

На фиг. 15 представлена карта плазмиды pB10G-TP(1-2-3).

На фиг. 16 представлена карта плазмиды pB10G-TP(1-2-3) с уникальным сайтом рестрикционного фермента.

На фиг. 17 представлена карта плазмиды p261nS-TP(1-2-3).

На фиг. 18 представлен прямой формат анализа в соответствии с настоящим изобретением.

На фиг. 19 представлен непрямой формат анализа в соответствии с настоящим изобретением.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

В процедуре анализа (способ обнаружения) настоящего изобретения используются рекомбинантные антигены внешних мембранных белков Treponema pallidum (TP) (возбудитель сифилиса) для обнаружения антител анти-IgG, анти-IgM и анти-IgA в образце пациента. Рассматриваемые рекомбинантные белковые антигены представляют собой антиген с молекулярной массой 15 килодальтон (TP15), антиген с молекулярной массой 17 килодальтон (TP17) и антиген с молекулярной массой 47 килодальтон (TP47). Была разработана слитая конструкция рекомбинантного антигена, которая содержит три рассматриваемых антигена, а также человеческую медь-цинк супероксиддисмутазу (hSOD). Кроме последовательностей антигена Treponema pallidum и hSOD на N-конце слитой конструкции антигена присутствует метка из 10 аминокислот («последовательность 261»), чтобы была возможность проводить определение с помощью вестерн-блоттинга и ИФА, а также при необходимости обеспечить возможность аффинной очистки. При анализе в соответствии с настоящим изобретением используется данная слитая конструкция рекомбинантного антигена.

В одном варианте осуществления для анализа используется тест VITROS® Syphilis TPA, и анализ проводится с использованием иммунодиагностической системы VITROS® ECi/ECiQ, иммунодиагностической системы VITROS® 3600 или интегрированной системы VITROS® 5600 с применением технологии Intellicheck®. Каждый из данных анализаторов доступен в продаже от компании Ortho-Clinical Diagnostics, Inc., 100 Indigo Creek Drive, Rochester, NY, 14626. Используется методика количественного иммуноанализа, которая включает взаимодействие антител IgG, IgM или IgA, присутствующих в образце, с биотинилированным рекомбинантным антигеном TP и конъюгатом рекомбинантного антигена ТР, меченным пероксидазой хрена (HRP). Комплекс антитело-антиген фиксируется стрептавидином на лунках (лунки SAC). Несвязанные материалы удаляются промыванием. Связанный HRP-конъюгат измеряют по люминесцентной реакции. В лунки добавляют реагент, содержащий люминогенный субстрат (производное люминола и соль надкислоты), и переносчик электронов. HRP в связанном конъюгате катализирует окисление производного люминола, вызывая свечение. Переносчик электронов (замещенный ацетанилид) увеличивает интенсивность испускаемого света и делает свечение более продолжительным. Световые сигналы считывают системой анализатора. Концентрация связанного HRP-конъюгата прямо пропорциональна концентрации присутствующих антител анти-ТР. Схема данной реакции представлена на фиг. 1, где 10 - лунка, покрытая стрептавидином, 12 - биотинилированный антиген ТР, 14 - антитела к антигенам ТР, присутствующим в образце, 16 - антиген ТР, меченный HRP, 18 - сигнальный реагент с усилителем, и 20 - люминесценция. В составе аналитического биотинового реагента присутствует супероксиддисмутаза для блокирования связывания антител анти-SOD, которые могут присутствовать в образце, взятом у пациента. Это позволяет исключить образование ложных реакционных сигналов.

Настоящее изобретение представляет рекомбинантную плазмиду, кодирующую триплетный антиген Treponema pallidum. Плазмида представляет собой нуклеиновую кислоту, кодирующую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 и SEQ ID NO:12.

В одном варианте осуществления плазмида обозначается p261nS-TP17-15-47 и депонирована в Американской коллекции типовых культур (ATCC) с № доступа ATCC PTA-11590. Плазмида p261nS-TP17-15-47 включает нуклеиновую кислоту с нуклеотидной последовательностью, представленной в SEQ ID NO:3, кодирующей конструкцию триплетного антигена с аминокислотной последовательностью, представленной в SEQ ID NO:9. В данном конкретном варианте осуществления аминокислоты 5-14 кодируют метку 261, аминокислоты 17-150 кодируют TP17, аминокислоты 155-277 кодируют TP15, аминокислоты 282-695 кодируют TP47 и аминокислоты 697-849 кодируют hSOD.

В другом варианте осуществления плазмида обозначается p261nS-ТР47-17-15 и депонирована в Американской коллекции типовых культур с № доступа ATCC PTA-11589. Плазмида p261nS-ТР47-17-15 включает нуклеиновую кислоту с нуклеотидной последовательностью, представленной в SEQ ID NO:6, кодирующей конструкцию триплетного антигена с аминокислотной последовательностью, представленной в SEQ ID NO:12. В данном конкретном варианте осуществления аминокислоты 5-14 кодируют метку 261, аминокислоты 17-430 кодируют TP47, аминокислоты 435-568 кодируют TP17, аминокислоты 573-695 кодируют TP15 и аминокислоты 697-849 кодируют hSOD.

В дополнительном варианте осуществления плазмида обозначается p261nS-TP17-47-15. Плазмида p261nS-TP17-47-15 включает нуклеиновую кислоту с нуклеотидной последовательностью, представленной в SEQ ID NO:4, кодирующей конструкцию триплетного антигена с аминокислотной последовательностью, представленной в SEQ ID NO:10. В данном конкретном варианте осуществления аминокислоты 5-14 кодируют метку 261, аминокислоты 17-150 кодируют TP17, аминокислоты 155-568 кодируют TP47, аминокислоты 571-693 кодируют TP15 и аминокислоты 695-847 кодируют hSOD.

В еще одном варианте осуществления плазмида обозначается p261nS-TP47-15-17. Плазмида p261nS-ТР47-15-17 включает нуклеиновую кислоту с нуклеотидной последовательностью, представленной в SEQ ID NO:5, кодирующей конструкцию триплетного антигена с аминокислотной последовательностью, представленной в SEQ ID NO:11. В данном конкретном варианте осуществления аминокислоты 5-14 кодируют метку 261, аминокислоты 17-430 кодируют TP47, аминокислоты 435-557 кодируют TP15, аминокислоты 560-693 кодируют TP17 и аминокислоты 695-847 кодируют hSOD.

В дополнительном варианте осуществления плазмида обозначается p261nS-TP15-17-47. Плазмида p261nS-ТР15-17-47 включает нуклеиновую кислоту с нуклеотидной последовательностью, представленной в SEQ ID NO:1, кодирующей конструкцию триплетного антигена с аминокислотной последовательностью, представленной в SEQ ID NO:7. В данном конкретном варианте осуществления аминокислоты 5-14 кодируют метку 261, аминокислоты 17-139 кодируют TP15, аминокислоты 143-276 кодируют TP17, аминокислоты 281-694 кодируют TP47 и аминокислоты 696-848 кодируют hSOD.

В другом дополнительном варианте осуществления плазмида обозначается p261nS-TP15-47-17. Плазмида p261nS-ТР15-47-17 включает нуклеиновую кислоту с нуклеотидной последовательностью, представленной в SEQ ID NO:2, кодирующей конструкцию триплетного антигена с аминокислотной последовательностью, представленной в SEQ ID NO:8. В данном конкретном варианте осуществления аминокислоты 5-14 кодируют метку 261, аминокислоты 17-139 кодируют TP15, аминокислоты 143-556 кодируют TP47, аминокислоты 559-692 кодируют TP17 и аминокислоты 694-846 кодируют hSOD.

ATCC размещена по адресу 10801 University Boulevard, Manassas, Virginia 20110-2209 USA, и каждая из представленных выше депонированных плазмид была приготовлена 12 января 2011 г. в соответствии с Будапештским договором о международном признании депонирования микроорганизмов для целей патентной процедуры («Будапештский договор»).

Каждая конструкция триплетного антигена Treponema pallidum включает три антигена Treponema pallidum (TP15, TP17 и TP47). Хотя каждая из них образуется своей аминокислотной последовательностью, а также нуклеотидной последовательностью, специалистам в данной области должно быть очевидно, что добавления, делеции и/или замещения нуклеотидов, такие, которые не влияют на трансляцию молекулы ДНК, входят в объем конкретной нуклеотидной последовательности (т.е. кодируемая аминокислотная последовательность при этом остается неизменной). Такие добавления, делеции и/или замещения могут быть, например, результатом точечных мутаций, проводимых в соответствии со способами, известными специалистам в данной области. Можно также проводить замены нуклеотида, который меняет кодируемую при этом аминокислотную последовательность, где замещенная аминокислота представляет собой консервативную замену или не меняет гомологии аминокислот. Можно также производить незначительные добавления, делеции и/или замещения нуклеотидов, которые не меняют функцию полученного триплета (т.е. его способность обнаруживать антитела анти-TP15, анти-TP17 и/или анти-TP47).

Добавления, делеции и/или замещения аминокислот, которые не сводят к нулю способность полученного триплета обнаруживать антитела анти-TP15, анти-TP17 и/или анти-TP47, таким образом, входят в объем конкретной аминокислотной последовательности. Такие добавления, делеции и/или замещения могут быть, например, следствием точечных мутаций в ДНК, кодирующей аминокислотную последовательность, например, таких точечных мутаций, которые проводятся в соответствии со способами, известными специалистам в данной области. Замены аминокислот могут быть консервативными. Два аминокислотных остатка рассматриваются в качестве консервативных замен друг друга, например, если два остатка относятся к одному типу. С данной точки зрения пролин, аланин, глицин, серин и треонин, все из которых являются нейтральными, слабо гидрофобными остатками, относятся к одному типу. Глутамин, глутаминовая кислота, аспарагин и аспарагиновая кислота, все из которых являются кислыми, гидрофильными остатками, относятся к одному типу. Другой тип остатка представляет собой основной, гидрофильный аминокислотный остаток, который включает гистидин, лизин и аргинин. Лейцин, изолейцин, валин и метионин, все из которых являются гидрофобными, алифатическими аминокислотными остатками, образуют еще один тип остатков. Еще один тип остатков состоит из фенилаланина, тирозина и триптофана, все из которых являются гидрофобными, ароматическими остатками. Дополнительное описание концепции консервативных замещений представлено в работах French и Robson [J Molecular Evolution 19: 171-175 (1983 г.)], Taylor [J Theor Biol 119: 205-218 (1986 г.)], а также Bordo и Argos [J Mol Biol 217: 721-729 (1991 г.)].

Хотя в данном случае предпочтительная векторная система для нуклеиновой кислоты, кодирующей конструкцию триплетного антигена, представляет собой плазмидный вектор, могут также использоваться другие векторные системы. Более того, хотя в данном случае предпочтительная клетка-хозяин для экспрессии конструкции триплетного антигена представляет собой бактериальную клетку-хозяина Escherichia coli, для экспрессии конструкции триплетного антигена может использоваться любая подходящая клетка-хозяин и/или векторная система. Можно применять другие подходящие бактериальные клетки-хозяева, дрожжевые клетки-хозяева (например, Saccharomyces cerevisiae), а также клетки-хозяева млекопитающих (например, клетки Hela, клетки Cv-1, клетки COS) и насекомых (например, клеточные линии Drosophila).

Методики введения молекул нуклеиновой кислоты в клетки-хозяева могут опираться на применение векторов экспрессии, которые содержат молекулы нуклеиновой кислоты. Данные векторы экспрессии (например, плазмиды и вирусы; причем вирусы включают бактериофаги) могут затем применяться для введения молекул нуклеиновой кислоты в подходящие клетки-хозяева. Например, ДНК, кодирующая триплетный антиген, может вводиться в ядро клетки-хозяина или трансформироваться в клетку-хозяина с помощью подходящего вектора, или же мРНК, кодирующая триплетный антиген, может вводиться непосредственно в клетку-хозяина, чтобы обеспечить экспрессию триплетного антигена в клетке-хозяине.

Специалистам в данной области известны различные способы введения молекул нуклеиновых кислот в клетки-хозяева. Один способ представляет собой микроинъекцию, при которой ДНК вводят непосредственно в ядро клеток через тонкие стеклянные иголки (или РНК вводят непосредственно в цитоплазму клеток). В альтернативном варианте осуществления ДНК можно инкубировать с инертным углеводным полимером (декстран), с которым связана положительно заряженная химическая группа (DEAE, диэтиламиноэтил). ДНК связывается с DEAE-декстраном за счет своих отрицательно заряженных фосфатных групп. Данные крупные частицы, содержащие ДНК, фиксируются на поверхности клеток, которые предположительно захватывают их в ходе процесса, называемого эндоцитозом. Части ДНК удается избежать распада в цитоплазме клетки и попасть в ядро, где она может транскрибироваться в РНК подобно любому другому гену в клетке. В другом способе клетки эффективно захватывают ДНК в форме осадка с фосфатом кальция. В ходе электропорации клетки помещают в раствор, содержащий ДНК, и подвергают воздействию короткого электрического импульса, что приводит к кратковременному открытию отверстий в их мембранах. ДНК проходит через отверстия непосредственно в цитоплазму, минуя эндоцитозные везикулы, посредством которых она попадает в клетку при использовании DEAE-декстрана и фосфата кальция (прохождение данных везикул может иногда приводить к уничтожению или разрушению ДНК). ДНК также может включаться в искусственные липидные везикулы, липосомы, которые закрепляются на клеточной мембране и доставляют свое содержимое непосредственно в цитоплазму. В рамках еще более прямого подхода с использованием, главным образом, клеток и тканей растений ДНК абсорбируется на поверхности микроснарядов из вольфрама и доставляется в клетки с помощью устройства, напоминающего ружье.

Дополнительные способы введения молекул нуклеиновой кислоты в клетки предусматривают применение вирусных векторов. Поскольку развитие вирусов зависит от возможности доставки вирусного генома в клетки, для этой цели у вирусов была выработана продуманная и эффективная система способов. Один такой вирус, широко применяемый при продукции белка, представляет собой вирус насекомых, бакуловирус. Бакуловирус привлек внимание исследователей, поскольку в процессе инфицирования он вырабатывает впечатляющие уровни одного из своих структурных белков (белка оболочки). Если такой вирусный ген будет замещен чуждым геном, он тоже будет отличаться высокими уровнями продукции. Бакуловирус, как и осповакцина, также является очень большим, и, следовательно, чуждые гены необходимо вносить в вирусный геном с помощью рекомбинантных технологий. Для экспрессии чуждого гена в бакуловирусе рассматриваемый ген клонируют на месте гена белка оболочки вируса в плазмиде, несущей небольшую часть вирусного генома. Рекомбинантная плазмида котрансфектируется в клетки насекомых вместе с ДНК бакуловируса дикого типа. При низкой частоте плазмида и вирусные ДНК рекомбинируются посредством гомологичных последовательностей, что приводит к вставке чуждого гена в вирусный геном. Образуются вирусные бляшки, причем бляшки с рекомбинантным вирусом отличаются внешне, поскольку не содержат белок оболочки. Бляшки с рекомбинантным вирусом отбирают и культивируют. Данный вирусный материал затем применяют для инфицирования свежей культуры клеток насекомых, что приводит к высокому уровню экспрессии чуждого белка. Обзор по векторам бакуловируса представлен в работе Miller [Bioessays 11: 91-95 (1989 г.)]. Для трансформации клеток млекопитающих также применяют различные вирусные векторы, такие как бактериофаг, вирус осповакцины, аденовирус и ретровирус.

Как указано выше, некоторые из данных способов трансформации клетки требуют применения промежуточного плазмидного вектора. В патенте США № 4237224, выданном Cohen и Boyer, описано получение экспрессирующих систем в форме рекомбинантных плазмид с использованием расщепления рестрикционным ферментом и сшивания ДНК-лигазой. Затем данные рекомбинантные плазмиды вводят посредством трансформации и реплицируют в моноклеточных культурах, включая прокариотные организмы и эукариотные клетки, выращиваемые в тканевой культуре. Последовательности ДНК клонируют в плазмидный вектор с использованием стандартных процедур клонирования, известных специалистам в данной области, как описано в работе Sambrook et al. [Molecular Cloning: A Laboratory Manual, 2-е изд., Cold Spring Harbor Laboratory Press, Колд-Спринг-Харбор, штат Нью-Йорк (1989 г.)].

Клетки-хозяева, в которые введена нуклеиновая кислота, кодирующая триплетный антиген, можно использовать для продукции (т.е. функциональной экспрессии) триплетного антигена.

Настоящее изобретение дополнительно представляет триплетный антиген Treponema pallidum с аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 и SEQ ID NO:12. В настоящее время предпочтительные варианты осуществления триплетного антигена представляют собой такие варианты, которые представлены последовательностями SEQ ID NO:9 и SEQ ID NO:12. В данных вариантах осуществления часть TP17 триплета предшествует части TP15 триплета, и с помощью данных конструкций достигается более высокая чувствительность к обнаружению антител. Все конструкции включают лидерную последовательность (в настоящее время предпочтительно использовать лидерную последовательность из десяти аминокислот (метка 261), хотя они могут быть замещены другими подходящими лидерными последовательностями). Все конструкции на карбоксильном конце дополнительно включают медь-цинк содержащую супероксиддисмутазу (hSOD) человека, белок с низкой иммуногенностью. Одиннадцать лизиновых остатков в hSOD обеспечивают сайты для связывания биотина и конъюгации HRP, и два цистеиновых остатка мутируют в серин (Cys 4 и Cys 112) для предотвращения межцепной полимеризации белка [Hallewel et al., J Biol Chem 264: 5260-5268 (1989 г.)]. Таким образом, данная конструкция оптимизируется для диагностики сифилитической инфекции in vitro. Могут использоваться и другие подходящие белки с низкой иммуногенностью, которые обеспечивают аналогичные сайты для связывания биотина и конъюгации HRP. В предпочтительной в настоящее время конструкции плазмиды триплетный антиген контролируется промотором T5.

Хотя конкретные детали анализа для обнаружения присутствия антител Treponema pallidum в образце раскрыты ниже, по существу способ включает: приведение образца в контакт с триплетным антигеном Treponema pallidum, составляющим предмет настоящего изобретения, причем антитела Treponema pallidum, присутствующие в образце, связываются с триплетным антигеном Treponema pallidum с образованием комплекса антитело/антиген; и обнаружение комплекса антитело/антиген, чем осуществляется обнаружение присутствия антител Treponema pallidum. Для применения в формате анализа для обнаружения антител к Treponema pallidum триплетный антиген может быть помечен обнаруживаемым маркером. Подходящие маркеры включают, например, ферментативные метки, такие как пероксидаза хрена или щелочная фосфатаза, а также флуоресцентные метки (такие как флуоресцеин, родамин и зеленый флуоресцентный белок).

В формате анализа также могут использоваться биотин/авидин/стрептавидин, чтобы получить триплетный антиген, связанный с твердой фазой. Подходящие твердые фазы включают, например, любые неводные матрицы, с которыми может связываться триплетный антиген. Такие твердые фазы хорошо известны специалистам в области иммуноанализа и включают, например, полистирольные пластинки, полиакриламиды, стекло, полисахариды, поливиниловый спирт и силиконы. В иммуноанализах в качестве твердых фаз применяют предметные стекла, микролунки и микронаконечники.

Формат анализа может включать прямое обнаружение комплекса антитело/антиген (см. фиг. 18), которое может включать: приведение комплекса антитело/антиген в контакт со вторым триплетным антигеном Treponema pallidum, составляющим предмет настоящего изобретения, причем второй триплетный антиген Treponema pallidum помечен обнаруживаемым маркером (представленным как HRP). Второй триплетный антиген Treponema pallidum связывается с антителом, присутствующим в комплексе антитело/антиген, с образованием комплекса антиген/антитело/меченый антиген, который затем обнаруживается, чем осуществляется обнаружение присутствия антител Treponema pallidum в образце.

Формат анализа может включать непрямое обнаружение комплекса антитело/антиген (см. фиг. 19), которое может включать: приведение комплекса антитело/антиген в контакт с меченым антителом к иммуноглобулину человека (показанным как моноклональное мышиное антитело к иммуноглобулину человека). Меченое антитело к иммуноглобулину человека связывается с антителом, присутствующим в комплексе антитело/антиген, с образованием комплекса антиген/антитело/меченое анти-антитело, который затем обнаруживается, чем осуществляется обнаружение присутствия антител Treponema pallidum в образце.

Для всех анализов, составляющих предмет настоящего изобретения, образец может представлять собой любой подходящий образец (например, сыворотку, плазму и ЭДТА или гепариновую плазму), но предпочтительно представляет собой образец сыворотки.

Конструкция триплетного антигена Treponema pallidum, составляющего предмет настоящего изобретения, таким образом, может использоваться в качестве компонента набора для определения антител Treponema pallidum. Предлагается набор, который содержит конструкцию триплетного антигена Treponema pallidum, а также дополнительно конструкцию второго триплетного антигена Treponema pallidum, меченную обнаруживаемым маркером («ферментативный конъюгат», такой как меченный HRP триплетный антиген Treponema pallidum) (см. выше описание маркеров). Набор также может содержать подходящие положительный и/или отрицательный контроли, калибровочные образцы, ферментативные конъюгаты, субстраты для ферментативных конъюгатов (такие как О-фенилендиамин), буферный раствор и промывочный раствор.

Ниже представлена подробная информация о конструкции триплетного антигена и его применении в анализе для обнаружения антител Treponema pallidum в образце пациента.

Синтетические гены. Каждый из генов белка внешней мембраны T. pallidum TP15, TP17 и TP47 синтезировали на основе аминокислотной последовательности P16055 (аминокислоты 19-141), P29722 (аминокислоты 23-156) и P29723 (аминокислоты 21-434) соответственно, опубликованных в центральной базе данных UniProt (http://www.uniprot.org). Ген человеческой медь-цинк содержащей супероксиддисмутазы (hSOD) синтезировали на основе аминокислотной последовательности P00441 (аминокислоты 2-154) кроме мутации двух цистеиновых остатков (аминокислоты 7 и 112) в серин для предотвращения полимеризации. Все четыре синтезированных генетических кодона были оптимизированы для бактериальной экспрессии, и каждый вставляли в сайт EcoR V плазмиды-хозяина pUC57. Полученные плазмиды pUC57-15, pUC57-17, pUC57-45 и pUC57-hSOD представлены на фиг. 2-5 соответственно.

Четыре синтетических гена не содержат стоп-кодонов, и ниже представлено описание всех внутренних сайтов Apa I, BamH I, Bgl II, EcoR I и Hind III, которые использовали в последовательном субклонировании. В четыре синтетических гена включали сайты рестрикционного фермента, содержащие или не содержащие ген-метку (последовательность 261).

Вектор экспрессии и конструкция дублета TP. Каждый из генов TP из pUC57 расщепляли на Bgl II и Apa I (см. фиг. 6, где представлена полученная конструкция ТР) и по отдельности клонировали в сайты BamH I и Apa I ранее сконструированного вектора экспрессии, pB10G (см. фиг. 8), который содержал промотор T5, стартовый сайт ATG и уникальные сайты рестрикции EcoR I, BamH I, Apa I и Hind III. В результате получили три экспрессивных вектора: pB10G-TP15, pB10G-TP17 и pB10G-TP47 (в общем показаны как pB10G-TP(1), pB10G-TP(2) и pB10G-TP(3) на фиг. 9-11 соответственно). Лигирование совместимых концов Bgl II фрагментов генов и концов BamH I на плазмидах позволило удалить сайты рестрикционного фермента Bgl II/BamH I во всех трех конструкциях. Дублет TP получали субклонированием. Для конструирования субклона дублета TP (см. фиг. 13) с помощью реакции ПЦР получали вставку гена ДНК с помощью вектора экспрессии второго антигена в качестве матрицы и пары прямых и обратных праймеров. Прямой праймер распространяется на сайт EcoR I, размещенный в участке промотора T5 вверх от гена TP. Обратный праймер совмещен с концом гена ТР и трансформирует сайт Apa I в сайт Bgl II. Полученный продукт ПЦР затем расщепляли EcoR I/Bgl II (см. фиг. 12, где представлена полученная конструкция TP-1) и клонировали в другой вектор экспрессии антигена, который раскрывался с помощью EcoR I и BamH I. Аналогичным образом лигирование совместимого Bgl II на вставке и BamH I на хозяине позволяло удалять оба сайта рестрикционного фермента.

Конструкция триплета TP. Для получения шести конечных генов слитых триплетов в качестве хозяина использовали четыре дублетных вектора ТР: pB10G-TP17-TP47, pB10G-TP15-TP47, pB10G-TP47-TP15 и pB10G-TP17-TP15, а третий ген ТР добавляли либо к 5'-концу дублета ТР, либо добавляли к 3'-концу дублета TP. Двойной вектор TP(1-2) в общем показан на фиг. 13, и конструкция ТР(3) для вставки в дублетный вектор показана на фиг. 14. Для добавления вставки на 3'-конце с помощью реакции ПЦР получали вставку гена ДНК с помощью вектора экспрессии третьего антигена в качестве матрицы и пары прямых и обратных праймеров. Прямой праймер совмещался с 5'-концом гена ТР и содержал сайт Apa I. Обратный праймер совмещался с 3'-концом гена ТР и содержал сайт Hind III. Полученный продукт ПЦР затем расщепляли Apa I/Hind III и клонировали в дублетный вектор экспрессии, который раскрывали соответствующими рестрикционными ферментами. Триплеты pB10G-TP15-TP17-TP47, pB10G-TP17-TP15-TP47 и pB10G-TP47-TP17-TP15 получали добавлением третьего гена ТР к дублетному 5'-концу, тогда как триплеты pB10G-TP15-TP47-TP17, pB10G-TP47-TP15-TP17 и pB10G-TP17-TP47-TP15 получали добавлением третьего гена ТР к дублетному 3'-концу. Праймеры ПЦР, которые применяли для приготовления дублетов и триплетов, представлены в таблице 4 «Праймеры ПЦР», группа А. Данная триплетная конструкция в целом показана на фиг. 15.

Конструкция триплета TP со слитой SOD. Триплет ТР с С-концевой меткой слитой SOD (в целом показан на фиг. 17) получали посредством «двойной» ПЦР и клонирования. «Двойную ПЦР» проводили для связывания С-концевого ТР3 с SOD (см. фиг. 7, где представлена конструкция SOD) и введения сайтов рестрикционного фермента для клонирования. Первый цикл ПЦР состоял из двух отдельных ПЦР, причем обратный праймер (таблица 4 «Праймеры ПЦР», группа В) в одной ПЦР дополнялся прямым праймером (таблица 4 «Праймеры ПЦР», группа С) в другой ПЦР. Во втором цикле ПЦР два продукта первого цикла ПЦР объединяли и амплифицировали с третьим набором вложенных праймеров (таблица 4 «Праймеры ПЦР», группа D). Прямой праймер соответствовал последовательности ТР3 и содержал уникальный сайт рестрикционного фермента. Обратный праймер соответствовал 3'-концу SOD. Два стоп-кодона и сайт Hind III образовали новую вставку ДНК (см. фиг. 16). Для слияния гена SOD с существующим триплетом T. pallidum новый продукт ПЦР расщепляли и напрямую клонировали в плазмиду триплета pB10G-TP, которая расщеплялась по сконструированному уникальному сайту рестрикции и сайту Hind III с образованием pB10G-TP(1-2-3)-SOD (см. фиг. 17). Используемые в настоящем документе обозначения TP1, TP2 и TP3 соответствуют трем антигенам T. pallidum TP15, TP17 и TP47 в любом порядке. Таким образом, TP1 может представлять собой TP15, TP2 может представлять собой TP17, и TP3 может представлять собой TP47. Другие комбинации включают: TP1 может представлять собой TP15, TP2 может представлять собой TP47, и TP3 может представлять собой TP17; TP1 может представлять собой TP17, TP2 может представлять собой TP15, и TP3 может представлять собой TP47; TP1 может представлять собой TP17, TP2 может представлять собой TP47, и TP3 может представлять собой TP15; TP1 может представлять собой TP47, TP2 может представлять собой TP15, и TP3 может представлять собой TP17; и TP1 может представлять собой TP47, TP2 может представлять собой TP17, и TP3 может представлять собой TP15.

Все амплификации ПЦР проводили с помощью Taq-полимеразы с использованием стандартной последовательности 35 циклов ПЦР: 95°C (15 с), 55°C (20 с), 72°C (30 с). Нуклеотидные последовательности ПЦР-праймеров перечислены в таблице 4. Указано использование каждого праймера для получения конкретных триплетов. Все продукты ПЦР очищали в соответствии с протоколом набора Qiagen для ПЦР. Все рестрикционные ферменты приобретали у New England Biolabs. Плазмиды готовили с использованием наборов Qiagen DNA Miniprep. Все шесть участков, кодирующих триплеты, проходили ДНК-секвенирование (SEQ ID NO:1-6) с последующей трансляцией аминокислотных последовательностей (SEQ ID NO:7-12).

Анализ, составляющий предмет настоящего изобретения, предусматривает измерение антител к трем антигенам T. pallidum - TP15, TP17 и TP47. Анализ проводят на микропланшетах, предварительно покрытых антигеном. Образцы добавляют в лунки титрационного микропланшета и инкубируют. При присутствии специфичных антител T. pallidum IgG/IgM они будут связываться и иммобилизироваться на лунках, предварительно покрытых антигеном. Связанные антитела обнаруживают либо прямым сэндвич-форматом для конъюгированного антигена (см. фиг. 18), либо непрямым форматом по конъюгированному антителу к человеческому IgG и IgM (см. фиг. 19).

В частности, рекомбинантные триплеты ТР в качестве антигенной ловушки пассивно наносили на поверхность лунок планшета ИФА с высоким уровнем связывания. Затем планшет блокировали 1% BSA/ФСБ, чтобы покрыть все несвязанные поверхности лунок. В лунки добавляли сыворотку или плазму инфицированного сифилисом пациента и инкубировали в течение первого инкубационного периода, что позволяло антителам T. pallidum (IgG, IgM и IgA) в образце взаимодействовать с предварительно нанесенными триплетными антигенами. После первой инкубации несвязанные материалы смывали. В случае прямого анализа детектором был конъюгированный с HRP рекомбинантный триплет ТР, и его добавляли в лунки и инкубировали в течение второго инкубационного периода. После второй инкубации несвязанные триплетные конъюгаты смывали. Образованный комплекс антиген-человеческое антитело T. pallidum (IgG/IgM)-антиген измеряли при добавлении раствора субстрата пероксидазы, затем через 30 минут реакцию останавливали и для анализа регистрировали оптическую плотность. При непрямом анализе в качестве детектора выступала смесь конъюгированного с HRP мышиного моноклонального антитела к человеческому IgG и конъюгированного с HRP мышиного моноклонального антитела к человеческому IgM, и ее добавляли в лунки и инкубировали в течение второго инкубационного периода. После второй инкубации несвязанные конъюгаты смывали. Образованный комплекс антитело к человеческому IgG/IgM-человеческое антитело T. pallidum (IgG/IgM)-антиген измеряли при добавлении раствора субстрата пероксидазы, затем через 30 минут реакцию останавливали и для анализа регистрировали оптическую плотность.

Генетически сконструированный рекомбинантный триплет T. pallidum имеет лидерную последовательность из 10 аминокислот (метка 261) на N-конце и от двух до четырех аминокислотных линкеров между каждым антигеном TP. Последовательность метки 261 была получена из фактора роста плаценты человека (PlGF). Человеческую медь-цинк содержащую супероксиддисмутазу (hSOD) включают у С-конца триплетного антигена T. pallidum для образования слитого белка.

hSOD ранее использовали в различных рекомбинантных слитых антигенах для диагностических анализов инфекционных патогенов, таких как ВГС, ВИЧ и т.д. hSOD представляет собой небольшой по размерам эндогенный белок человека с низкой иммуногенностью, который состоит из 153 аминокислот с молекулярной массой приблизительно 16 кДа. 11 остатков лизина в hSOD обеспечивают дополнительный сайт конъюгации для биотинилирования и конъюгации HRP.

ПРИМЕР I

Реагенты, формат и протокол анализа ИФА

Реагенты для анализа:

96-луночный титрационный микропланшет с высоким связыванием (Costar);

покрывающий буферный раствор (10 мМ фосфата, 2 мМ ЭДТА, pH 7,0), блокирующий буферный раствор (1% БСА в ФСБ, pH 7,0), промывающий раствор (ФСБ с 0,05% Tween-20), буферный раствор образца (Blocker Casein в ФСБ с 0,05% Tween-20, Pierce);

образец для ИФА и разбавитель конъюгата: Blocker Casein в ФСБ производства Pierce. До применения к раствору добавляли Tween-20 до конечной концентрации 0,05%. В прямом анализе добавляли лизат hSOD вместе с HRP-конъюгированным триплетом TP;

очищенные рекомбинантные слитые триплеты TP, их последовательности подтверждены секвенированием ДНК (см. SEQ ID NO:1-6). Экспрессию белков проводили в прокариотных клетках E.coli. Чистота белка по результатам ДСН-ПААГ была выше 87%;

конъюгированный с HRP (пероксидаза хрена) рекомбинантный триплет TP. 150 нг/мл, фосфат, pH=7,2, молярность = 50 мМ. Буферный раствор реагента для HRP-конъюгата содержит: H2O, K2HPO4 (безводный), KH2PO4 (безводный), NaCl, БСА (жидкий), KFeCN, ANS, Tween-20, Anti-foam 204, ProClin 950;

конъюгированная с HRP (пероксидаза хрена) мышиная моноклональная анти-261 метка;

конъюгированное с HRP (пероксидаза хрена) мышиное моноклональное антитело к человеческому IgG;

конъюгированное с HRP (пероксидаза хрена) мышиное моноклональное антитело к человеческому IgM;

таблетка субстрата HRP (пероксидаза хрена) (O-фенилендиамин гидрохлорид) и раствор, а также стоп-раствор входят в комплект ингредиентов стандартных продуктов для ИФА, производство Ortho-Clinical Diagnostics;

образцы: сифилис-положительная плазма, сифилис-отрицательная плазма, смешанная панель титрования SeraCare Syphilis (PS C202) и смешанная панель титрования Zeptometrix Syphilis (K-ZMC002).

Формат анализа ИФА представлен на фиг. 18 и 19 (прямой формат анализа и непрямой формат анализа).

Протокол ИФА. Покрытие планшетов. 1) Добавили покрывающий раствор по 100 мкл/лунку, содержащий 2 мкг/мл слитого триплета TP при 25°C в течение 18 часов. 2) Лунки однократно промывали промывным буферным раствором и добавляли 290 мкл/лунку блокирующего буферного раствора в течение 1 ч при 25°C для блокирования. 3) После отсасывания блокирующего буферного раствора планшеты высушивали в течение более 4 часов в инкубаторе с низкой влажностью. 4) До применения планшеты помещали в газонепроницаемый герметичный пакет.

Протокол прямого анализа. Анализ. 1) В каждую лунку добавляли 50 мкл казеинового (ФСБ) разбавителя для образца и 50 мкл образца (или контроля). Планшет инкубировали в течение 30 мин при 37°C с встряхиванием. 2) После 6-кратного промывания промывным раствором в каждую лунку добавляли 100 мкл HRP-конъюгированного слитого триплета TP, разбавленного в казеине (ФСБ). Планшет инкубировали в течение 30 мин при 37°C с встряхиванием. 3) После 6-кратного промывания добавляли 100 мкл субстрата OPD и инкубируют в темноте в течение 30 мин при 25C. 4) Добавляли 25 мкл стоп-раствора и считывали оптическую плотность (ОП) при 492 нм.

Протокол косвенного анализа. Анализ. 1) В каждую лунку добавляли 90 мкл казеинового (ФСБ) разбавителя для образца и 10 мкл образца (или контроля). Планшет инкубировали в течение 15 мин при 37°C с встряхиванием. 2) После 6-кратного промывания промывным раствором в каждую лунку добавляли 100 мкл смеси конъюгата HRP, содержащей HRP-мышиное моноклональное антитело к человеческому IgG и HRP-мышиное моноклональное антитело к человеческому IgM, разбавленные казеином (ФСБ). Планшет инкубировали в течение 15 мин при 37°C с встряхиванием. 3) После 6-кратного промывания добавляли 100 мкл субстрата OPD и инкубируют в темноте в течение 30 мин при 25°C. 4) Добавляли 25 мкл стоп-раствора и считывали оптическую плотность (ОП) при 492 нм.

ПРИМЕР II

Оценка триплетных конструкций

Реакция ИФА. (1) Лунки покрывали последовательным разбавлением шести триплетов TP и затем покрывали 1% БСА в ФСБ. (2) В предварительно покрытые антигеном лунки добавляли 100 мкл HRP-конъюгированной мышиной моноклональной анти-261 метки, разбавленной в казеине (ФСБ), и инкубируют при 37°C в течение 15 минут с встряхиванием. (2) Промывали 6 раз, добавляли 100 мкл раствора субстрата OPD и инкубировали при комнатной температуре в течение 15 минут в темноте. (4) Добавляли 25 мкл стоп-раствора 4 Н серной кислоты и считывали показания при 490 нм.

Результаты, представленные в таблице 1, соответствуют ОП. Предлагаемые концентрации покрытия триплетом TP получены из расчетов для калибровки количества антигена, иммобилизированного на планшете и использованного для покрытия планшета при оценке анализа антител.

Реакция ИФА. (1) Лунки покрывали шестью триплетами ТР в концентрации, указанной в таблице 1, и повторно покрывали 1% БСА в ФСБ. (2) Добавляли 50 мкл казеина (ФСБ) и 50 мкл образцов панели к лункам, предварительно покрытым антигеном, и инкубировали при 37°C в течение 15 минут с встряхиванием. (3) Промывали 6 раз, добавляли 100 мкл HRP-конъюгированных триплетных антигенов ТР и инкубировали при 37°C в течение 15 минут с встряхиванием. HRP-конъюгированный антиген представляет собой антиген, нанесенный на планшеты. (4) Промывали 6 раз, добавляли 100 мкл раствора субстрата OPD и инкубировали при комнатной температуре в течение 15 минут в темноте. (4) Добавляли 25 мкл стоп-раствора 4 Н серной кислоты и считывали показания при 490 нм.

Результаты представлены в таблице 2 в виде значений S/C. S - сигнал ОП, C - отсечение, равное 5-кратной средней ОП, полученной от трех отрицательных контролей.

Реакция ИФА. (1) В лунки, предварительно покрытые антигеном, добавляли 90 мкл казеина и 10 мкл образца панели (2-кратное последовательное разбавление в обычной человеческой плазме) и инкубировали при 37°C в течение 15 минут с встряхиванием. (2) Промывали 6 раз, добавляли 100 мкл смеси конъюгата, содержащей HRP-мышиное моноклональное антитело к человеческому IgG и моноклональное антитело к человеческому IgM, и инкубировали при 37°C в течение 15 минут с встряхиванием. (3) Промывали 6 раз, добавляли 100 мкл раствора субстрата OPD и инкубировали при комнатной температуре в течение 15 минут в темноте. (4) Добавляли 25 мкл стоп-раствора 4 Н серной кислоты и считывали показания при 490 нм.

Представленные в таблице 3 результаты относятся к конечному разбавлению образца панели ZeptoMetrix нормальной человеческой плазмой (1:X, X=), причем разбавление образцов было определено как положительное (сигнал выше отсечения >1). Отсечение равно 5-кратной средней ОП, полученной от трех отрицательных контролей.

ПРИМЕР III

Подробная информация теста VITROS® Syphilis TPA

Принципы теста VITROS® Syphilis TPA с использованием триплетной конструкции TP15-TP17-TP47 соответствуют представленному выше описанию, показанному на фиг. 1. Предлагается набор, который включает пакет реагентов и калибратор. Упаковка с реагентами содержит: 100 лунок с покрытием (трептавидин, бактериальный; связывает ≥2 нг биотина/лунку); 13,1 мл биотинилированного антигенного реагента (биотин-рекомбинантные антигены ТР, 0,15 мкг/мл) в буферном растворе с бычьим гамма-глобулином, альбумином бычьей сыворотки и бактерицидным агентом; и 20,4 мл конъюгатного реагента (HRP-рекомбинантные антигены ТР, 0,15 мкг/мл) в буферном растворе с альбумином бычьей сыворотки и бактерицидным агентом. Калибратор представляет собой калибратор VITROS® Syphilis TPA (плазма, положительная к человеческому сифилитическому IgG, 2,2 мл) с бактерицидным агентом. Для каждого определения в тесте применяют 25 мкл калибратора.

Подходящие образцы для применения в тесте представляют собой сыворотку, гепариновую плазму, плазму ЭДТА и цитратную плазму. Для каждого определения в тесте применяют 25 мкл образца.

В тесте также применяют сигнальный реагент (такой как сигнальный реагент VITROS® Immunodiagnostic Products Signal Reagent), промывной реагент (такой как промывной реагент VITROS® Immunodiagnostic Products Universal Wash Reagent) и материалы для контроля качества (такие как контроли VITROS® Immunodiagnostic Products Syphilis TPA).

Для теста применяют первый 16-минутный инкубационный период и второй 8-минутный инкубационный период, причем время получения первого результата составляет 34 минуты. Анализ выполняют при 37°C.

Результаты автоматически рассчитывают системами VITROS® Immunodiagnostic System и VITROS® Integrated System и представляются в форме «сигнала тестового образца»/«сигнала отсечения (значения отсечения)». Образцы с результатами <0,80 будут помечаться как «отрицательные», образцы с результатами ≥0,80 и <1,20 будут помечаться как «граничные», и образцы с результатами ≥1,20 будут помечаться как «реакционноспособные». Отрицательная реакция означает отсутствие активной или имевшей место в прошлом инфекции Treponema pallidum; граничная реакция показывает, что тест не в состоянии определить факт инфицирования Treponema pallidum, и образец следует протестировать повторно; и реакционноспособные образцы соответствуют активной или имевшей место в прошлом инфекции Treponema pallidum.

ПРИМЕР IV

Показатели эффективности теста VITROS® Syphilis TPA

В таблице 5 представлены результаты оценки исходной чувствительности и специфичности для выборки из 4290 образцов с использованием теста VITROS® Syphilis TPA и представленного на рынке иммуноанализа (ИА 1) антител к Treponema pallidum. Исходный анализ по тесту VITROS® Syphilis TPA обеспечивает исходную специфичность, включая граничные образцы (4015/4016), на уровне 99,98% (точно 95% Cl 99,9-100,0%). Исходная чувствительность, включая граничные образцы (266/274), составляла 97,08% (точно 95% Cl 94,3-98,7%). Один образец (0,025%) в тесте VITROS® Syphilis TPA оказался граничным. В представленном на рынке тесте граничный участок не предусмотрен.

В таблице 6 представлены результаты оценки относительной специфичности и чувствительности после решения проблем неинтерпретируемых образцов. Сюда входят образцы с различиями по классификации относительно представленного на рынке теста (реакционноспособный/отрицательный) (определяемые как «расходящиеся»). Образцы, показавшие расходящиеся или граничные результаты (либо в тесте VITROS®, либо в тесте ИА 1), дополнительно тестировали для определения относительной чувствительности и специфичности. Итого 9 расходящихся и граничных образцов дополнительно тестировали, сначала дважды повторив тест VITROS® Syphilis TPA. Итого 9 расходящихся и граничных образцов оставались расходящимися при ИА 1 после повторного тестирования в VITROS® Syphilis TPA. 9 образцов также тестировали, проводя до 4 дополнительных представленных на рынке анализов для антител к Treponema pallidum. Затем срединный результат VITROS® Syphilis TPA сопоставляли с согласованной классификацией других 4 представленных на рынке анализов. При использовании данного алгоритма 8 образцов были отнесены к отрицательным на антитела к сифилису, и один образец остался граничным по данным теста VITROS® Syphilis TPA. После разрешения проблем с расходящимися результатами рассчитывали относительную специфичность теста VITROS® Syphilis TPA по сравнению с тестом ИА 1 (4023/4024), которая составила 99,98% (точно Cl 99,9-100,0%), и относительную чувствительность (266/266), которая составила 100% (точно Cl 98,6-100,0%).

Как представлено в таблице 7, 149 образцов, содержащих потенциальные перекрестно взаимодействующие подгруппы, тестировали VITROS® Syphilis TPA и доступным в продаже тестом (ИФА 1). Подгруппы включали: IgG и IgM против вируса гепатита А, IgG и IgM против вируса гепатита B, IgG и IgM против вируса гепатита C, IgG и IgM против вируса Эпштейна - Барр, антитела IgG и IgM к вирусу герпеса, антитела IgG и IgM к ВИЧ 1/2, IgG и IgM против цитомегаловируса, IgG и IgM против краснухи, антиядерные антитела при СКВ, IgG и IgM к инфекциям Borrelia burgdorferi (европейские и американские штаммы) и Toxoplasma gondii, гетерофильные/HAMA-антитела и ревматоидный фактор. Специфичность (137/137) составила 100,0% (95% Cl 97,3-100,0%), и чувствительность (12/12) составила 100,0% (95% Cl 73,5%-100,0%). Расходящиеся образцы не регистрировали, и все результаты находились в соответствии с ожидаемыми клиническими показателями доступного в продаже теста. Таким образом, ни один из образцов не демонстрировал перекрестного взаимодействия с VITROS® Syphilis TPA, что приводило бы к неверной классификации результатов.

Оценивали точность иммунодиагностической системы VITROS® ECi/ECiQ Immunodiagnostic System. Два дубликата каждого из 4 пулов образцов пациента и 4 контрольных образцов тестировали 2 раза в день по меньшей мере 20 различных суток. Эксперимент проводили с использованием 2 партий реагентов для двух различных систем. Также оценивали точность по VITROS® 3600 Immunodiagnostic System и VITROS® 5600 Integrated System. Два дубликата каждого из 4 пулов образцов пациента и 4 контрольных образцов тестировали 2 раза в день по меньшей мере 20 различных суток. Эксперимент проводили с использованием 1 партии реагентов для каждой системы. Результаты показывали точность на отсечении до высоких положительных показателей в среднем 1,6 % (диапазон 0,9-3,2%) в одном измерении, 4,8% (диапазон 2,7-9,0%) в пределах калибровки и 4,6% (диапазон 2,1-9,0%) в лаборатории. Таким образом, тест VITROS® Syphilis TPA обеспечивает высокую точность для граничного и реакционноспособного диапазонов для всех систем VITROS®.

В таблице 8 представлены результаты оценки интерференции теста VITROS® Syphilis TPA. Из тестированных соединений ни одно не интерферировали с клинической интерпретацией теста при указанных концентрациях.

Также проводили оценку теста VITROS® Syphilis TPA для двух наборов специализированных образцов от CAP и NEQAS и двух доступных в продаже панелей характеристик (Zeptometrix и BBI-Seracare). Было получено 100%-ное согласие для таких специализированных образцов и панелей характеристик.

Также проводили оценку типов образцов в тесте VITROS® Syphilis TPA. Отбирали пять образцов здоровых доноров в виде сыворотки (SST, с активатором сгустков и в стеклянных пробирках для сгустков), в виде гепариновой плазмы (литий и натрий), плазмы ЭДТА и цитратной плазмы. У пяти других доноров отбирали 50 мл цельной крови. Образцы смешивали с реакционноспособной сифилитической плазмой и распределяли по таким же пробиркам, чтобы моделировать доноров с положительной реакцией на сифилис. Оценивали расхождение между видами образцов. Значительные расхождения между видами образцов по сравнению с сывороткой не обнаружены. Для цитратных образцов выделение по сравнению с сывороткой было ниже из-за разбавительного эффекта цитрата. Исследование стабильности с использованием данных образцов показало, что образцы могут храниться в течение 7 суток при 2-8°C и 4 недель при -20°C без существенного ухудшения результатов дозы или изменения клинической классификации.

С учетом всех показателей эффективности можно отметить, что тест VITROS® Syphilis TPA сочетает хорошие аналитические и клинические показатели с простотой в работе при проведении быстрого автоматизированного непрерывного случайного иммуноанализа.

Хотя были представлены конкретные варианты осуществления настоящего изобретения, очевидно, следует понимать, что оно не ограничено только ими, так как специалисты в данной области могут вносить изменения, в частности, с учетом описанных выше инструкций. Возможны разумные изменения и модификации в рамках объема описанного выше раскрытия настоящего изобретения, которые не противоречат сущности настоящего изобретения.

Таблица 1
Калибровка шести покрытых триплетных антигенов ТР на планшете
Триплет ТР на планшете [мкг/мл] Сигнал ОП по HRP анти-261 (2 нг/мл) Предлагаемое покрытие триплетом TP [мкг/мл]
4,00 2,00 1,00 0,50 0,25 0,13
TP15-17-47-SOD изб. 3,006 2,372 1,490 0,914 0,613 1,00
TP15-47-17-SOD изб. 2,916 2,106 1,356 0,843 0,566 1,20
TP17-15-47-SOD изб. 3,144 3,193 2,508 1,494 0,891 0,50
TP17-47-15-SOD изб. 1,454 0,914 0,580 0,346 0,263 2,80
TP47-15-17-SOD изб. 3,310 2,481 1,950 1,209 0,713 0,65
TP47-17-15-SOD изб. 3,523 3,626 3,489 2,434 1,426 0,25
Таблица 2
Оценка образцов с положительной реакцией на сифилис
с помощью прямого ИФА
Планшет: покрытие триплетом TP Смешанная панель титрования Sera Care
Syphilis (PS C202) - (значения S/C)
ID № [мкг/мл] № 1 № 2 № 3 № 4 № 5 № 6 № 7 № 8 № 9 № 10
TP15-17-47-SOD 1,00 3,0 5,4 1,1 0,0 2,6 2,6 8,0 1,3 7,7 4,0
TP15-47-17-SOD 1,20 4,5 7,2 2,7 0,0 1,8 4,5 14 4,0 7,8 6,1
TP17-15-47-SOD 0,50 4,9 10 3,4 0,0 3,0 4,9 15 6,7 15 6,7
TP17-47-15-SOD 2,80 3,1 8,8 3,0 0,0 2,6 4,9 4,7 5,6 15 6,7
TP47-15-17-SOD 0,65 4,4 9,7 1,9 0,0 3,1 4,9 17 3,4 15 5,4
TP47-17-15-SOD 0,25 4,9 10 3,3 0,0 4,2 4,9 15 6,0 15 6,7
Таблица 2 (продолжение)
Планшет: покрытие триплетом TP
ID № [мкг/мл] № 11 № 12 № 13 № 14 № 15 № 16 № 17 № 18 № 19 № 20
TP15-17-47-SOD 1,00 2,1 3,3 3,2 2,9 5,3 0,0 3,1 2,6 2,8 3,9
TP15-47-17-SOD 1,20 3,0 6,1 6,9 8,1 6,9 0,0 3,2 7,0 4,0 2,8
TP17-15-47-SOD 0,50 6,3 6,7 11 7,5 10 0,0 4,6 16 4,5 10
TP17-47-15-SOD 2,80 5,6 4,0 14 6,2 10 0,0 3,6 10 4,2 5,3
TP47-15-17-SOD 0,65 4,9 6,1 11 6,6 10 0,0 2,5 5,0 5,8 5,6
TP47-17-15-SOD 0,25 7,0 6,7 11 9,7 13 0,0 3,5 12 3,9 9,0
Таблица 3
Оценка комбинации последовательностей антигена на покрытии планшетов
Планшет: покрытие триплетом TP Смешанная панель титрования ZeptoMetrix Mixed Titer Syphilis Panel (K-ZMC002)
ID № [мкг/мл] № 1 № 2 № 3 № 4 № 5 № 6 № 7 № 8
TP15-17-47-SOD 1,00 2 2 2 4 8 8 8 2
TP15-47-17-SOD 1,20 4 2 2 8 4 16 8 2
TP17-15-47-SOD 0,50 16 4 2 256 32 64 256 8
TP17-47-15-SOD 2,80 8 2 2 32 4 8 64 2
TP47-15-17-SOD 0,65 16 2 4 64 32 16 256 8
TP47-17-15-SOD 0,25 32 4 4 256 16 64 256 8
Таблица 3 (продолжение)
Планшет: покрытие триплетом TP
ID № [мкг/мл] № 9 № 10 № 11 № 12 № 13 № 14 № 15
TP15-17-47-SOD 1,00 2 32 2 2 4 256 8
TP15-47-17-SOD 1,20 2 16 2 2 4 32 8
TP17-15-47-SOD 0,50 32 256 8 64 32 256 32
TP17-47-15-SOD 2,80 2 256 2 8 8 256 16
TP47-15-17-SOD 0,65 16 256 4 16 16 256 32
TP47-17-15-SOD 0,25 16 256 8 32 16 256 64
Таблица 4
ПЦР-праймеры
Группа Название Направление праймера Праймеры, использованные при образовании триплета Комментарии
15-17-47 17-15-47 15-47-17 47-15-17 17-47-15 47-17-15
A F4-ER Прямой да да да да да да EcoR I, векторная последовательность
Apa-TP15 Прямой да Apa -(TP15)…
Apa-TP17 Прямой да да Apa -(TP17)…
TP15-BG Обратный да …TP15-gly-pro-Bgl II
TP15-BG2 Обратный да да …TP15-gly-Bgl II
TP17-BG Обратный да да да да …TP17-gly-pro-Bgl II
TP47-BG2 Обратный да да …TP47-gly-pro-Bgl II
B F-15 Прямой да да 50bp до SacI в TP15
R-15S Обратный да да TP15(3')-SOD(5')
T17-BH Прямой да да 95bp до Eag I в TP17
R-17S Обратный да да TP17(3')-SOD(5')
F-47b Прямой да да 50bp до Xma в TP47
R-47S Обратный да да TP47(3')-SOD(5')
C F-15S Прямой да да TP15(3')-SOD(5')
F-17S Прямой да да TP17(3')-SOD(5')
F-47S Прямой да да TP47(3')-SOD(5')
RS Обратный да да да да да да вниз от гена SOD
D T15-Sac Прямой да да (TP15)…SacI…
TP17-EAG Прямой да да (TP17)…EagI…
T47-XMA Прямой да да (TP47)…Xma1…
RS-H3 Обратный да да да да да да SOD(3')-StopStop-Hind III
Таблица 4 (продолжение)
Группа Название Последовательность праймеров (5'-3')
A F4-ER SEQ ID NO:13: cacaGAATTCATTAAAGAGGAGAAATTAAC
Apa-TP15 SEQ ID NO:14: tgtctGGGCCCAGCTTTTCTAGTATTCCGA
Apa-TP17 SEQ ID NO:15: tgtctGGGCCCGTGAGCTGCACCACGGT
TP15-BG SEQ ID NO:16: agctggAGATCTCGGGCCGCGAGAGATAATGGCTTCTT
TP15-BG2 SEQ ID NO:17: gctggAGATCTACCGCGAGAGATAATGGCTTCTT
TP17-BG SEQ ID NO:18: agctggAGATCTCGGGCCTTTCTTGGTTTTCTTCAGAACGTA
TP47-BG2 SEQ ID NO:19: agctggAGATCTTGGACCCTGCGCCACCACTTTCGCG
B F-15 SEQ ID NO:20: CGCGACCGTGAGCTCTCAGAGTTTT
R-15S SEQ ID NO:21:
CAGCACGCTGACGGCTTTGGTCGCgagGCGAGAGATAATGGCTTCTTTTTCGCC
T17-BH SEQ ID NO:22: GTGAGCTGCACCACGGT
R-17S SEQ ID NO:23:
CAGCACGCTGACGGCTTTGGTCGCgagTTTCTTGGTTTTCTTCAGAACGTAAA
F-47b SEQ ID NO:24: GGTTAGCGATCAGGCCGT
R-47S SEQ ID NO:25:
CAGCACGCTGACGGCTTTGGTCGCgagCTGCGCCACCACTTTCGCGCGC
C F-15S SEQ ID NO:26:
GGCGAAAAAGAAGCCATTATCTCTCGCctcGCGACCAAAGCCGTCAGCGTGCTG
F-17S SEQ ID NO:27:
TTTACGTTCTGAAGAAAACCAAGAAActcGCGACCAAAGCCGTCAGCGTGCTG
F-47S SEQ ID NO:28:
GCGCGCGAAAGTGGTGGCGCAGctcGCGACCAAAGCCGTCAGCGTGCTG
RS SEQ ID NO:29: TGCAGTCGACGGGCCCGGGAT
D T15-Sac SEQ ID NO:30: CGCGACCGTGAGCTCTCAGAGTTTT
TP17-EAG SEQ ID NO:31: CCCTGCCGGCCGCAGATTGT
T47-XMA SEQ ID NO:32: GGATTTCACCCCGGGTACCGAATATA
RS-H3 SEQ ID NO:33: agccAAGCTTcattaCTGGGCGATACCAATAACGCCA
Таблица 5
Тест VITROS Syphilis TPA
Реакционноспособный Граничный Отрицательный Итого
ИА 1 Реакционно-способный 266 0 8 274
Отрицательный 0 1 4015 4016
Итого 266 1 4023 4290
Таблица 6
Тест VITROS Syphilis TPA
Реакционноспособный Граничный Отрицательный Итого
ИА 1 Реакционно-способный 266 0 0 266
Отрицательный 0 1 4023 4024
Итого 266 1 4023 4290
Таблица 7
Тест VITROS Syphilis TPA
Реакционноспособный Граничный Отрицательный Итого
ИФА 1 Реакционно-способный 12 0 0 12
Отрицательный 0 0 137 137
Итого 12 0 137 149
Таблица 8
Соединение Концентрация
Азид (натрий) 20 мг/дл 3,06 ммоль/л
Билирубин 20 мг/дл 0,342 ммоль/л
Биотин 1000 нг/дл 40,8 нмоль/л
БСА (высокий уровень белка) 5 г/дл
(итого ~12 г/дл)
Нет данных
Холестерин 250 мг/дл Нет данных
Гемоглобин (гемолизат) 500 мг/дл 0,155 ммоль/л
Интралипид 850 мг/дл Нет данных
Триолеин 3000 мг/дл 33,96 ммоль/л

1. Рекомбинантная плазмида, кодирующая триплетный антиген Treponema pallidum, причем плазмида содержит нуклеиновую кислоту, кодирующую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 и SEQ ID NO:12.

2. Рекомбинантная плазмида по п. 1, в которой аминокислотная последовательность представляет собой SEQ ID NO:7.

3. Рекомбинантная плазмида по п. 1, в которой аминокислотная последовательность представляет собой SEQ ID NO:8.

4. Рекомбинантная плазмида по п. 1, в которой аминокислотная последовательность представляет собой SEQ ID NO:9.

5. Рекомбинантная плазмида по п. 1, в которой аминокислотная последовательность представляет собой SEQ ID NO:10.

6. Рекомбинантная плазмида по п. 1, в которой аминокислотная последовательность представляет собой SEQ ID NO:11.

7. Рекомбинантная плазмида по п. 1, в которой аминокислотная последовательность представляет собой SEQ ID NO:12.

8. Рекомбинантная плазмида по п. 1, в которой нуклеиновая кислота имеет нуклеотидную последовательность, выбранную из группы, состоящей из SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 и SEQ ID NO:6.

9. Рекомбинантная плазмида по п. 1, в которой нуклеиновая кислота имеет нуклеотидную последовательность, представленную в SEQ ID NO:1.

10. Рекомбинантная плазмида по п. 1, в которой нуклеиновая кислота имеет нуклеотидную последовательность, представленную в SEQ ID NO: 2.

11. Рекомбинантная плазмида по п. 1, в которой нуклеиновая кислота имеет нуклеотидную последовательность, представленную в SEQ ID NO: 3.

12. Рекомбинантная плазмида по п. 1, в которой нуклеиновая кислота имеет нуклеотидную последовательность, представленную в SEQ ID NO: 4.

13. Рекомбинантная плазмида по п. 1, в которой нуклеиновая кислота имеет нуклеотидную последовательность, представленную в SEQ ID NO: 5.

14. Рекомбинантная плазмида по п. 1, в которой нуклеиновая кислота имеет нуклеотидную последовательность, представленную в SEQ ID NO: 6.

15. Клетка-хозяин для экспрессии триплетного антигена Treponema pallidum, содержащая рекомбинантную плазмиду по п. 1.

16. Клетка-хозяин по п. 15, представляющая собой Escherichia coli.

17. Способ получения триплетного антигена Treponema pallidum, который включает культивирование клетки-хозяина по п. 15 в условиях, подходящих для экспрессии триплетного антигена Treponema pallidum, и выделение триплетного антигена Treponema pallidum из клеточной культуры.

18. Рекомбинантная плазмида, кодирующая триплетный антиген Treponema pallidum, причем рекомбинантную плазмиду выбирают из группы, состоящей из:
плазмиды, обозначенной p261nS-TP17-15-47 и депонированной в Американской коллекции типовых культур с №доступа АТСС РТА-11590;
плазмиды, обозначенной p261nS-TP47-17-15 и депонированной в Американской коллекции типовых культур с №доступа АТСС РТА-11589;
плазмиды, обозначенной p261nS-TP17-47-15;
плазмиды, обозначенной p261nS-TP47-15-17;
плазмиды, обозначенной p261nS-TP15-17-47; и
плазмиды, обозначенной p261nS-TP15-47-17.

19. Рекомбинантная плазмида по п. 18, обозначенная p261nS-ТР17-15-47 и депонированная в Американской коллекции типовых культур с №доступа АТСС РТА-11590.

20. Рекомбинантная плазмида по п. 18, обозначенная p261nS-ТР47-17-15 и депонированная в Американской коллекции типовых культур с №доступа АТСС РТА-11589.

21. Рекомбинантная плазмида по п. 18, обозначенная p261nS-ТР17-47-15.

22. Рекомбинантная плазмида по п. 18, обозначенная p261nS-ТР47-15-17.

23. Рекомбинантная плазмида по п. 18, обозначенная p261nS-ТР15-17-47.

24. Рекомбинантная плазмида по п. 18, обозначенная p261nS-ТР15-47-17.

25. Клетка-хозяин для экспрессии триплетного антигена Treponema pallidum, содержащая рекомбинантную плазмиду по п. 18.

26. Клетка-хозяин по п. 25, представляющая собой Escherichia coli.

27. Способ получения триплетного антигена Treponema pallidum, который включает культивирование клетки-хозяина по п. 25 в условиях, подходящих для экспрессии триплетного антигена Treponema pallidum, и выделение триплетного антигена Treponema pallidum из клеточной культуры.

28. Триплетный антиген Treponema pallidum с аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 и SEQ ID NO:12.

29. Триплетный антиген Treponema pallidum по п. 28 с аминокислотной последовательностью, представленной в SEQ ID NO:7.

30. Триплетный антиген Treponema pallidum по п. 28 с аминокислотной последовательностью, представленной в SEQ ID NO:8.

31. Триплетный антиген Treponema pallidum по п. 28 с аминокислотной последовательностью, представленной в SEQ ID NO:9.

32. Триплетный антиген Treponema pallidum по п. 28 с аминокислотной последовательностью, представленной в SEQ ID NO:10.

33. Триплетный антиген Treponema pallidum по п. 28 с аминокислотной последовательностью, представленной в SEQ ID NO:11.

34. Триплетный антиген Treponema pallidum по п. 28 с аминокислотной последовательностью, представленной в SEQ ID NO:12.

35. Триплетный антиген Treponema pallidum по п. 28, меченный обнаруживаемым маркером.

36. Триплетный антиген Treponema pallidum по п. 35, где обнаруживаемый маркер представляет собой пероксидазу хрена.

37. Способ обнаружения присутствия антител Treponema pallidum в образце, включающий стадии:
приведения образца в контакт с триплетным антигеном Treponema pallidum по п. 28, причем антитела Treponema pallidum, присутствующие в образце, связываются с триплетным антигеном Treponema pallidum c образованием комплекса антитело/антиген; и
обнаружения комплекса антитело/антиген, чем осуществляется обнаружение присутствия антител Treponema pallidum.

38. Способ по п. 37, в котором триплетный антиген Treponema pallidum иммобилизован на твердой подложке.

39. Способ по п. 37, в котором стадия обнаружения комплекса антитело/антиген включает:
приведение комплекса антитело/антиген в контакт со вторым триплетным антигеном Treponema pallidum по п. 28, причем второй триплетный антиген Treponema pallidum помечен обнаруживаемым маркером, причем второй триплетный антиген Treponema pallidum связывается с антителом, присутствующим в комплексе антитело/антиген, с образованием комплекса антиген/антитело/меченый антиген; и
обнаружение комплекса антиген/антитело/меченый антиген, чем осуществляется обнаружение присутствия антител Treponema pallidum.

40. Способ по п. 37, в котором стадия обнаружения комплекса антитело/антиген включает:
приведение комплекса антитело/антиген в контакт с мечены антителом к человеческому иммуноглобулину, причем указанное меченое антитело к человеческому иммуноглобулину связывается с антителом, присутствующим в комплексе антитело/антиген, с образованием комплекса антиген/антитело/меченое анти-антитело; и
обнаружение комплекса антиген/антитело/меченое анти-антитело, чем осуществляется обнаружение присутствия антител Treponema pallidum.

41. Компонент набора для обнаружения антител Treponema pallidum, содержащий триплетный антиген Treponema pallidum по п. 28.

42. Набор для обнаружения антител Treponema pallidum, содержащий:
триплетный антиген Treponema pallidum по п. 28; и
второй триплетный антиген Treponema pallidum по п. 28, меченный обнаруживаемым маркером.

43. Набор по п. 42, дополнительно содержащий положительные или отрицательные контроли.

44. Набор по п. 42, дополнительно содержащий калибровочные образцы.

45. Набор по п. 42, дополнительно содержащий один или более из ферментативного конъюгата, субстрата для ферментативного конъюгата, буферного раствора и промывного раствора.



 

Похожие патенты:
Изобретение относится к области медицины, в частности к венерологии, и предназначено для прогнозирования нейросифилиса. Проводят исследование титров нетрепонемных антител в крови во флокуляционных тестах до выполнения диагностической пункции, и при обнаружении титров не менее чем 1:32 определяют высокую вероятность нейросифилиса, а при обнаружении титров ниже чем 1:32, определяют титры трепонемаспецифичных антител в крови в реакции гемагглютинации, и при их значениях не менее 1:40960 также определяют высокую вероятность нейросифилиса.

Изобретение относится к области медицины и касается способа диагностики качества жизни больных, страдающих генитальными инфекциями. .
Изобретение относится к медицине, а именно к акушерству и гинекологии, урологии, венерологии, паразитологии, медицинской микробиологии, и касается способа диагностики урогенитального трихомониаза.

Изобретение относится к области клинической лабораторной диагностики, биотехнологии и медицины и касается диагностической тест-системы в формате иммуночипа (биологического чипа) и способа диагностики сифилиса с использованием данного иммуночипа, позволяющего одновременно и дифференциально выявлять реагиновые и трепонемоспецифические антитела (антитела к Treponema pallidum) разных классов.
Изобретение относится к области биотехнологии и иммунологии и может быть использовано в технологии изготовления панелей сывороток для контроля качества тест-систем, предназначенных для серологической диагностики сифилиса.
Изобретение относится к области медицины, а именно к дерматологии, и касается способа диагностики сифилиса. .
Изобретение относится к области медицины и касается антигенной композиции и способа обнаружения антител к Treponema pallidum при диагностике сифилиса. .
Изобретение относится к области медицины, в частности к дерматовенерологии, а именно к способам диагностики носительства микоплазм у мужчин. .

Группа изобретений относится к области вирусологии и биотехнологии. Бакуловирусный вектор для переноса содержит структуру, в которую встроены сдвоенный промотор и слитая ДНК.

Изобретение относится к биотехнологии. Предложено выделенное антитело, которое специфически связывается по меньшей мере с одним из собачьего интерлейкина-31 (IL-31) или кошачьего IL-31.

Изобретение относится к биотехнологии и представляет собой пептид, который имеет аминокислотную последовательность, состоящую из смежных аминокислот, полученных из белка WT1, и индуцирует WT1-специфические хелперные Т-клетки связыванием с молекулой МНС класса II.

Данное изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5 человека, охарактеризованное последовательностями гипервариабельных участков (HVR), и его антигенсвязывающий фрагмент.

Изобретение относится к биотехнологии. Раскрыт полипептид миметика антитела с функцией распознавания и связывания с цианобактериями, аминокислотная последовательность которого приведена в SEQ ID NO.

Представлена группа изобретений, касающаяся эпитопа, специфичного для вируса гепатита В (ВГВ), полинуклеотида, кодирующего эпитоп, экспрессионного рекомбинантного векора, рекомбинантного микроорганизма, вируса или клетки млекопитающих, способа получения эпитопа и способа получения антитела, специфично связывающегося с эпитопом.

Представленная группа изобретений касается слитого белка, ДНК, кодирующей такой белок, рекомбинантного вектора и клетки-хозяина. Охарактеризованный слитый белок содержит фактор VII (FVII) и трансферрин, где указанный трансферрин соединен с С-концом указанного FVII, необязательно через линкер.

Группа изобретений относится к генетически модифицированной клетке для продуцирования фукозилированных олигосахаридов, способу ее получения и способу получения фукозилированных олигосахаридов.

Настоящее изобретение относится к области иммунологии и биотехнологии. Предложены антитела к А2 домену тенасцина-С (TNC A2), а также выделенный полинуклеотид, вектор экспрессии, клетка-хозяин и способы получения антитела по изобретению.

Настоящее изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5, охарактеризованное последовательностями HVR.

Изобретение относится к биохимии. Описана молекула нуклеиновой кислоты для генетической терапии мукополисахаридозов. Также описаны векторы и фармацевтические композиции для лечения заболеваний мукополисахаридозов. Изобретение расширяет арсенал средств для лечения мукополисахаридозов. 7 н. и 8 з.п. ф-лы, 15 ил., 1 табл., 11 пр.
Наверх