Новое антитело против dr5



Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5
Новое антитело против dr5

 


Владельцы патента RU 2590711:

ДАЙИТИ САНКИО КОМПАНИ, ЛИМИТЕД (JP)

Изобретение относится к области биохимии. Заявлено антитело, связывающееся с рецептором клеточной поверхности DR5. Антитело проявляет цитотоксическую активность против клеток, экспрессирующих содержащий домен гибели рецептор, посредством апоптоза. Также изобретение относится к полинуклеотиду, вектору, клеткам-хозяевам для получения указанного антитела, а также к фармацевтическим композициям и способам лечения и профилактики злокачественного новообразования, аутоиммунного заболевания или воспалительного заболевания. Изобретение позволяет усилить цитотоксическую активность антитела против DR5 и индуцировать апоптоз в клетках, а также позволяет достичь эффективного терапевтического действия при лечении пациента антителом по изобретению. 11 н. и 33 з. п. ф-лы, 58 ил., 14 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к антителу, которое связывается с рецептором клеточной поверхности, участвующим в индукции апоптоза, и которое может использоваться в качестве терапевтического и/или профилактического средства для опухолей, а также к способу лечения и/или профилактики злокачественного новообразования, аутоиммунного заболевания или воспалительного заболевания с помощью указанного антитела.

Уровень техники

Апоптоз является феноменом, необходимым для физиологического процесса удаления ненужных клеток или поврежденных клеток и поддержания количества нормальных клеток in vivo. Благодаря прогрессу в понимании того факта, что регуляторный механизм апоптоза часто является поврежденным при злокачественных заболеваниях или иммунных нарушениях, а также благодаря пониманию регуляторного пути апоптоза, были достигнуты успехи в развитии нового индуктора апоптоза, который может быть использован в лечении злокачественных заболеваний или иммунных нарушений. В частности, предполагают, что антитело, которое имеет аффинность связывания в отношении лиганда рецептора клеточной поверхности, участвующего в индукции апоптоза, по типу рецептора гибели, может оказывать терапевтический эффект на эти заболевания (см., например, непатентный документ 1). Известен рецептор гибели 5 (DR5), который является одним из рецепторов гибели, иногда называемый также KILLER, TRICK 2A, TRAIL-R2, TRICK B или CD262, и множество агонистических антител, которые индуцируют апоптоз в клетках (см., например, непатентный документ 2 или 3, или патентные документы 1-6). Некоторые из антител проходят в настоящее время клинические испытания в качестве возможных терапевтических средств, и предполагается, что они обладают терапевтическим эффектом, таким, что антитела специфически действуют агонистическим образом на клетки (на раковые клетки или на клетки, относящиеся к иммунному заболеванию), которые экспрессируют рецептор, для уничтожения этих клеток. Для того, чтобы такое антитело проявляло противоопухолевый эффект, существенно, что эти клетки экспрессируют DR5, однако, было выявлено, что не существует корреляции между этим действием и уровнем экспрессии DR5 в преклиническом испытании (непатентный документ 4). Полагают, что это связано с тем, что клеточная реакция находится под контролем большого числа факторов, таких как уровень экспрессии внутриклеточных переносящих сигнал молекул (таких как каспаза-8 или Bcl-2), участвующих в путях апоптоза (непатентный документ 5).

Документ известного уровня техники

Патентный документ 1

WO 98/51793

Патентный документ 2

WO 2001/83560

Патентный документ 3

WO 2002/94880

Патентный документ 4

WO 2003/54216

Патентный документ 5

WO 2006/83971

Патентный документ 6

WO 2007/22157

Непатентный документ 1

Cell Death and Differentiation, 10: 66-75 (2003)

Непатентный документ 2

Journal of Immunology, 162: 2597-2605 (1999)

Непатентный документ 3

Nature Medicine, 7(8): 954-960 (2001)

Непатентный документ 4

Cell Death and Differentiation, 10: 66-75 (2003)

Непатентный документ 5

Journal of Clinical Oncology, 26: 3621-3630 (2008)

Сущность изобретения

Задачи, решаемые настоящим изобретением

Целью настоящего изобретения является получение антитела или функционального фрагмента антитела для использования в фармацевтическом препарате с терапевтическим эффектом в отношении злокачественного новообразования, и получение полинуклеотида, кодирующего антитело или функциональный фрагмент антитела.

Способы решения этих задач

Авторы настоящего изобретения провели интенсивные исследования для достижения вышеуказанной цели, и в результате обнаружили антитело, которое проявляет сильную апоптоз-индуцирующую активность в клетках и на этом основании было создано настоящее изобретение. Антитело также вызывает эффективное терапевтическое действие у пациента, у которого не может быть достигнут достаточный терапевтический эффект с использованием доступных в настоящее время антител.

Таким образом, настоящее изобретение включает следующие изобретения.

(1) Антитело, отличающееся тем, что:

последовательность тяжелой цепи содержит вариабельный домен с CDRH1, CDRH2 и CDRH3, и CDRH1 содержит аминокислотную последовательность SEQ ID NO:82, CDRH2 содержит любую аминокислотную последовательность из SEQ ID NO:83 и 89, и CDRH3 содержит аминокислотную последовательность SEQ ID NO:84; и

последовательность легкой цепи содержит вариабельный домен с CDRL1, CDRL2 и CDRL3, и CDRL1 содержит любую аминокислотную последовательность из SEQ ID NO:79, 85, 86, 87 и 88, CDRL2 содержит аминокислотную последовательность SEQ ID NO:80, и CDRL3 содержит аминокислотную последовательность SEQ ID NO:81, или функциональный фрагмент антитела.

(2) Антитело, или функциональный фрагмент антитела, по (1), отличающееся тем, что содержит последовательность вариабельного домена тяжелой цепи, содержащую аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO:20, и последовательность вариабельного домена легкой цепи, содержащую аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO:16.

(3) Антитело, или функциональный фрагмент антитела, по (1) или (2), отличающееся тем, что антитело является химерным антителом.

(4) Антитело, или функциональный фрагмент антитела, по (3), отличающееся тем, что содержит последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO:20, и последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO:16.

(5) Антитело, или функциональный фрагмент антитела, по (1), отличающееся тем, что антитело является гуманизированным.

(6) Антитело, или функциональный фрагмент антитела, по (5), отличающееся тем, что содержит:

(а) последовательность вариабельного домена тяжелой цепи, выбранную из группы, состоящей из следующих аминокислотных последовательностей:

а1) аминокислотной последовательности, содержащей аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO:42;

а2) аминокислотной последовательности, содержащей аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO:70;

а3) аминокислотной последовательности, которая гомологична по меньшей мере на 95% аминокислотной последовательности, выбранной из а1) и а2);

а4) аминокислотной последовательности, которая гомологична по меньшей мере на 99% аминокислотной последовательности, выбранной из а1) и а2); и

а5) аминокислотной последовательности, включающей замену, делецию или добавление одной-нескольких аминокислотных остатков в любой из аминокислотных последовательностей, выбранных из а1) и а2); и

(b) последовательность вариабельного домена легкой цепи, выбранную из группы, состоящей из следующих аминокислотных последовательностей:

b1) аминокислотной последовательности, содержащей аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO:28;

b2) аминокислотной последовательности, содержащей аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO:52;

b3) аминокислотной последовательности, содержащей аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO:58;

b4) аминокислотной последовательности, содержащей аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO:62;

b5) аминокислотной последовательности, содержащей аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO:66;

b6) аминокислотной последовательности, которая гомологична по меньшей мере на 95% любой аминокислотной последовательности, выбранной из b1)-b5);

b7) аминокислотной последовательности, которая гомологична по меньшей мере на 99% любой аминокислотной последовательности, выбранной из b1)-b5); и

b8) аминокислотной последовательности, содержащей замену, делецию или добавление одной-нескольких аминокислотных остатков в любой из аминокислотных последовательностей, выбранных из b1)-b5).

(7) Антитело, или функциональный фрагмент антитела, по (6), отличающееся тем, что содержит последовательность вариабельного домена тяжелой цепи, содержащую аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO:42, и последовательность вариабельного домена легкой цепи, содержащую аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO:28.

(8) Антитело, или функциональный фрагмент антитела, по (6), отличающееся тем, что содержит последовательность вариабельного домена тяжелой цепи, содержащую аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO:70, и последовательность вариабельного домена легкой цепи, содержащую аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO:52.

(9) Антитело, или функциональный фрагмент антитела, по (6), отличающееся тем, что содержит последовательность вариабельного домена тяжелой цепи, содержащую аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO:70, и последовательность вариабельного домена легкой цепи, содержащую аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO:58.

(10) Антитело, или функциональный фрагмент антитела, по (6), отличающееся тем, что содержит последовательность вариабельного домена тяжелой цепи, содержащую аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO:70, и последовательность вариабельного домена легкой цепи, содержащую аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO:62.

(11) Антитело, или функциональный фрагмент антитела, по (6), отличающееся тем, что содержит последовательность вариабельного домена тяжелой цепи, содержащую аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO:70, и последовательность вариабельного домена легкой цепи, содержащую аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO:66.

(12) Антитело, или функциональный фрагмент антитела, по (6), отличающееся тем, что содержит последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO:42, и последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO:28.

(13) Антитело, или функциональный фрагмент антитела, по (6), отличающееся тем, что содержит последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO:70, и последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO:52.

(14) Антитело, или функциональный фрагмент антитела, по (6), отличающееся тем, что содержит последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO:70, и последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO:58.

(15) Антитело, или функциональный фрагмент антитела, по (6), отличающееся тем, что содержит последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO:70, и последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO:62.

(16) Антитело, или функциональный фрагмент антитела, по (6), отличающееся тем, что содержит последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO:70, и последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO:66.

(17) Функциональный фрагмент антитела по любому из (1)-(16), который выбран из группы, состоящей из Fab, F(ab')2, Fab' и Fv.

(18) Фармацевтическая композиция, отличающаяся тем, что содержит по меньшей мере одно из антител или функциональных фрагментов антител по (1)-(17).

(19) Фармацевтическая композиция по (18), отличающаяся тем, что представляет собой фармацевтическую композицию для лечения и/или профилактики злокачественного новообразования.

(20) Фармацевтическая композиция для лечения и/или профилактики злокачественного новообразования, отличающаяся тем, что содержит по меньшей мере одно из антител или функциональных фрагментов антител по (1)-(17) и по меньшей мере один представитель, выбранный из группы, состоящей из паклитаксела, карбоплатина, СРТ-11 и винбластина.

(21) Фармацевтическая композиция по (19) или (20), где злокачественное новообразование выбрано из группы, состоящей из рака легкого, рака предстательной железы, рака щитовидной железы, рака желудка, рака печени, рака ободочной кишки, рака молочной железы, рака поджелудочной железы, рака почки, рака матки, меланомы, фибросаркомы, глиобластомы и рака клеток крови.

(22) Способ лечения и/или профилактики злокачественного новообразования, отличающийся тем, что вводят по меньшей мере одно из антител или функциональных фрагментов антител по (1)-(17).

(23) Способ лечения и/или профилактики злокачественного новообразования, отличающийся тем, что может быть одновременным или последовательным введение по меньшей мере одного из антител или функциональных фрагментов антител по (1)-(17) и по меньшей мере одного представителя, выбранного из группы, состоящей из паклитаксела, карбоплатина, СРТ-11, винбластина и 5-FU.

(24) Способ лечения и/или профилактики по (22) или (23), где злокачественное новообразование выбрано из группы, состоящей из рака легкого, рака предстательной железы, рака щитовидной железы, рака желудка, рака печени, рака яичника, рака ободочной кишки, рака молочной железы, рака поджелудочной железы, рака почки, рака матки, меланомы, фибросаркомы, глиобластомы и рака клеток крови.

(25) Полинуклеотид, кодирующий антитело по любому из (2), (4) и (6)-(16).

(26) Полинуклеотид по (25), отличающийся тем, что содержит нуклеотидную последовательность, содержащую нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO:19, и нуклеотидную последовательность, содержащую нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO:15.

(27) Полинуклеотид по (25), отличающийся тем, что содержит нуклеотидную последовательность, содержащую нуклеотиды 58-1413 нуклеотидной последовательности SEQ ID NO:19, и нуклеотидную последовательность, содержащую нуклеотиды 61-717 нуклеотидной последовательности SEQ ID NO:15.

(28) Полинуклеотид по (25), отличающийся тем, что содержит:

(а) полинуклеотид, выбранный из группы, состоящей из следующих нуклеотидных последовательностей:

а1) нуклеотидной последовательности, содержащей нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO:41;

а2) нуклеотидной последовательности, содержащей нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO:69;

а3) нуклеотидной последовательности полинуклеотида, которая гибридизуется с полинуклеотидом, содержащим нуклеотидную последовательность, комплементарную нуклеотидной последовательности, выбранной из а1) и а2), при жестких условиях; и

а4) нуклеотидной последовательности, включающей замену, делецию или добавление одного-нескольких нуклеотидов в нуклеотидной последовательности, выбранной из а1) и а2); и

(b) полинуклеотид, выбранный из группы, состоящей из следующих нуклеотидных последовательностей:

b1) нуклеотидной последовательности, содержащей нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO:27;

b2) нуклеотидной последовательности, содержащей нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO:51;

b3) нуклеотидной последовательности, содержащей нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO:57;

b4) нуклеотидной последовательности, содержащей нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO:61;

b5) нуклеотидной последовательности, содержащей нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO:65;

b6) нуклеотидной последовательности полинуклеотида, которая гибридизуется с полинуклеотидом, содержащим нуклеотидную последовательность, комплементарную любой из нуклеотидных последовательностей, выбранных из b1)-а5), при жестких условиях; и

b7) нуклеотидной последовательности, содержащей замену, делецию или добавление любого одного-нескольких нуклеотидов, выбранных из b1)-b5).

(29) Полинуклеотид по (28), отличающийся тем, что содержит полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO:41, и полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO:27.

(30) Полинуклеотид по (28), отличающийся тем, что содержит полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO:69, и полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO:51.

(31) Полинуклеотид по (28), отличающийся тем, что содержит полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO:69, и полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO:57.

(32) Полинуклеотид по (28), отличающийся тем, что содержит полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO:69, и полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO:61.

(33) Полинуклеотид по (28), отличающийся тем, что содержит полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO:69, и полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO:65.

(34) Полинуклеотид по (28), отличающийся тем, что содержит полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-1413 нуклеотидной последовательности SEQ ID NO:41, и полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-717 нуклеотидной последовательности SEQ ID NO:27.

(35) Полинуклеотид по (28), отличающийся тем, что содержит полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-1413 нуклеотидной последовательности SEQ ID NO:69, и полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-717 нуклеотидной последовательности SEQ ID NO:51.

(36) Полинуклеотид по (28), отличающийся тем, что содержит полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-1413 нуклеотидной последовательности SEQ ID NO:69, и полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-717 нуклеотидной последовательности SEQ ID NO:57.

(37) Полинуклеотид по (28), отличающийся тем, что содержит полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-1413 нуклеотидной последовательности SEQ ID NO:69, и полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-717 нуклеотидной последовательности SEQ ID NO:61.

(38) Полинуклеотид по (28), отличающийся тем, что содержит полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-1413 нуклеотидной последовательности SEQ ID NO:69, и полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-717 нуклеотидной последовательности SEQ ID NO:65.

(39) Вектор, содержащий любой из полинуклеотидов по (25)-(38).

(40) Трансформированная клетка-хозяин, содержащая любой из полинуклеотидов по (25)-(38).

(41) Трансформированная клетка-хозяин, содержащая вектор по (39).

(42) Способ получения антитела по любому из (2), (4) и (6)-(16), предусматривающий стадию культивирования клетки-хозяина по (40) или (41) и очистки антитела из полученного культивированного продукта.

(43) Антитело, или функциональный фрагмент антитела, отличающееся тем, что связывает тот же самый эпитоп, который связывает антитело, содержащее последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO:20, и последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO:16.

(44) Антитело, или функциональный фрагмент антитела, отличающееся тем, что конкурирует с антителом, содержащим последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO:20, и последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO:16.

(45) Антитело, или функциональный фрагмент антитела, по (43) или (44), отличающееся тем, что Fab-фрагмент антитела, полученный расщеплением папаином, при связывании рекомбинантного белка SEQ ID NO:23, находится рядом с остатком глицина в положении 26, остатком изолейцина в положении 34, остатком глутаминовой кислоты в положении 36, остатком аспарагиновой кислоты в положении 37, остатком глицина в положении 38, остатком аспарагиновой кислоты в положении 56, остатком лейцина в положении 57, остатком лейцина в положении 58, остатком фенилаланина в положении 59, остатком лейцина в положении 61 и остатком аргинина в положении 62 рекомбинантного белка SEQ ID NO:23, при расстоянии 4 ангстрем или менее.

(46) Антитело или функциональный фрагмент антитела по (45), отличающиеся тем, что расстояние между каждым аминокислотным остатком, составляющим рекомбинантный белок SEQ ID NO:23, и Fab-фрагментом определяют комплексным структурным анализом с использованием данных дифракции рентгеновских лучей.

Преимущество изобретения

В соответствии с изобретением, может быть получено терапевтическое средство для лечения злокачественного новообразования, механизм действия которого связан прежде всего с индукцией апоптоза в клетках.

Краткое описание фигур

Фиг 1 является фигурой, показывающей разрушающий клетки эффект В273-антитела мыши.

Фиг. 2 является фигурой, показывающей активности связывания cB273-антитела и sTRAIL с белком внеклеточного домена DR5.

Фигура 3 является фигурой, показывающей активность связывания cB273-антитела с DR5 человека с использованием Biacore. На верхней части фигуры, показана диаграмма, в которой ордината представляет единицы резонанса (RU), и абсцисса представляет время (секунды). На нижней части фигуры показаны величины Kon, Koff и KD cB273-антитела, рассчитанные с использованием анализа при помощи программного обеспечения.

Фиг. 4 является фигурой, показывающей in vitro разрушающий клетки эффект cB273-антитела на линиях раковых клеток человека. А) показывает результаты для клеточной линии рака яичника человека, В) показывает результаты для клеточной линии рака ободочной кишки человека, С) показывает результаты для клеточной линии рака легкого человека и D) показывает результаты для клеточной линии рака молочной железы человека.

Фиг. 5 является фигурой, показывающей in vitro разрушающий клетки эффект cB273-антитела на линиях раковых клеток человека. А) показывает результаты для клеточной линии рака поджелудочной железы человека. В) показывает результаты клеточной линии меланомы человека, С) показывает результаты для клеточной линии глиобластомы человека и D) показывает результаты клеточной линии рака эндометрия человека.

Фиг. 6 является видом, показывающим структуру комплекса DR5-cB273 Fab.

Фиг. 7 является видом, показывающим взаимодействие между DR5 и H- или L-цепью cB273 Fab. А) является видом, иллюстрирущим аминокислотные остатки Н-цепи cB273 Fab, которые находятся на расстоянии 4 ангстрем или менее от DR5 и vice versa в качестве stick модели. Ile34, Glu36, Asp37, Gly38, Asp56, Leu57, Leu58, Phe59, Leu61 и Arg62, показанные на левой сторон рисунка, являются аминокислотными остатками, полученными из DR5, и соответствующие номера аминокислотных остатков соответствуют номерам в аминокислотной последовательности SEQ ID NO:23 в Списке последовательностей. Далее, Phe33, Arg50, Asn52, Tyr54, Asn55, Phe59, Tyr101, Tyr102, Phe103 и Asp104 на правой стороне этого рисунка являются аминокислотными остатками, полученными из тяжелой цепи cB273, и соответствующие номера аминокислотных остатков даются с использованием остатка глутаминовой кислоты в положении 20 SEQ ID NO:20 в Списке последовательностей в качестве исходной точки. В) является видом, иллюстрирующим аминокислотные остатки L-цепи cB273 Fab, которые находятся при расстоянии 4 ангстрем или менее от DR5 и vice versa с некоторыми в виде stick модели и другими в виде ленточной модели. Gly26, Glu36, Asp37 и Gly38 на левой стороне рисунка являются аминокислотными остатками, полученными из DR5, и соответствующие номера аминокислотных остатков соответствуют номерам в аминокислотной последовательности SEQ ID NO:23 в Списке последовательностей. Далее, His31, Asn33, Val99 и Trp101 на правой стороне рисунка являются аминокислотными остатками, полученными из легкой цепи cB273, и соответствующие номера аминокислотных остатков даются с использованием остатка аспарагиновой кислоты в положении 21 SEQ ID NO:16 в Списке последовательностей в качестве исходной точки. Аминокислотные остатки DR5, которые находятся на расстоянии 4 ангстрем или менее от Fab-фрагмента cB273, были остатком глицина в положении 26, остатком изолейцина в положении 34, остатком глутаминовой кислоты в положении 36, остатком аспарагиновой кислоты в положении 37, остатком глицина в положении 38, остатком аспарагиновой кислоты в положении 56, остатком лейцина в положении 57, остатком лейцина в положении 58, остатком фенилаланина в положении 59, остатком лейцина в положении 61 и остатком аргинина в положении 62 аминокислотной последовательности SEQ ID NO:23 в Списке последовательностей.

Фиг. 8-1 является фигурой, показывающей активность связывания hB273-антител с DR5 человека, с использованием Biacore, и показывает графики измерения для соответствующих антител.

Фиш. 8-2 является таблицей, показывающей активность связывания hB273-антител с DR5 человека с использованием Biacore, и показывает величины Kon, Koff и KD соответствующих антител, рассчитанные с использованием анализа при помощи программного обеспечения. В данном случае, число, конкретное для каждой диаграммы на фиг. 8-1, соответствует номеру ввода таблицы на фиг. 8-2.

Фиг. 9 является фигурой, показывающей in vitro разрушающие клетки активность hB273-антител против клеток Jurkat, которые являются полученной из Т-лимфомы человека клеточной линией.

Фиг. 10-1 является фигурой, показывающей активность связывания hB273-антитела с DR5 человека с использованием Biacore, и показывает графики измерений для соответствующих антител.

Фиг. 10-2 является таблицей, показывающей активность связывания hB273-антител с DR5 человека с использованием Biacore, и показывает величины Kon, Koff и KD соответствующих антител, рассчитанные с использованием анализа при помощи программного обеспечения. В данном случае, число, конкретное для каждой диаграммы на фиг. 10-1, соответствует номеру ввода в таблице на фиг. 10-2.

Фиг. 11 является фигурой, показывающей in vitro разрушающую клетки активность hB273-антител против клеток Jurkat, которые являются полученной из Т-лимфомы человека клеточной линией.

Фиг. 12-1 является видом, показывающим активность связывания CDR-модифицированных hB273-антител с DR5 человека с использованием Biacore, и показывает графики измерения для соответствующих антител.

Фиг. 12-2 является таблицей, показывающей активность связывания CDR-модифицированных hB273-антител с DR5 человека с использованием Biacore, и показывает величины Kon, Koff и KD соответствующих антител, рассчитанные с использованием анализа при помощи программного обеспечения. В данном случае, число, конкретное для каждой диаграммы на фиг. 12-1, соответствует номеру введения в таблице на фиг. 12-2.

Фиг. 13-1 является фигурой, показывающей оценку термостабильности CDR-модифицированных hB273-антител с использованием дифференциальной сканирующей калориметрии (DSC), и показывает графики измерения для соответствующих антител.

Фиг. 13-2 является фигурой, показывающей оценку термостабильности CDR-модифицированных hB273-антител с использованием дифференциальной сканирующей калориметрии (DSC), и показывает графики измерения для соответствующих антител.

Фиг. 13-3 показывает величины Tm соответствующих антител, рассчитанные из графиков, показанных на фиг. 13-1 и 13-2. В данном случае, число, конкретное для каждого графика на фиг. 13-1 и 13-2, соответствует № ввода на фиг. 13-3.

Фиг. 14 является фигурой, показывающей in vitro разрушающие клетки активности CDR-модифицированных hB273-антител против клеток Jurkat, которые являются полученной из Т-лимфомы человека клеточной линией.

Фиг. 15 является видом, показывающим эффект активации каспазы-3/7 и in vitro разрушающую клетки активность hB273_H2-1-NE/L1-NK-антитела на клеточных линиях рака человека. А) показывает результаты для клеточной линии HCT-15 рака ободочной кишки человека и В) показывает результаты для клеточной линии U-87MG глиобластомы человека.

Фиг. 16 является фигурой, показывающей in vivo противоопухолевую активность cB273-антитела в мышах “nude”, имплантированных клеточной линией COLO 205 рака ободочной кишки человека.

Фиг. 17 является фигурой, показывающей in vivo противоопухолевую активность cB273-антитела в мышах “nude”, имплантированных клеточной линией MIAPaCa-2 рака поджелудочной железы человека.

Фиг. 18 является фигурой, показывающей in vivo противоопухолевую активность cB273-антитела в мышах “nude”, имплантированных клеточной линией U-87MG глиобластомы человека.

Фиг. 19 является фигурой, показывающей in vivo противоопухолевую активность cB273-антитела в мышах “nude”, имплантированных клеточной линией NCI-H2122 рака легкого человека (в комбинации с паклитакселом и карбоплатином).

Фиг. 20 является фигурой, показывающей in vivo противоопухолевую активность cB273-антитела в мышах “nude”, имплантированных клеточной линией NCI-H460 рака легкого человека (в комбинации с паклитакселом и карбоплатином).

Фиг. 21 является фигурой, показывающей in vivo противоопухолевую активность cB273-антитела в мышах “nude”, имплантированных клеточной линией DLD-1 рака ободочной кишки человека (в комбинации с CPT-11).

Фиг. 22 является фигурой, показывающей in vivo противоопухолевую активность cB273-антитела в мышах “nude”, имплантированных клеточной линией HCT-15 рака ободочной кишки человека (в комбинации с CPT-11).

Фиг. 23 является фигурой, показывающей in vivo противоопухолевую активность cB273-антитела в мышах “nude”, имплантированных клеточной линией HCT-116 рака ободочной кишки человека (в комбинации с CPT-11).

Фиг. 24 является фигурой, показывающей in vivo противоопухолевую активность cB273-антитела в мышах “nude”, имплантированных клеточной линией A375 меланомы человека (в комбинации с винбластином).

Фиг. 25 является фигурой, показывающей сравнение in vivo противоопухолевой активности в мышах “nude”, имплантированных клеточной линией HCT-15 рака ободочной кишки человека, между cB273-антителом и конатумумабом.

Фиг. 26 является фигурой, показывающей сравнение in vivo противоопухолевой активности в мышах “nude”, имплантированных клеточной линией NCI-H1975 рака легкого человека, между cB273-антителом и конатумумабом.

Фиг. 27 является фигурой, показывающей in vivo противоопухолевую активность hB273_H2-1-NE/L1-NK-антитела (обозначенного как “hB273” на этом рисунке) в мышах “nude”, имплантированных клеточной линией COLO 205 рака ободочной кишки человека.

Фиг. 28 является фигурой, показывающей нуклеотидную последовательность кДНК, кодирующей тяжелую цепь антитела В273 мыши, и аминокислотную последовательность тяжелой цепи антитела В273 мыши.

Фиг. 29 является фигурой, показывающей нуклеотидную последовательность кДНК, кодирующей легкую цепь антитела В273 мыши, и аминокислотную последовательность легкой цепи антитела В273 мыши.

Фиг. 30 является фигурой, показывающей нуклеотидную последовательность, кодирующую легкую цепь В273-химера-типа, и аминокислотную последовательность легкой цепи В273-химера типа.

Фиг. 31 является фигурой, показывающей нуклеотидную последовательность, кодирующую тяжелую цепь В273-химера типа, и аминокислотную последовательность тяжелой цепи В273-химера типа.

Фиг. 32 является фигурой, показывающей нуклеотидную последовательность, кодирующую легкую цепь hB273_L1-типа, и аминокислотную последовательность легкой цепи hB273_L1-типа.

Фиг. 33 является фигурой, показывающей нуклеотидную последовательность, кодирующую легкую цепь hB273_L2-типа, и аминокислотную последовательность легкой цепи hB273_L2-типа.

Фиг. 34 является фигурой, показывающей нуклеотидную последовательность, кодирующую легкую цепь hB273_L3-типа, и аминокислотную последовательность легкой цепи hB273_L3-типа.

Фиг. 35 является фигурой, показывающей нуклеотидную последовательность, кодирующую тяжелую цепь hB273_Н1-типа, и аминокислотную последовательность тяжелой цепи hB273_Н1-типа.

Фиг. 36 является фигурой, показывающей нуклеотидную последовательность, кодирующую тяжелую цепь hB273_Н2-типа, и аминокислотную последовательность тяжелой цепи hB273_Н2-типа.

Фиг. 37 является фигурой, показывающей нуклеотидную последовательность, кодирующую тяжелую цепь hB273_Н3-типа, и аминокислотную последовательность тяжелой цепи hB273_Н3-типа.

Фиг. 38 является фигурой, показывающей нуклеотидную последовательность, кодирующую тяжелую цепь hB273_Н1-1-типа, и аминокислотную последовательность тяжелой цепи hB273_Н1-1-типа.

Фиг. 39 является фигурой, показывающей нуклеотидную последовательность, кодирующую тяжелую цепь hB273_Н2-1-типа, и аминокислотную последовательность тяжелой цепи hB273_Н2-1-типа.

Фиг. 40 является фигурой, показывающей нуклеотидную последовательность, кодирующую тяжелую цепь hB273_Н2-2-типа, и аминокислотную последовательность тяжелой цепи hB273_Н2-2-типа.

Фиг. 41 является фигурой, показывающей нуклеотидную последовательность, кодирующую тяжелую цепь hB273_Н2-3-типа, и аминокислотную последовательность тяжелой цепи hB273_Н2-3-типа.

Фиг. 42 является фигурой, показывающей нуклеотидную последовательность, кодирующую тяжелую цепь hB273_Н2-4-типа, и аминокислотную последовательность тяжелой цепи hB273_Н2-4-типа.

Фиг. 43 является фигурой, показывающей нуклеотидную последовательность, кодирующую тяжелую цепь hB273_Н2-5-типа, и аминокислотную последовательность тяжелой цепи hB273_Н2-5-типа.

Фиг. 44 является фигурой, показывающей нуклеотидную последовательность, кодирующую легкую цепь hB273_L1-NE-типа, и аминокислотную последовательность легкой цепи hB273_L1-NE-типа.

Фиг. 45 является фигурой, показывающей нуклеотидную последовательность, кодирующую легкую цепь hB273_L1-NF-типа, и аминокислотную последовательность легкой цепи hB273_L1-NF-типа.

Фиг. 46 является фигурой, показывающей нуклеотидную последовательность, кодирующую легкую цепь hB273_L1-NK-типа, и аминокислотную последовательность легкой цепи hB273_L1-NK-типа.

Фиг. 47 является фигурой, показывающей нуклеотидную последовательность, кодирующую легкую цепь hB273_L1-NL-типа, и аминокислотную последовательность легкой цепи hB273_L1-NL-типа.

Фиг. 48 является фигурой, показывающей нуклеотидную последовательность, кодирующую тяжелую цепь hB273_Н2-1-NE-типа, и аминокислотную последовательность тяжелой цепи hB273_Н2-1-NE-типа.

Фиг. 49 является фигурой, показывающей нуклеотидную последовательность кДНК, кодирующей легкую цепь конатумумаба, и аминокислотную последовательность легкой цепи конатумумаба.

Фиг. 50 является фигурой, показывающей нуклеотидную последовательность кДНК, кодирующей тяжелую цепь конатумумаба, и аминокислотную последовательность тяжелой цепи конатумумаба.

Фиг. 51 является фигурой, показывающей in vitro разрушающую клетки активность hB273_H2-1-NE/hB273_L1-NK-антитела против клеточных линий рака человека. А) показывает результаты для клеточной линии рака желудка человека, В) показывает результаты для клеточной линии рака почки человека, С) показывает результаты для клеточной линии рака печени человека и D) показывает результаты клеточной линии фибросаркомы человека.

Фиг. 52 является фигурой, показывающей in vivo противоопухолевую активность hB273_H2-1-NE/hB273_L1-NK-антитела (обозначенного как “hB273” на фигуре), в комбинации с 5-FU в мышах “nude”, имплантированных клеточной линией HST-15 рака ободочной кишки человека, и сравнение активности с конатумумабом.

Фиг. 53 является фигурой, показывающей in vivo противоопухолевую активность hB273_H2-1-NE/hB273_L1-NK-антитела (обозначенного как “hB273” на фигуре), в комбинации с паклитакселом в мышах “nude”, имплантированных клеточной линией NCI-H1975 немелкоклеточного рака легкого человека, и сравнение активности с конатумумабом.

Варианты осуществления изобретения

В данном контексте термины “злокачественное новообразование” и “опухоль” используются в одном и том же значении.

В данном контексте термин “ген” включает не только ДНК, но также ее мРНК, кДНК и кРНК.

Термин “полинуклеотид” используется в настоящем описании в том же самом значении, что и “нуклеиновая кислота”, и также включает ДНК, РНК, зонды, олигонуклеотиды и праймеры.

В данном контексте термины “полипептид” и “белок” используются без различия.

В данном контексте термин “фракция РНК” относится к фракции, содержащей РНК.

В данном контексте термин “клетка” включает также клетки в индивидууме-животном и культивируемые клетки.

В данном контексте термин “злокачественная трансформация клеток” относится к состоянию, в котором клетки обнаруживают аномальную пролиферацию, например, клетки теряют их чувствительность к феномену контактного ингибирования, клетки обнаруживают независимую от фиксации пролиферацию и т.д., и клетки, которые обнаруживают такую аномальную пролиферацию, называют “раковыми клетками”.

В данном контексте термин “повреждение клеток” относится к состоянию, в котором патологическое изменение вызывается в клетках в форме некоторого типа, и это повреждение клеток не ограничивается непосредственным повреждением и включает все сорта повреждения в отношении структуры и функции клеток, такие как расщепление ДНК, образование оснований-димеров, расщепление хромосом, повреждение аппарата деления клеток и уменьшение различных ферментативных активностей.

В данном контексте термин “цитотоксическая активность” относится к активности вызывания вышеописанного повреждения клеток.

В данном контексте термин “домен гибели-содержащий рецептор” (который включает Fas, TNFRI, DR3, DR4, DR5 и DR6, хотя и не ограничивается ими) относится к молекуле рецептора, имеющей домен трансдукции апоптотического сигнала, называемый “доменом гибели”, обнаруживающий гомологию с геном-самоубийцей Drosophila, регулятором апоптоза в Drosophila, во внутриклеточном домене.

В данном контексте термин “функциональный фрагмент антитела” относится к частичному фрагменту антитела, имеющему антигенсвязывающую активность, и включает Fab, F(ab')2, scFv и т.п. Этот термин включает также Fab', который является моновалентным фрагментом в вариабельном домене антитела, полученным обработкой F(ab')2 при восстанавливающих условиях. Однако, этот термин не ограничивается этими молекулами, пока фрагмент имеет аффинность связывания в отношении антигена. Кроме того, эти функциональные фрагменты включают не только фрагмент, полученный обработкой полноразмерной молекулы белка антитела подходящим ферментом, но также белок, продуцируемый в подходящей клетке-хозяине с использованием генетически модифицированного гена антитела.

В данном контексте термин “Fab” относится к моновалентному фрагменту в вариабельном домене антитела, полученному обработкой F(ab')2 при восстанавливающих условиях, как описано выше. Однако Fab', полученный с использованием гена генетически модифицированного антитела, также включен в термин Fab' настоящего изобретения.

Термин “одноцепочечный вариабельный фрагмент антитела” используется в данном контексте в том же самом значении, что и одноцепочечный Fv (scFv).

В данном контексте термин “эпитоп” относится к частичному пептиду или к частичной третичной структуре антигена, с которой связывается конкретное антитело. Эпитоп, который является частичным пептидом антигена, может быть определен способами, хорошо известными специалисту в данной области, такими как иммуноанализ, и, например, может быть использован следующий способ. Сначала, получают различные частичные структуры антигена. В получении этих частичных структур может быть использован известный способ синтеза олигопептидов. Например, ряд полипептидов, имеющих подходящим образом уменьшенные длины, полученных последовательным укорочением антигена с С-конца или N-конца, получают с использованием способа генетической рекомбинации, известного специалистам в данной области. После этого, реактивность антитела против этих полипептидов испытывают и определяют приблизительно сайт распознавания. Затем, пептиды, имеющие более короткие длины, синтезируют и испытывают реактивность с этими пептидами, посредством чего может быть определен эпитоп. Кроме того, эпитоп, который является частичной третичной структурой связывания антигена со специфическим антителом, может быть определен установлением аминокислотных остатков антигена, которые находятся рядом с антителом, при помощи рентгеновского структурного анализа.

В данном контексте термин “антитела, которые связываются с одним и тем же эпитопом”, относится к различным антителам, которые связываются с общим эпитопом. Если второе антитело связывается с частичным пептидом или частичной третичной структурой, с которой связано первое антитело, можно определить, что первое антитело и второе антитело связываются с одним и тем же эпитопом. Далее, посредством подтверждения, что второе антитело конкурирует с первым антителом за связывание с антигеном (т.е., второе антитело ингибирует связывание между первым антителом и антигеном), можно определить, что первое антитело и второе антитело связываются с одним и тем же эпитопом, даже если эта конкретная последовательность или структура эпитопа не была определена. Кроме того, когда это первое антитело и это второе антитело связываются с одним и тем же эпитопом, а также первое антитело имеет особое действие, такое как апоптоз-индуцирующая активность, можно ожидать, что второе антитело также имеет ту же самую активность.

В данном контексте термин “CDR” относится к определяющему комплементарность домену (CDR), и известно, что каждая тяжелая и легкая цепь молекулы антитела имеет три определяющих комплементарность домена (CDR). CDR называют также гипервариабельным доменом, и он присутствует в вариабельном домене каждой тяжелой и легкой цепи антитела. Он является сайтом, который имеет необычно высокую вариабельность в его первичной структуре, и имеются три отдельных CDR в первичной структуре каждой тяжелой и легкой полипептидной цепи. В настоящем описании, что касается CDR антитела, CDR тяжелой цепи представлены CDRH1, CDRH2 и CDRH3 от аминоконцевой стороны аминокислотной последовательности тяжелой цепи, и CDR легкой цепи представлены CDRL1, CDRL2 и CDRL3 от аминоконцевой стороны аминокислотной последовательности легкой цепи. Эти сайты находятся вблизи друг от друга в третичной структуре и определяют специфичность в отношении антигена, с которым связывается антитело.

В данном контексте термин “вторичное антитело” относится к антителу, которое связывается специфически с молекулой антитела, сшивая посредством этого эти молекулы антител.

Фраза “гибридизацию выполняют при жестких условиях” относится в настоящем описании к процессу, в котором гибридизация выполняется в условиях, при которых идентификация может достигаться проведением гибридизации при 68ºС в коммерчески доступном растворе для гибридизации (изготовляемом Clontech, Inc.) или проведением гибридизации при 68ºС в присутствии 0,7-1,0 М NaCl с использованием фильтра, имеющего иммобилизованную на нем ДНК, с последующим проведением промывки при 68ºС с использованием раствора 0,1-2 х SSC (1 х раствор SSC состоит из 150 мМ NaCl и 15 мМ цитрат натрия) или при условиях, эквивалентных этому.

Термин “несколько аминокислот” в описании “аминокислотная последовательность, включающая замену, делецию или добавление одной-нескольких аминокислот”, относится в данном контексте к произвольному числу аминокислотных остатков, выбранному из 2-10. Более конкретно, когда 10 или менее аминокислот, 5-6 или менее аминокислот, или 2-3 или менее аминокислот, заменены, делетированы или добавлены, используется описание “аминокислотная последовательность, включающая замену, делецию или добавление нескольких аминокислот”.

Описание, например, “вариабельного домена тяжелой цепи, имеющего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:34”, используется в настоящем описании в том же самом значении, что и описание “последовательности вариабельного домена тяжелой цепи, содержащей аминокислотные остатки 20-141 SEQ ID NO:34”. Далее, описание, например, “тяжелой цепи, имеющей аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:34” используется в том же самом значении, что и описание “последовательности тяжелой цепи, содержащей аминокислотные остатки 20-471 SEQ ID NO:34”.

1. Рассмотрение связанного с апоптозом гена

Антитело в соответствии с настоящим изобретением должно связываться со специфическим антигеном и проявлять цитотоксическую активность через антиген. Далее, необходимо выбрать антиген, специфически присутствующий в опухолевых клетках, для предотвращения уничтожения нормальных клеток. Один пример такой группы антигенов может включать рецепторные группы фактора некроза опухолей (далее называемого “TNF” в настоящем описании изобретения), родственного апоптоз-индуцирующему лиганду (далее называемому “TRAIL” в настоящем описании). TRAIL является представителем TNF-семейства белков и включает Fas-лиганды и TNF-α (Wiley SR, et al., Immunity 1995 Dec; 3 (6): 673-82). Эти белки являются сильными апоптоз-индуцирующими факторами.

Рецепторы для этих белков TNF-семейства характеризуются богатыми цистеином повторяющимися последовательностями во внеклеточном домене. Среди них, Fas, который является рецептором для Fas-лигандов, и TNF-рецептор I (далее называемый “TNFRI” в этом описании), который является рецептором для TNFα, имеют, во внутриклеточном домене, область, существенную для трансдукции апоптотического сигнала, называемый “доменом гибели”, который является областью, обнаруживающую гомологию с геном-самоубийцой Drosophila, регулятором апоптоза, Golstein, P., (1995) Cell. 81, 185-186 и White, K, et al., (1994) Science 264, 677-683); и коллективно называются содержащими домен гибели рецепторами.

Были идентифицированы пять рецепторов для TRAIL, и среди них, два рецептора (DR4 (TRAIL-R1) и DR5 (TRAIL-R2)) способны трансдуцировать апоптотический сигнал, а другие три рецептора (DcR1 (TRAIL-R3), DcR2 (TRAIL-R4) и остеопротегерин (OPG)) не трансдуцируют апоптотический сигнал. Подобно Fas и TNFRI, как DR4, так и DR5 включают домен гибели во внутриклеточном сегменте и трансдуцируют апоптотический сигнал через путь, содержащий Fas-связанный белок домена гибели (далее называемый “FADD” в настоящем описании) и каспазу 8 (Chaudhary PM, et al., Immunity 1997 Dec; 7 (6): 813-20; и Schneider P, et al. Immunity 1997 Dec; 7 (6): 821-30). Для Fas, TNFRI, DR4 или DR5, описанных выше, известно, что антитело, которое связывается с любой из этих молекул и функционирует как агонист, проявляет апоптоз-индуцирующую активность против клеток, несущих эту молекулу на поверхности клетки (Journal of Cellular Physiology, 209: 1221-1028 (2006); Leukemia, Apl; 21 (4): 805-812 (2007); Blood, 99: 1666-1675 (2002; и Cellular Immunology, Jan; 153 (1): 184-193 (1994)). Фармакологическое действие вышеописанного агонистического антитела усиливается сшиванием со вторичным антителом или эффекторной клеткой (Journal of Immunology, 149: 3166-3173 (1992); и European Journal of Immunology, Oct; 23 (10): 2676-2681 (1993)).

Нуклеотидная последовательность гена DR5 человека (рецептора гибели 5) и его аминокислотная последовательность были зарегистрированы как GI:22547118 (Номер доступа: NM_147187) в GenBank. В данном случае, нуклеотидная последовательность, кодирующая белок, который имеет аминокислотную последовательность, включающую замену, делецию или добавление одной-нескольких аминокислот в аминокислотной последовательности DR5, а также имеет эквивалент биологической активности относительно эквивалента DR5, также включен в значение термина “нуклеотидная последовательность гена DR5”. Далее, белок, который имеет аминокислотную последовательность, включающую замену, делецию или добавление одной-нескольких аминокислот в аминокислотной последовательности DR5, а также имеет эквивалент биологической активности относительно эквивалента DR5, также включен в значение термина “DR5”.

2. Получение анти-DR5-антитела

Антитело против DR5 по настоящему изобретению может быть получено иммунизацией животного DR5 или произвольным полипептидом, выбранным из аминокислотной последовательности DR5, и сбором и очисткой антитела, полученного in vivo, в соответствии с обычной процедурой. Биологический вид DR5 для использования в качестве антигена не ограничивается человеком, и животное может быть иммунизировано DR5, происходящим из животного, другого, чем человек, такого как мышь или крыса. В этом случае, посредством проведения перекрестной реактивности между антителом, которое связывается с полученным гетерологичным DR5 и DR5 человека, может быть отобрано антитело, используемое для лечения болезни человека.

Далее, моноклональное антитело может быть получено слиянием антителопродуцирующих клеток, которые продуцируют антитело против DR5, с миеломными клетками для установления гибридомы в соответствии с известным способом (например, Kohler and Milstein, Nature, (1975) 256, pp. 495-497, Kennet, R. Ed., Monoclonal Antibodies, pp. 365-367, Plenum Press, N.Y. (1980)).

В данном случае, DR5 для использования в качестве антигена может быть получен методами генной инженерии для экспрессии клеткой-хозяином гена DR5.

Конкретно, был получен вектор, способный экспрессировать ген DR5, и полученный вектор трансфицируют в клетку-хозяина для экспрессии гена, и затем экспрессированный DR5 очищают. Далее, способ получения антитела против DR5 будет описан более подробно.

(1) Получение антигена

Примеры антигена для использования для получения анти-DR5-антитела включают DR5, полипептид, содержащий частичную аминокислотную последовательность, содержащую по меньшей мере 6 последовательных аминокислот DR5, и производное, полученное путем добавления к ней конкретной аминокислотной последовательности или носителя.

DR5 может быть очищен непосредственно из тканей опухоли человека или опухолевых клеток. Кроме того, DR5 может быть очищен синтезом его in vitro или индукцией клетки-хозяина продуцировать его генетической инженерией.

Что касается генетической инженерии, конкретно, кДНК DR5 интегрируют в вектор, способный экспрессировать кДНК DR5, и DR5 синтезируется в растворе, содержащем фермент, субстрат и энергетическое вещество, необходимое для транскрипции и трансляции, или другую прокариотическую или эукариотическую клетка-хозяина трансформируют для экспрессии DR5, посредством чего может быть получен антиген.

Далее, антиген также может быть получен в виде секреторного белка путем экспрессии слитого белка, полученного соединением внеклеточного домена DR5, который является мембранным белком, с константным доменом антитела в подходящей системе хозяин-вектор.

кДНК DR5 может быть также получена, например, так называемым ПЦР-способом, в котором осуществляется полимеразная цепная реакция (далее обозначаемая в настоящем описании “ПЦР”) с использованием библиотеки кДНК, содержащей кДНК DR5, в качестве матрицы, и праймеров, которые специфически амплифицируют кДНК DR5 (см. Saiki, R.K., et al., Science, (1988) 239, pp. 487-489).

Что касается системы для синтеза in vitro полипептида, может быть приведена в качестве примера Система Быстрой Трансляции (RTS), изготовляемая Roche Diagnostics, Inc, но без ограничения ею.

Примеры прокариотической клетки-хозяина включают Escherichia coli и Bacillus subtilis. Для трансформации клетки-хозяина геном-мишенью клетку-хозяина трансформируют с использованием плазмидного вектора, содержащего репликон, т.е. точку инициации репликации, происходящую из вида, совместимого с хозяином, и регуляторной последовательности. Кроме того, вектор, предпочтительно, имеет последовательность, способную придавать фенотипическую селективность трансформированной клетке.

Примеры эукариотической клетки включают клетки позвоночных, клетки насекомых и клетки дрожжей. В качестве клеток позвоночных часто используют, например, штаммы, дефицитные по дигидрофолатредуктазе (Urlaub, G. and Chasin L. A., Proc. Natl. Acad. Sci. USA (1980) 77, pp. 4126-4220) клеток COS обезьяны (Gluzman, Y., Cell, (1981), pp. 175-182, ATCC CRL-1650), фибробласты NIH3T3 мыши (АТСС № CRL-1658) и клетки яичника Китайского хомячка (клетки СНО; АТСС: CRL-61); и т.п., однако они не ограничиваются ими.

Полученный таким образом трансформант может быть культивирован в соответствии с обычной процедурой, и посредством культивирования трансформанта получают полипептид-мишень внутриклеточно или внеклеточно.

Подходящая среда, которая должна быть использована для культивирования клеток, может быть выбрана из различных обычно используемых культуральных сред в зависимости от используемой клетки-хозяина. Если используется Escherichia coli, может быть использована, например, среда LB, дополненная антибиотиком, таким как ампициллин или IPMG, в случае необходимости.

Рекомбинантный белок, полученный внутриклеточно или внеклеточно посредством трансформанта с использованием такого культивирования, может быть выделен и очищен любым из различных известных способов выделения с использованием физического или химического свойства белка.

Конкретные примеры способов включают обработку обычным осадителем белка, ультрафильтрацию, различные типы жидкостной хроматографии, такие как хроматография на молекулярных ситах (гель-фильтрация), адсорбционная хроматография, ионообменная хроматография и аффинная хроматография, диализ, и их комбинации.

Кроме того, посредством присоединения метки из шести остатков гистидина к рекомбинантному белку, который должен быть экспрессирован, белок может быть эффективно очищен с использованием никель-аффинной колонки. Альтернативно, присоединением Fc-района IgG к рекомбинантному белку, который должен быть экспрессирован, белок может быть эффективно очищен с использованием протеин А-колонки.

Комбинированием вышеописанных способов, большое количество полипептида-мишени может быть легко получено с высоким выходом и с высокой чистотой.

(2) Получение моноклонального анти-DR5-антитела

Примеры антитела, которое специфически связывается с DR5, включают моноклональное антитело, которое специфически связывается с DR5, и способ получения антитела описан ниже.

Получение моноклонального антитела обычно требует следующих операционных стадий:

(а) очистки биополимера, который должен быть использован в качестве антигена;

(b) получения антителопродуцирующих клеток иммунизацией животного инъекцией антигена, сбором крови, анализом титра антитела в крови для определения, когда следует вырезать селезенку;

(с) получения миеломных клеток (далее называемых в настоящем описании “миеломой”);

(d) слияния этих антителопродуцирующих клеток с миеломой;

(е) скрининга группы гибридом, продуцирующих антитело-мишень;

(f) разделения гибридом на одноклеточные клоны (клонирования);

(g) необязательно, культивирования гибридомы или выращивания животного, имплантированного гибридомой, для получения большого количества моноклональных антител;

(h) испытания полученного таким образом моноклонального антитела на биологическую активность и специфичность связывания, или анализа его на свойства в качестве меченого реагента; и т.п.

Кроме того, способ получения моноклонального антитела будет описан подробно в соответствии с вышеописанными стадиями, однако, способ не ограничивается раскрытым в настоящем описании, и, например, могут быть использованы антителопродуцирующие клетки, другие, чем клетки селезенки и миелома.

(а) Очистка антигена

В качестве антигена, может быть использован DR5, полученный способом, описанным выше, или его частичный пептид.

Кроме того, в качестве антигена может быть использована также мембранная фракция, полученная из рекомбинантных клеток, экспрессирующих DR5, или сами рекомбинантные клетки, экспрессирующие DR5, а также частичный пептид белка по настоящему изобретению, химически синтезированный способом, известным специалистам в данной области.

(b) Получение антителопродуцирующих клеток

Антиген, полученный на стадии (а), смешивают с адъювантом, таким как полный или неполный адъювант Фрейнда или сульфат алюминия-калия, и полученную смесь используют в качестве иммуногена для иммунизации экспериментального животного. В качестве экспериментального животного, может быть использовано без затруднений любое животное, используемое в известном способе получения гибридом. Например, конкретно могут быть использованы мышь, крыса, коза, овца, крупный рогатый скот, лошадь или т.п. Однако, с точки зрения легкости доступности миеломных клеток, подлежащих слиянию с экстрагированными антителопродуцирующими клетками, в качестве животного, подлежащего иммунизации, используют предпочтительно мышь или крысу.

Кроме того, штамм мыши или крысы не ограничивается конкретно, и в случае мыши, например, могут быть использованы различные штаммы, такие как A, AKR, BALB/c, BDP, BA, CE, C3H, 57BL, C57BL, C57L, DBA, FL, HTH, HT1, LP, NZB, NZW, RF, RIII, SJL, SWR, WB и 129, и в случае крысы, например, могут быть использованы Wistar, Low, Lewic, Spraque, Dawley, ACI, BN, Fischer и т.п.

Среди них, при рассмотрении совместимости слияния с миеломными клетками, описанными ниже, в случае мыши, штамм BALB/c, и, в случае крысы, штаммы Wistar и Low являются особенно предпочтительными в качестве животного, подлежащего иммунизации.

Кроме того, при рассмотрении антигенной гомологии между людьми и мышами, также, предпочтительно, использование мыши, имеющей уменьшенную биологическую функцию для удаления аутоантител, т.е. мыши с аутоиммунным заболеванием.

Возраст мыши или крысы во время иммунизации является предпочтительно, возраст 5-12 недель, более предпочтительно, возраст 6-8 недель.

Для иммунизации животного DR5 или его рекомбинантным белком, может быть использован, например, известный способ, описанный подробно, например, в Weir, D. M., Handbook of Experimental Immunology Vol. I. II, III., Blackwell Scientific Publications, Oxford (1987), Kabat, E. A. and Mayer, M. M., Experimental Immunochemistry, Charles C Thomas Publisher Springfield, Illinois (1964) или т.п.

Клетки селезенки или лимфоциты, включающие антителопродуцирующие клетки, асептически удаляют из иммунизированного животного. В это время, измеряют титр антитела и, если используют животное, имеющее достаточно увеличенный титр антитела в качестве снабжающего источника антителопродуцирующих клеток, последующую процедуру можно проводить более эффективно.

Примеры способа измерения титра антитела для использования в настоящем описании, включают способ RIA и способ ELISA, но способ не ограничивается ими.

Отделение антителопродуцирующих клеток от клеток селезенки или лимфоцитов иммунизированного животного может проводиться согласно известному способу (например, Kohler et al., Nature (1975) 256, p. 495; Kohler et al., Eur. J. Immunol. (1977), 6, p. 511; Milstein et al., Nature (1977), 266, p. 550; Walsh, Nature (1977), 266, p. 495).

(с) Миеломные клетки (далее называемые “миеломой”)

Миеломные клетки, подлежащие использованию для слияния клеток, особо не ограничиваются, и подходящие клетки могут быть выбраны из известных клеточных линий. Однако, при рассмотрении эффективности, когда гибридома выбирается из слитых клеток, предпочтительным является использовние HGPRT-(гипоксантин-гуанин-фосфорибозилтрансфераза)-дефицитного штамма, процедура селекции которого была установлена.

Более конкретно, примеры штамма, дефицитного по HGPRT, включают X63-Ag8 (X-63), NS1-ANS/1 (NS1), P3X63-Ag8.U1 (P3U1), X63-Ag8.653 (X63.653) SP2/0-Ag14 (SP2/0), MPC11-45.6TG1.7 (45.6TG), F0, S149/5XXO и BU.1, полученные из мышей; 210.RSY3.Ag.1.2.3 (Y3), полученные из крыс; и U266AR (SKO-007), GM1500-GTG-A12 (GM1500), UC729-6, LICR-LOW-HMy2 (HMy2) и 8226AR/NIP4-1 (NP41), полученные из людей.

(d) Слияние клеток

Слияние между антителопродуцирующими клетками и миеломными клетками может подходящим образом выполняться в соответствии с известным способом (Weir, D.M. Handbook of Experimental Immunology Vol. I. II, III., Blackwell Scientific Publications, Oxford (1987), Kabat, E. A. and Mayer, M. M., Experimental Immunochemistry, Charles C Thomas Publisher Springfield, Illinois (1964) и т.д.), при таких условиях, что коэффициент выживаемости не является избыточно уменьшенным.

В качестве такого способа, может, например, использоваться химический способ, в котором антителопродуцирующие клетки и миеломные клетки смешивают в растворе, содержащем полимер, такой как полиэтиленгликоль, высокой концентрации, физический способ с использованием электрической стимуляции или т.п.

(е) Селекция группы гибридом

Способ селекции гибридом, полученных вышеописанным слиянием клеток, не ограничивается особенно. Обычно, используют способ селекции НАТ (гипоксантин, аминоптерин, тимидин) (Kohler et al., Nature (1975) 256, p. 495; Milstein et al., Nature (1977), 266, p. 550).

Способ является эффективным, когда гибридомы получают с использованием миеломных клеток штамма, дефицитного по HGPRT, которые не могут выживать в присутствии аминоптерина.

То есть, посредством культивирования неслитых клеток и гибридом в среде НАТ, создается возможность выживания и пролиферации только гибридом, устойчивых к аминоптерину.

(f) Разделение на одноклеточные клоны (клонирование)

В качестве способа клонирования для гибридом, может быть использован известный способ, такой как метилцеллюлозный способ, способ мягкой агарозы или способ лимитирующего разведения (см., например, Barbara, B. M. and Stanley, M. S.: Selected Methods in Cellular Immunology, W,H, Freeman and Company, San Francisco (1980)). Среди этих способов, конкретно, предпочтительным является способ трехмерного культивирования, такой как метилцеллюлозный способ. Например, группу гибридом, полученных слиянием клеток, суспендируют в метилцеллюлозной среде, такой как ClonaCell-HY Selection Medium D (изготовляемой StemCell Technologies, inc., #03804), и культивируют. Затем, образованные гибридомные колонии собирают, с получением посредством этого моноклональных гибридом. Собранные соответственные гибридомные колонии культивируют, и гибридомы, для которых подтверждалось наличие стабильного титра антител в полученном супернатанте гибридомной культуры, отбирают в качестве продуцирующего моноклональное DR5-антитело гибридомного штамма.

Примеры установленного таким образом гибридомного штамма включают DR5 гибридомный В273. В данном случае, в этом описании, антитело, продуцируемое гибридомой В273, называют “В273-антителом” или просто “В273”. Тяжелая цепь В273-антитела имеет аминокислотную последовательность SEQ ID NO:8 в Списке последовательностей. Кроме того, легкая цепь В273-антитела имеет аминокислотную последовательность SEQ ID NO:10 в Списке последовательностей. В данном случае, в аминокислотной последовательности тяжелой цепи SEQ ID NO:8 в Списке последовательностей, аминокислотная последовательность, содержащая аминокислотные остатки 1-19, является сигнальной последовательностью, аминокислотная последовательность, содержащая аминокислотные остатки 20-141, является вариабельным доменом и аминокислотная последовательность, содержащая аминокислотные остатки 142-465, является константным доменом. Далее, в аминокислотной последовательности легкой цепи SEQ ID NO:10 в Списке последовательностей, аминокислотная последовательность, содержащая аминокислотные остатки 1-19, является сигнальной последовательностью, аминокислотная последовательность, содержащая аминокислотные остатки 20-133, является вариабельным доменом и аминокислотная последовательность, содержащая аминокислотные остатки 134-238, является константным доменом.

Аминокислотная последовательность тяжелой цепи SEQ ID NO:8 в Списке последовательностей, кодируется нуклеотидной последовательностью SEQ ID NO:7 в Списке последовательностей. В нуклеотидной последовательности SEQ ID NO:7 в Списке последовательностей, нуклеотидная последовательность, содержащая нуклеотиды 1-57, кодирует сигнальную последовательность тяжелой цепи антитела, нуклеотидная последовательность, содержащая нуклеотиды 58-423, кодирует вариабельный домен тяжелой цепи антитела и нуклеотидная последовательность, содержащая нуклеотиды 424-1395, кодирует константный домен тяжелой цепи антитела.

Аминокислотная последовательность легкой цепи SEQ ID NO:10 в Списке последовательностей, кодируется нуклеотидной последовательностью SEQ ID NO:9 в Списке последовательностей. В нуклеотидной последовательности SEQ ID NO:9 в Списке последовательностей, нуклеотидная последовательность, содержащая нуклеотиды 1-57, кодирует сигнальную последовательность легкой цепи антитела, нуклеотидная последовательность, содержащая нуклеотиды 58-399, кодирует вариабельный домен легкой цепи антитела и нуклеотидная последовательность, содержащая нуклеотиды 400-714, кодирует константный домен легкой цепи антитела.

(g) Получение моноклонального антитела культивированием гибридомы

Культивированием отобранной таким образом гибридомы может быть эффективно получено моноклональное антитело. Однако, перед культивированием, предпочтительно, выполнять скрининг на гибридому, которая продуцирует моноклональное антитело-мишень.

В таком скрининге может быть использован известный способ.

Измерение титра антител в настоящем изобретении может проводиться, например, при помощи способа ELISA, описанного в пункте (b) выше.

Гибридома, полученная описанным выше способом, может храниться в замороженном состоянии в жидком азоте или в морозильнике при -80ºС или при более низкой температуре.

После завершения клонирования, среду заменяют со среды НТ на нормальную среду, и гибридому культивируют.

Широкомасштабное культивирование выполняют ротационным культивированием больших культуральных бутылей или с использованием “спин”-культуры (с постоянным перемешиванием). Из супернатанта, полученного при помощи широкомасштабной культуры, моноклональное антитело, которое специфически связывается с белком по настоящему изобретению, может быть получено очисткой с использованием способа, известного специалистам в данной области, такого как гель-фильтрация.

Кроме того, гибридому инъецируют в брюшную полость мыши того же штамма, что и гибридома (например, вышеописанных BALB/c), или Nu-Nu-мыши для пролиферации гибридомы, посредством чего может быть получен асцит, содержащий большое количество моноклонального антитела по настоящему изобретению.

В случае, когда гибридому вводят в брюшную полость, если минеральное масло, такое как 2,6,10,14-тетраметилпентадекан (пристан) вводят перед (за 3-7 дней раньше) введением гибридомы, может быть получено большое количество асцита.

Например, иммунодепрессант предварительно инъецируют в брюшную полость мыши того же штамма, что и гибридома, для инактивации Т-клеток. Спустя 20 дней после этого, 106-107 клеток гибридомного клона суспендируют в бессывороточной среде (0,5 мл) и суспензию инъецируют в брюшную полость мыши. Обычно, когда брюшная полость расширяется и наполняется асцитом, асцит собирают из мыши. При помощи этого способа моноклональное антитело может быть получено в концентрации, которая приблизительно в 100 раз или более выше, чем концентрация в культуральном растворе.

Моноклональное антитело, полученное вышеописанным способом, может быть очищено способом, описанным, например, в Weir, D. M., Handbook of Experimental Immunology Vol. I, II, III, Blackwell Scientific Publications, Oxford (1978).

Полученное таким образом моноклональное антитело имеет высокую антиген-специфичность в отношении DR5.

(h) Анализ моноклонального антитела

Изотип и подкласс полученного таким образом моноклонального антитела может быть определена следующим образом.

Прежде всего, примеры способа идентификации включают способ Ouchterlony, способ ELISA и способ RIA.

Способ Ouchterlony является простым, но когда концентрация моноклонального антитела является низкой, требуется операция конденсации.

С другой стороны, при использовании способа ELISA или способа RIA, прямое реагирование культурального супернатанта с антиген-адсорбированной твердой фазой и использование антител, соответствующих различным типам изотипов и подклассов иммуноглобулина, в качестве вторичных антител, может быть идентифицирован изотип и подкласс моноклонального антитела.

Кроме того, в качестве более простого способа, может быть также использован коммерчески доступный набор для идентификации (например, Mouse Typer Kit, изготовляемый Bio-Rad Laboratories, Inc.) или подобный способ.

Кроме того, количественное определение белка может выполняться способом Фолина-Лоури и способом расчета на основе оптической плотности при 280 нм [1,4 (OD280) = 1 мг/мл иммуноглобулина].

Кроме того, даже когда моноклональное антитело отдельно и независимо получено выполнением опять стадий (а)-(h) в вышеописанном пункте (2), можно получить антитело, имеющее цитотоксическую активность, эксивалентную цитотоксической активности В273. В качестве одного примера такого антитела, может быть приведено антитело, которое связывается с тем же самым эпитопом, что и В273-антитело. Если вновь продуцированное моноклональное антитело связывается с частичным пептидом или частичной третичной структурой, с которыми связывается В273-антитело, может быть определено, что моноклональное антитело связывается с тем же самым эпитопом, что и В273-антитело. Кроме того, посредством подтверждения, что моноклональное антитело конкурирует с В273 за связывание с DR5 (то-есть, это моноклональное антитело ингибирует связывание между В273-антителом и DR5), может быть определено, что моноклональное антитело связывается с тем же самым эпитопом, что и В273-антитело, даже если конкретная эпитопная последовательность или структура не была определена. В случае, когда моноклональное антитело связывается с тем же самым эпитопом, что и В273-антитело, можно с большой уверенностью ожидать, что оно имеет цитотоксическую активность, эквивалентную цитотоксической активности В273.

Кроме того, как показано в Примере 4, можно установить аминокислотный остаток на стороне DR5, который находится смежно с Fab-фрагментом антитела из данных дифракции рентгеновских лучей комплекса между Fab-фрагментом и DR5. Конкретно, в случае, когда Fab-фрагмент, полученный из производного антитела находится смежно с остатком глицина в положении 26, остатком изолейцина в положении 34, остатком глутаминовой кислоты в положении 36, остаком аспарагиновой кислоты в положении 37, остатком глицина в положении 38, остатком аспарагиновой кислоты в положении 56, остатком лейцина в положении 57, остатком лейцина в положении 58, остатком фенилаланина в положении 59, остатком лейцина в положении 61 и остатком аргинина в положении 62 аминокислотной последовательности SEQ ID NO:23 в Списке последовательностей, на расстоянии 4 ангстрем или менее, может быть определено, что антитело имеет специфичность в отношении того же самого эпитопа, что и В273.

(3) Другие антитела

Антитело по настоящему изобретению включает не только вышеописанное моноклональное антитело против DR5, но также рекомбинантное антитело, полученное искусственной модификацией, с целью уменьшения гетерологичной антигенности в людях, такое как химерное антитело, гуманизированное антитело и антитело человека. Эти антитела могут быть получены с использованием известного способа.

В качестве примера химерного антитела, может быть приведено антитело, в котором вариабельные и константные домены получены из различных видов, например, химерного антитела, в котором произведенный из мыши или крысы вариабельный домен антитела соединен с полученным из человека константным доменом (см. Proc. Natl. Acad. Sci. USA, 81, 6851-6855, (1994)). Химерное антитело, полученное из мышиного анти-DR5-человека-антитела В273, является антителом, содержащим тяжелую цепь, содержащую вариабельный домен тяжелой цепи, имеющий аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:20, и легкую цепь, содержащую вариабельный домен легкой цепи, имеющий аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:16, и может иметь произвольный константный домен. В качестве одного примера такого химерного антитела, может быть приведено антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:20 в списке последовательностей, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:16. В данном случае, в этой последовательности тяжелой цепи SEQ ID NO:20 в Списке последовательностей, аминокислотная последовательность, содержащая аминокислотные остатки 1-19, является сигнальной последовательностью, аминокислотная последовательность, содержащая аминокислотные остатки 20-141, является вариабельным доменом, и аминокислотная последовательность, содержащая аминокислотные остатки 142-471, является константным доменом. Кроме того, в аминокислотной последовательности легкой цепи SEQ ID NO:16 в Списке последовательностей, аминокислотная последовательность, содержащая аминокислотные остатки 1-20, является сигнальной последовательностью, аминокислотная последовательность, содержащая аминокислотные остатки 21-134, является вариабельным доменом и аминокислотная последовательность, содержащая аминокислотные остатки 135-239, является константным доменом.

Аминокислотная последовательность тяжелой цепи SEQ ID NO:20 в Списке последовательностей кодируется нуклеотидной последовательностью SEQ ID NO:19 в Списке последовательностей. В нуклеотидной последовательности SEQ ID NO:19 в Списке последовательностей, нуклеотидная последовательность, содержащая нуклеотиды 1-57, кодирует сигнальную последовательность тяжелой цепи антитела, нуклеотидная последовательность, содержащая нуклеотиды 58-423, кодирует вариабельный домен тяжелой цепи антитела и нуклеотидная последовательность, содержащая нуклеотиды 424-1413, кодирует константный домен тяжелой цепи антитела.

Аминокислотная последовательность легкой цепи SEQ ID NO:16 в Списке последовательностей, кодируется нуклеотидной последовательностью SEQ ID NO:15 в Списке последовательностей. В нуклеотидной последовательности SEQ ID NO:15 в Списке последовательностей, нуклеотидная последовательность, содержащая нуклеотиды 1-60, кодирует сигнальную последовательность легкой цепи антитела, нуклеотидная последовательность, содержащая нуклеотиды 61-402, кодирует вариабельный домен легкой цепи антитела и нуклеотидная последовательность, содержащая нуклеотиды 403-717, кодирует константный домен легкой цепи антитела.

В качестве примера гуманизированного антитела, может быть приведено антитело, полученное интеграцией только определяющих комплементарность областей (CDR) в полученное из человека антитело (см. Nature (1986) 321, pp. 522-525), и антитело, полученное трансплантацией части аминокислотных остатков каркаса, а также CDR-последовательностей в антитело человека способом CDR-трансплантации (WO90/07861).

Однако, гуманизированное антитело, полученное из В273-антитела, не ограничивается конкретным гуманизированным антителом, пока гуманизированное антитело имеет все 6 типов CDR-последовательностей В273 и имеет активность индукции апоптоза в клетках. В данном случае, вариабельный домен тяжелой цепи В273-антитела имеет CDRH1 (GYFMN), состоящий из аминокислотной последовательности SEQ ID NO:82 в Списке последовательностей, CDRH2 (RENPYNGDTFYNQKFKG), состоящий из аминокислотной последовательности SEQ ID NO:83, и CDRH3 (SAYYFDSGGYFDY), состоящий из аминокислотной последовательности SEQ ID NO:84. Кроме того, вариабельный домен легкой цепи В273-антитела имеет CDRL1 (RSSQSLVHSNGNTYLH), состоящий из аминокислотной последовательности SEQ ID NO:79 в Списке последовательностей, CDRL2 (KVSNRFS), состоящий из аминокислотной последовательности SEQ ID NO:80, и CDRL3 (SQSTHVPWT), состоящий из аминокислотной последовательности SEQ ID NO:81.

Кроме того, последовательность, включающая замену, делецию или добавление одного-нескольких аминокислотных остатков в одном из вышеописанных CDR, может быть использована в качестве CDR-последовательности, которая имеет CDR-модифицированное антитело, полученное из В273-антитела. Примеры последовательности, включающей замену одного аминокислотного остатка в CDRL1, включают последовательность (RSSQSLVHSNENTYLH), состоящую из аминокислотной последовательности SEQ ID NO:85 в Списке последовательностей, последовательность (RSSQSLVHSNFNTYLH), состоящую из аминокислотной последовательности SEQ ID NO:86, последовательность (RSSQSLVHSNKNTYLH), состоящую из аминокислотной последовательности SEQ ID NO:87, и последовательности (RSSQSLVHSNLNTYLH), состоящей из аминокислотной последовательности SEQ ID NO:88. Кроме того, примеры последовательности, включающей замену одного аминокислотного остатка в CDRH2, включают последовательность (RFNPYNEDTFYNQKFKG), состоящую из аминокислотной последовательности SEQ ID NO:89.

Обычно, деамидирование аспарагина в белке происходит посредством образования переходного состояния (состояния транзиции) циклического сукцинимида между аспарагином и соседней аминокислотой на С-концевой стороне (Geiger, T. and Clarke, S. (1987), Deamidation, Isomerization, and racemization at asparaginyl and ashartyl residues in peptides. Succinimid-linked reactions that contribute to protein degradation. J. Biol. Chem. 262, 785-794). Ограничивающим скорость фактором для образования состояния транзиции циклического сукцинимида является размер боковой цепи смежной аминокислоты, и, таким образом, глицин, который имеет наименьшую боковую цепь, может создавать самую быструю скорость деамидирования. С другой стороны, заменой смежной группы на С-концевой стороне аминокислотой, имеющей большую боковую цепь, скорость деамидирования может быть супрессирована. В273-антитело имеет -N-G-(аспарагин-глицин) последовательность, которая является чувствительной к деамидированию в CDRL1 и CDRH2. Таким образом, авторы настоящего изобретения получили точковые мутанты, в которых смежную группу изменяли с глицина на лизин, фенилаланин, лейцин или глутаминовую кислоту, каждая из которых имеет более длинную боковую цепь, чем глицин. То-есть, в CDRH2, -N-G-(аспарагин-глицин) последовательность мутируют в -N-E-(аспарагин-глутаминовая кислота) последовательность, и в CDRL1, -N-G-(аспарагин-глицин) последовательность мутируют в -N-L-(аспарагин-лейцин) последовательность, -N-F-(аспарагин-фенилаланин) последовательность, -N-K-(аспарагин-лизин) последовательность или -N-E-(аспарагин-глутаминовая кислота) последовательность, посредством чего деамидирование антитела супрессируется.

В качестве примера антитела, имеющего вышеописанные CDR, может быть приведено антитело, содержащее вариабельный домен тяжелой цепи, имеющий CDRH1, состоящий из аминокислотной последовательности SEQ ID NO:82 в Списке последовательностей, CDRH2, состоящий из аминокислотной последовательности SEQ ID NO:83, и CDRH3, состоящий из аминокислотной последовательности SEQ ID NO:84, и вариабельный домен легкой цепи, имеющий CDRL1, состоящий из аминокислотной последовательности SEQ ID NO:79 в Списке последовательностей, CDRL2, состоящий из аминокислотной последовательности SEQ ID NO:80, и CDRL3, состоящий из аминокислотной последовательности SEQ ID NO:81; антитело, содержащее вариабельный домен тяжелой цепи, имеющий CDRH1, состоящий из аминокислотной последовательности SEQ ID NO:82 в Списке последовательностей, CDRH2, состоящий из аминокислотной последовательности SEQ ID NO:89, и CDRH3, состоящий из аминокислотной последовательности SEQ ID NO:84, и вариабельный домен легкой цепи, имеющий CDRL1, состоящий из аминокислотной последовательности SEQ ID NO:85 в Списке последовательностей, CDRL2, состоящий из аминокислотной последовательности SEQ ID NO:80, и CDRL3, состоящий из аминокислотной последовательности SEQ ID NO:81; антитело, содержащее вариабельный домен тяжелой цепи, имеющий CDRH1, состоящий из аминокислотной последовательности SEQ ID NO:82 в Списке последовательностей, CDRH2, состоящий из аминокислотной последовательности SEQ ID NO:89, и CDRH3, состоящий из аминокислотной последовательности SEQ ID NO:84, и вариабельный домен легкой цепи, имеющий CDRL1, состоящий из аминокислотной последовательности SEQ ID NO:86 в Списке последовательностей, CDRL2, состоящий из аминокислотной последовательности SEQ ID NO:80, и CDRL3, состоящий из аминокислотной последовательности SEQ ID NO:81; антитело, содержащее вариабельный домен тяжелой цепи, имеющий CDRH1, состоящий из аминокислотной последовательности SEQ ID NO:82 в Списке последовательностей, CDRH2, состоящий из аминокислотной последовательности SEQ ID NO:89, и CDRH3, состоящий из аминокислотной последовательности SEQ ID NO:84, и вариабельный домен легкой цепи, имеющий CDRL1, состоящий из аминокислотной последовательности SEQ ID NO:87 в Списке последовательностей, CDRL2, состоящий из аминокислотной последовательности SEQ ID NO:80, и CDRL3, состоящий из аминокислотной последовательности SEQ ID NO:81; и антитело, содержащее вариабельный домен тяжелой цепи, имеющий CDRH1, состоящий из аминокислотной последовательности SEQ ID NO:82 в Списке последовательностей, CDRH2, состоящий из аминокислотной последовательности SEQ ID NO:89, и CDRH3, состоящий из аминокислотной последовательности SEQ ID NO:84, и вариабельный домен легкой цепи, имеющий CDRL1, состоящий из аминокислотной последовательности SEQ ID NO:88 в Списке последовательностей, CDRL2, состоящий из аминокислотной последовательности SEQ ID NO:80, и CDRL3, состоящий из аминокислотной последовательности SEQ ID NO:81.

В качестве примера гуманизированного антитела мышиного антитела В273 (в том числе CDR-модифицированного антитела), может быть приведена произвольная комбинация тяжелой цепи, содержащая вариабельный домен тяжелой цепи, содержащий аминокислотную последовательность, содержащую аминокислотные остатки 20-141 любой из SEQ ID NO:34, 36, 38, 40, 42, 44, 48, 50 и 70 в Списке последовательностей, с легкой цепью, содержащей вариабельный домен легкой цепи, содержащий аминокислотную последовательность, содержащую аминокислотные остатки 21-134 любой из SEQ ID NO:28, 30, 32, 52, 58, 62 и 66.

В качестве предпочтительной комбинации, могут быть приведены антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:34, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:28; антитело, отличающееся тем, что содержит вариабельный домен тяжелой цепи, содержащий аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:34, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:30; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:34, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:32; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:36, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:28; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:36, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:30; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:36, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:32; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:38, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:28; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:38, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:30; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:38, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:32; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:40, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:28; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:42, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:28; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:44, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:28; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:46, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:28; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:48, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:28; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:50, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:28; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:70, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:52; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:70, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:58; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:70, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:62; и антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:70, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:66.

В качестве более предпочтительной комбинации, могут быть приведены антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:34, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:28; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:34, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:30; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:34, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:32; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:36, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:28; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:36, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:30; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:36, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:32; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:38, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:28; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:38, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:30; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:38, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:32; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:40, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:28; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:42, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:28; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:44, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:28; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:46, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:28; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:48, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:28; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:50, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:28; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:70, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:52; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:70, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:58; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:70, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:62; и антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:70, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:66.

В качестве еще более предпочтительной комбинации, могут быть приведены антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:42, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:28; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:70, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:52; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:70, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:58; антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:70, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:62; и антитело, отличающееся содержанием вариабельного домена тяжелой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 20-141 SEQ ID NO:70, и вариабельного домена легкой цепи, содержащего аминокислотную последовательность, содержащую аминокислотные остатки 21-134 SEQ ID NO:66.

В качестве наиболее предпочтительной комбинации, могут быть приведены антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-171 SEQ ID NO:42, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:28; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:70, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:52; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:70, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:58; антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:70, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:62; и антитело, содержащее тяжелую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 20-471 SEQ ID NO:70, и легкую цепь, имеющую аминокислотную последовательность, содержащую аминокислотные остатки 21-239 SEQ ID NO:66.

Комбинированием последовательности, имеющей высокую гомологию с вышеописанной аминокислотной последовательностью тяжелой цепи, с последовательностью, имеющей высокую гомологию с вышеописанной аминокислотной последовательностью легкой цепи, можно отобрать антитело, имеющее цитотоксическую активность, эквивалентную цитотоксической активности каждого из вышеописанных антител. Гомология является обычно гомологией 80% или более, предпочтительно, гомологией 90% или более, более предпочтительно, гомологией 95% или более, наиболее предпочтительно, гомологией 99% или более. Кроме того, комбинированием аминокислотной последовательности, включающей замену, делецию или добавление одного-нескольких аминокислотных остатков в аминокислотной последовательности тяжелой цепи или легкой цепи, можно также отобрать антитело, имеющее цитотоксическую активность, эквивалентную цитотоксической активности каждого из вышеописанных антител. Количество аминокислотных остатков, которые должны быть заменены, делетированы или добавлены, равно обычно 10 или менее, предпочтительно, 5-6 или менее, более предпочтительно, 2-3 или менее, наиболее предпочтительно, 1.

Гомология между двумя аминокислотными последовательностями может быть определена с использованием версии 2.2.2 алгоритма Blast (Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller and David J. Lipman (1997), “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”, Nucleic Acids Res. 25: 3389-3402) с параметрами по умолчанию. Алгоритм Blast может быть также использован посредством Интернета с доступом к сайту www.ncbi.nlm.nih.gov/blast. В данном случае, два типа процентных величин идентичности (или идентичностей) и положительного результата (положительных результатов) рассчитывают при помощи алгоритма Blast. Первая является величиной, когда аминокислотные остатки совпадают друг с другом в двух аминокислотных последовательностях, для которых должна быть определена степень гомологии, а последняя является величиной, полученной посредством рассмотрения также аминокислотных остатков, имеющих сходную химическую структуру. В настоящем описании, величина идентичности, когда аминокислотные остатки совпадают друг с другом, используется в качестве величины гомологии.

В данном случае, в аминокислотной последовательности тяжелой цепи SEQ ID NO:34, 36, 38, 40, 42, 44, 46, 48, 50 и 70 в Списке последовательностей, аминокислотная последовательность, состоящая из аминокислотных остатков 1-19, является сигнальной последовательностью, аминокислотная последовательность, состоящая из аминокислотных остатков 20-141, является вариабельным доменом и аминокислотная последовательность, состоящая из аминокислотных остатков 142-471, является константным доменом. Кроме того, в аминокислотной последовательности легкой цепи SEQ ID NO:28, 30, 32, 52, 58, 62 или 66 в Списке последовательностей, аминокислотная последовательность, состоящая из аминокислотных остатков 1-20, является сигнальной последовательностью, аминокислотная последовательность, состоящая из аминокислотных остатков 21-134, является вариабельным доменом и аминокислотная последовательность, состоящая из аминокислотных остатков 135-239, является константным доменом.

Аминокислотная последовательность тяжелой цепи SEQ ID NO:34, 36, 38, 40, 42, 44, 46, 48, 50 или 70 в Списке последовательностей, кодируется нуклеотидной последовательностью SEQ ID NO:33, 35, 37, 39, 41, 43, 45, 47, 49 или 69 в Списке последовательностей. В каждой из вышеуказанных нуклеотидных последовательностей, нуклеотидная последовательность, состоящая из нуклеотидов 1-57, кодирует сигнальную последовательность тяжелой цепи антитела, нуклеотидная последовательность, состоящая из нуклеотидов 58-423, кодирует вариабельный домен тяжелой цепи антитела и нуклеотидная последовательность, состоящая из нуклеотидов 424-1413, кодирует константный домен тяжелой цепи антитела.

Аминокислотная последовательность легкой цепи SEQ ID NO:28, 30, 32, 52, 62 или 66 в Списке последовательностей, кодируется нуклеотидной последовательностью SEQ ID NO:27, 29, 31, 51, 57, 61 или 65 в Списке последовательностей. В каждой из вышеописанных нуклеотидных последовательностей, нуклеотидная последовательность, состоящая из нуклеотидов 1-60, кодирует сигнальную последовательность легкой цепи антитела, нуклеотидная последовательность, состоящая из нуклеотидов 61-402, кодирует вариабельный домен легкой цепи антитела и нуклеотидная последовательность, состоящая из нуклеотидов 403-717, кодирует константный домен легкой цепи антитела.

Гомология между любыми из этих нуклеотидных последовательностей и нуклеотидной последовательностью другого антитела может быть также определена с использованием алгоритма Blast.

Кроме того, антитело по настоящему изобретению включает антитело человека, которое связывается с тем же самым эпитопом, что и В273-антитело. Анти-DR5-антителом человека называют антитело человека, имеющего только последовательность гена антитела, полученного из хромосомы человека. Анти-DR5-антитело человека может быть получено способом, использующим продуцирующую антитело человека мышь, имеющую фрагмент хромосомы человека, содержащий гены тяжелой и легкой цепей антитела человека (см. Tomizuka, K. et al., Nature Genetics (1997) 16, pp. 133-143; Kuroiwa, Y. et al., Nucl. Acids Res. (1998) 26, pp. 3447-3448; Yoshida, H. et al., Animal Cell Technology: Basic and Applied Aspects vol. 10, pp. 69-73 (Kitagawa, Y., Matsuda, T. and Iijima, S. eds.), Kluwer Academic Publishers, 1999; Tomizuka, K. et al., Proc. Natl. Acad. Sci. USA (2000) 97, pp. 722-727, и т.д.).

Такая продуцирующая антитело человека мышь может быть создана конкретно следующим образом. Генетически модифицированное животное, в котором были разрушены эндогенные локусы генов тяжелой и легкой цепей иммуноглобулина, и вместо этого были введены локусы генов тяжелой и легкой цепей иммуноглобулина человека посредством вектора дрожжевой искусственной хромосомы (YAC) или подобного вектора, создается получением животного с нокаутом и трансгенного животного и скрещиванием этих животных.

Кроме того, в соответствии со способом генетической инженерии, с использованием кДНК, кодирующих такие тяжелую цепь и легкую цепь антитела человека, соответственно, и предпочтительно, вектора, содержащего кДНК, эукариотические клетки трансформируют, и трансформант, который продуцирует рекомбинантное моноклональное антитело человека, культивируют, посредством чего антитело может быть также получено из супернатанта культуры.

В настоящем описании, в качестве хозяина могут быть использованы, например, эукариотические клетки, предпочтительно, клетки млекопитающих, такие как СНО-клетки, лимфоциты или миеломные клетки.

Кроме того, известен также способ получения полученного при помощи фагового дисплея антитела человека скринингом библиотеки антител человека (см. Wormstone, I. M. et al., Investigative Ophthalmology & Visual Science, (2002) 43 (7), pp. 2301-2308; Carmen, S. et al., Briefings in Functional Genomics and Proteomics (2002), 1 (2), pp. 189-203; Siriwardena, D. et al., Ophthalmology (2002) 109 (3), pp. 427-431, etc.).

Например, может быть использован способ фагового дисплея, в котором вариабельный домен антитела человека экспрессируется на поверхности фага в виде одноцепочечного антитела (scFv), и отбирается фаг, который связывается с антигеном (Nature Biotechnology) (2005), 23, (9), pp. 1105-1116).

Посредством анализа гена, выбранного с использованием фага на основе связывания с антигеном, может быть определена ДНК-последовательность, кодирующая вариабельный домен антитела человека, который связывается с антигеном.

Если ДНК-последовательность scFv, которая связывается с антигеном, определена, антитело человека может быть получено получением вектора экспрессии, имеющего последовательность, и введением вектора в подходящего хозяина для его экспрессии (WO 92/01047, WO 92/20791, WO 93/06213, WO 93/11236, WO 93/19172, WO 95/01438, WO 95/15388, Annu. Rev. Immunol. (1994) pp. 433-455, Nature Biotechnology (2005) 23 (9), pp. 1105-1116).

Если вновь продуцируемое антитело человека связывается с частичным пептидом или частичной третичной структурой, с которыми связывается В273-антитело, можно определить, что антитело человека и В273-антитело связываются с одним и тем же эпитопом. Кроме того, посредством подтверждения, что антитело человека конкурирует с В273-антителом за связывание с DR5 (т.е., антитело человека ингибрует связывание между В273-антителом и DR5) можно определить, что антитело человека и В273-антитело связываются с одним и тем же эпитопом, даже если не были определены специфическая последовательность или структура эпитопа. При подтверждении, что антитело человека и В273-антитело связываются с одним и тем же эпитопом, можно с большой уверенностью ожидать, что антитело человека имеет цитотоксическую активность, эквивалентную цитотоксической активности В273.

Кроме того, как показано в Примере 4, можно установить аминокислотный остаток на стороне DR5, который находится смежно с Fab-фрагментом антитела, из данных дифракции рентгеновских лучей (рентгенографии) комплекса между Fab-фрагментом и DR5. Конкретно, в случае, когда Fab-фрагмент, полученный из произвольного антитела, находится смежно с остатком глицина в положении 26, остатком изолейцина в положении 34, остатком глутаминовой кислоты в положении 36, остатком аспарагиновой кислоты в положении 37, остатком глицина в положении 38, остатком аспарагиновой кислоты в положении 56, остатком лейцина в положении 57, остатком лейцина в положении 58, остатком фенилаланина в положении 59, остатком лейцина в положении 61 и остатком аргинина в положении 62 аминокислотной последовательности SEQ ID NO:23 в Списке последовательностей, на расстоянии 4 ангстрем или менее, может быть определено, что антитело связывается с тем же самым эпитопом, что и В273.

Химерные антитела, гуманизированные антитела или антитела человека, полученные вышеописанным способом, оцениваются на свойство связывания с антигеном посредством способа, показанного в Примере 3, или подобного способа, и может быть отобрано предпочтительное антитело. В качестве одного примера другого показателя для использования в сравнении свойств антител может быть приведена стабильность антител. Дифференциальная сканирующая калориметрия (DSC), показанная в Примере 10, является устройством, способным быстро и точно измерять температуру средней точки термической денатурации Tm для использования в качестве подходящего показателя относительной конформационной стабильности белков. Измерением этих величин Tm с использованием DSC и сравнением этих величин, может сравниваться различие термостабильности. Известно, что стабильность при хранении антител обнаруживает некоторую корреляцию с термостабильностью антител (Lori Burton, et al., Pharmaceutical Development and Technology (2007) 12, pp. 265-273), и предпочтительное антитело может быть выбрано с использованием термостабильности в качестве показателя. Примеры других показателей для селекции антител, включают следующие факторы: выход в подходящей клетке-хозяине является высоким и агрегируемость в водном растворе является низкой. Например, антитело, которое обнаруживает наивысший выход, не всегда обнаруживает наивысшую термостабильность, и, следовательно, необходимо отбирать антитело, наиболее подходящее для введения людям, проведением исчерпывающего оценивания на основе вышеописанных показателей.

Кроме того, известен способ, в котором полноразмерные тяжелая и легкая цепи последовательности антитела соединены с использованием подходящего линкера, посредством чего получают одноцепочечный иммуноглобулин (Lee, H-S, et al., Molecular Immunology (1999) 36, pp. 61-71; Shirrman, T. et al., mAbs (2010), 2, (1) pp. 1-4). Вследствие димеризации такого одноцепочечного иммуноглобулина, полученный димер может иметь структуру и активность, сходные со структурой и активностью антитела, которое само является тетрамером. Кроме того, антитело по настоящему изобретению может быть антителом, которое имеет единственный вариабельный домен тяжелой цепи и не имеет последовательности легкой цепи. Такое антитело называют антителом с одним доменом (sdAb) или нанотелом, и фактически, такое антитело наблюдается в верблюдах и ламах, и сообщалось, что оно имеет антигенсвязывающую аффинность (Muyldemans S. et al., Pritein Eng. (1994) 7 (9), 1129-35, Hamers-Casterman C. et al., Nature (1993) 363 (6428) 446-8). Вышеописанные антитела включены в антитело в соответствии с настоящим изобретением.

Кроме того, посредством контролирования гликозилирования, в котором гликан связывается с антителом по настоящему изобретению, можно увеличивать антиген-зависимую цитотоксическую активность. В качестве способа для контролирования гликозилирования антител, известны WO 99/54342, WO 00/61739, WO 02/31140, и т.д. Однако они не ограничиваются этим.

В случае, когда антитело получают сначала выделением гена антитела и затем введением антитела в подходящего хозяина, может быть использована комбинация подходящего хозяина и подходящего вектора экспрессии. Конкретные примеры гена антитела включают комбинацию гена, кодирующего последовательность тяжелой цепи антитела, описанного в настоящем описании, и гена, кодирующего последовательность легкой цепи антитела. Когда клетка-хозяин является трансформированной, можно инсертировать ген последовательности тяжелой цепи и ген последовательности легкой цепи в один и тот же вектор экспрессии, а также в различные векторы экспрессии раздельно. В случаях, в которых в качестве хозяина используют эукариотические клетки, могут быть использованы клетки животного, растительные клетки и эукариотические микроорганизмы. В качестве примеров клеток животных могут быть приведены (1) клетки млекопитающих, например, штаммы, дефицитные по дигидрофолат-редуктазе (Urlaub, G. and Chasin, L.A., Proc. Natl. Acad. Sci. USA (1980) 77, pp. 4126-4220) COS-клеток обезьян (Gluzman, Y., Cell, (1981) 23, pp. 175-182, ATCC CRL-1650), мышиные фибробласты NIH3T3 (АТСС № CRL-1658) и клетки яичника Китайского хомячка (СНО-клетки; АТСС: CCL-61). Далее, в случае, когда использовали прокариотические клетки, могут быть приведены в качестве примеров, например, Escherichia coli и Bacillus subtilis. Введением гена антитела-мишени в клетки посредством трансформации и культивированием таким образом трансформированных клеток in vitro, может быть получено антитело. В вышеописанном способе культивирования, выход может иногда варьироваться в зависимости от последовательности антитела, и, следовательно, можно отбирать антитело, которое легко можно получить в качестве фармацевтического препарата, с использованием выхода как показателя среди антител, имеющих сравнимую активность связывания.

Не существует ограничения в отношении изотипа антитела по настоящему изобретению, и примеры его включают IgG (IgG1, IgG2, IgG3, IgG4), IgM, IgA (IgA1, IgA2), IgD и IgE, и их предпочтительные примеры включают IgG1 и IgG2.

Кроме того, антителом по настоящему изобретению может быть функциональный фрагмент антитела, имеющий антигенсвязывающий сайт антитела или его модифицированный фрагмент. Фрагмент этого антитела может быть получен обработкой антитела протеазой, такой как папаин или пепсин, или модификацией гена антитела согласно способу генетической инженерии и экспрессией этого модифицированного гена в подходящих культивируемых клетках. Среди этих фрагментов антител, фрагмент, имеющий все функции или часть функций полноразмерной молекулы антитела, может быть назван функциональным фрагментом антитела. В качестве функций антитела, могут быть приведены в качестве примеров, обычно антигенсвязывающая активность, активность нейтрализации активности антигена, активность усиления активности антигена, антителозависимая цитотоксическая активность, комплемент-зависимая цитотоксическая активность и комплемент-зависимая клеточная цитотоксическая активность. Функцией функционального фрагмента антитела по настоящему изобретению является активность связывания с DR5, предпочтительно, активность индукции апоптоза в клетках, более предпочтительно, цитотоксическая активность через индукцию апоптоза в раковых клетках. Однако антитело по настоящему изобретению может иметь антителозависимую цитотоксическую активность, комплемент-зависимую цитотоксическую активность и/или комплемент-зависимую клеточную цитотоксическую активность, а также активность индуцирования апоптоза в клетках.

Примеры фрагмента антитела включают Fab, F(ab')2, Fv, одноцепочечный Fv (scFv), в котором Fv-молекулы тяжелой цепи и легкой цепи соединены через подходящий линкер, диатело (диатела), линейное антитело и полиспецифическое антитело, состоящее из фрагмента антитела. Кроме того, Fab', который является моновалентным фрагментом в вариабельном домене антитела, полученным обработкой F(ab')2 при восстанавливающих условиях, также включен в фрагмент антитела.

Кроме того, антитело по настоящему изобретению может быть полиспецифическим антителом со специфичностью в отношении по меньшей мере двух различных антигенов. Обычно, такая молекула связывается с двумя антигенами (т.е. является биспецифическим антителом), однако, термин “полиспецифическое антитело” включает в данном контексте антитело, имеющее специфичность в отношении двух или более (например, трех) антигенов.

Полиспецифическое антитело по настоящему изобретению может быть полноразмерным антителом или фрагментом такого антитела (например, биспецифическим антителом F(ab')2). Это биспецифическое антитело может быть получено соединением тяжелой и легкой цепей (HL-пар) двух типов антител, или может быть также получено слиянием гибридом, которые продуцируют различные моноклональные антитела, для получения продуцирующих биспецифическое антитело слитых клеток (Millstein et al., Nature (1983) 305, pp. 537-539).

Антитело по настоящему изобретению может быть одноцепочечным антителом (также называемым scFv). Это одноцепочечное антитело может быть получено соединением вариабельного домена тяжелой цепи и вариабельного домена легкой цепи антитела посредством полипептидного линкера (Pluckthun, The Pharmacology of Monoclonal Antibodies, 113 (edited by Rosenburg and Moore), Springer Verlag, New York, pp. 269-315 (1994), Nature Biothechnology (2005), 23, pp. 1126-1136). Кроме того, BiscFv-фрагмент, получаемый соединением двух молекул scFv через полипептидный линкер, может быть также использован в качестве биспецифического антитела.

Способ получения одноцепочечного антитела известен в данной области техники (см., например, патенты США с номерами 4946778, 5260203, 5091513, 5455030 и т.д.). В этом scFv, вариабельный домен тяжелой цепи и вариабельный домен легкой цепи соединены через линкер, который не образует конъюгат, предпочтительно через полипептидный линкер (Huston, J. S. et al., Proc. Natl. Acad. Sci. USA (1988), 85, pp. 5879-5883). В scFv, вариабельный домен тяжелой цепи и вариабельный домен легкой цепи могут быть получены из одного и того же антитела или из разных антител.

В качестве полипептидного линкера для использования для соединения вариабельных доменов, используют, например, одноцепочечный пептид, состоящий из 12-19 остатков.

ДНК, кодирующая scFv, может быть получена выполнением амплификации с использованием ДНК, кодирующей всю аминокислотную последовательность или желаемую частичную аминокислотную последовательность, из ДНК, выбранной из ДНК, кодирующей тяжелую цепь или вариабельный домен тяжелой цепи вышеописанного антитела, и ДНК, кодирующей легкую цепь или вариабельный домен легкой цепи антитела, в качестве матрицы при помощи ПЦР-способа с использованием пары праймеров, которая определяет оба его конца, и дополнительно выполнением амплификации объединением ДНК, кодирующей полипептидную линкерную часть, и пары праймеров, которая определяет оба ее конца таким образом, чтобы соединить оба эти конца с тяжелой цепью и легкой цепью, соответственно.

Кроме того, после получения ДНК, кодирующего scFv, вектор экспрессии, содержащий его, и хозяин, трансформированный вектором экспрессии, могут быть получены в соответствии с обычной процедурой. Далее, с использованием полученного хозяина, scFv может быть получен в соответствии с обычной процедурой. Фрагмент антитела может быть получен в хозяине получением гена и экспрессии гена таким же образом, как описано выше.

Антитело по настоящему изобретению может быть мультимеризовано для увеличения его аффинности в отношении антигена. Антитело, подлежащее мультимеризации, может быть одним типом антитела или множеством антител, которые распознают множество эпитопов одного и того же антигена. В качестве мультимеризации антитела может быть приведено связывание СН3-домена IgG с двумя молекулами scFv, связывание со стрептавидином, введение мотива спираль-петля-спираль и т.п.

Антитело по настоящему изобретению может быть поликлональным антителом, которое является смесью множественных типов анти-DR5-антител, имеющих разные аминокислотные последовательности. В качестве одного примера поликлонального антитела, может быть приведена смесь множественных типов антител, имеющих разные CDR. В качестве такого поликлонального антитела могут быть использованы антитела, полученные культивированием смеси клеток, которые продуцируют различные антитела, и затем очисткой антител из полученной культуры (см. WO 2004/061104).

В качестве модифицированного антитела, может быть также использовано антитело, связанное с любым типом молекул, таких как полиэтиленгликоль.

Кроме того, антитело по изобретению может быть в форме конъюгата, образованного между любым из этих антител и другим лекарственным средством (иммуноконъюгат). Примеры такого антитела включают пример, в котором антитело конъюгировано с радиоактивным веществом или соединением, имеющим фармакологическое действие (Nature Biotechnology (2005) 23, pp. 1137-1146).

Полученное антитело может быть очищено до гомогенности. Выделение и очистка этого антитела может выполняться с использованием общепринятого выделения белка и способа очистки. Например, антитело может быть выделено и очищено подходящим выбором и комбинированием колоночной хроматографии, гель-фильтрации, ультрафильтрации, осаждения солью, диализа, препаративного гель-электрофореза на полиакриламидном геле, электрофореза с изоэлектрическим фокусированием и т.п. (Strategies for Protein Purification and Characterization: A Laboratory Course Manual, Daniel R. Marshak et al., eds., Cold Spring Harbor Laboratory Press (1996); Antibodies: A Laboratory Manual. Ed Harlow and David Lane, Cold Spring Harbor Laboratory (1988)), но этот способ не ограничивается этим.

Примеры такой хроматографии включают аффинную хроматографию, ионообменную хроматографию, гидрофобную хроматографию, гель-фильтрационную хроматографию, хроматографию с обращенной фазой и абсорбционную хроматографию.

Такая хроматография может выполняться с использованием жидкостной хроматографии, такой как HPLC или FPLC.

В качестве примера колонки для использования в аффинной хроматографии могут быть приведены Протеин А-колонка и Протеин G-колонка.

Например, в качестве примера колонки, использующей Протеин А-колонку, могут быть приведены Hyper D, POROS, Сефароза FF (Pharmacia) и т.п. Кроме того, с использованием носителя, имеющего иммобилизованный на нем антиген, антитело может быть очищено с использованием свойства связывания антитела с антигеном.

(4) Конкретные примеры других анти-DR5-антител

Анти-DR5-антитела, которые индуцируют апоптоз в DR5-экспрессирующих клетках, описаны, например, в WO 98/51793, WO 2001/83560, WO 2002/94880, WO 2003/54216, WO 2006/83971 и WO 2007/22157. Кроме того, анти-DR5-антитела, названные тигатуцумабом (CS-1008), лексатумумабом (HGS-ETR2), HGS-TR2J, дроцитумабом (APOMAB), конатумумабом (ANG-655) и LBY135, находятся все еще в клинических испытаниях или были в клинических испытаниях в прошлом. Анти-DR5-антителами, которые все еще находились в клинических испытаниях к дате, когда была подана эта заявка, являются тигатуцумаб, лексатумумаб и конатумумаб. Новые анти-DR5-антитела, описанные в этом описании изобретения, имеют превосходство в in vitro и/или in vivo противоопухолевой активности по сравнению с вышеописанными тигатуцумабом, лексатумумабом, конатумумабом и дроцитумабом.

3. Фармацевтический препарат, содержащий анти-DR5-антитело

Антитела, полученные способом, описанным в пункте “2. Получение анти-DR5-антитела”, могут быть использованы в качестве фармацевтического средства, конкретно, терапевтического и/или профилактического средства для лечения злокачественного новообразования, поскольку антитела, каждое, функционируют в качестве агониста для связанного с апоптозом рецептора, DR5, in vivo и индуцируют апоптоз в раковых клетках через рецептор для проявления цитотоксической активности.

Разрушающая клетки активность, проявляемая антителом in vitro, может быть определена измерением их активности в ингибировании пролиферации клеток, которые сверхэкспрессируют связанный с апоптозом рецептор.

Например, клеточную линию рака, которая сверхэкспрессирует DR5, культивируют, антитело добавляют к культуральной системе при различных концентрациях, и может быть измерена ингибиторная активность против образования очага, образования колоний и пролиферации сфероидов.

In vivo терапевтическое действие антитела на злокачественное новообразование с использованием экспериментальных животных может быть определено, например, измерением изменения в раковых клетках введением антитела мышам “nude”, имплантированным линией опухолевых клеток, которые сверхэкспрессируют DR5.

Примеры типа злокачественного новообразования включают рак легкого, рак предстательной железы, рак щитовидной железы, рак желудка, рак печени, рак ободочной кишки, рак молочной железы, рак поджелудочной железы, рак почки, рак матки, меланокарциному, в том числе меланому, фибросаркому, глиобластому, и рак клеток крови (такой как лейкоз и лимфома), однако тип рака не ограничивается ими, пока раковая клетка, подлежащая лечению, экспрессирует DR5.

Кроме того, известно, что антитело против DR5 индуцирует апоптоз в воспалительных клетках (J. Clin. Invest. 1996, 98 (2), 271-278, Int. Immunol. 1996, 8 (10), 1595-1602). Таким образом, антитело по изобретению может быть также использовано в качестве терапевтического средства для аутоиммунного заболевания или воспалительного заболевания. Примеры аутоиммунного заболевания или воспалительного заболевания включают системную красную волчанку, болезнь Хашимото, ревматоидный артрит, болезнь трансплантат против хозяина, синдром Шегрена, пернициозную анемию, болезнь Аддисона, склеродермию, синдром Гудпасчера, болезнь Крона, аутоиммунную гемолитическую анемию, стерильность, тяжелую псевдопаралитическую миастению, рассеянный склероз, базедову болезнь (болезнь Грейвса), тромбоцитопеническую пурпуру, инсулинозависимый сахарный диабет, аллергию, астму, атопическое заболевание, артериосклероз, миокардит, кардиомиопатию, гломерулонефрит, апластическую анемию и отторжение после трансплантации органа.

Вещество для использования в препарате, приемлемое в фармацевтической композиции по настоящему изобретению, является, предпочтительно, нетоксичным для лица, которому должна вводиться эта фармацевтическая композиция, в плане дозы и концентрации.

Фармацевтическая композиция по настоящему изобретению может содержать вещество для фармацевтического применения, которое способно изменять или поддерживать рН, осмотическое давление, вязкость, прозрачность, цвет, изотоничность, асептическое состояние, стабильность, растворимость, скорость высвобождения, скорость абсорбции и его проницаемость. Примеры такого вещества для фармацевтического применения включают, но не ограничиваются ими, аминокислоты, такие как глицин, аланин, глутамин, аспарагин, аргинин и лизин; противомикробные средства; антиоксиданты, такие как аскорбиновая кислота, сульфат натрия и гидросульфит натрия; буферы, такие как фосфатный, цитратный, боратный, гидрокарбонат натрия и Трис-HCl-растворы; наполнители, такие как маннит и глицин; хелатообразующие средства, такие как этилендиаминтетраацетат (ЭДТА); комплексообразующие средства, такие как кофеин, поливинилпирролидин, β-циклодекстрин и гидроксипропил-β-циклодекстрин; расширители, такие как глюкоза, манноза и декстрин; другие карбогидраты, такие как моносахариды и дисахариды; красящие средства; ароматизаторы; разбавители; эмульгирующие средства; гидрофильные полимеры, такие как поливинилпирролидин; консерванты, такие как низкомолекулярные полипептиды, солеобразующие противоионы, хлорид бензалкония, бензойная кислота, салициловая кислота, тимерозал, фенетиловый спирт, метилпарабен, пропилпарабен, хлоргексидин, сорбиновая кислота и пероксид водорода; растворители, такие как глицерин, пропиленгликоль и полиэтиленгликоль; сахароспирты, такие как маннит и сорбит; суспендирующие средства; поверхностно-активные вещества, такие как сложный эфир сорбитана, полисорбаты, в том числе полисорбат 20 и полисорбат 80, Тритон, трометамин, лецитин и холестерин; усиливающие стабильность средства, такие как сахароза и сорбит; увеличивающие эластичность средства, такие как хлорид натрия, хлорид калия, и маннит, и сорбит; средства транспорта; эксципиенты и/или фармацевтические адъюванты. Количество веществ для фармацевтического применения является, предпочтительно, 0,01-100-кратным, особенно предпочтительно, 0,1-10-кратным относительно массы анти-DR5-антитела. Специалисты в данной области могут подходящим образом определять предпочтительную форму фармацевтической композиции в препарате, в зависимости от заболевания, для которого применяют эту композицию, способа применяемого введения или т.п.

Эксципиент или носитель в фармацевтической композиции может находиться в форме жидкости или твердого вещества. Подходящим эксципиентом или носителем может быть вода для инъекций, физиологический солевой раствор, искусственная цереброспинальная жидкость или другое вещество, обычно используемое для парентерального введения. Кроме того, в качестве носителя могут быть также использованы нейтральный физиологический солевой раствор или физиологический солевой раствор, содержащий сывороточный альбумин. Фармацевтическая композиция может содержать Трис-буфер рН 7,0-8,5, ацетатный буфер рН 4,0-5,5 или цитратный буфер рН 3-6,2. Кроме того, такой буфер может быть дополнен сорбитом или другим соединением.

Примеры фармацевтической композиции по настоящему изобретению включают фармацевтическую композицию, содержащую анти-DR5-антитело, и фармацевтическую композицию, содержащую анти-DR5-антитело и по меньшей мере одно терапевтическое средство для лечения злокачественного новообразования. Фармацевтическую композицию по изобретению получают в форме лиофилизированного продукта или жидкости в виде лекарственного средства, имеющего выбранную композицию и требуемую чистоту. Фармацевтическая композиция, содержащая анти-DR5-антитело, и фармацевтическая композиция, содержащая анти-DR5-антитело и по меньшей мере одно терапевтическое средство для лечения рака, может быть также получено в лиофилизированной форме с использованием подходящего эксципиента, такого как сахароза.

В вышеописанной фармацевтической композиции, терапевтическое средство для лечения злокачественного новообразования, подлежащее включению вместе с анти-DR5-антителом, может вводиться одновременно с анти-DR5-антителом, или терапевтическое средство и это анти-DR5-антитело могут вводиться при различных дозовых интервалах. Примеры такого терапевтического средства для лечения рака включают абраксан, карбоплатин, цисплатин, гемцитабин, иринотекан (CPT-11), паклитаксел, пеметрексед, сорафениб, винбластин, 5-FU и лекарственные средства, описанные в WO 2003/038043, однако, средство не ограничивается ими, пока средство является лекарственным средством, имеющим противоопухолевую активность.

Фармацевтическая композиция по изобретению может быть получена для парентерального введения или для желудочно-кишечной абсорбции через пероральное введение. Состав и концентрация препарата может быть определена в зависимости от способа введения. Более высокая аффинность анти-DR5-антитела, содержащегося в фармацевтической композиции по изобретению, является аффинностью в отношении DR5, т.е. чем ниже константа диссоциации (величина Kd) в отношении DR5, тем больше анти-DR5-антитело может проявлять его лекарственную эффективность, даже при уменьшении дозы для людей. Следовательно, доза фармацевтической композиции по настоящему изобретению для людей может быть также определена на основе этого факта. Что касается дозы, в случае, когда анти-DR5-антитело человека вводят людям, антитело может вводиться в дозе от приблизительно 0,1-100 мг/кг один раз на один-180 дней.

Примеры лекарственной формы фармацевтической композиции по настоящему изобретению включают инъекции, в том числе инфузии, суппозитории, трансназальные средства, сублингвальные средства и чрескожные абсорбенты.

Далее, настоящее изобретение будет описано более конкретно со ссылкой на Примеры, однако, настоящее изобретение не ограничивается ими. Обратите внимание на то, что соответствующие операции, касающиеся манипулирования генами, в следующих Примерах выполнялись в соответствии со способами, описанными в “Molecular Cloning” (написанном Sambrook, J., Fritsch, E.F. and Maniatis, T., опубликованном Cold Spring Harbor Laboratory Press в 1989 году), или, в случае использования коммерчески доступных реагентов или наборов, их использовали в соответствии с протоколами, прикрепленными к ним, если нет других указаний.

Пример 1. Получение антитела В273 мыши

1)-1 Получение белка DR5 человека (слитого белка внеклеточный домен DR5 человека/Fc человека)

1)-1-1 Получение вектора экспрессии внеклеточного домена DR5 человека

Вектор, экспрессирующий белок DR5 человека (изоформу 2: NP_671716), конструировали инсертированием гена, в котором внеклеточный домен DR5 человека был слит с IgG1 человека/Fc-области, справа от промотора CMV.

1)-1-2 Получение белка DR5 человека

Введение вектора экспрессии в клетки 293 FreeStyle и сбор культурального супернатанта проводили в Invitrogen Corporation (в настоящее время Life Technologies Japan Ltd.).

1)-1-3 Очистка белка DR5 человека

Культуральный супернатант, полученный, как описано выше в b), очищали с использованием хроматографии с использованием Протеин A-аффинной колоночной хроматографии. 5 л культурального супернатанта наносили на “HiTrap Protein AFF” (GE Healthcare Bio-Sciences Co., Ltd., Cat. No. 17-5079-01), уравновешенной ЗФР, с последующим промыванием ЗФР. Затем, в колонку добавляли 2 М раствор аргинина (рН 4,0) и фракцию, содержащую белок DR5 человека, собирали. Фракцию добавляли в центрифужное фильтрующее устройство (Amicon Ultra-4, фракционная молярная масса: 10 К, Millipore Co., Ltd.) и проводили замену жидкости ЗФР и конденсацию. Конечный объем доводили до 6 мл, и использовали в качестве очищенной пробы (rDR5-hFc). Количественное определение очищенного продукта белка выполняли с использованием “Micro BCA Protein Assay Kit” (PIERCE #232235). В качестве ссылочного стандарта, использовали “Albumin Standard”, содержащийся в наборе.

1)-2 Иммунизация

Использовали мышей BALB/cAJcl (CLEA Japan, Inc,) в возрасте 5-6 недель. В день 0, смесь 50 мкл rDR5-hFc, приготовленного в 1)-1-3, и полного адъюванта Фрейнда (получаемого от Wako Pure Chemical Industries, Ltd.) (при соотношении объемов 1:1) вводили подкожно в области шеи каждой мыши. В дни 14 и 28, смесь 50 мкг rDR5-hFc и неполного адъюванта Фрейнда (получаемого от Wako Pure Chemical Industries, Ltd.) (при соотношении объемов 1:1) вводили подкожно в дорсальном районе каждой мыши. В день 42, 50 мкг rDR5-hFc вводили в брюшную полость каждой мыши и в день 45 селезенку вырезали из каждой мыши и использовали для получения гибридом.

1)-3 Получение гибридом

Клетки селезенки и миеломные клетки мыши P3X63Ag8U.1 подвергали слиянию клеток с использованием PEG 4000 (получаемого от Immuno-biological Laboratories Co., Ltd.) и полученные слитые клетки разводили средой ClonaCell-HY Selection Medium D (изготовляемой StemCell Technologies, Inc., #03804) и культивировали. Затем, образованные гибридомные колонии собирали, посредством чего получали моноклональные гибридомы. Собранные колонии гибридом культивировали раздельно и с использованием полученного культурального супернатанта каждой гибридомы продуцирующую анти-DR5-антитело гибридому подвергали скринингу.

1)-4 Скрининг антитела по способу ELISA для клеток

1)-4-1 Конструирование вектора экспрессии мутанта DR5 человека (pcDNA3.1-DR5M)

кДНК, кодирующую белок DR5 человека (изоформу 2: NP_671716), клонировали в вектор pcDNA3.1(+) и конструировали вектор экспрессии pcDNA3.1-DR5M с модифицированным доменом гибели, который был сконструирован таким образом, чтобы экспрессировать белок, в котором аминокислота L в положении 334 в домене гибели заменена на D.

1)-4-2 Получение экспрессирующих ген антигена клеток

Клетки HEK 293 получали при 7,5×105 клеток/мл в среде DMEM, содержащей 10% ФТС. Затем клетки HEK 293 трансфицировали вектором экспрессии pcDNA3.1-DR5M с модифицированным доменом гибели или pcDNA3.1-mock, служащим в качестве контроля, с использованием липофектамина 2000 (изготовляемого Life Technologies Japan LTD.), и каждую суспензию клеток распределяли при 50 мкл на лунку в 96-луночном микропланшете половинной площади (изготовляемом Corning Incorporated). Клетки культивировали в течение ночи в среде DMEM, содержащей 10% ФТС, в условиях 37ºС и 5% СО2. Трансфицированные таким образом клетки в прикрепленном состоянии использовали как таковые в ELISA для клеток.

1)-4-3 ELISA для клеток

После удаления супернатанта из культуры клеток HEK 293, трансфицированных вектором экспрессии, полученным в 1)-4-2, супернатант гибридомной культуры добавляли в каждые из клеток HEK 293, трансфицированных pcDNA3.1-DR5M, и клеток HEK 293, трансфицированных pcDNA3.1-mock, и планшет оставляли стоять при 4ºС в течение 1 часа. После промывания клеток в каждой лунке один раз с использованием ЗФР, содержащего 5% ФТС, козьи антитела против IgG мыши, конъюгированные с пероксидазой (изготовленные Chemicon Co., Ltd., #AP181P), разведенные в 500 раз ЗФР, содержащим 5% ФТС, добавляли в каждую лунку и планшет оставляли стоять при 4ºС в течение 1 часа. После того как клетки в каждой лунке промывали 5 раз ЗФР, содержащим 5% ФТС, развивающий окраску раствор OPD (дигидрохлорида о-фенилендиамина (изготовляемого Wako Pure Chemical Industries, Ltd.) и H2O2 растворяли при 0,4 мг/мл и 0,6 (о/о), соответственно, в растворе для растворения OPD (0,05 М тринатрицитрата и 0,1 М додекагидрата дигидрофосфата натрия, рН 4,5)) и добавляли при 25 мкл на лунку. Развивающей окраску реакции позволяли протекать с перемешиванием иногда этой реакционной смеси и реакцию развития окраски останавливали добавлением 1 М HCl при 25 мкл на лунку. После этого, оптическую плотность при 490 нм измеряли с использованием планшет-ридера (ARVO, изготовляемого Perkin Elmer, Inc.). Для отбора гибридомы, которая продуцирует антитело, которое специфически связывается с DR5, экспрессируемым на клеточной мембране, гибридому, которая продуцирует культуральный супернатант, обнаруживающий более высокую оптическую плотность в клетках HEK 293, трансфицированных вектором экспрессии pcDNA3.1-DR5M, в сравнении с клетками НЕК 293, трансфицированными pcDNA3.1-mock (контролем), отбирали как являющуюся положительной в отношении продуцирования анти-DR5-антитела.

1)-5 Скрининг антитела способом проточной цитометрии

1)-5-1 Получение экспрессирующих ген антигена клеток

Клетки 293T высевали при 5×104 клеток/см2 в колбу на 225-см2 (изготовляемую Sumitomo Bakelite Co., Ltd.) и культивировали в течение ночи в среде DMEM, содержащей 10% ФТС, при условиях 37ºС и 5% СО2. На следующий день клетки 293Т трансфицировали pcDNA3.1-DR5M или pcDNA3.1-mock, служащей в качестве контроля, с использованием Липофектамина 2000, и дополнительно культивировали в течение ночи при условиях 37ºС и 5% СО2. На следующий день клетки 293Т, трансфицированные вектором экспрессии, обрабатывали TrypLE Express (изготовляемым Life Technologies Japan Ltd.). Затем клетки промывали DMEM, содержащей 10% ФТС и после этого суспендировали в ЗФР, содержащем 5% ФТС. Полученную таким образом суспензию клеток использовали в анализе с проточной цитометрией.

1)-5-2 Проточный цитометрический анализ

Суспензию клеток 293Т, полученную в 1)-5-1, центрифугировали и супернатант удаляли. Затем супернатант гибридомной культуры добавляли к каждой из клеток 293Т, трансфицированных pcDNA3.1-DR5M, и клеток 293Т, трансфицированных pcDNA3.1-mock, для суспендирования клеток, и эти клетки оставляли стоять при 4ºС в течение 1 часа. После промывания клеток дважды ЗФР, содержащим 5% ФТС, конъюгированную с флуоресцеином фракцию козьего IgG к IgG мыши (цельной молекуле) (изготовляемой Cappel Co., Ltd., # 55493), разведенную в 1000 раз ЗФР, содержащим 5% ФТС, добавляли для суспендирования этих клеток, и эти клетки оставляли стоять при 4ºС в течение 1 часа. После промывания клеток 3 раза ЗФР, содержащим 5% ФТС, эти клетки ресуспендировали в ЗФР, содержащем 5% ФТС, дополненном 2 мкг/мл 7-аминоактиномицином D (изготовляемым Invitrogen (Molecular Probes) Corporation), и выполняли детектирование с использованием проточного цитометра (FC500, Beckman Coulter, Inc.). Эти данные анализировали с использованием Flowjo (Tree Star, Inc.). 7-аминоактиномицин D-положительные мертвые клетки исключали с использованием клапана. Затем создавали гистограммы интенсивности флуоресценции FITC жизнеспособных клеток. Гибридому, которая продуцировала пробу, которая давала более высокую интенсивность флуоресценции в гистограмме интенсивности флуоресценции клеток 293Т, трансфицированных pcDNA3.1-DR5M, чем в гистограмме интенсивности флуоресценции клеток 293Т, трансфицированных pcDNA3.1-mock, служащих в качестве контроля, отбирали как являющуюся положительной в отношении продуцирования анти-DR5-антитела.

1)-6 Скрининг в плане разрушающего клетки эффекта

С использованием культуральных супернатантов гибридом, выбранных таким образом, что они являются положительными в отношении продуцирования анти-DR5-антитела в 1)-4 и 1)-5, подтверждали индуцирующий гибель клеток эффект на клеточной линии Jurkat Т-лимфомы человека. AffiniPure Fc-специфические козьи антитела против мышиного Fc IgG (изготовляемые Jackson ImmunoResearch Laboratories, Inc., #115-005-071), полученные при 50 мкг/мл с 5 мМ Трис-HCl (рН 8,5), распределяли при 25 мкл на лунку в 96-луночном микролуночном планшете с половинной площадью (изготовляемом Corning Incorporated) и планшет оставляли стоять в течение ночи при 4ºС. После промывания каждой лунки дважды с использованием ЗФР, культуральный супернатант добавляли в каждую лунку и планшет оставляли стоять в течение ночи при 4ºС. После промывания каждой лунки дважды ЗФР, клетки Jurkat, полученные при 4,0×104 клеток на мл в среде RPMI 1640, содержащей 10% ФТС, добавляли при 25 мкг на лунку и культивировали при условиях 37ºС и 5% СО2 в течение 20 часов. Разрушающий клетки эффект моноклонального анти-DR5-антитела, присутствующего в культуральном супернатанте гибридомы, оценивали количественно определением количества АТФ, получаемого из жизнеспособных клеток с использованием набора для анализа жизнеспособности CellTiter-Glo люминесцентных клеток (изготовляемых Promega Corporation, #G7571). В результате, были установлены гибридомы, которые продуцируют 5 типов моноклональных антител (B086, B139, B192, B275 и B467), каждое из которых обнаруживало уменьшение количества АТФ на 80% или более в сравнении с вариантом добавления среды для культивирования этой гибридомы.

1)-7 Определение изотипа моноклонального антитела

Изотипы моноклональных антител определяли с использованием набора моноклонального изотипирования мыши (изготовляемого AbD Serotec, Inc.). В результате было подтверждено, что изотипом B086, B139, B192, B275 и B467 был IgG1, κ-цепь.

1)-8 Получение моноклонального антитела

Моноклональное антитело очищали из асцита мыши, имплантированной гибридомой, (далее называемого в настоящем описании “исходным материалом для очистки антитела”).

Асцит мыши получали следующим образом. Сначала мышей Balb/cAJcl-nu/nu (Japan SLC, Inc.) в возрасте 7-8 недель обрабатывали пристаном (изготовляемым Sigma Co., Ltd.), и после приблизительно 3 недель, гибридому, промытую физиологическим раствором, имплантировали в брюшную полость при 1×107 клеток на мышь. После 1-2 недель, асцит, накопленный в брюшной полости, собирали и стерилизовали через фильтр с 0,22-мкм-ячейками и полученный материал использовали в качестве исходного материала для очистки антител.

Антитело очищали при помощи Hitrap MabSelect SuRe (изготовляемого GE Healthcare Bio-Sciences Co., Ltd.). То есть, исходный материал для очистки антител добавляли в колонку и колонку промывали ЗФР и после этого выполняли элюцию 2 М Аргинин-HCl рН 4,0. После нейтрализации элюированного раствора антитела буфер заменяли ЗФР. Концентрирование антитела получали элюцией антитела, связанного с колонкой POROS G 20 мкм Column PEEK, 4,6 мм × 50 мм, 0,83 мл (Applied Biosystems, Inc.), и измерением оптической плотности (OD 280 нм) элюата. Конкретно, пробу антитела, разведенную ЗФР, добавляли в колонку POROS G 20 мкм, уравновешенную буфером для уравновешивания (30,6 мМ додекагидрат дигидрофосфата натрия, 19,5 мМ монокалийфосфат, 0,15 М NaCl, рН 7,0). Затем, колонку промывали буфером для уравновешивания и затем антитело, связанное с этой колонкой, элюировали элюентом (0,1% (о/о) HCl, 0,15 М NaCl). Площадь пика оптической плотности (OD 280 нм) элюата измеряли и концентрацию рассчитывали в соответствии со следующим уравнением: Концентрация пробы антитела (мг/мл) = (Площадь пика пробы антитела)/(Площадь пика ссылочного стандарта (IgG1 человека)) × Концентрация ссылочного стандарта (мг/мл) × Коэффициент разведения пробы. Кроме того, концентрацию эндотоксина, содержащегося в полученном антителе, измеряли с использованием Limulus ES-II Single Test Wako (Wako Pure Chemical Industries, Ltd., 295-51030, содержащего контрольный стандартный эндотоксин) и токсинометра (Wako Pure Chemical Industries, Ltd., ET-301 или ET-5000) и подтверждали, что она равна 1 EU/мг или менее. Полученное антитело использовали в следующем эксперименте.

1)-9 In vitro разрушающая клетки активность мышиного антитела В273 против клеточных линий рака человека

Каждую клеточную линию Jurkat Т-лимфомы человека и клеточную линию U-87MG глиобластомы человека получали при 4,4×104 клеток/мл в среде RPMI 1640, содержащей 10% ФТС, или в среде МЕМ (Минимальной Поддерживающей Среде), содержащей 10% ФТС, и добавляли в 96-луночный микропланшет с белым прозрачным дном (изготовляемым Corning Incorporated) при 45 мкл на лунку, и культивировали в течение ночи при условиях 37ºС и 5% СО2. В273-антитело мыши или IgG1-антитело мыши (изготовляемое R&D System, Inc.) смешивали с той же самой концентрацией AffiniPure Fc-специфических козьих антител против мышиного IgG (изготовляемых Jackson ImmunoResearch Laboratories, Inc., #115-005-071), и полученную смесь добавляли при 5 мкл на лунку, так что конечная концентрация этого мышиного антитела В275 или мышиного IgG1-антитела была равна 10000-0,01 нг/мл, и эти клетки культивировали при условиях 37ºС и 5% СО2 в течение 24 часов. Количество АТФ, полученное из жизнеспособных клеток в каждой лунке, измеряли люминометром (изготовляемым Perkin Elmer, Inc.) с использованием набора для анализа жизнеспособности люминесцентных клеток CellTiter-Glo (изготовляемого Promega Corporation, #G7571) в соответствии с прилагаемым протоколом. Активность разрушения клеток оценивали принятием величины, полученной из лунки, в которую добавляли среду вместо раствора антитела, за 100% (фиг. 1). В каждой группе, жизнеспособность клеток выражается как среднее +/- стандартное отклонение (n=3). В результате было обнаружено, что В273-антитело мыши проявляет разрушающее клетки действие на обеих клеточных линиях зависимым от концентрации антитела образом.

Пример 2. Клонирование гена В273-антитела мыши и получение гена химерного антитела человека

2)-1 Клонирование кДНК В273-антитела мыши и определение последовательности

2)-1-1 Определение N-концевых аминокислотных последовательностей тяжелой и легкой цепей антитела В273 мыши

Для определения N-концевых аминокислотных последовательностей тяжелой и легкой цепей В273-антитела мыши, В273-антитело мыши, очищенное в Примере 1-8, разделяли электрофорезом в ДСН-ПААГ. Белок из геля переносили из геля, после разделения, на мембрану PVDF (размер пор: 0,45 мкм, изготовляемую Invitrogen Corporation). Мембрану промывали промывочным буфером (буфером 25 мМ NaCl, 10 мМ борат натрия рН 8,0) и после этого окрашивали погружением в раствор красителя (50% метанол, 20% уксусная кислота, 0,05% Кумасси бриллиантовый синий) на 5 минут с последующим обесцвечиванием 90% метанолом. Части полосы, соответствующей тяжелой цепи (полосы с меньшей подвижностью), и полосы, соответствующей легкой цепи (полосы с большей подвижностью), вырезали, и была предпринята попытка идентификации их соответствующих N-концевых аминокислотных последовательностей при помощи способа Эдмана (см. Edman et al. (1867) Eur. J. Biochem. 1, 80) с использованием Procise (зарегистрированное товарное название) cLC Protein Sequencer Model 492cLC (Applied Biosystems, Inc.). В результате, N-концевая аминокислотная последовательность полосы, соответствующей тяжелой цепи мышиного В273-антитела, была EVQLQQSGPELVKPG (SEQ ID NO:1 в Списке последовательностей), и N-концевая аминокислотная последовательность полосы, соответствующей легкой цепи мышиного В273-антитела, была DVVMTQTPLSLPVSLGDQAS (SEQ ID NO:2 в Списке последовательностей).

2)-1-2 Получение мРНК из продуцирующей В273-антитело мыши гибридомы

Для клонирования кДНК, кодирующих тяжелую цепь и легкую цепь В273-антитела мыши, соответственно, мРНК получали из продуцирующей В273-антитело мыши гибридомы с использованием набора Quick Prep mRNA Purification (GE Healthcare Bio-Sciences Co., Ltd.).

2)-1-3 Клонирование кДНК В273-антитела мыши и определение последовательности

Со ссылкой на открытия, что изотипами тяжелой и легкой цепи цепей В273-антитела мыши являются γ1 и κ, обнаруженные в Примере 1-7, и N-концевые аминокислотные последовательности тяжелой и легкой цепи, определенные в описанном выше 2)-1-1, и базу данных аминокислотных последовательностей, полученных Kabat et al., (см. Kabat, E.A. et al., (1991) в Sequences of Proteins of Immunological Interest Vol. I and II, U.S. Department of Health and Human Services), были синтезированы несколько олигонуклеотидных праймеров, гибридизующихся с 5'-концевой областью кодирующей ген антитела областью, и его 3'-концевой областью, содержащую стоп-кодон, соответственно, и кДНК, кодирующую тяжелую цепь, и кДНК, кодирующую легкую цепь, амплифицировали с использованием мРНК, полученной в 2)-1-2, и набора TaKaRa One Step RNA PCR (AMV) (TaKaRa Bio, Inc.). В результате, кДНК, кодирующая тяжелую цепь антитела, и кДНК, кодирующая легкую цепь антитела могли быть амплифицированы с использованием следующих наборов праймеров.

Набор праймеров для тяжелой цепи

5'-aagaattcatgggatggagctgtatc-3' (MH258E1F1: SEQ ID NO:3 в Списке последовательностей)

5'-aagatatcttatttaccaggagagtgggagag-3' (G1EVR1: SEQ ID NO:4 в Списке последовательностей)

Набор праймеров для легкой цепи

5'-aagaattcatgaagttgcctgttagg-3' (MK19EIF1: SEQ ID NO:5 в Списке последовательностей

5'-aagatatcttaacactcattcctgttgaagct-3' (KEVR1: SEQ ID NO:6 в Списке последовательностей)

Каждую из кДНК, кодирующих тяжелую цепь, и кДНК, кодирующих легкую цепь, амплифицированных при помощи ПЦР, клонировали с использованием набора для экспрессии pEF6/V5-His TOPO TA (Invitrogen Corporation), и каждую из нуклеотидных последовательностей тяжелой цепи и легкой цепи определяли с использованием анализатора последовательностей генов (“ABI PRISM 3700 DNA Analyser; Applied Biosystems” или (Applied Biosystems 3730xl Analyser; Applied Biosystems”). В этой реакции секвенирования использовали GeneAmp 9700 (Applied Biosystems, Inc.).

Определенная нуклеотидная последовательность кДНК, кодирующей тяжелую цепь В273-антитела мыши, представлена SEQ ID NO:7 в Списке последовательностей и ее аминокислотная последовательность представлена SEQ ID NO:8. Нуклеотидная последовательность кДНК, кодирующей легкую цепь В273-антитела мыши, представлена SEQ ID NO:9 в Списке последовательностей и ее аминокислотная последовательность представлена SEQ ID NO:10 в Списке последовательностей. Последовательности SEQ ID NO:7 и 8 показаны на фиг. 28, а последовательности SEQ ID NO:9 и 10 показаны на фиг. 29.

Кроме того, аминокислотные последовательности тяжелой цепи и легкой цепи анализировали сравнением с использованием KabatMan (см. PROTEINS: Structure, Function and Genetics, 25 (1996), 130-133), который является базой данных аминокислотных последовательностей антител. В результате было обнаружено, что в тяжелой цепи В273-антитела мыши аминокислотная последовательность, представленная номерами аминокислот 20-141 SEQ ID NO:8 в Списке последовательностей, является вариабельным доменом. Было также обнаружено, что в легкой цепи В273-антитела мыши аминокислотная последовательность, представленная номерами аминокислот 20-133 SEQ ID NO:10 в Списке последовательностей, является вариабельным доменом.

2)-2 Получение вектора экспрессии химерного В273-антитела

2)-2-1 Получение универсальных векторов экспрессии pEF6KCL и pEF1FCCU

2)-2-1-1 Конструирование вектора экспрессии pEF6KCL химерной и гуманизированной цепи

Выполнением ПЦР с использованием плазмиды pEF6/V5-HisB (Invitrogen Corporation) в качестве матрицы и также с использованием следущих праймеров, получали ДНК-фрагмент от непосредственно справа от BGHpA (положение последовательности: 2174) до SmaI (положение последовательности: 2958) (ДНК-фрагмент, содержащий сайт инициации репликации f1 и промотор и сайт инициации репликации SV40, далее называемый в настоящем описании “фрагментом А”).

5'-ccacgcgccctgtagcggcgcattaagc-3' (праймер EFF1: SEQ ID NO:11 в Списке последовательностей)

5'-aaacccgggagctttttgcaaaagcctagg-3' (праймер EFsmaR: SEQ ID NO:12 в Списке последовательностей)

Полученный фрагмент А и ДНК-фрагмент (SEQ ID NO:13, далее называемый в настоящем описании “фрагментом В”), содержащий ДНК-последовательность, кодирующую секреторный сигнал κ-цепи человека, константный сигнал κ-цепи человека и сигнал добавления поли-А человека, лигировали друг с другом с использованием ПЦР с перекрывающимся удлинением. Полученный таким образом ДНК-фрагмент, в котором фрагмент А и фрагмент В были лигированы друг с другом, расщепляли рестрикционными ферментами KpnI и SmaI, который был лигирован с плазмидой pEF6/V5-HisB (Invitrogen Corporation), которая была расщеплена рестрикционными ферментами KpnI и SmaI, посредством чего конструировали вектор pEF6KCL химерной и гуманизированной легкой цепи человека, имеющий сигнальную последовательность, сайт клонирования, константный домен κ-цепи человека и сигнальную последовательность поли-А-добавления справа от промотора EF1.

2)-2-1-2 Конструирование pEF1/KCL

ДНК-фрагмент, полученный расщеплением pEF6KCL, полученный вышеописанным способом с рестрикционными ферментами KpnI и SmaI, лигировали с pEF1/myc-HisB (Invitrogen Corporation), которая была расщеплена KpnI и SmaI, посредством чего конструировали плазмиду pEF1KCL.

2)-2-1-3 Конструирование вектора экспрессии pEF1FCCU химерной и гуманизированной тяжелой цепи

ДНК-фрагмент (SEQ ID NO:14), содержащий ДНК-последовательность, кодирующую аминокислоты сигнальной последовательности и константного домена IgG1 человека, расщепляли рестрикционными ферментами NheI и PmeI и лигировали с плазмидой pEF1KCL, которая была расщеплена NheI и PmeI, посредством чего конструировали вектор экспрессии pEF1FCCU, имеющий сигнальную последовательность, сайт клонирования, константный домен тяжелой цепи человека и сигнальную последовательность добавления поли-А человека справа от промотора EF1.

2)-2-2 Конструирование вектора экспрессии легкой цепи В273-химера-типа

С использованием кДНК, кодирующей легкую цепь В273-антитела мыши, в качестве матрицы, а также с использованием KOD-Plus- (TOYOBO, Co., Ltd.) и следующего набора праймеров, амплифицировали домен, содержащий кДНК, кодирующую вариабельный домен легкой цепи. ДНК-фрагмент, полученный расщеплением амплифицированного продукта рестрикционными ферментами NdeI и BsiWI, инсертировали в универсальный вектор экспрессии легкой цепи химерного и гуманизированного антитела (pEF6KCL) в сайте, расщепляемом рестрикционными ферментами NdeI и BsiWI, посредством чего конструировали вектор экспрессии легкой цепи В273 химера-типа. Полученный таким образом вектор экспрессии был назван “pEF6KCL/B273L”. Полученная таким образом нуклеотидная последовательность легкой цепи В273 химера-типа представлена SEQ ID NO:15 в Списке последовательностей, а ее аминокислотная последовательность представлена SEQ ID NO:16. Последовательности SEQ ID NO:15 и 16 показаны на фиг. 30. В данном случае, аминокислотный остаток в положении 134 в аминокислотной последовательности легкой цепи химера-типа SEQ ID NO:16 в Списке последовательностей, расположен в карбокси-конце вариабельного домена легкой цепи и соответствует остатку аланина в положении 133 в аминокислотной последовательности легкой цепи В273-антитела мыши SEQ ID NO:10 в Списке последовательностей, однако, в аминокислотной последовательности SEQ ID NO:16, остаток уже был заменен остатком треонина, происходящим из легкой цепи антитела человека.

Набор праймеров для легкой цепи:

5'-aaacatatggcgatgttgtgatgacccaaactccactctcc-3' (B273LF: SEQ ID NO:17 в Списке последовательностей)

5'-aaacgtacgtttgatttccagcttggtgcctccaccgaacg-3' (B273LR: SEQ ID NO:18 в Списке последовательностей)

2)-2-3 Конструирование вектора экспрессии тяжелой цепи В273-химера-типа

С использованием кДНК, кодирующей тяжелую цепь В273-антитела мыши, в качестве матрицы, а также с использованием KOD-Plus- (TOYOBO, Co., Ltd.) и следующего набора праймеров, амплифицировали область, содержащую кДНК, кодирующую вариабельный домен тяжелой цепи. ДНК-фрагмент, полученный расщеплением этого амплифицированного продукта рестрикционным ферментом BlpI, инсертировали в универсальный вектор экспрессии тяжелой цепи химерного и гуманизированного антитела (pEF1FCCU) в сайте, расщепляемом рестрикционным ферментом BlpI, посредством чего конструировали вектор экспрессии тяжелой цепи В273 химера-типа. Полученный таким образом вектор экспрессии был назван pEF1FCCU/B273H”. Нуклеотидная последовательность тяжелой цепи В273 химера-типа представлена SEQ ID NO:19 в Списке последовательностей, и ее аминокислотная последовательность представлена SEQ ID NO:20. Последовательности SEQ ID NO:19 и 20 показаны на фиг. 31.

Набор праймеров для тяжелой цепи:

5'-aaagctgagcgaggttcagctgcagcagtctggacctgagc-3' (B273HF: SEQ ID NO:21 в Списке последовательностей)

5'-aaagctgagctgactgtgagagtggtgccttggccccagtag-3' (B273HR: SEQ ID NO:22 в Списке последовательностей)

2)-3 Приготовление химерного антитела В273

2)-3-1 Получение химерного антитела В273

1,2×109 клеток FreeStyle 293F клеток (Invitrogen Corporation) в логарифмической фазе роста высевали в 1,2 л свежей среды для экспрессии FreeStyle 293 (Invitrogen Corporation) и культивировали в течение 1 часа встряхиванием при 90 об/мин при 37ºС в термостате с 8% СО2. 3,6 мг полиэтиленимина (Polyscience #24765) растворяли в 20 мл среды Opti-Pro SFM (Invitrogen Corporation). Затем pEF1FCCU/B273H (0,4 мг) и pEF6KCL/B273L (0,8 мг), полученные с набором PureLink HiPure Plasmid (Invitrogen Corporation), суспендировали в 20 мл среды Opti-Pro-SEM. Затем, 20 мл смешанной жидкости векторы экспрессии /Opti-Pro SEM добавляли к 20 мл полученной жидкости полиэтиленимин/Opti-Pro SEM и полученную смесь осторожно перемешивали и затем оставляли на 5 минут. После этого, смесь добавляли к клеткам FreeStyle 293F, встряхивание культуры при 90 об/мин выполняли в течение 7 дней при 37ºС в термостате с 8% СО2. Полученный культуральный супернатант фильтровали через фильтр с одноразовой капсулой (Advantec #CCS-045-E1H).

Химерное антитело В273, полученное комбинированием pEF1FCCU/В273Н и pEF6KCL/B273L, было названо “cB273”.

2)-3-2 Очистка cB273

Культуральный супернатант, полученный в приведенном выше 2)-3-1, очищали двухступенчатым процессом, включающим rProtein A аффинную хроматографию (при 4-6ºС) и очистку с применением колонки керамического гидроксиапатита (при комнатной температуре). Смену буфера после очистки с использованием афинной хроматографии rProyein A и керамического гидроксиапатита выполняли при комнатной температуре. Сначала 1100-1200 мл культурального супернатанта наносили на MabSelect SuRe (изготовляемый GE Healthcare Bio-Sciences Co., Ltd., две HiTrap-колонки (объем: 1 мл), соединенные последовательно), уравновешенную ЗФР. После выливания всего культурального раствора в колонку, колонку промывали 15-30 мл ЗФР. Затем выполняли элюцию 2 М раствором гидрохлорида аргинина (рН 4,0) и собирали фракцию, содержащую это антитело. Фракцию наносили на обессоливающую колонку (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две обессоливающие колонки HiTrap (объем: 5 мл) соединенные последовательно), заменяя тем самым буфер буфером, содержащим 5 мМ фосфат натрия, 50 мМ MES и 20 мМ NaCl при рН 6,5. Далее, раствор антитела, подвергнутый замене буфера, наносили на колонку с керамическим гидроксиапатитом (Japan Bio-Rad Laboratories, Inc., Bio-Scale CHT2-1 hydroxyapatite column (объем: 2 мл)), уравновешенную буфером, содержащим 5 мМ NaPi, 50 мМ MES и 20 мМ NaCl при рН 6,5. Затем, выполняли элюцию с использованием линейного градиента концентрации с хлоридом натрия и фракцию, содержащую это антитело, собирали. Эту фракцию наносили на обессоливающую колонку (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две обессоливающие колонки HiTrap (объем: 5 мл) соединенные последовательно), заменяя тем самым эту жидкость CBS (10 мМ цитратный буфер, содержащий 140 мМ хлорид натрия, рН 6,0). Наконец, полученный раствор концентрировали с использованием Centrifugal UF Filter Device VIVASPIN 20 (фракционная молекулярная масса: 30 К, Sartorius Co., Ltd., при 4ºС), и концентрацию IgG доводили 1,0 мг/мл или более, и полученный таким образом раствор использовали в качестве очищенной пробы.

Пример 3. Измерение активности химерного В273-антитела (cB273) человека (in vitro)

3)-1 Исследование свойства селективного связывания cB273-антитела с внеклеточным доменом DR5 человека

Свойство связывания cB273 с белками внеклеточного домена TRAIL R1-R4 человека и TRAIL R2 мыши (изготовляемыми R&D Systems Inc.) исследовали прямым способом ELISA, описанным ниже. Сначала, каждый из белков TRAIL R внеклеточного домена разводили до 1 мкг/мл ЗФР и разведенный раствор распределяли при 50 мкл на лунку в имунопланшет (изготовляемый Nunc, Inc., #442404) и планшет оставляли стоять в течение ночи при 4ºС, посредством чего белок абсорбировался на планшет. На следующий день, жидкость в каждой лунке удаляли и каждую лунку промывали один раз ЗФР. После этого, для супрессии неспецифической абсорбции белков ЗФР, содержащий 3% фетальную телячью сыворотку распределяли при 200 мкл на лунку и планшет оставляли стоять при комнатной температуре в течение 1,5 часов. Жидкость в каждой лунке удаляли и добавляли cB273 или растворимый TRAIL человека (изготовляемый ALEXIS Corporation, #ALX-522-003), разведенный ЗФР, содержащим 3% фетальную телячью сыворотку при 50 мкл на лунку. После оставления этого планшета при комнатной температуре в течение 1,5 часов, в каждую лунку добавляли ЗФР и затем жидкость в лунке удаляли и лунку промывали дважды ЗФР. Затем в лунку, к которой было добавлено антитело cB273, добавляли козье антитело против F(ab')2-фрагмента IgG человека, конъюгированное с пероксидазой (изготовляемое Jackson ImmunoResearch Laboratories, Inc., #109-035-097), разведенное в 2500 раз ЗФР, содержащим 3% фетальную телячью сыворотку при 50 мкл на лунку, и в лунку, к которой был добавлен растворимый TRAIL, добавляли конъюгат моноклональное анти-FLAG М2-антитело-пероксидаза, разведенный в 2000 раз, при 50 мкл на лунку, и планшет оставляли стоять при комнатной температуре в течение 1 часа. После добавления ЗФР в каждую лунку жидкость в этой лунке удаляли и эту лунку промывали дважды ЗФР. После этого добавляли развивающую окраску жидкость при 100 мкг на лунку, посредством чего развивалась окраска. Затем добавляли 1 М HCl при 100 мкл на лунку, посредством чего реакция развития окраски останавливалась. После этого измеряли оптическую плотность при 492 нм с использованием планшет-ридера. Фиг. 2А показывает результаты для cB273 и Фиг. 2В показывает результаты для растворимого TRAIL. Результаты в этих графиках выражены как среднее ± стандартное отклонение (n=3). В результате, было показано, что cB273 селективно связывается с внеклеточным доменом TRAIL R2 человека.

3)-2 Оценивание активности связывания cB273-антитела с использованием Biacore

3)-2-1 Получение белка внеклеточного домена DR5 человека

3)-2-1-1 Получение вектора экспрессии белка внеклеточного домена DR5 человека

Для конструирования вектора, который экспрессирует область (далее называемую в настоящем описании “sDR5”), состоящую из аминокислотной последовательности, показанной номерами аминокислот 1-130 DR5 человека SEQ ID NO:23 в Списке последовательностей, выполняли ПЦР-реакцию с использованием набора праймеров для амплификации sDR5:

DR5 Ndefw: 5'-gtggcatatggctctgatcacccaacaa-3' (SEQ ID NO:24 в Списке последовательностей) и

DR5 Xhorv: 5'-cgcctcgagtgattctttgtggacaca-3' (SEQ ID NO:25 в Списке последовательностей), а также с использованием кДНК, кодирующей внеклеточный домен DR5 человека, в качестве матрицы. Полученный ПЦР-продукт расщепляли NdeI и XhoI и клонировали в сайт NdeI/XhoI pET21b(+) (изготовляемой Novagen, Inc.) (далее сокращаемую в настоящем описании как “pET21b(+)-sDR5”. Кроме того, рекомбинантный белок, экспрессируемый “pET21b(+)-sDR5”, называют далее в настоящем описании и в рисунках “rsDR5” (SEQ ID NO:26 в Списке последовательностей).

3)-2-1-2 Получение белка внеклеточного домена DR5 (rsDR5)

Escherichia coli Origami B (DE3) (изготовляемую Novagen, Inc.) трансформировали экспрессирующей плазмидой pET21b(+)-sDR5 и культивировали в среде 2-YT, дополненной 100 мкг/мл ампициллина (изготовляемого Sigma Co. Ltd.) и 15 мкг/мл канамицина (изготовляемого Wako Pure Chemical Industries, Ltd.), и экспрессию частичного белка DR5 индуцировали добавлением 0,5 мМ IPTG. Эти клетки собирали центрифугированием при 6000 об/мин и суспендировали в буфере для связывания (50 мМ Трис-HCl рН 7,5, 300 мМ NaCl) с последующей гомогенизацией ультразвуком на льду. Полученный гомогенат центрифугировали при 25000 об/мин в течение 20 минут. Супернатант извлекали и наносили на Ni-NTA (изготовляемый Invitrogen Corporation). После выполнения промывания буфером для связывания выполняли элюцию буфером для элюции (50 мМ Трис-HCl рН 7,5, 300 мМ NaCl и 300 мМ имидазол). Элюированную пробу диализовали с использованием буфера для диализа (50 мМ Трис-HCl рН 8,0, 20 мМ NaCl) и наносили на MONO Q, и элюцию градиента выполняли буфером для элюции (50 мМ Трис-HCl рН 8,0, 0,1 М NaCl). Затем элюированную пробу очищали гель-фильтрационой колоночной хроматографией (Superdex 75 16/60, изготовляемый (GE Healthcare Bio-Sciences Co., Ltd.) с использованием ЗФР в качестве растворителя. Концентрацию полученного таким образом рекомбинантного белка измеряли при УФ 280 нм (константа молярной оптической плотности: 14855).

3)-2-2 Измерение активности связывания при помощи Biacore

Константу диссоциации каждого из cB273-антитела и rsDR5 измеряли с использованием Biacore 3000 (GE Healthcare Bio-Sciences Co., Ltd.) способом захвата, в котором антитело захватывается иммобилизованным анти-IgG (Fc) человека-антителом и это измерение выполняется с использованием антигена в качестве аналита. Анти-IgG (Fc) человека-антитело (Набор для захвата антитела человека, GE Healthcare Bio-Sciences Co., Ltd.) ковалентно иммобилизовали на сенсорном чипе СМ5 (BIAcore, Inc.) при приблизительно 8000 RU способом аминосочетания. Иммобилизацию выполняли также на ссылочной клетке таким же образом. В качестве рабочего буфера, использовали HBS-EP (10 мМ HEPES рН 7,4, 0,15 М NaCl, 3 мМ ЭДТА и 0,05% поверхностно-активное вещество Р20). На чип, имеющий анти-IgG (Fc) человека-антитело, иммобилизованное на нем, добавляли 50 нМ раствор cB273-антитела при скорости потока 10 мкл/мин в течение 60 секунд и затем добавляли серию разведений rsDR5 (0,63-20 нМ) при скорости потока 30 мкл/мин в течение 60 секунд и затем фазу диссоциации подвергали мониторингу в течение 300 секунд. В качестве регенерирующего раствора, добавляли 3 М хлорид магния при скорости потока 10 мкл/мин в течение 30 секунд. В этом анализе данных, использовали программу для анализа (программу BIAevaluation, версию 3.1) с взаимно однозначной моделью связывания и рассчитывали константу скорости ассоциации (kon), константу скорости диссоциации (koff) и константу диссоциации (KD; KD = koff/kon). Результаты, полученные измерением с использованием Biacore для cB273-антитела, показаны на фиг. 3.

3)-3 In vitro разрушающий клетки эффект антитела cB273 на клеточных линиях рака человека

Разрушающий клетки эффект антитела cB273 на различных линиях раковых клеток исследовали следующим способом. А2780, SK-OV-3, SR-CO-1, Caov-3 и NIH:OVCAR-5 (все из которых являются клеточными линиями рака яичника человека), HCT-15, COLO 205, HT29, SW480, SW620, DLD-1, COLO 201 и WiDr (все из которых являются клеточными линиями рака ободочной кишки человека), NCI-H1975, NCI-H292, NCI-H460 и NCI-H358 (все из которых являются клеточными линиями рака легкого человека), MDA-MB-231 и ZR-75-1 (оба из которых являются клеточными линиями рака молочной железы человека) покупали из Американской Коллекции Типовых Культур (АТСС). Каждую из этих клеточных линий готовили при 1×105 клеток на мл со средой, содержащей 10% фетальную телячью сыворотку (изготовляемую HyClone Laboratories, Inc.) (в дальнейшем называемой в настоящем описании “средой”), и высевали при 50 мкл на лунку 96-луночного планшета с белым прозрачным дном (изготовляемого Corning Incorporated). Антитело cB273 получали при 20000 нг/мл с 1 мкг/мл раствором вторичного антитела (козьего антитела против Fc IgG человека, изготовляемого MP Biomedicals, LLC.), и затем готовили при 2000, 200, 20 и 2 нг/мл с этой средой и каждый из полученных растворов добавляли в планшет при 50 мкл на лунку (конечная концентрация антитела: 10000, 1000, 100, 10 и 1 нг/мл). После инкубирования планшета при условиях 37ºС и 5% СО2 в течение 72 часов, количество АТФ, происходящей из жизнеспособных клеток в каждой лунке, измеряли с использованием набора для люминесцентного анализа жизнеспособности клеток CellTiter-Glo (изготовляемого Promega Corporation, #G7571) при помощи люминометра (изготовляемого Berthold Technologies) в соответствии с прилагаемым протоколом. Готовили лунку, в которую добавляли среду и суспензию клеток, в качестве отрицательной контрольной лунки, и лунку, в которую добавляли только среду, в качестве лунки фона, и рассчитывали жизнеспособность клеток в каждой тест-лунке. На фиг. 4, показано среднее ± стандартная ошибка (n=3) жизнеспособности клеток для каждой раковой клеточной линии, обработанной антителом cB273. Антитело cB273 проявляло разрушающую клетки активность против клеточных линий, за исключением SK-CO-1.

In vitro разрушающий клетки эффект на различных раковых клеточных линиях исследовали с использованием BxPC-3 и MIA PaCa-2 (обе из которых являются клеточными линиями рака поджелудочной железы человека), A2058 и A375 (обе из которых являются клеточными линиями меланомы человека), U-87MG (клеточной линии глиобластомы человека), AN3CA (клеточной линии эндометрического рака человека) в качестве тест-субъектов. Каждую из этих клеточных линий готовили при 4,4×104 клеток/мл со средой, содержащей 10% ФТС, и добавляли при 45 мкл на лунку в 96-луночный планшет с белым прозрачным дном (изготовляемым Corning Incorporation), и планшет инкубировали в течение ночи при условиях 37ºС и 5% СО2. Антитело cB273 смешивали с такой же концентрацией козьего антитела против Fc IgG человека (изготовляемого MP Biomedicals, LLC.) и затем полученную смесь добавляли в планшет при 5 мкл на лунку, так что конечная концентрация антитела cB273 была равна от 10000 до 1 нг/мл, и планшет инкубировали при условиях 37ºС и 5% СО2 в течение 24 часов. Количество АТФ, происходящее из жизнеспособных клеток в каждой лунке измеряли с использованием набора для люминесцентного анализа жизнеспособности клеток CellTiter-Glo (изготовляемого Promega Corporation, #G7571) люминометром (изготовляемым Perkin Elmer Inc.) в соответствии с прилагаемым протоколом. Каждый график показывает жизнеспособность клеток, выраженную как среднее ± стандартное отклонение (n=3). В результате, антитело cB273 проявляло разрушающий клетки эффект на всех исследованных раковых клеточных линиях (фиг. 5).

Пример 4. Идентификация эпитопа антитела cB273

4)-1 Получение Fab-фрагмента cB273

cB273 диализовали ЗФР и затем разводили до 2 мг/мл ЗФР и готовили до конечного объема 17 мл. Цистеин (изготовляемый Sigma Co., Ltd.) готовили при 0,1 мМ с ЗФР в количестве 1,7 мл, и добавляли папаин (изготовляемый Sigma Co., LRD.), разведенный до 0,1 мг/мл ЗФР в количестве 2,04 мл, и этой реакции давали протекать при 37ºС в течение 5 часов. После 5 часов, к ней добавляли N-этилмалеимид (изготовляемый Tokyo Chemical Industries Co., Ltd.), растворенный при 120 мМ в ЗФР, в количестве 6,33 мл, для остановки этой реакции. Реакционный раствор добавляли к Superdex 200 26/60 (изготовляемому GE Healthcare Bio-Sciences Co., Ltd.), уравновешенному 50 мМ Трис-HCl, содержащим 20 мМ NaCl, и собирали 14 мл фракции, соответствующей Fab-фрагменту.

4)-2 Приготовление пробы комплекса Fab-фрагмент cB273-rsDR5

Fab-фрагмент сВ273 концентрировали до 9,46 мг/мл с использованием Amicon Ultra-15 (MWCO: 10 K) (изготовляемого Millipore CO., Ltd.), и 2 мл сконцентрированного таким образом Fab-фрагмента cB273 смешивали с 2 мл rsDR5, сконцентрированного до 5,6 мг/мл с использованием Amicon Ultra-15 (MWCO: 3 K), и полученную смесь добавляли к Superdex 200 16/60, уравновешенному 20 мМ Трис-HCl, содержащему 50 мМ NaCl.

Собирали 8 мл фракции, соответствующей этому комплексу.

4)-3 Кристаллизация и структурный анализ комплекса Fab-фрагмент cB273-rsDR5

Полученный таким образом комплекс rsDR5-Fab-фрагмент cB273 концентрировали до 25 мг/мл и использовали для кристаллизации. Для кристаллизации, использовали способ измерения диффузии пара. Раствор, полученный добавлением равного количества раствора преципитирующего средства (осадителя) (6-8% (м/о) полиэтиленгликоля 4000, 20% (о/о) изопропанола, 0,1 М хлорида лития, 0,1 М цитратного буфера (рН 5,6)) к 0,45-1,0 мкл раствора белка, помещали в герметичный контейнер, в котором уже были помещены 0,45 мл раствора преципитирующего средства (осадителя), таким образом, что оба раствора не приходили в контакт друг с другом, и контейнер оставляли стоять при 22ºС. Спустя 3 дня, получали пластинчатый кристалл (0,4 мм × 0,3 мм х 0,03 мм).

Полученный таким образом кристалл погружали в раствор преципитирующего средства, дополненного 30% (о/о) глицерином, и затем замораживали в токе азота при -180ºС. Данные дифракции рентгеновских лучей собирали в потоке азота при 95 К на BL17A в Photon Factory of the Institute of Materials Structure Science в High Energy Accelerator Research Organization. Из полученного изображения дифракции, интенсивность дифракции определяли количественно с использованием программного обеспечения HKL-2000 (изготовляемой HKL Research, Inc.), и рассчитывали структурные факторы кристалла. Полученный кристалл принадлежал к моноклинической системе, пространственной группой была С2, и кристалл имел параметры элементарной ячейки: а=152,0 ангстрем, b=75,5 ангстрем, с=116,3 ангстрем и β=110,2.

Способ молекулярного замещения проводили с использованием полученных таким образом структурных факторов и трехмерных структурных координат DR5 (PDB-код: 2H9G) и Fab Herceptin (PDB-код 1N8Z), и фазы определяли. В этом расчете, использовали фазирующее устройство программного обеспечения (CCP4: Collaborative Computational Project No. 4). Кристалл содержал два комплекса в асимметричном звене.

Структуру уточняли с использованием программы CNX (Accerlys Inc.), и модель корректировали с использованием программы Coot. Процедуру повторяли и конечную величину R 25,0% и свободную величину R 28,7% получали при разрешении 2,1 ангстрем. Эта конечная модель состояла из двух комплексов, и она содержит аминокислотные остатки 1-218 L-цепи Fab cB273 (обе молекулы), аминокислотные остатки 1-222 Н-цепи (обе молекулы), аминокислотные остатки 18-92 и 98-127 одной молекулы DR5 среди этих двух молекул, аминокислотные остатки 21-92 и 98-127 другой молекулы DR5 и 324 молекул воды. Не наблюдали явной электронной плотности для аминокислотных остатков 93-97 этого DR5, 17 или 20 остатков в N-конце этого DR5, 6 остатков и одну His-метку в С-конце DR5, один остаток в С-конце L-цепи Fab cB273 и 5 остатков в С-конце H-цепи Fab cB273, и, следовательно, не была сконструирована модель. Эту модель подтверждали диаграммой Ramachandran, и было обнаружено, что только Val 56 L-цепи был расположен снаружи допускаемого района, и эта аминокислота Val 56 имеет структурную характеристику CDR L2.

Эти взаимодействия, определяемые между DR5 и Fab cB273, были по существу одинаковыми в двух молекулах в асимметричном звене. Аминокислотные остатки (положение каждого аминокислотного остатка соответствует положению SEQ ID NO:23) DR5, которые находятся на расстоянии 4 ангстрем или менее от Fab cB273, были следующими: Gly26, Ile34, Glu36, Asp37, Gly38, Asp56, Leu57, Leu58, Phe59, Leu61 и Arg62. Фиг. 6 показывает ленточную модель всего комплекса и его поверхности, а фиг. 7 показывает взаимодействие между DR5 и H- или L-цепями Fab cB273.

[Пример 5] Гуманизация антитела cB273 (1)

5)-1 Конструирование гуманизированного B273 (hB273)

5)-1-1 Молекулярное моделирование вариабельных доменов B273

Молекулярное моделирование вариабельных доменов B273 выполняли в соответствии со способом, обычно известным как гомологичное моделирование (Methods in Enzymology, 203, 121-153, (1991)). Первичные последовательности (трехмерные структуры, произведенные из структур рентгеновских кристаллов, являются доступными) вариабельных доменов иммуноглобулина человека, зарегистрированные в Банке Данных Белков (Nuc. Acid Res, 28, 235-242 (2000)), сравнивали с вариабельными доменами B273, определенными выше. В результате, 1Т66 был выбран в качестве последовательности, имеющей наивысшую гомологию последовательности с вариабельным доменом легкой цепи В273. Кроме того, 1XIW был выбран в качестве последовательности, имеющей наивысшую гомологию последовательности с вариабельным доменом тяжелой цепи В273. Трехразмерную структуру области каркаса получали на основе “каркасной модели” комбинированием координат 1Т66 и 1XIW, соответствующих легкой цепи и тяжелой цепи В273. Для CDR В273, CDRL1, CDRL2, CDRL3, CDRH1 и CDRH2 приписаны к кластерам 16А, 7А, 9А, 10А и 10А, соответственно, в соответствии с классификацией Thornton et al. (J. Mol. Biol. 263, 800-815, (1996))). CDRH3 был классифицирован в κ(11) - в соответствии с Н3-правилами (FEBS letters 399, 1-8 (1996)). Затем репрезентативную комбинацию каждого CDR включали в каркасную модель.

Наконец, для получения возможной молекулярной модели вариабельного домена В273 в плане энергии, расчет энергии выполняли для исключения неблагоприятного межатомного контакта. Вышеописанную процедуру проводили с использованием коммерчески доступной программы Prime для предсказания третичной структуры белков и программы MacroModel координатного поиска (Schrodinger, LLC).

5)-1-2 Конструирование аминокислотной последовательности гуманизированного В273

Гуманизированное антитело В273 конструировали в соответствии со способом, обычно известным в качестве CDR-трансплантации (Proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)). Акцепторное антитело выбирали на основе гомологии аминокислот в пределах каркасного района.

Последовательность каркасного района В273 сравнивали со всеми каркасными районами человека в Базе данных Кабата (Nuc. Acid Res. 29, 205-206 (2001)) аминокислотных последовательностей антител. В результате, антитело HuMc3 было отобрано в качестве акцептора на основе гомологии последовательности 76% в каркасном районе. Эти аминокислотные остатки в каркасном районе HuMc3 сопоставляли с аминокислотными остатками В273, и были идентифицированы положения, в которых использовались другие аминокислоты. Положения этих остатков анализировали с использованием трехмерной модели В273, сконструированной, как описано выше. Затем донорские остатки, подлежащие трансплантации на этот акцептор, отбирали в соответствии с критериями, обеспеченными Queen et al. (Proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)).

Посредством переноса некоторых донорских остатков в акцепторное антитело, конструировали гуманизированные последовательности В273, как описано в следующем Примере.

5)-1-2 Гуманизация легкой цепи В273

5)-1-2-1 Легкая цепь hB273_L1-типа:

Гуманизированная легкая цепь В273, сконструированная заменой номеров аминокислот 22 (валина), 27 (треонина), 34 (серина), 35 (лейцина), 37 (аспарагиновой кислоты), 38 (глутамина), 70 (лизина), 108 (лейцина), 110 (изолейцина), 112 (фенилаланина), 125 (глицина) и 129 (лейцина) легкой цепи cB273 SEQ ID NO:16 в Списке последовательностей, изолейцином, серином, треонином, пролином, глутаминовой кислотой, пролином, глутамином, валином, валином, тирозином, пролином и валином, соответственно, была названа “легкой цепью hB273_L1-типа”.

Нуклеотидная последовательность, кодирующая легкую цепь hB273_L1-типа, представлена SEQ ID NO:27 в Списке последовательностей. Кроме того, аминокислотная последовательность легкой цепи hB273_L1-типа представлена SEQ ID NO:28 в Списке последовательностей. Последовательности SEQ ID NO:27 и 28 показаны также на фиг. 32.

5)-1-2-2 Легкая цепь hB273_L2-типа

Гуманизированная легкая цепь В273, сконструированная заменой номеров аминокислот 37 (аспарагиновой кислоты), 38 (глутамина), 108 (лейцина), 110 (изолейцина), 125 (глицина) и 129 (лейцина), легкой цепи hB273_L2-типа SEQ ID NO:16 в Списке последовательностей, глутаминовой кислотой, пролином, валином, валином, пролином и валином, соответственно, была названа “легкой цепью hB273_L2-типа”.

Нуклеотидная последовательность, кодирующая легкую цепь hB273_L2-типа, представлена SEQ ID NO:29 в Списке последовательностей. Кроме того, аминокислотная последовательность легкой цепи hB273_L2-типа представлена SEQ ID NO:30 в Списке последовательностей. Последовательности SEQ ID NO:29 и 30 показаны также на фиг. 33.

5)-1-2-3 Легкая цепь hB273_L3-типа:

Гуманизированная легкая цепь В273, сконструированная заменой номеров аминокислот 37 (аспарагиновой кислоты), 38 (глутамина), 108 (лейцина), 110 (изолейцина) и 129 (лейцина), легкой цепи cB273 SEQ ID NO:16 в Списке последовательностей, глутаминовой кислотой, пролином, валином, валином и валином, соответственно, была названа “легкой цепью hB273_L3-типа”.

Нуклеотидная последовательность, кодирующая легкую цепь hB273_L3-типа, представлена SEQ ID NO:31 в Списке последовательностей. Кроме того, аминокислотная последовательность легкой цепи hB273_L3-типа представлена SEQ ID NO:32 в Списке последовательностей. Последовательности SEQ ID NO:31 и 32 показаны также на фиг. 34.

5)-1-3 Гуманизация тяжелой цепи В273

5)-1-3-1 Тяжелая цепь hB273_Н1-типа:

Гуманизированная тяжелая цепь В273, сконструированная заменой номеров аминокислот 20 (глутаминовой кислоты), 24 (глутамина), 28 (пролина), 30 (лейцина), 31 (валина), 39 (изолейцина), 56 (метионина), 57 (лизина), 59 (серина), 60 (гистидина), 62 (лизина), 63 (серина), 67 (изолейцина), 86 (лизина), 87 (аланина), 95 (серина), 96 (треонина), 99 (гистидина), 103 (лейцина), 106 (треонина), 110 (серина), 114 (фенилаланина), 116 (глицина), 136 (треонина) и 137 (лейцина) тяжелой цепи cB273 SEQ ID NO:20 в Списке последовательностей, глутамином, валином, аланином, валином, лизином, валином, валином, аргинином, аланином, пролином, метионином, глицином, метионином, аргинином, валином, треонином, серином, тирозином, серином, аргинином, треонином, тирозином, аланином, лейцином и валином, соответственно, была названа “тяжелой цепью hB273_H1-типа”.

Нуклеотидная последовательность, кодирующая тяжелую цепь hB273_Н1-типа, представлена SEQ ID NO:33 в Списке последовательностей. Кроме того, аминокислотная последовательность тяжелой цепи hB273_Н1-типа представлена SEQ ID NO:34 в Списке последовательностей. Последовательности SEQ ID NO:33 и 34 показаны также на фиг. 35.

5)-1-3-2 Тяжелая цепь hB273_Н2-типа:

Гуманизированная тяжелая цепь В273, сконструированная заменой номеров аминокислот 20 (глутаминовой кислоты), 24 (глутамина), 28 (пролина), 30 (лейцина), 31 (валина), 39 (изолейцина), 60 (гистидина), 62 (лизина), 95 (серина), 96 (треонина), 99 (гистидина), 103 (лейцина), 106 (треонина), 110 (серина), 116 (глицина), 136 (треонина) и 137 (лейцина) тяжелой цепи SEQ ID NO:20 в Списке последовательностей, глутамином, валином, аланином, валином, лизином, валином, пролином, метионином, треонином, серином, тирозином, серином, аргинином, треонином, аланином, лейцином и валином, соответственно, была названа “тяжелой цепью hB273_H2-типа”.

Нуклеотидная последовательность, кодирующая тяжелую цепь hB273_Н2-типа, представлена SEQ ID NO:35 в Списке последовательностей. Кроме того, аминокислотная последовательность тяжелой цепи hB273_Н2-типа представлена SEQ ID NO:36 в Списке последовательностей. Последовательности SEQ ID NO:35 и 36 показаны также на фиг. 36.

5)-1-3-3 Тяжелая цепь hB273_Н3-типа:

Гуманизированная тяжелая цепь В273, сконструированная заменой номеров аминокислот 24 (глутамина), 28 (пролина), 30 (лейцина), 31 (валина), 39 (изолейцина), 60 (гистидина), 95 (серина), 96 (треонина), 103 (лейцина), 106 (треонина), 110 (серина), 136 (треонина) и 137 (лейцина) тяжелой цепи сВ273, SEQ ID NO:20 в Списке последовательностей, валином, аланином, валином, лизином, валином, пролином, треонином, серином, серином, аргинином, треонином, лейцином и валином, соответственно, была названа “тяжелой цепью hB273_H3-типа”.

Нуклеотидная последовательность, кодирующая тяжелую цепь hB273_Н3-типа, представлена SEQ ID NO:37 в Списке последовательностей. Кроме того, аминокислотная последовательность тяжелой цепи hB273_Н3-типа представлена SEQ ID NO:38 в Списке последовательностей. Последовательности SEQ ID NO:37 и 38 показаны также на фиг. 37.

5)-2 Конструирование векторов экспрессии легкой цепи hB273_L1, hB273_L2 и hB273_L3-типа

Синтезировали ДНК, содержащие ген, кодирующий вариабельный домен легкой цепи hB273_L1, hB273_L2 и hB273_L3-типа, представленный номерами аминокислот 21-134 SEQ ID NO:28, номерами аминокислот 21-134 SEQ ID NO:30 или номерами аминокислот 21-134 SEQ ID NO:32 (GENEART, Inc. Artificial Gene Synthesis Service). Затем, каждый из ДНК-фрагментов, полученных расщеплением этих синтезированных ДНК рестрикционными ферментами NdeI и BsiWI, инсертировали в универсальный вектор экспрессии легкой цепи гуманизированного антитела (pEF6KCL) в сайте, расщепляемом этими рестрикционными ферментами NdeI и BsiWI, посредством чего конструировали векторы экспрессии легкой цепи hB273_L1, hB273_L2 и hB273_L3. Полученные таким образом векторы экспрессии были названы pEF6KCL/hB273_L1, pEF6KCL/hB273_L2 и pEF6KCL/hB273_L3, соответственно.

5)-3 Конструирование векторов экспрессии тяжелой цепи hB273_H1, hB273_H2 и hB273_H3-типа

Синтезировали ДНК, содержащие ген, кодирующий вариабельный домен тяжелой цепи hB273_H1, hB273_H2 и hB273_H3-типа, представленный номерами аминокислот 20-141 SEQ ID NO:34 в Списке последовательностей, номера аминокислот 20-141 SEQ ID NO:36 или номера аминокислот 20-141 SEQ ID NO:38 (GENEART, Inc. Artificial Gene Synthesis Service). Затем, каждый из ДНК-фрагментов, полученных расщеплением этих синтезированных ДНК рестрикционным ферментом BlpI, инсертировали в универсальный вектор экспрессии тяжелой цепи гуманизированного антитела (pEF1FCCU) в сайте, расщепляемом этим рестрикционным ферментом BlpI, посредством чего конструировали векторы экспрессии тяжелой цепи hB273_H1, hB273_H2 и hB273_H3. Полученные таким образом векторы экспрессии были названы pEF1FCCU/hB273_H1, pEF1FCCU/hB273_H2 и pEF1FCCU/hB273_H3, соответственно.

5)-4 Приготовление гуманизированного антитела

5)-4-1 Получение гуманизированного антитела

1,2×109 клеток FreeStyle 293F клеток (Invitrogen Corporation) в логарифмической фазе роста высевали в 1,2 л свежей среды для экспрессии FreeStyle 293 (Invitrogen Corporation) и культивировали в течение 1 часа встряхиванием при 90 об/мин при 37ºС в термостате с 8% СО2. 3,6 мг полиэтиленимина (Polyscience #24765) растворяли в 20 мл среды Opti-Pro SEM (Invitrogen Corporation). Затем вектор экспрессии тяжелой цепи (0,4 мг) и вектор экспрессии легкой цепи (0,8 мг), приготовленные с использованием набора PureLink HiPure Plasmid (Invitrogen Corporation), суспендировали в 20 мл среды Opti-Pro-SEM. Затем, 20 мл полученной смешанной жидкости векторов экспрессии/Opti-Pro SEM добавляли к 20 мл полученной жидкости полиэтиленимин/Opti-Pro SEM и полученную смесь осторожно перемешивали и затем оставляли на 5 минут. После этого, эту смесь добавляли к клеткам FreeStyle 293F. После 3 часов, Z-VAD-FMK (PEPTIDE (INSTITUTE, Inc.) добавляли к ней при конечной концентрации 10 мкМ и встряхивание культуры при 90 об/мин выполняли в течение 7 дней при 37ºС в термостате с 8% СО2. Полученный культуральный супернатант фильтровали через фильтр с одноразовой капсульным фильтром (Advantec #CCS-045-E1H).

Гуманизированное антитело сВ273, полученное комбинированием pEF1FCCU/В273_Н1 и pEF6KCL/hB273_L1, было названо “hB273_H1/hB273_L1”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н1 и pEF6KCL/hB273_L2, было названо “hB273_Н1/hB273_L2”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н1 и pEF6KCL/hB273_L3, было названо “hB273_H1/hB273_L3”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н2 и pEF6KCL/hB273_L1, было названо “hB273_H2/hB273_L1”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н2 и pEF6KCL/hB273_L2, было названо “hB273_H2/hB273_L2”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н2 и pEF6KCL/hB273_L3, было названо “hB273_H2/hB273_L3”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н3 и pEF6KCL/hB273_L1, было названо “hB273_H3/hB273_L1”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н3 и pEF6KCL/hB273_L2, было названо “hB273_H3/hB273_L2”, и гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н3 и pEF6KCL/hB273_L3, было названо “hB273_H1/hB273_L3”.

5)-4-2 Очистка гуманизированного антитела

Культуральный супернатант, полученный в приведенном выше 5)-4-1, очищали двухступенчатым процессом, включающим rProtein A аффинную хроматографию (при 4-6ºС) и очистку с применением колонки керамического гидроксиапатита (при комнатной температуре). Смену буфера после очистки rProtein A аффинной хроматографии и после очистки с применением керамического гидроксиапатита выполняли при комнатной температуре. Сначала 1100-1200 мл культурального супернатанта наносили на MabSelect SuRe (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две HiTrap-колонки (объем: 1 мл), соединенные последовательно), уравновешенную ЗФР. После выливания всего культурального раствора в колонку, колонку промывали 15-30 мл ЗФР. Затем выполняли элюцию 2 М раствором гидрохлорида аргинина (рН 4,0), и собирали фракцию, содержащую антитело. Фракцию наносили на обессоливающую колонку (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две обессоливающие колонки HiTrap (объем: 5 мл) соединенные последовательно), заменяя тем самым буфер буфером, содержащим 5 мМ фосфат натрия, 50 мМ MES и 20 мМ NaCl при рН 6,5. Далее, раствор антитела, подвергнутый замене буфера, наносили на колонку с керамическим гидроксиапатитом (Japan Bio-Rad Laboratories, Inc., Bio-Scale CHT2-1 hydroxyapatite column (объем: 2 мл)), уравновешенную буфером, содержащим 5 мМ NaPi, 50 мМ MES и 20 мМ NaCl при рН 6,5. Затем, выполняли элюцию с использованием линейного градиента концентрации с хлоридом натрия и фракцию, содержащую это антитело, собирали. Эту фракцию наносили на обессоливающую колонку (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две обессоливающие колонки HiTrap (объем: 5 мл) соединенные последовательно), заменяя тем самым эту жидкость CBS (10 мМ цитратный буфер, содержащий 140 мМ хлорид натрия, рН 6,0). Наконец, полученный раствор концентрировали с использованием Centrifugal UF Filter Device VIVASPIN 20 (фракционная молекулярная масса: 30 К, Sartorius Co., Ltd., при 4ºС), и концентрацию IgG доводили до 1,0 мг/мл или более, и полученный таким образом раствор использовали в качестве очищенной пробы.

Пример 6. Измерение активности гуманизированного В273 (hB273)-антитела (1)

6)-1 Оценивание активности связывания антитела hB273 с использованием Biacore

Константу диссоциации каждого из гуманизированных анти-DR5-антител и rsDR5 измеряли с использованием Biacore Т100 (GE Healthcare Bio-Sciences Co., Ltd.) способом захвата, в котором антитело захватывается иммобилизованным анти-IgG (Fc) человека-антителом и это измерение выполняется с использованием антигена в качестве аналита. Анти-IgG (Fc) человека-антитело (Набор для захвата антитела человека, GE Healthcare Bio-Sciences Co., Ltd.) ковалентно иммобилизовали на сенсорном чипе СМ5 (BIAcore, Inc.) при приблизительно 10000 RU способом аминосочетания. Иммобилизацию выполняли также на ссылочной клетке таким же образом. В качестве рабочего буфера, использовали HBS-ER (10 мМ HEPES рН 7,4, 0,15 М NaCl, 3 мМ ЭДТА и 0,05% поверхностно-активное вещество Р20). На этот чип, имеющий анти-IgG (Fc) человека-антитело, иммобилизованное на нем, добавляли раствор антитела при 20 нМ при скорости потока 10 мкл/мин в течение 60 секунд и затем добавляли серию разведений rsDR5 (3,13-50 нМ) при скорости потока 30 мкл/мин в течение 120 секунд и затем фазу диссоциации подвергали мониторингу в течение 180 секунд. В качестве регенерирующего раствора, добавляли 3 М хлорид магния при скорости потока 10 мкл/мин в течение 30 секунд. В этом анализе данных, использовали программу для анализа (программу Biacore Т100 Evaluation, версию 2.0.1) с взаимно однозначной моделью связывания и рассчитывали константу скорости ассоциации (kon), константу скорости диссоциации (koff) и константу диссоциации (KD; KD = koff/kon). Эти результаты, полученные измерением с использованием Biacore для 9 типов гуманизированных DR5-антител, показаны на фиг. 8.

6)-2 In vitro разрушающая клетки активность антитела hB273 против клеточной линии рака человека

AffiniPure F(ab')2-фрагмент, специфический в отношении козьего антитела против Fc-фрагмента IgG человека (изготовляемый Jackson ImmunoResearch Laboratories, Inc., #109-006-098), полученный при 50 мкг/мл с 5 мМ Трис-HCl (рН 8,5), распределяли при 45 мкл на лунку в 96-луночном микропланшете (изготовляемом Corning Incorporated) и этот планшет оставляли стоять в течение ночи при 4ºС. После промывания каждой лунки дважды с использованием ЗФР, культуральный супернатант 293F, которому давали продуцировать антитело в 5)-4-1, очищенное антитело cB273 (Пример 2-3-2) или коммерчески доступный IgG человека (изготовляемый Jackson ImmunoResearch Laboratories, Inc., #109-000-003) добавляли при 50 мкл на лунку, так что конечная концентрация этого антитела была 150-1,5 нг/мл, и этот планшет оставляли стоять в течение ночи при 4ºС. После промывания каждой лунки дважды ЗФР, клетки Jurkat, полученные при 4,0×104 клеток на мл в среде RPMI 1640, содержащей 10% ФТС, добавляли при 50 мкг на лунку и культивировали при условиях 37ºС и 5% СО2 в течение 23 часов. Количество АТФ, происходящее из жизнеспособных клеток, определяли количественно с использованием набора для анализа жизнеспособности CellTiter-Glo люминесцентных клеток (изготовляемого Promega Corporation, #G7571) и разрушающий клетки эффект каждого из антител hB273 оценивали принятием величины, полученной из лунки, к которой была добавлена среда вместо раствора антител, за 100%. В результате, как показано на фиг. 9, наблюдали тенденцию, что антитела, содержащие тяжелую цепь Н1-типа, проявляли слегка более низкий разрушающий клетки эффект, чем антитела, содержащие тяжелую цепь Н2 или Н3-типа. С другой стороны, в отношении гуманизации легкой цепи В273, было обнаружено, что антитела, содержащие любую из легкой цепи L1, L2 и L3-типа, могут проявлять по существу тот же самый разрушающий клетки эффект.

Пример 7. Гуманизация антитела cB273 (2)

7)-1 Конструирование гуманизированного В273 (hB273)

7)-1-1 Конструирование аминокислотной последовательности гуманизированного В273

На основе результатов конструирования гуманизированных антител (1), показанных в Примерах 5 и 6, посредством перенесения нескольких донорских остатков в акцепторное антитело, конструировали гуманизированные последовательности В273, как описано в следующем Примере.

7)-1-2 Конструирование аминокислотной последовательности гуманизированного В273

7)-1-2-1 Тяжелая цепь hB273_Н1-1-типа:

Гуманизированная тяжелая цепь В273, сконструированная заменой номеров аминокислот 20 (глутаминовой кислоты), 24 (глутамина), 28 (пролина), 30 (лейцина), 31 (валина), 39 (изолейцина), 57 (лизина), 59 (серина), 60 (гистидина), 62 (лизина), 63 (серина), 67 (изолейцина), 86 (лизина), 87 (аланина), 95 (серина), 96 (треонина), 99 (гистидина), 103 (лейцина), 106 (треонина), 110 (серина), 136 (треонина) и 137 (лейцина) тяжелой цепи cB273 SEQ ID NO:20 в Списке последовательностей, глутамином, валином, аланином, валином, лизином, валином, аргинином, аланином, пролином, метионином, глицином, метионином, аргинином, валином, треонином, серином, тирозином, серином, аргинином, треонином, лейцином и валином, соответственно, была названа “тяжелой цепью hB273_H1-1-типа”.

Нуклеотидная последовательность, кодирующая тяжелую цепь hB273_Н1-1-типа, представлена SEQ ID NO:39 в Списке последовательностей. Кроме того, аминокислотная последовательность тяжелой цепи hB273_Н1-1-типа представлена SEQ ID NO:40 в Списке последовательностей. Последовательности SEQ ID NO:39 и 40 показаны также на фиг. 38.

7)-1-2-2 Тяжелая цепь hB273_Н2-1-типа:

Гуманизированная тяжелая цепь В273, сконструированная заменой номеров аминокислот 24 (глутамина), 28 (пролина), 30 (лейцина), 31 (валина), 39 (изолейцина), 60 (гистидина), 62 (лизина), 95 (серина), 96 (треонина) 99 (гистидина), 103 (лейцина), 106 (треонина), 110 (серина), 116 (глицина), 136 (треонина) и 137 (лейцина) тяжелой цепи cB273 SEQ ID NO:20 в Списке последовательностей, валином, аланином, валином, лизином, валином, пролином, метионином, треонином, серином, тирозином, серином, аргинином, треонином, аланином, лейцином и валином, соответственно, была названа “тяжелой цепью hB273_H2-1-типа”.

Нуклеотидная последовательность, кодирующая тяжелую цепь hB273_Н2-1-типа, представлена SEQ ID NO:41 в Списке последовательностей. Кроме того, аминокислотная последовательность тяжелой цепи hB273_Н2-1-типа представлена SEQ ID NO:42 в Списке последовательностей. Последовательности SEQ ID NO:41 и 42 показаны также на фиг. 39.

7)-1-2-3 Тяжелая цепь hB273_Н2-2-типа:

Гуманизированная тяжелая цепь В273, сконструированная заменой номеров аминокислот 20 (глутаминовой кислоты), 24 (глутамина), 28 (пролина), 30 (лейцина), 31 (валина), 39 (изолейцина), 60 (гистидина), 62 (лизина), 95 (серина), 96 (треонина), 103 (лейцина), 106 (треонина), 110 (серина), 116 (глицина), 136 (треонина) и 137 (лейцина) тяжелой цепи cB273 SEQ ID NO:20 в Списке последовательностей, глутамином, валином, аланином, валином, лизином, валином, пролином, метионином, треонином, серином, серином, аргинином, треонином, аланином, лейцином и валином, соответственно, была названа “тяжелой цепью hB273_H2-2-типа”.

Нуклеотидная последовательность, кодирующая тяжелую цепь hB273_Н2-2-типа, представлена SEQ ID NO:43 в Списке последовательностей. Кроме того, аминокислотная последовательность тяжелой цепи hB273_Н2-2-типа представлена SEQ ID NO:44 в Списке последовательностей. Последовательности SEQ ID NO:43 и 44 показаны также на фиг. 40.

7)-1-2-4 Тяжелая цепь hB273 Н2-3-типа

Гуманизированная тяжелая цепь В273, сконструированная заменой номеров аминокислот 24 (глутамина), 28 (пролина), 30 (лейцина), 31 (валина), 39 (изолейцина), 60 (гистидина), 62 (лизина), 95 (серина), 96 (треонина), 103 (лейцина), 106 (треонина), 110 (серина), 116 (глицина), 136 (треонина) и 137 (лейцина) тяжелой цепи cB273 SEQ ID NO:20 в Списке последовательностей, валином, аланином, валином, лизином, валином, пролином, метионином, треонином, серином, серином, аргинином, треонином, аланином, лейцином и валином, соответственно, была названа “тяжелой цепью hB273_H2-3-типа”.

Нуклеотидная последовательность, кодирующая тяжелую цепь hB273_Н2-3-типа, представлена SEQ ID NO:45 в Списке последовательностей. Кроме того, аминокислотная последовательность тяжелой цепи hB273_Н2-3-типа представлена SEQ ID NO:46 в Списке последовательностей. Последовательности SEQ ID NO:45 и 46 показаны также на фиг. 41.

7)-1-2-5 Тяжелая цепь hB273_Н2-4-типа

Гуманизированная тяжелая цепь В273, сконструированная заменой номеров аминокислот 20 (глутаминовой кислоты), 24 (глутамина), 28 (пролина), 30 (лейцина), 31 (валина), 39 (изолейцина), 60 (гистидина), 62 (лизина), 95 (серина), 96 (треонина), 99 (гистидина), 103 (лейцина), 106 (треонина), 110 (серина), 136 (треонина) и 137 (лейцина) тяжелой цепи cB273 SEQ ID NO:20 в Списке последовательностей, глутамином, валином, аланином, валином, лизином, валином, пролином, метионином, треонином, серином, тирозином, серином, аргинином, треонином, лейцином и валином, соответственно, была названа “тяжелой цепью hB273_H2-4-типа”.

Нуклеотидная последовательность, кодирующая тяжелую цепь hB273_Н2-4-типа, представлена SEQ ID NO:47 в Списке последовательностей. Кроме того, аминокислотная последовательность тяжелой цепи hB273_Н2-4-типа представлена SEQ ID NO:48 в Списке последовательностей. Последовательности SEQ ID NO:47 и 48 показаны также на фиг. 42

7)-1-2-6 Тяжелая цепь hB273_Н2-5-типа

Гуманизированная тяжелая цепь В273, сконструированная заменой номеров аминокислот 20 (глутаминовой кислоты), 24 (глутамина), 28 (пролина), 30 (лейцина), 31 (валина), 39 (изолейцина), 60 (гистидина), 95 (серина), 96 (треонина), 99 (гистидина), 103 (лейцина), 106 (треонина), 110 (серина), 136 (треонина) и 137 (лейцина) тяжелой цепи cB273 SEQ ID NO:20 в Списке последовательностей, глутамином, валином, аланином, валином, лизином, валином, пролином, треонином, серином, тирозином, серином, аргинином, треонином, лейцином и валином, соответственно, была названа “тяжелой цепью hB273_H2-5-типа”.

Нуклеотидная последовательность, кодирующая тяжелую цепь hB273_Н2-5-типа, представлена SEQ ID NO:49 в Списке последовательностей. Кроме того, аминокислотная последовательность тяжелой цепи hB273_Н2-5-типа представлена SEQ ID NO:50 в Списке последовательностей. Последовательности SEQ ID NO:49 и 50 показаны также на фиг. 43.

7)-2 Конструирование векторов экспрессии тяжелой цепи hB273_Н1-1, hB273_Н2-1, hB273_Н2-2, hB273_Н2-3, hB273_Н2-4 и hB273_Н2-5-типа

Синтезировали ДНК, содержащие ген, кодирующий вариабельный домен тяжелой цепи hB273_H1-1, hB273_H2-1, hB273_H2-2, hB273_H2-3, hB273_H2-4 или hB273_Н2-5-типа, представленные номерами аминокислот 20-141 SEQ ID NO:40 в Списке последовательностей, номерами аминокислот 20-141 SEQ ID NO:42, номерами аминокислот 20-141 SEQ ID NO:44, номерами аминокислот 20-141 SEQ ID NO:46, номерами аминокислот 20-141 SEQ ID NO:48 или номерами аминокислот 20-141 SEQ ID NO:50 (GENEART, Inc. Artificial Gene Synthesis Service). Затем, каждый из ДНК-фрагментов, полученных расщеплением этих синтезированных ДНК рестрикционным ферментом BlpI, инсертировали в универсальный вектор экспрессии тяжелой цепи гуманизированного антитела (pEF1FCCU) в сайте, расщепляемом этим рестрикционным ферментом BlpI, посредством чего конструировали векторы экспрессии тяжелой цепи hB273_H1-1, hB273_H2-1, hB273_H2-2, hB273_H2-3, hB273_H2-4 и hB273_H2-5. Полученные таким образом векторы экспрессии были названы “pEF1FCCU/hB273_H1-1”, “pEF1FCCU/hB273_H2-1”, “pEF1FCCU/hB273_H2-2”, “pEF1FCCU/hB273_H2-3”, “pEF1FCCU/hB273_H2-4”, и pEF1FCCU/hB273_H2-5, соответственно.

7)-3 Приготовление гуманизированного антитела

7)-3-1 Получение гуманизированного антитела

1,2×109 клеток FreeStyle 293F клеток (Invitrogen Corporation) в логарифмической фазе роста высевали в 1,2 л свежей среды для экспрессии FreeStyle 293 (Invitrogen Corporation) и культивировали в течение 1 часа встряхиванием при 90 об/мин при 37ºС в термостате с 8% СО2. 3,6 мг полиэтиленимина (Polyscience #24765) растворяли в 20 мл среды Opti-Pro SEM (Invitrogen Corporation). Затем вектор экспрессии тяжелой цепи (0,4 мг) и вектор экспрессии легкой цепи (0,8 мг), полученные с использованием набора PureLink HiPure Plasmid (Invitrogen Corporation), суспендировали в 20 мл среды Opti-Pro-SEM. Затем, 20 мл полученной смешанной жидкости векторов экспрессии/Opti-Pro SEM добавляли к 20 мл полученной смешанной жидкости полиэтиленимин/Opti-Pro SEM и полученную смесь осторожно перемешивали и затем оставляли на 5 минут. После этого, эту смесь добавляли к клеткам FreeStyle 293F. После 3 часов, Z-VAD-FMK (PEPTIDE (INSTITUTE, Inc.) добавляли к ней при конечной концентрации 10 мкМ и встряхивание культуры при 90 об/мин выполняли в течение 7 дней при 37ºС в термостате с 8% СО2. Полученный культуральный супернатант фильтровали через одноразовый капсульный фильтр (Advantec #CCS-045-E1H).

Гуманизированное антитело сВ273, полученное комбинированием pEF1FCCU/hB273_Н1-1 и pEF6KCL/hB273_L1, было названо “hB273_H1-1/hB273_L1”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н2-1 и pEF6KCL/hB273_L2, было названо “hB273_Н2-1/hB273_L1”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н2-2 и pEF6KCL/hB273_L1, было названо “hB273_H2-2/hB273_L1”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н2-3 и pEF6KCL/hB273_L1, было названо “hB273_H2-3/hB273_L1”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н2-4 и pEF6KCL/hB273_L1, было названо “hB273_H2-4/hB273_L1”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н2-5 и pEF6KCL/hB273_L1, было названо “hB273_H2-5/hB273_L1”.

7)-3-2 Очистка гуманизированного антитела

Культуральный супернатант, полученный в приведенном выше 7)-3-1, очищали двухступенчатым процессом, включающим rProtein A аффинную хроматографию (при 4-6ºС) и очистку с применением колонки керамического гидроксиапатита (при комнатной температуре). Смену буфера после очистки rProtein A аффинной хроматографией и после очистки с применением керамического гидроксиапатита выполняли при комнатной температуре. Сначала 1100-1200 мл культурального супернатанта наносили на MabSelect SuRe (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две HiTrap-колонки (объем: 1 мл), соединенные последовательно), уравновешенную ЗФР. После выливания всего культурального раствора в эту колонку, эту колонку промывали 15-30 мл ЗФР. Затем выполняли элюцию 2 М раствором гидрохлорида аргинина (рН 4,0), и собирали фракцию, содержащую это антитело. Эту фракцию наносили на обессоливающую колонку (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две обессоливающие колонки HiTrap (объем: 5 мл) соединенные последовательно), заменяя тем самым этот буфер буфером, содержащим 5 мМ фосфат натрия, 50 мМ MES и 20 мМ NaCl при рН 6,5. Далее, раствор антитела, подвергнутый замене буфера, наносили на колонку с керамическим гидроксиапатитом (Japan Bio-Rad Laboratories, Inc., Bio-Scale CHT2-1 hydroxyapatite column (объем: 2 мл)), уравновешенную буфером, содержащим 5 мМ NaPi, 50 мМ MES и 20 мМ NaCl при рН 6,5. Затем, выполняли элюцию с использованием линейного градиента концентрации с хлоридом натрия и фракцию, содержащую это антитело, собирали. Фракцию наносили на обессоливающую колонку (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две обессоливающие колонки HiTrap (объем: 5 мл) соединенные последовательно), заменяя тем самым эту жидкость CBS (10 мМ цитратный буфер, содержащий 140 мМ хлорид натрия, рН 6,0). Наконец, полученный раствор концентрировали с использованием Centrifugal UF Filter Device VIVASPIN 20 (фракционная молекулярная масса: 30 К, Sartorius Co., Ltd., при 4ºС), и концентрацию IgG доводили до 1,0 мг/мл или более, и полученный таким образом раствор использовали в качестве очищенной пробы.

Пример 8. Измерение активности гуманизированного В273 (hB273)-антитела (2)

8)-1 Оценивание активности связывания антитела hB273 с использованием Biacore

Константу диссоциации каждого из гуманизированных анти-DR5-антител и rsDR5 измеряли с использованием Biacore Т100 (GE Healthcare Bio-Sciences Co., Ltd.) способом захвата, в котором антитело захватывается иммобилизованным анти-IgG (Fc) человека-антителом и это измерение выполняется с использованием антигена в качестве аналита. Анти-IgG (Fc) человека-антитело (Набор для захвата антитела человека, GE Healthcare Bio-Sciences Co., Ltd.) ковалентно иммобилизовали на сенсорном чипе СМ5 (BIAcore, Inc.) при приблизительно 10000 RU способом аминосочетания. Иммобилизацию выполняли также на ссылочной клетке таким же образом. В качестве рабочего буфера, использовали HBS-EP (10 мМ HEPES рН 7,4, 0,15 М NaCl, 3 мМ ЭДТА и 0,05% поверхностно-активное вещество Р20). На этот чип, имеющий анти-IgG (Fc) человека-антитело, иммобилизованное на нем, добавляли раствор антитела при 20 нМ при скорости потока 10 мкл/мин в течение 60 секунд и затем добавляли серию разведений rsDR5 (3,13-50 нМ) при скорости потока 30 мкл/мин в течение 120 секунд и затем фазу диссоциации подвергали мониторингу в течение 180 секунд. В качестве регенерирующего раствора, добавляли 3 М хлорид магния при скорости потока 10 мкл/мин в течение 30 секунд. В этом анализе данных, использовали программу для анализа (программу Biacore Т100 Evaluation, версию 2.0.1) с взаимно однозначной моделью связывания и рассчитывали константу скорости ассоциации (kon), константу скорости диссоциации (koff) и константу диссоциации (KD; KD = koff/kon). Эти результаты, полученные измерением с использованием Biacore для 6 типов гуманизированных DR5-антител, показаны на фиг. 10.

8)-2 In vitro разрушающая клетки активность антитела hB273 против клеточной линии рака человека

AffiniPure F(ab')2-фрагмент, специфический в отношении козьего антитела против Fc-фрагмента IgG человека (изготовляемый Jackson ImmunoResearch Laboratories, Inc., #109-006-098), полученный при 50 мкг/мл с 5 мМ Трис-HCl (рН 8,5), распределяли при 45 мкл на лунку в 96-луночном микропланшете (изготовляемом Corning Incorporated) и этот планшет оставляли стоять в течение ночи при 4ºС. После промывания каждой лунки дважды с использованием ЗФР, культуральный супернатант 293F, которому давали продуцировать это антитело в 7)-3-1, добавляли при 50 мкл на лунку, так что конечная концентрация этого антитела была 150-1,5 нг/мл, и этот планшет оставляли стоять в течение ночи при 4ºС. После промывания каждой лунки дважды ЗФР, клетки Jurkat, приготовленные при 4,0×104 клеток на мл в среде RPMI 1640, содержащей 10% ФТС, добавляли при 50 мкг на лунку и культивировали при условиях 37ºС и 5% СО2 в течение 23 часов. Количество АТФ, происходящее из жизнеспособных клеток, определяли количественно с использованием набора для анализа жизнеспособности CellTiter-Glo люминесцентных клеток (изготовляемого Promega Corporation, #G7571) и разрушающий клетки эффект каждого из антител hB273 оценивали принятием величины, полученной из лунки, к которой была добавлена среда вместо раствора антител, за 100. В результате, как показано на фиг. 11, наблюдали тенденцию для антитела В273_Н1-1/L1 проявления более высокой разрушающей клетки активности, чем активность антитела hB273_Н1/L1, и на этом основании конструировали антитело hB273_Н1-1/L1. С другой стороны, антитела, hB273_Н2-1/L1 - hB273_Н2-5/L1 проявляли по существу такой же разрушающий клетки эффект, что и антитело hB273_Н2/L1, и на этом основании конструировали антитела hB273_Н2-1/L1 - hB273_Н2-5/L1.

Пример 9. Удаление сайта деамидирования из CDR cB273-антитела

9)-1 Конструирование мутанта и конструирование вектора экспрессии

9)-1-1 Конструирование мутанта

Обычно, деамидирование аспарагина в белке происходит через образование переходного состояния циклического сукцинимида между аспарагином и смежной аминокислотой на С-концевой стороне (Geiger, T. and Clarke, S/ (1987) Deamidation, Isomerization and racemization at asparaginyl and aspartyl residues in peptides. Succinimid-linked reactions that contribute to protein degradation. J. Biol. Chem., 262, 785-794). Ограничивающим скорость фактором для образования переходного состояния циклического сукцинимида является размер боковой цепи смежной аминокислоты, и, следовательно, глицин, который имеет самую маленькую боковую цепь, может достигать самой быстрой скорости деамидирования. С другой стороны, заменой смежной группы на С-концевой стороне аминокислотой, имеющей большую боковую цепь, скорость деамидирования может быть супрессирована. В273-антитело имеет -N-G-(аспарагин/глицин)-последовательность, которая является чувствительной к деамидированию как в L-цепи, так и Н-цепи. Таким образом, авторы настоящего изобретения получали точковые мутанты, в которых смежная группа могла изменяться из глицина в лизин, фенилаланин, лейцин или глутаминовую кислоту, каждая из которых имеют более длинную боковую цепь, чем глицин. То есть, конструирование мутантов таким образом, что в Н-цепи, -N-G-(аспарагин-глицин)-последовательность была мутирована в последовательность -N-Е-(аспарагин-глутаминовая кислота), а в L-цепи, -N-G-(аспарагин-глицин)-последовательность была мутирована в последовательность -N-L-(аспарагин-лейцин), последовательность -N-F-(аспарагин-фенилаланин), последовательность -N-K-(аспарагин-лизин) или последовательность -N-E-(аспарагин-глутаминовая кислота).

9)-1-2 Конструирование вектора экспрессии легкой цепи hB273_L1-NE-типа

С использованием pEF6KCL/hB273_L1, который является вектором экспрессии легкой цепи hB273_L1-типа, получаемым в Примере 5, в качестве матрицы, ДНК-фрагмент, полученный выполнением ПЦР с использованием набора праймеров А, и ДНК-фрагмент полученный выполнением ПЦР с использованием набора праймеров В, лигировали друг с другом с использованием ПЦР с перекрывающимся удлинением с использованием набора праймеров С. ДНК-фрагмент, полученный расщеплением полученного таким образом ДНК-фрагмента рестриктазами NheI и PmeI, инсертировали в универсальный вектор экспрессии легкой цепи гуманизированного антитела (pEF6KCL) в сайте, расщепляемом рестриктазами NheI и PmeI, посредством чего конструировали вектор экспрессии легкой цепи hB273_L1-NE-типа, в котором глицин при номере аминокислоты 54 SEQ ID NO:28 был заменен глутаминовой кислотой. Полученный таким образом вектор экспрессии был назван “pEF6KCL/hB273_L1-NE”.

Нуклеотидная последовательность, кодирующая легкую цепь hB273_L1-NE, представлена SEQ ID NO:51 в Списке последовательностей. Кроме того, аминокислотная последовательность легкой цепи hB273_L1-NE-типа представлена SEQ ID NO:52 в Списке последовательностей. Последовательности SEQ ID NO:51 и 52 показаны также на фиг. 44.

Набор праймеров А

5'-aggtaagcttgctagcgccaccatggtgctgc-3' (L-F1: SEQ ID NO:53 в Списке последовательностей)

5'-ccaatgcaggtaagtgttctcattgctatggaccagtgactg-3' (L-NE-R2: SEQ ID NO:54 в Списке последовательностей)

Набор праймера В

5'-cagtcactggtccatagcaatgagaacacttacctgcattgg-3' (L-NE-F2: SEQ ID NO:55 в Списке последовательностей)

5'-ggatgccacccgtttaaacgggcccctaacac-3' (L-R1: SEQ ID NO:56 в Списке последовательностей)

Набор праймеров С

5'-aggtaagcttgctagcgccaccatggtgctgc-3' (L-F1: SEQ ID NO:53 в Списке последовательностей)

5'-ggatgccacccgtttaaacgggcccctaacac-3' (L-R1: SEQ ID NO:56 в Списке последовательностей)

9)-1-3 Конструирование вектора экспрессии легкой цепи hB273_L1-NF-типа

С использованием pEF6KCL/hB273_L1, который является вектором экспрессии легкой цепи hB273_L1-типа, продуцируемым в Примере 5, в качестве матрицы, ДНК-фрагмент, полученный выполнением ПЦР с использованием набора праймеров А, и ДНК-фрагмент полученный выполнением ПЦР с использованием набора праймеров В, лигировали друг с другом с использованием ПЦР с перекрывающимся удлинением с использованием набора праймеров С. ДНК-фрагмент, полученный расщеплением полученного таким образом ДНК-фрагмента рестриктазами NheI и PmeI, инсертировали в универсальный вектор экспрессии легкой цепи гуманизированного антитела (pEF6KCL) в сайте, расщепляемом рестриктазами NheI и PmeI, посредством чего конструировали вектор экспрессии легкой цепи hB273_L1-NF-типа, в котором глицин при номере аминокислоты 54 SEQ ID NO:28 был заменен фенилаланином. Полученный таким образом вектор экспрессии был назван “pEF6KCL/hB273_L1-NF”.

Нуклеотидная последовательность, кодирующая легкую цепь hB273_L1-NF, представлена SEQ ID NO:57 в Списке последовательностей. Кроме того, аминокислотная последовательность легкой цепи hB273_L1-NF представлена SEQ ID NO:58 в Списке последовательностей. Последовательности SEQ ID NO:57 и 58 показаны также на фиг. 45.

Набор праймеров А

5'-aggtaagcttgctagcgccaccatggtgctgc-3' (L-F1: SEQ ID NO:53 в Списке последовательностей)

5'-ccaatgcaggtaagtgttgaaattgctatggaccagtgactg-3' (L-NF-R2: SEQ ID NO:59 в Списке последовательностей)

Набор праймеров В

5'-cagtcactggtccatagcaatttcaacacttacctgcattgg-3' (L-NF-F2: SEQ ID NO:60 в Списке последовательностей)

5'-ggatgccacccgtttaaacgggcccctaacac-3' (L-R1: SEQ ID NO:56 в Списке последовательностей)

Набор праймеров С

5'-aggtaagcttgctagcgccaccatggtgctgc-3' (L-F1: SEQ ID NO:53 в Списке последовательностей)

5'-ggatgccacccgtttaaacgggcccctaacac-3' (L-R1: SEQ ID NO:56 в Списке последовательностей)

9)-1-4 Конструирование вектора экспрессии легкой цепи hB273_L1-NK-типа

С использованием pEF6KCL/hB273_L1, который является вектором экспрессии легкой цепи hB273_L1-типа, продуцируемым в Примере 5, в качестве матрицы, ДНК-фрагмент, полученный выполнением ПЦР с использованием набора праймеров А, и ДНК-фрагмент полученный выполнением ПЦР с использованием набора праймеров В, лигировали друг с другом с использованием ПЦР с перекрывающимся удлинением с использованием набора праймеров С. ДНК-фрагмент, полученный расщеплением полученного таким образом ДНК-фрагмента рестриктазами NheI и PmeI, инсертировали в универсальный вектор экспрессии легкой цепи гуманизированного антитела (pEF6KCL) в сайте, расщепляемом рестриктазами NheI и PmeI, посредством чего конструировали вектор экспрессии легкой цепи hB273_L1-NK-типа, в котором глицин при номере аминокислоты 54 SEQ ID NO:28 был заменен лизином. Полученный таким образом вектор экспрессии был назван “pEF6KCL/hB273_L1-NK”.

Нуклеотидная последовательность, кодирующая легкую цепь hB273_L1-NK, представлена SEQ ID NO:61 в Списке последовательностей. Кроме того, аминокислотная последовательность легкой цепи hB273_L1-NK-типа представлена SEQ ID NO:62 в Списке последовательностей. последовательности SEQ ID NO:61 и 62 показаны также на фиг. 46.

Набор праймеров А

5'-aggtaagcttgctagcgccaccatggtgctgc-3' (L-F1: SEQ ID NO:53 в Списке последовательностей)

5'-ccaatgcaggtaagtgttcttattgctatggaccagtgactg-3' (L-NK-R2: SEQ ID NO:63 в Списке последовательностей)

Набор праймеров В

5'-cagtcactggtccatagcaataagaacacttacctgcattgg-3' (L-NK-F2: SEQ ID NO:64 в Списке последовательностей)

5'-ggatgccacccgtttaaacgggcccctaacac-3' (L-R1: SEQ ID NO:56 в Списке последовательностей)

Набор праймеров С

5'-aggtaagcttgctagcgccaccatggtgctgc-3' (L-F1: SEQ ID NO:53 в Списке последовательностей)

5'-ggatgccacccgtttaaacgggcccctaacac-3' (L-R1: SEQ ID NO:56 в Списке последовательностей)

9)-1-5 Конструирование вектора экспрессии легкой цепи hB273_L1-NL-типа

С использованием pEF6KCL/hB273_L1, который является вектором экспрессии легкой цепи hB273_L1-типа, получаемым в Примере 5, в качестве матрицы, ДНК-фрагмент, полученный выполнением ПЦР с использованием набора праймеров А, и ДНК-фрагмент полученный выполнением ПЦР с использованием набора праймеров В, лигировали друг с другом с использованием ПЦР с перекрывающимся удлинением с использованием набора праймеров С. ДНК-фрагмент, полученный расщеплением полученного таким образом ДНК-фрагмента рестриктазами NheI и PmeI, инсертировали в универсальный вектор экспрессии легкой цепи гуманизированного антитела (pEF6KCL) в сайте, расщепляемом рестриктазами NheI и PmeI, посредством чего конструировали вектор экспрессии легкой цепи hB273_L1-NL-типа, в котором глицин при номере аминокислоты 54 SEQ ID NO:28 был заменен лейцином. Полученный таким образом вектор экспрессии был назван “pEF6KCL/hB273_L1-NL”.

Нуклеотидная последовательность, кодирующая легкую цепь hB273_L1-NL-типа, представлена SEQ ID NO:65 в Списке последовательностей. Кроме того, аминокислотная последовательность легкой цепи hB273_L1-NL-типа представлена SEQ ID NO:66 в Списке последовательностей. Последовательности SEQ ID NO:65 и 66 показаны также на фиг.47.

Набор праймеров А

5'-aggtaagcttgctagcgccaccatggtgctgc-3' (L-F1: SEQ ID NO:53 в Списке последовательностей)

5'-ccaatgcaggtaagtgttcagattgctatggaccagtgactg-3' (L-NL-R2: SEQ ID NO:67 в Списке последовательностей)

Набор праймеров В

5'-cagtcactggtccatagcaatctgaacacttacctgcattgg-3' (L-NL-F2: SEQ ID NO:68 в Списке последовательностей)

5'-ggatgccacccgtttaaacgggcccctaacac-3' (L-R1: SEQ ID NO:56 в Списке последовательностей)

Набор праймеров С

5'-aggtaagcttgctagcgccaccatggtgctgc-3' (L-F1: SEQ ID NO:53 в Списке последовательностей)

5'-ggatgccacccgtttaaacgggcccctaacac-3' (L-R1: SEQ ID NO:56 в Списке последовательностей)

9)-1-6 Конструирование вектора экспрессии тяжелой цепи hB273_H2-1-NE-типа

С использованием pEF1FCCU/hB273_H2-1, который является вектором экспрессии тяжелой цепи hB273_Н2-1-типа, продуцируемым в Примере 7, в качестве матрицы, ДНК-фрагмент, полученный выполнением ПЦР с использованием набора праймеров А, и ДНК-фрагмент полученный выполнением ПЦР с использованием набора праймеров В, лигировали друг с другом с использованием ПЦР с перекрывающимся удлинением с использованием набора праймеров С. ДНК-фрагмент, полученный расщеплением полученного таким образом ДНК-фрагмента рестриктазами NheI и PmeI, инсертировали в универсальный вектор экспрессии тяжелой цепи гуманизированного антитела (pEF1FCCU) в сайте, расщепляемом рестриктазами NheI и PmeI, посредством чего конструировали вектор экспрессии тяжелой цепи hB273_H2-1-NE-типа, в котором глицин при номере аминокислоты 75 SEQ ID NO:42 был заменен глутаминовой кислотой. Полученный таким образом вектор экспрессии был назван “pEF1FCCU/hB273_Н2-1-NE”.

Нуклеотидная последовательность, кодирующая тяжелую цепь hB273_H2-1-NE-типа, представлена SEQ ID NO:69 в Списке последовательностей. Кроме того, аминокислотная последовательность тяжелой цепи hB273_H2-1-NE-типа представлена SEQ ID NO:70 в Списке последовательностей. Последовательности SEQ ID NO:69 и 70 показаны также на фиг. 48.

Набор праймеров А

5'-aggtaagcttgctagcgccaccatgaaacacc-3' (H-F1: SEQ ID NO:71 в Списке последовательностей)

5'-ctggttgtagaaggtgtcctcgttgtaggggttgaaccggcc-3' (H-NE-R2: SEQ ID NO:72 в Списке последовательностей)

Набор праймеров В

5'-ggccggttcaacccctacaacgaggacaccttctacaaccag-3' (H-NE-F2: SEQ ID NO:73 в Списке последовательностей)

5'-ggatgccacccgtttaaacgggcccgatatctc-3' (H-R1: SEQ ID NO:74 в Списке последовательностей)

Набор праймеров С

5'-aggtaagcttgctagcgccaccatgaaacacc-3' (H-F1: SEQ ID NO:71 в Списке последовательностей)

5'-ggatgccacccgtttaaacgggcccgatatctc-3' (H-R1: SEQ ID NO:74 в Списке последовательностей)

9)-2 Приготовление CDR-модифицированного hB273-антитела

9)-2-1 Получение CDR-модифицированного hB273-антитела

1,2×109 клеток FreeStyle 293F клеток (Invitrogen Corporation) в логарифмической фазе роста высевали в 1,2 л свежей среды для экспрессии FreeStyle 293 (Invitrogen Corporation) и культивировали в течение 1 часа встряхиванием при 90 об/мин при 37ºС в термостате с 8% СО2. 3,6 мг полиэтиленимина (Polyscience #24765) растворяли в 20 мл среды Opti-Pro SEM (Invitrogen Corporation). Затем вектор экспрессии тяжелой цепи (0,4 мг) и вектор экспрессии легкой цепи (0,8 мг), приготовленные с использованием набора PureLink HiPure Plasmid (Invitrogen Corporation), суспендировали в 20 мл среды Opti-Pro-SEM. Затем, 20 мл полученной смешанной жидкости векторов экспрессии/Opti-Pro SEM добавляли к 20 мл полученной смешанной жидкости полиэтиленимин/Opti-Pro SEM и полученную смесь осторожно перемешивали и затем оставляли на 5 минут. После этого, эту смесь добавляли к клеткам FreeStyle 293F. После 3 часов, Z-VAD-FMK (PEPTIDE (INSTITUTE, Inc.) добавляли к ней при конечной концентрации 10 мкМ и встряхивание культуры при 90 об/мин выполняли в течение 7 дней при 37ºС в термостате с 8% СО2. Полученный культуральный супернатант фильтровали через одноразовый капсульный фильтр (Advantec #CCS-045-E1H).

Гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_H2-1-NE и pEF6KCL/hB273_L1-NE, было названо “hB273_H2-1-NE/hB273_L1-NE”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_H2-1-NE и pEF6KCL/hB273_L1-NF, было названо “hB273_H2-1-NE/hB273_L1-NF”, гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_H2-1-NE и pEF6KCL/hB273_L1-NK, было названо “hB273_H2-1-NE/hB273_L1-NK” и гуманизированное антитело cB273, полученное комбинированием pEF1FCCU/hB273_Н2-1-NE и ppEF6KCL/hB273_L1-NL, было названо “hB273_H2-1-NE/hB273_L1-NL”.

9)-2-2 Очистка CDR-модифицированного hB273-антитела

Культуральный супернатант, полученный в приведенном выше 9)-2-1, очищали двухступенчатым процессом, включающим rProtein A аффинную хроматографию (при 4-6ºС) и очистку с применением колонки керамического гидроксиапатита (при комнатной температуре). Смену буфера после очистки rProtein A аффинной хроматографией и после очистки с применением керамического гидроксиапатита выполняли при комнатной температуре. Сначала 1100-1200 мл культурального супернатанта наносили на MabSelect SuRe (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две HiTrap-колонки (объем: 1 мл), соединенные последовательно), уравновешенную ЗФР. После выливания всего культурального раствора в эту колонку, эту колонку промывали 15-30 мл ЗФР. Затем выполняли элюцию 2 М раствором аргинингидрохлорида (рН 4,0), и собирали фракцию, содержащую это антитело. Эту фракцию наносили на обессоливающую колонку (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две обессоливающие колонки HiTrap (объем: 5 мл) соединенные последовательно), заменяя тем самым этот буфер буфером, содержащим 5 мМ фосфат натрия, 50 мМ MES и 20 мМ NaCl при рН 6,5. Далее, этот раствор антитела, подвергнутый замене буфера, наносили на колонку с керамическим гидроксиапатитом (Japan Bio-Rad Laboratories, Inc., Bio-Scale CHT2-1 hydroxyapatite column (объем: 2 мл)), уравновешенную буфером, содержащим 5 мМ NaPi, 50 мМ MES и 20 мМ NaCl при рН 6,5. Затем, выполняли элюцию с использованием линейного градиента концентрации с хлоридом натрия и фракцию, содержащую это антитело, собирали. Эту фракцию наносили на обессоливающую колонку (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две обессоливающие колонки HiTrap (объем: 5 мл) соединенные последовательно), заменяя тем самым эту жидкость CBS (10 мМ цитратный буфер, содержащий 140 мМ хлорид натрия, рН 6,0). Наконец, полученный раствор концентрировали с использованием Centrifugal UF Filter Device VIVASPIN 20 (фракционная молекулярная масса: 30 К, Sartorius Co., Ltd., при 4ºС), и концентрацию IgG доводили до 1,0 мг/мл или более, и полученный таким образом раствор использовали в качестве очищенной пробы.

Пример 10. Измерение активности CDR-модифицированного hB273-антитела

10)-1 Оценивание активности связывания CDR-модифицированного hB273-антитела с использованием Biacore

Константу диссоциации каждого из гуманизированных анти-DR5-антител и rsDR5 измеряли с использованием Biacore Т100 (GE Healthcare Bio-Sciences Co., Ltd.) способом захвата, в котором антитело захватывается иммобилизованным анти-IgG (Fc) человека-антителом и это измерение выполняется с использованием антигена в качестве аналита. Анти-IgG (Fc) человека-антитело (Набор для захвата антитела человека, GE Healthcare Bio-Sciences Co., Ltd.) ковалентно иммобилизовали на сенсорном чипе СМ5 (BIAcore, Inc.) при приблизительно 10000 RU способом аминосочетания. Иммобилизацию выполняли также на ссылочной клетке таким же образом. В качестве рабочего буфера, использовали HBS-EP (10 мМ HEPES рН 7,4, 0,15 М NaCl, 3 мМ ЭДТА и 0,05% поверхностно-активное вещество Р20). На этот чип, имеющий анти-IgG (Fc) человека-антитело, иммобилизованное на нем, добавляли раствор антитела при 20 нМ при скорости потока 10 мкл/мин в течение 60 секунд и затем добавляли серию разведений rsDR5 (3,13-50 нМ) при скорости потока 30 мкл/мин в течение 120 секунд и затем фазу диссоциации подвергали мониторингу в течение 180 секунд. В качестве регенерирующего раствора, добавляли 3 М хлорид магния при скорости потока 10 мкл/мин в течение 30 секунд. В анализе данных, использовали программу для анализа (программу Biacore Т100 Evaluation, версию 2.0.1) с взаимно однозначной моделью связывания и рассчитывали константу скорости ассоциации (kon), константу скорости диссоциации (koff) и константу диссоциации (KD; KD = koff/kon). Результаты, полученные измерением с использованием Biacore для 4 типов гуманизированных DR5-антител, показаны на фиг. 12.

10)-2 Измерение термостабильности гуманизированного анти-DR5-антитела и его мутанта с использованием дифференцирующей сканирующей калориметрии (DSC)

Измерение термостабильности выполняли с использованием дифференцирующей сканирующей калориметрии (DSC). Пробу растворяли в CBS-буфере (содержащим 10 мМ лимонную кислоту и 140 мМ NaCl и готовили при рН 6,0) при 0,5 мг/мл и 400 мкл ее использовали в качестве пробы для DSC-измерения. Условия DSC-измерения устанавливали следующим образом: начальная температура: 20ºС; конечная температура: 100ºС; скорость увеличения температуры 200ºС/час; период фильтрования: 2 секунды и режим обратной связи: низкий. В качестве ссылочного раствора использовали CBS. В качестве DSC-измеряющего устройства, для всех измерений использовали VP-Capillary DSC-Platform, изготовляемую MicroCal, Inc. (US) (в настоящее время GE Healthcare Bio-Sciences Co., Ltd.). Коррекцию относительно фона проводили вычитанием фона (сканирующей кривой, получаемой также заполнением ячейки для пробы ссылочным раствором) из сканирующей кривой, полученной из раствора пробы. Величину максимальной высокой температуры во всей термограмме определяли в виде средней точки Tm термальной денатурации Fab-района. Результаты измерения DSC 4 типов гуманизированный DR5-антител показаны на Фиг. 13.

10)-3 In vitro разрушающая клетки активность CDR-модифицированного антитела hB273 против клеточной линии рака человека

AffiniPure F(ab')2-фрагмент, специфический в отношении козьего антитела против Fc-фрагмента IgG человека (изготовляемый Jackson ImmunoResearch Laboratories, Inc., #109-006-098), полученный при 50 мкг/мл с 5 мМ Трис-HCl (рН 8,5), распределяли при 45 мкл на лунку в 96-луночном микропланшете (изготовляемом Corning Incorporated) и этот планшет оставляли стоять в течение ночи при 4ºС. После промывания каждой лунки дважды с использованием ЗФР, культуральный супернатант 293F, которому давали продуцировать это антитело в 9)-2-1, добавляли при 50 мкл на лунку, так что конечная концентрация этого антитела была 150-1,5 нг/мл, и планшет оставляли стоять в течение ночи при 4ºС. После промывания каждой лунки дважды ЗФР, клетки Jurkat, полученные при 4,0×104 клеток на мл в среде RPMI 1640, содержащей 10% ФТС, добавляли при 50 мкг на лунку и культивировали при условиях 37ºС и 5% СО2 в течение 23 часов. Количество АТФ, происходящее из жизнеспособных клеток, определяли количественно с использованием набора для анализа жизнеспособности CellTiter-Glo люминесцентных клеток (изготовляемого Promega Corporation, #G7571) и разрушающий клетки эффект каждого из антител hB273 оценивали принятием величины, полученной из лунки, к которой была добавлена среда вместо раствора антител, за 100%. Разрушающая клетки активность каждого из 4 типов CDR-модифицированных антител показана на Фиг. 14.

10)-4 Эффект активации каспазы-3/7 и in vitro разрушающей клетки активности hB273_H2-1-NE/L1-NK-антитела на клеточных линиях рака человека

Каждую из клеточной линии HCT-15 рака ободочной кишки человека и клеточной линии U-87MG глиобластомы человека готовили при 1,1×105 клеток на мл в среде RPMI 1640, содержащей 10% ФТС, или среде МЕМ (Минимальной Поддерживающей Среде), содержащей 10% ФТС, и добавляли в 96-луночный микропланшет с белым прозрачным дном (изготовляемым Corning Incorporation) при 45 мкг на лунку и культивировали в течение ночи при условиях 37ºС и 5% СО2. hB273_H2-1-NE/L1-NK-антитело, cB273-антитело или IgG человека (изготовляемые Jackson ImmunoResearch Laboratories, Inc.) смешивали с такой же концентрацией AffiniPure козьего антитела, специфического против Fcγ-фрагмента IgG человека (изготовляемого Jackson ImmunoResearch Laboratories, Inc. №109-005-098) и полученную смесь добавляли при 5 мкл на лунку, так что конечная концентрация hB273_H2-1-NE/L1-NK-антитела, cB273-антитела или IgG человека была 10000-0,1 нг/мл, и эти клетки культивировали при условиях 37ºС и 5% СО2 в течение 4 часов. Активность каспазы-3/7 в каждой лунке измеряли люминометром (изготовляемым Perkin Elmer, Inc.) с использованием набора для анализа Каспазы-Glo 3/7 (изготовляемого Promega Corporation, #G8093). Это измерение проводили после инкубирования при комнатной температуре в течение 30 минут в соответствии с протоколом, прилагаемым к этому набору. Затем, активность каспазы-3/7 оценивали принятием величины, полученной из лунки, к которой добавляли среду вместо раствора антитела, за 100%. Кроме того, in vitro разрушающую клетки активность оценивали измерением количества АТФ при 24 часах после обработки антителом в соответствии со способом, показанным в Примере 3-3. В результате было обнаружено, что hB273_H2-1-NE/L1-NK-антитело имеет эффект активации каспазы-3/7 и разрушающий клетки эффект в сравнении с этими показателями антитела cB273 (Фиг. 15).

Пример 11. In vivo противоопухолевое действие cB273-антитела

11)-1 Противоопухолевая активность cB273-антитела

11)-1-1 Противоопухолевая активность в мышах “nude”, имплантированных клеточной линией COLO 205 рака ободочной кишки человека

2×106 клеток клеточной линии COLO 205 рака ободочной кишки человека (покупаемой из АТСС), имплантировали подкожно в подмышечной области мышей “nude” (CAnN. Cg-Foxnlnu/CrlCrlj, покупаемых из Charles River Laboratories Japan, Inc.). В дни 7, 14 и 21 после имплантации, cB273-антитело вводили несущим опухоль мышам через хвостовую вену в дозе 1, 3 или 10 мг/кг (n= 10). Большую ось и малую ось имплантированной опухоли измеряли дважды с использованием электронного цифрового штангенциркуля (изготовляемого Mitutoyo Corporation) и объем опухоли рассчитывали согласно следующей формуле расчета.

Объем опухоли (мм3) = ½ × (малая ось)2 (мм) × (большая ось)2 (мм)

Эти результаты показаны на Фиг. 16. Наблюдали полную дегенерацию опухоли во всех мышах в группе введения cB273-антитела.

11)-1-2 Противоопухолевая активность в мышах “nude”, имплантированных клеточной линией MIAPaCa-2 рака поджелудочной железы человека

3×106 клеток клеточной линии MIAPaCa-2 рака поджелудочной железы человека (покупаемой из АТСС), имплантировали подкожно в подмышечной области мышей “nude”. В дни 11, 19, 26 и 33 после имплантации, cB273-антитело вводили несущим опухоль мышам через хвостовую вену в дозе 3 или 10 мг/кг (n=10). Таким же образом, как описано выше, измеряли большую ось и малую ось имплантированной опухоли и рассчитывали объем опухоли.

Результаты показаны на фиг. 17. Скорость ингибирования роста опухоли в день 39 после имплантации, который был последним днем измерения, была 73,5% в группе введения 3 мг/кг и 77,4% в группе введения 10 мг/кг.

11)-1-3 Противоопухолевая активность в мышах “nude”, имплантированных клеточной линией U-87MG глиобластомы человека

5×106 клеток клеточной линии U-87MG (покупаемой из АТСС), имплантировали подкожно в подмышечной области мышей “nude”. В дни 4, 11, 18 и 25 после имплантации, cB273-антитело вводили несущим опухоль мышам через хвостовую вену в дозе 1, 3 или 10 мг/кг (n=10). Таким же образом, как описано выше, измеряли большую ось и малую ось имплантированной опухоли и рассчитывали объем опухоли.

Результаты показаны на фиг. 18. Скорость ингибирования роста опухоли в день 32 после имплантации, который был последним днем измерения, была 99,7% в группе введения 1 мг/кг, 97,8% в группе введения 3 мг/кг и 98,0% в группе введения 10 мг/кг. Кроме того, наблюдали полную дегенерацию опухоли в 2 из 10 мышей в группе введения 1 мг/кг, 5 из 10 мышей в группе введения 3 мг/кг и 3 из 10 мышей в группе введения 10 мг/кг.

11)-1-4 Противоопухолевая активность в мышах “nude”, имплантированных клеточной линией NCI-H2122 рака легкого человека (в комбинации с паклитакселом и карбоплатином)

5×106 клеток клеточной линии NCI-H2122 рака легкого человека (покупаемых из АТСС) имплантировали подкожно в подмышечной области мышей “nude”. В дни 13 и 20 после имплантации cB273-антитело вводили несущим опухоль мышам через хвостовую вену в дозе 10 мг/кг. Паклитаксел вводили подкожно в дозе 6,25 мг/кг в дни 13, 14, 15, 16 и 17 после имплантации. Карбоплатин вводили внутрибрюшинно в дозе 100 мг/кг в день 13 после имплантации (n=10). Таким же образом, как описано выше, измеряли большую ось и малую ось имплантированной опухоли и рассчитывали объем опухоли.

Результаты показаны на фиг. 19. Скорость ингибирования роста опухоли в день 41 после имплантации, который был последним днем измерения, была 99,6% в группе введения cB273-антитела, 10,2% в группе комбинированного введения паклитаксела и карбоплатина, и 99,7% в группе комбинированного введения cB273-антитела, паклитаксела и карбоплатина.

11)-1-5 Противоопухолевая активность в мышах “nude”, имплантированных клеточной линией NCI-H460 рака легкого человека (в комбинации с паклитакселом и карбоплатином)

5×106 клеток клеточной линии NCI-H460 рака легкого человека (покупаемых из АТСС) имплантировали подкожно в подмышечной области мышей “nude”. В день 6 после имплантации cB273-антитело вводили внутрибрюшинно несущим опухоль мышам в дозе 10 мг/кг. Паклитаксел вводили подкожно в дозе 6,25 мг/кг в дни 6, 7, 8, 9 и 10 после имплантации. Карбоплатин вводили внутрибрюшинно в дозе 100 мг/кг в день 6 после имплантации (n=10). Таким же образом, как описано выше, измеряли большую ось и малую ось имплантированной опухоли и рассчитывали объем опухоли.

Результаты показаны на фиг. 20. Скорость ингибирования роста опухоли в день 16 после имплантации, который был последним днем измерения, была 43,3% в группе введения cB273-антитела, 66,4% в группе комбинированного введения паклитаксела и карбоплатина, и 79,6% в группе комбинированного введения cB273-антитела, паклитаксела и карбоплатина.

11)-1-6 Противоопухолевая активность в мышах “nude”, имплантированных клеточной линией DLD-1 рака ободочной кишки человека (в комбинации с CPT-11)

5×106 клеток клеточной линии DLD-1 рака ободочной кишки человека (покупаемых из АТСС) имплантировали подкожно в подмышечной области мышей “nude”. В день 35 после имплантации cB273-антитело вводили внутрибрюшинно несущим опухоль мышам в дозе 10 мг/кг. CPT-11 вводили внутрибрюшинно в дозе 80 мг/кг в дни 35, 40 и 43 после имплантации (n=10). Таким же образом, как описано выше, измеряли большую ось и малую ось имплантированной опухоли, и рассчитывали объем опухоли.

Результаты показаны на фиг. 21. Скорость ингибирования роста опухоли в день 55 после имплантации, который был последним днем измерения, была 25,9% в группе введения cB273-антитела, 29,5% в группе введения СРТ-11 и 72,7% в группе комбинированного введения cB273-антитела и СРТ-11.

11)-1-7 Противоопухолевая активность в мышах “nude”, имплантированных клеточной линией НСТ-15 рака ободочной кишки человека (в комбинации с CPT-11)

5×106 клеток клеточной линии НСТ 15 рака ободочной кишки человека (покупаемых из АТСС) имплантировали подкожно в подмышечной области мышей “nude”. В день 7 после имплантации cB273-антитело вводили несущим опухоль мышам через хвостовую вену в дозе 10 мг/кг. CPT-11 вводили внутрибрюшинно в дозе 80 мг/кг в дни 7, 10 и 14 после имплантации (n=10). Таким же образом, как описано выше, измеряли большую ось и малую ось имплантированной опухоли, и рассчитывали объем опухоли.

Результаты показаны на фиг. 22. Скорость ингибирования роста опухоли в день 31 после имплантации, который был последним днем измерения, была 52,8% в группе введения cB273-антитела, 83,5% в группе введения СРТ-11 и 97,8% в группе комбинированного введения cB273-антитела и СРТ-11.

11)-1-8 Противоопухолевая активность в мышах “nude”, имплантированных клеточной линией НСТ-116 рака ободочной кишки человека (в комбинации с CPT-11)

1×107 клеток клеточной линии НСТ 116 рака ободочной кишки человека (покупаемых из АТСС) имплантировали подкожно в подмышечной области мышей “nude”. В день 7 после имплантации cB273-антитело вводили несущим опухоль мышам через хвостовую вену в дозе 10 мг/кг. CPT-11 вводили внутрибрюшинно в дозе 65 мг/кг в дни 7, 10 и 14 после имплантации (n=10). Таким же образом, как описано выше, измеряли большую ось и малую ось имплантированной опухоли, и рассчитывали объем опухоли.

Результаты показаны на фиг. 23. Скорость ингибирования роста опухоли в день 28 после имплантации, который был последним днем измерения, была 13,9% в группе введения cB273-антитела, 89,8% в группе введения СРТ-11 и 99,7% в группе комбинированного введения cB273-антитела и СРТ-11.

11)-1-9 Противоопухолевая активность в мышах “nude”, имплантированных клеточной линией А375 рака меланомы человека (в комбинации с винбластином)

2×106 клеток клеточной линии А375 меланомы человека (покупаемых из АТСС) имплантировали подкожно в подмышечной области мышей “nude”. В дни 10, 17 и 24 после имплантации cB273-антитело вводили несущим опухоль мышам через хвостовую вену в дозе 10 мг/кг. Винбластин вводили через хвостовую вену в дозе 10 мг/кг в дни 10 после имплантации (n=10). Таким же образом, как описано выше, измеряли большую ось и малую ось имплантированной опухоли, и рассчитывали объем опухоли.

Результаты показаны на фиг. 24. Скорость ингибирования роста опухоли в день 46 после имплантации, который был последним днем измерения, была 53,1% в группе введения cB273-антитела, 43,6% в группе введения винбластина и 100% в группе комбинированного введения cB273-антитела и винбластина, и наблюдали полную дегенерацию опухоли во всех мышах в группе комбинированного введения cB273-антитела и винбластина.

11)-2 Сравнение противоопухолевой активности между cB273-антителом и конатумумабом

11)-2-1 Приготовление конатумумаба

Конатумумаб готовили на основе аминокислотных последовательностей легкой и тяжелой цепи, описанных в WHO Drug Information, Vol. 22, № 2, 2008, pp. 129-130.

11)-2-1-1 Конструирование вектора экспрессии легкой цепи конатумумаба

Синтезировали ДНК, содержащую ген, кодирующий вариабельный домен легкой цепи конатумумаба, представленный номерами аминокислот 21-130 SEQ ID NO:76 (GENEART, Inc. Artificial Gene Synthesis Service). Затем ДНК-фрагмент, полученный расщеплением синтезированной ДНК рестрикционными ферментами NdeI и BsiWI, инсертировали в универсальный вектор экспрессии легкой цепи гуманизированного антитела (pEF6KCL) в сайте, расщепляемом рестрикционными ферментами NdeI и BsiWI, посредством чего конструировали вектор экспрессии легкой цепи конатумумаба. Полученный таким образом вектор экспрессии был назван “pEF6KCL/Конатумумаб_L”.

11)-2-1-2 Конструирование вектора экспрессии тяжелой цепи конатумумаба

Синтезировали ДНК, содержащую ген, кодирующий вариабельный домен тяжелой цепи конатумумаба, представленный номерами аминокислот 20-141 SEQ ID NO:78 в Списке последовательностей (GENEART, Inc. Artificial Gene Synthesis Service). Затем ДНК-фрагмент, полученный расщеплением синтезированной ДНК рестрикционным ферментом BlpI, инсертировали в универсальный вектор экспрессии тяжелой цепи гуманизированного антитела (pEF1FCCU) в сайте, расщепляемом рестрикционным ферментом BlpI, посредством чего конструировали вектор экспрессии тяжелой цепи конатумумаба. Полученный таким образом вектор экспрессии был назван “pEF1FCCU/Конатумумаб_H”.

11)-2-1-3 Получение конатумумаба

1,2×109 клеток FreeStyle 293F (Invitrogen Corporation) в логарифмической фазе роста высевали в 1,2 л свежей среды для экспрессии FreeStyle 293 (Invitrogen Corporation) и культивировали в течение 1 часа встряхиванием при 90 об/мин при 37ºС в термостате с 8% СО2. 3,6 мг полиэтиленимина (Polyscience #24765) растворяли в 20 мл среды Opti-Pro SEM (Invitrogen Corporation). Затем вектор экспрессии тяжелой цепи pEF1FCCU/Конатумумаб_Н (0,4 мг) и вектор экспрессии легкой цепи pEF6KCL/Конатумумаб_L (0,8 мг), полученные с использованием набора PureLink HiPure Plasmid (Invitrogen Corporation), суспендировали в 20 мл среды Opti-Pro-SEM. Затем, 20 мл полученной смешанной жидкости векторов экспрессии /Opti-Pro SEM добавляли к 20 мл полученной смешанной жидкости полиэтиленимин/Opti-Pro SEM и полученную смесь осторожно перемешивали и затем оставляли на 5 минут. После этого, смесь добавляли к клеткам FreeStyle 293F и встряхивание культуры при 90 об/мин выполняли в течение 7 дней при 37ºС в термостате с 8% СО2. Полученный культуральный супернатант фильтровали через одноразовый капсульный фильтр (Advantec #CCS-045-E1H).

11)-2-1-4 Очистка конатумумаба

Культуральный супернатант, полученный в приведенном выше 11)-2-1-3, очищали двухступенчатым процессом, включающим rProtein A аффинную хроматографию (при 4-6ºС) и очистку с применением колонки керамического гидроксиапатита (при комнатной температуре). Смену буфера после очистки rProtein A аффинной хроматографией и после очистки с применением керамического гидроксиапатита выполняли при комнатной температуре. Сначала 1100-1200 мл культурального супернатанта наносили на MabSelect SuRe (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две HiTrap-колонки (объем: 1 мл), соединенные последовательно), уравновешенную ЗФР. После выливания всего культурального раствора в эту колонку, эту колонку промывали 15-30 мл ЗФР. Затем выполняли элюцию 2 М раствором гидрохлорида аргинина (рН 4,0) и собирали фракцию, содержащую это антитело. Эту фракцию наносили на обессоливающую колонку (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две обессоливающие колонки HiTrap (объем: 5 мл) соединенные последовательно), заменяя тем самым этот буфер буфером, содержащим 5 мМ фосфат натрия, 50 мМ MES и 20 мМ NaCl при рН 6,5. Далее, этот раствор антитела, подвергнутый замене буфера, наносили на колонку с керамическим гидроксиапатитом (Japan Bio-Rad Laboratories, Inc., Bio-Scale CHT2-1 hydroxyapatite column (объем: 2 мл)), уравновешенную буфером, содержащим 5 мМ NaPi, 50 мМ MES и 20 мМ NaCl при рН 6,5. Затем, выполняли элюцию с использованием линейного градиента концентрации с хлоридом натрия и фракцию, содержащую это антитело, собирали. Эту фракцию наносили на обессоливающую колонку (изготовляемую GE Healthcare Bio-Sciences Co., Ltd., две обессоливающие колонки HiTrap (объем: 5 мл) соединенные последовательно), заменяя тем самым эту жидкость CBS (10 мМ цитратный буфер, содержащий 140 мМ хлорид натрия, рН 6,0). Наконец, полученный раствор концентрировали с использованием Centrifugal UF Filter Device VIVASPIN 20 (фракционная молекулярная масса: 30 К, Sartorius Co., Ltd., при 4ºС), и концентрацию IgG доводили до 1,0 мг/мл или более, и полученный таким образом раствор использовали в качестве очищенной пробы.

11)-2-2 Сравнение противоопухолевой активности в мышах “nude”, имплантированных клеточной линией НСТ-15 рака ободочной кишки человека между cB273-антителом и конатумумабом

1×107 клеток клеточной линии НСТ-15 рака ободочной кишки человека (покупаемых из АТСС), имплантировали подкожно в подмышечной области мышей “nude”. В дни 6, 13 и 20 после имплантации, cB273-антитело или конатумумаб вводили несущим опухоль мышам через хвостовую вену в дозе 3, 10 или 30 мг/кг (n=10). Таким же образом, как описано выше, измеряли большую ось и малую ось имплантированной опухоли, и рассчитывали объем опухоли.

Результаты показаны на фиг. 25. Скорость ингибирования роста опухоли в день 30 после имплантации, который был последним днем измерения, была 57,9% в группе введения cB273-антитела при 3 мг/кг, 56,0% в группе введения cB273-антитела при 10 мг/кг, 53,6% в группе введения cB273-антитела при 30 мг/кг, 27,4% в группе введения конатумумаба при 3 мг/кг, 26,9% в группе введения конатумумаба при 10 мг/кг и 20,3% в группе введения конатумумаба при 30 мг/кг.

11)-2-3 Сравнение противоопухолевой активности в мышах “nude”, имплантированных клеточной линией NCI-H1975 рака легкого человека между cB273-антителом и конатумумабом

3×106 клеток клеточной линии NCI-H1975 рака легкого человека (покупаемых из АТСС), имплантировали подкожно в подмышечной области мышей “nude”. В дни 12, 19 и 26 после имплантации, cB273-антитело или конатумумаб вводили несущим опухоль мышам через хвостовую вену в дозе 3 или 10 мг/кг (n=10). Таким же образом, как описано выше, измеряли большую ось и малую ось имплантированной опухоли, и рассчитывали объем опухоли.

Эти результаты показаны на фиг. 26. Скорость ингибирования роста опухоли в день 32 после имплантации, который был последним днем измерения, была 71,5% в группе введения cB273-антитела при 3 мг/кг, 73,3% в группе введения cB273-антитела при 10 мг/кг, 13,5% в группе введения конатумумаба при 3 мг/кг и 12,6% в группе введения конатумумаба при 10 мг/кг.

Пример 12. In vivo противоопухолевое действие антитела hB273_H2-1-NE/hB273_L1-NK

12)-1 Противоопухолевая активность антитела hB273_H2-1-NE/hB273_L1-NK в мышах “nude”, имплантированных клеточной линией COLO 205 рака ободочной кишки человека

2×106 клеток клеточной линии COLO 205 человека (покупаемых из АТСС), имплантировали подкожно в подмышечной области мышей “nude”. В дни 8, 15 и 22 после имплантации, антитело hB273_H2-1-NE/hB273_L1-NK или cB273-антитело вводили в несущих опухоль мышей через хвостовую вену в дозе 0,3 или 3 мг/кг (n=10). Таким же образом, как описано выше, измеряли большую ось и малую ось имплантированной опухоли, и рассчитывали объем опухоли.

Результаты показаны на фиг. 27. Наблюдали полную дегенерацию опухоли во всех мышах в группе с введением антитела hB273_H2-1-NE/hB273_L1-NK при 3 мг/кг и в группе с введением cB273-антитела при 0,3 мг/кг. Кроме того, наблюдали полную дегенерацию опухоли в 9 из 10 мышей в группе с введением антитела hB273_H2-1-NE/hB273_L1-NK при 0,3 мг/кг и 8 из 10 мышей в группе с введением cB273-антител при 3 мг/кг.

Пример 13. In vitro разрушающая клетки активность антитела hB273_H2-1-NE/hB273_L1-NK против клеточных линий рака человека

NCI-N87, KATO-III и SNU-16 (каждая из которых является клеточной линией рака желудка человека), Caki-1, ACHN и 786-О (каждая из которых является клеточной линией рака почки человека), Hep3B, SK-Hep-1 и HepG2 (C3A) (каждая из которых является клеточной линией печени человека), и HT-1080 (которая является клеточной линией фибросаркомы человека) приобретали из Американской Коллекции Типовых Культур (АТСС). GCIY (которая является клеточной линией рака желудка человека) приобретали из RIKEN. HuH-7 (которая является клеточной линией рака печени человека) приобретали из National Institute Biomedical Innovation.

In vitro разрушающие клетки активности против различных типов клеточных линий измеряли следующим способом. Что касается клеточной линии рака желудка, клеточной линии рака почки и клеточной линии фибросаркомы, субкультивируемые подходящим образом клетки считали способом окрашивания трипановым синим и после этого готовили при 1×105 клеток на мл в среде, содержащей 10% фетальную телячью сыворотку (изготовляемую HyClone Laboratories, Inc.) (далее называемой “средой”). В этой среде, антитело hB273_H2-1-NE/hB273_L1-NK при 20 мкг/мл и вторичное антитело (антитело козы против IgG человека, изготовляемое МР Biomedicals, LLC.) смешивали при 40 мкг/мл. Затем, полученную смесь разводили средой с получением посредством этого растворов, так что концентрация антитела hB273_H2-1-NE/hB273_L1-NK была 2000, 200, 20 или 2 нг/мл. Каждый из полученных растворов, имеющих соответствующие концентрации, добавляли в прозрачный 96-луночный микропланшет (изготовляемый Corning Incorporation) при 50 мкл на лунку (3 лунки на группу) и суспензию клеток высевали при 50 мкл на лунку (5×103 клеток) (конечная концентрация антитела hB273_H2-1-NE/hB273_L1-NK: 10000, 1000, 100, 10 или 1 нг/мл).

Что касается клеточной линии рака печени, субкультивируемые подходящим образом клетки считали способом окрашивания трипановым синим и после этого готовили при 4×104 клеток на мл в среде. В среде, смешивали антитело hB273_H2-1-NE/hB273_L1-NK при 2 мкг/мл и вторичное антитело при 4 мкг/мл. Затем полученную смесь разводили средой, с получением посредством растворов таким образом, что концентрация антитела hB273_H2-1-NE/hB273_L1-NK была 200, 20, 2, 0,2 или 0,02 нг/мл. Каждый из полученных растворов, имеющих соответствующие концентрации, добавляли в 96-луночный микропланшет с черным прозрачным дном (изготовляемый Corning Incorporated) при 50 мкл на лунку (2 лунки на группу) и суспензию клеток высевали при 50 мкл на лунку (2×103 клеток (конечная концентрация антитела: 1000, 100, 10, 1, 0,1 или 0,01 нг/мл).

Клетки культивировали при 37ºС в присутствии 5% СО2 в течение 72 часов и измеряли количество АТФ в каждой лунке. Измерение количества АТФ выполняли с использованием люциферазного люминесцентного реагена (Cell-Glo, изготовляемого Promega Corporation) в соответствии с прилагаемым протоколом. То есть, тест-раствор, состоящий из компонента клеточного лизата и компонента люминесцентного субстрата, добавляли в этот планшет при 100 мкл на лунку с последующим перемешиванием. После этого, люминесценцию из каждой лунки измеряли с использованием люминометра (изготовляемого Berthold Technologies). Что касается клеточной линии рака желудка, клеточной линии рака почки и клеточной линии фибросаркомы, тест-раствор в количестве 100 мкл на лунку переносили из прозрачного 96-луночного микропланшета в белый 96-луночный микропланшет (изготовляемый Corning Incorporated) и затем измеряли люминесценцию.

Одну лунку, в которую добавляли среду и клеточную суспензию, готовили в качестве лунки отрицательного контроля, лунку, в которую добавляли только среду, готовили в качестве лунки фона и жизнеспособность в каждой тест-лунке рассчитывали в соответствии со следующей формулой.

Жизнеспособность клеток (%) = (Интенсивность люминесценции тест-лунки - Средняя интенсивность люминесценции лунки фона)/(Средняя интенсивность люминесценции лунки отрицательного контроля - Средняя интенсивность люминесценции лунки фона)×100

На фиг. 51 показана средняя величина жизнеспособности клеток каждой клеточной линии для соответствующих концентраций антитела, используемого в этой обработке. Что касается клеточной линии рака желудка, клеточной линии рака почки и клеточной линии фибросаркомы, стандартная ошибка представлена стержнем ошибки. Антитело hB273_H2-1-NE/hB273_L1-NK проявляло цитотоксическую активность против всех испытанных клеточных линий, за исключением 786-О.

Пример 14. Измерение in vivo активности антитела hB273_H2-1-NE/hB273_L1-NK в комбинации с химиотерапевтическим средством

14)-1 Противоопухолевая активность антитела hB273_H2-1-NE/hB273_L1-NK в комбинации с 5-FU в мышах “nude”, имплантированных клеточной линией НСТ-15, и сравнение активности с конатумумабом

1×107 клеток клеточной линии НСТ-15 рака ободочной кишки человека (покупаемой из АТСС), имплантировали подкожно в подмышечной области мышей “nude” (CAnN.Cg-Foxnlnu/CrlCrlj, приобретаемых из Charles River Laboratories Japan, Inc.). В дни 7, 14 и 21 после имплантации, антитело hB273_H2-1-NE/hB273_L1-NK или конатумумаб вводили несущим опухоль мышам через хвостовую вену в дозе 3 мг/кг. 5-FU вводили через хвостовую вену в день 7 после имплантации в дозе 160 мг/кг. Эксперимент проводили при n=6. Большую ось и малую ось имплантированной опухоли измеряли два раза в неделю с использованием электронного цифрового штангенциркуля (изготовляемого Mitutoyo Corporation), и объем опухоли рассчитывали в соответствии со следующей формулой расчета.

Объем опухоли (мм3) = ½ × (малая ось)2 (мм) × (большая ось)2 (мм)

Результаты показаны на фиг. 52. Скорость ингибирования роста опухоли в день 28 после имплантации, который был последним днем измерения, была 62% в группе введения антитела hB273_H2-1-NE/hB273_L1-NK, 27% в группе введения конатумумаба, 54% в группе введения 5-FU, 91% в группе комбинированного введения антитела hB273_H2-1-NE/hB273_L1-NK и 5-FU, и 78% в группе комбинированного введения конатумумаба и 5-FU. То есть, наблюдали комбинированный эффект антитела hB273_H2-1-NE/hB273_L1-NK и 5-FU, и, кроме того, наблюдали более высокую противоопухолевую активность в группе комбинированного введения антитела hB273_H2-1-NE/hB273_L1-NK и 5-FU, чем в группе комбинированного введения конатумумаба и 5-FU.

14)-2 Противоопухолевая активность антитела hB273_H2-1-NE/hB273_L1-NK в комбинации с паклитакселом в мышах “nude”, имплантированных клеточной линией NCI-H1975 немелкоклеточного рака легкого человека, и сравнение активности с конатумумабом

3×106 клеток клеточной линии NCI-H1975 немелкоклеточного рака легкого человека (покупаемой из АТСС), имплантировали подкожно в подмышечной области мышей “nude”. В дни 11, 18 и 25 после имплантации, антитело hB273_H2-1-NE/hB273_L1-NK или конатумумаб вводили несущим опухоль мышам через хвостовую вену в дозе 3 мг/кг. Паклитаксел вводили несущим опухоль мышам через хвостовую вену в дни 11, 12, 13 и 14 после имплантации в дозе 6,25 мг/кг. Этот эксперимент проводили при n=6. Таким же образом, как описано выше, измеряли большую ось и малую ось имплантированной опухоли и рассчитывали объем опухоли.

Результаты показаны на фиг. 53. Скорость ингибирования роста опухоли в день 32 после имплантации, который был последним днем измерения, была 66% в группе введения антитела hB273_H2-1-NE/hB273_L1-NK, 40% в группе введения конатумумаба, 49% в группе введения паклитаксела, 91% в группе комбинированного введения антитела hB273_H2-1-NE/hB273_L1-NK и паклитаксела, и 79% в группе комбинированного введения конатумумаба и паклитаксела. То есть, наблюдали комбинированный эффект антитела hB273_H2-1-NE/hB273_L1-NK и паклитаксела, и, кроме того, наблюдали более высокую противоопухолевую активность в группе введения антитела hB273_H2-1-NE/hB273_L1-NK и паклитаксела, чем в группе комбинированного введения конатумумаба и паклитаксела.

1. Антитело или функциональный фрагмент антитела, способные связываться с DR5, отличающиеся тем, что:
последовательность тяжелой цепи содержит вариабельный домен с CDRH1, CDRH2 и CDRH3, и CDRH1 содержит аминокислотную последовательность SEQ ID NO: 82, CDRH2 содержит любую аминокислотную последовательность из SEQ ID NO: 83 и 89, и CDRH3 содержит аминокислотную последовательность SEQ ID NO: 84; и
последовательность легкой цепи содержит вариабельный домен с CDRL1, CDRL2 и CDRL3, и CDRL1 содержит любую аминокислотную последовательность из SEQ ID NO: 79, 85, 86, 87 и 88, CDRL2 содержит аминокислотную последовательность SEQ ID NO: 80, и CDRL3 содержит аминокислотную последовательность SEQ ID NO: 81.

2. Антитело или функциональный фрагмент антитела по п.1, отличающиеся тем, что содержат
последовательность вариабельного домена тяжелой цепи, содержащую аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO: 20, и
последовательность вариабельного домена легкой цепи, содержащую аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO: 16.

3. Антитело или функциональный фрагмент антитела по п.1, отличающиеся тем, что антитело является химерным антителом.

4. Антитело или функциональный фрагмент антитела по п.3, отличающиеся тем, что содержат
последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO: 20, и
последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO: 16.

5. Антитело или функциональный фрагмент антитела по п.2, отличающиеся тем, что антитело является химерным антителом.

6. Антитело или функциональный фрагмент антитела по п.5, отличающиеся тем, что содержат
последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO: 20, и
последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO: 16.

7. Антитело или функциональный фрагмент антитела по п.1, отличающиеся тем, что антитело является гуманизированным.

8. Антитело или функциональный фрагмент антитела по п.7, отличающиеся тем, что содержат:
(a) последовательность вариабельного домена тяжелой цепи, выбранную из группы, состоящей из следующих аминокислотных последовательностей:
a1) аминокислотной последовательности, содержащей аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO: 42;
а2) аминокислотной последовательности, содержащей аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO: 70;
а3) аминокислотной последовательности, которая гомологична по меньшей мере на 95% в пределах каркасных областей аминокислотной последовательности, выбранной из a1) и а2), и которая гомологична на 100% областям, определяющим комплементарность, аминокислотной последовательности, выбранной из a1) и а2);
а4) аминокислотной последовательности, которая гомологична по меньшей мере на 99% в пределах каркасных областей аминокислотной последовательности, выбранной из a1) и а2), и которая гомологична на 100% областям, определяющим комплементарность, аминокислотной последовательности, выбранной из a1) и а2); и
а5) аминокислотной последовательности, включающей замену, делецию или добавление одного аминокислотного остатка в пределах каркасных областей любой из аминокислотных последовательностей, выбранных из a1) и а2); и
(b) последовательность вариабельного домена легкой цепи, выбранную из группы, состоящей из следующих аминокислотных последовательностей:
b1) аминокислотной последовательности, содержащей аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO: 28;
b2) аминокислотной последовательности, содержащей аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO: 52;
b3) аминокислотной последовательности, содержащей аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO: 58;
b4) аминокислотной последовательности, содержащей аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO: 62;
b5) аминокислотной последовательности, содержащей аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO: 66;
b6) аминокислотной последовательности, которая гомологична по меньшей мере на 95% в пределах каркасных областей аминокислотной последовательности, выбранной из b1 и b2), и которая гомологична на 100% областям, определяющим комплементарность, аминокислотной последовательности, выбранной из b1)-b5);
b7) аминокислотной последовательности, которая гомологична по меньшей мере на 99% в пределах каркасных областей аминокислотной последовательности, выбранной из b1) и b2), и которая гомологична на 100% областям, определяющим комплементарность, аминокислотной последовательности, выбранной из b1)-b5); и
b8) аминокислотной последовательности, включающей замену, делецию или добавление одного аминокислотного остатка в пределах каркасных областей любой из аминокислотных последовательностей, выбранных из b1)-b5).

9. Антитело или функциональный фрагмент антитела по п.8, отличающиеся тем, что содержат
последовательность вариабельного домена тяжелой цепи, содержащую аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO: 42, и
последовательность вариабельного домена легкой цепи, содержащую аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO: 28.

10. Антитело или функциональный фрагмент антитела по п.8, отличающиеся тем, что содержат
последовательность вариабельного домена тяжелой цепи, содержащую аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO: 70, и
последовательность вариабельного домена легкой цепи, содержащую аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO: 52.

11. Антитело или функциональный фрагмент антитела по п.8, отличающиеся тем, что содержат
последовательность вариабельного домена тяжелой цепи, содержащую аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO: 70, и
последовательность вариабельного домена легкой цепи, содержащую аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO: 58.

12. Антитело или функциональный фрагмент антитела по п.8, отличающиеся тем, что содержат
последовательность вариабельного домена тяжелой цепи, содержащую аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO: 70, и
последовательность вариабельного домена легкой цепи, содержащую аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO: 62.

13. Антитело или функциональный фрагмент антитела по п.8, отличающиеся тем, что содержат
последовательность вариабельного домена тяжелой цепи, содержащую аминокислотные остатки 20-141 аминокислотной последовательности SEQ ID NO: 70, и
последовательность вариабельного домена легкой цепи, содержащую аминокислотные остатки 21-134 аминокислотной последовательности SEQ ID NO: 66.

14. Антитело или функциональный фрагмент антитела по п.8, отличающиеся тем, что содержат
последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO: 42, и
последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO: 28.

15. Антитело или функциональный фрагмент антитела по п.8, отличающиеся тем, что содержат
последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO: 70, и
последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO: 52.

16. Антитело или функциональный фрагмент антитела по п.8, отличающиеся тем, что содержат
последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO: 70, и
последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO: 58.

17. Антитело или функциональный фрагмент антитела по п.8, отличающиеся тем, что содержат
последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO: 70, и
последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO: 62.

18. Антитело или функциональный фрагмент антитела по п.8, отличающиеся тем, что содержат
последовательность тяжелой цепи, содержащую аминокислотные остатки 20-471 аминокислотной последовательности SEQ ID NO: 70,
последовательность легкой цепи, содержащую аминокислотные остатки 21-239 аминокислотной последовательности SEQ ID NO: 66.

19. Функциональный фрагмент антитела по любому из пп.1-18, который выбран из группы, состоящей из Fab, F(ab′)2, Fab′ и Fv.

20. Фармацевтическая композиция для лечения и/или профилактики злокачественного новообразования, аутоиммунного заболевания или воспалительного заболевания, отличающаяся тем, что содержит по меньшей мере одно из антител или функциональных фрагментов антител по пп.1-19.

21. Фармацевтическая композиция по п.20, отличающаяся тем, что представляет собой фармацевтическую композицию для лечения и/или профилактики злокачественного новообразования.

22. Фармацевтическая композиция для лечения и/или профилактики злокачественного новообразования, отличающаяся тем, что содержит по меньшей мере одно из антител или функциональных фрагментов антител по пп.1-19 и по меньшей мере один представитель, выбранный из группы, состоящей из паклитаксела, карбоплатина, СРТ-11 и винбластина.

23. Фармацевтическая композиция по пп.21 или 22, где злокачественное новообразование выбрано из группы, состоящей из рака легкого, рака предстательной железы, рака щитовидной железы, рака желудка, рака печени, рака яичника, рака ободочной кишки, рака молочной железы, рака поджелудочной железы, рака матки, меланомы, глиобластомы и рака клеток крови.

24. Способ лечения и/или профилактики злокачественного новообразования, отличающийся тем, что вводят по меньшей мере одно из антител или функциональных фрагментов антител по пп.1-19.

25. Способ лечения и/или профилактики злокачественного новообразования, отличающийся тем, что осуществляют одновременное или последовательное введение по меньшей мере одного из антител или функциональных фрагментов антител по пп.1-19 и по меньшей мере одного представителя, выбранного из группы, состоящей из паклитаксела, карбоплатина, СРТ-11, винбластина и 5-FU.

26. Способ лечения и/или профилактики по п.24 или 25, где злокачественное новообразование выбрано из группы, состоящей из рака легкого, рака предстательной железы, рака щитовидной железы, рака желудка, рака печени, рака яичника, рака ободочной кишки, рака молочной железы, рака поджелудочной железы, рака почки, рака матки, меланомы, фибросаркомы, глиобластомы и рака клеток крови.

27. Полинуклеотид, кодирующий антитело по любому из пп.2, 4, 6 и 8-18.

28. Полинуклеотид по п.27, отличающийся тем, что содержит
нуклеотидную последовательность, содержащую нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO: 19, и
нуклеотидную последовательность, содержащую нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO: 15.

29. Полинуклеотид по п.27, отличающийся тем, что содержит
нуклеотидную последовательность, содержащую нуклеотиды 58-1413 нуклеотидной последовательности SEQ ID NO: 19, и
нуклеотидную последовательность, содержащую нуклеотиды 61-717 нуклеотидной последовательности SEQ ID NO: 15.

30. Полинуклеотид по п.27, отличающийся тем, что содержит:
(а) полинуклеотид, выбранный из группы, состоящей из следующих нуклеотидных последовательностей:
a1) нуклеотидной последовательности, содержащей нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO: 41;
а2) нуклеотидной последовательности, содержащей нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO: 69;
а3) нуклеотидной последовательности полинуклеотида, которая гибридизуется с полинуклеотидом, содержащим нуклеотидную последовательность, комплементарную нуклеотидной последовательности, выбранной из a1) и а2), при жестких условиях; и
а4) нуклеотидной последовательности, включающей замену, делецию или добавление одного нуклеотида в пределах любой нуклеотидной последовательности, кодирующей каркасную область, в нуклеотидной последовательности, выбранной из a1) и а2); и
(b) полинуклеотид, выбранный из группы, состоящей из следующих нуклеотидных последовательностей:
b1) нуклеотидной последовательности, содержащей нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO: 27;
b2) нуклеотидной последовательности, содержащей нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO: 51;
b3) нуклеотидной последовательности, содержащей нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO: 57;
b4) нуклеотидной последовательности, содержащей нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO: 61;
b5) нуклеотидной последовательности, содержащей нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO: 65;
b6) нуклеотидной последовательности полинуклеотида, которая гибридизуется с полинуклеотидом, содержащим нуклеотидную последовательность, комплементарную любой из нуклеотидных последовательностей, выбранных из b1)-b5), при жестких условиях; и
b7) нуклеотидной последовательности, включающей замену, делецию или добавление любого одного нуклеотида в пределах любой нуклеотидной последовательности, кодирующей каркасную область, в любой из нуклеотидных последовательностей, выбранных из b1)-b5).

31. Полинуклеотид по п.30, отличающийся тем, что содержит
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO: 41, и
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO: 27.

32. Полинуклеотид по п.30, отличающийся тем, что содержит
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO:69, и
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO: 51.

33. Полинуклеотид по п.30, отличающийся тем, что содержит
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO: 69, и
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO: 57.

34. Полинуклеотид по п.30, отличающийся тем, что содержит
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO:69, и
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO: 61.

35. Полинуклеотид по п.30, отличающийся тем, что содержит
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-423 нуклеотидной последовательности SEQ ID NO: 69, и
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-402 нуклеотидной последовательности SEQ ID NO: 65.

36. Полинуклеотид по п.30, отличающийся тем, что содержит полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-1413 нуклеотидной последовательности SEQ ID NO: 41, и
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-717 нуклеотидной последовательности SEQ ID NO: 27.

37. Полинуклеотид по п.30, отличающийся тем, что содержит
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-1413 нуклеотидной последовательности SEQ ID NO:69, и
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-717 нуклеотидной последовательности SEQ ID NO: 51.

38. Полинуклеотид по п.30, отличающийся тем, что содержит
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-1413 нуклеотидной последовательности SEQ ID NO: 69, и
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-717 нуклеотидной последовательности SEQ ID NO: 57.

39. Полинуклеотид по п.30, отличающийся тем, что содержит
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-1413 нуклеотидной последовательности SEQ ID NO: 69, и
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-717 нуклеотидной последовательности SEQ ID NO: 61.

40. Полинуклеотид по п.30, отличающийся тем, что содержит
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 58-1413 нуклеотидной последовательности SEQ ID NO: 69, и
полинуклеотид, содержащий нуклеотидную последовательность, содержащую нуклеотиды 61-717 нуклеотидной последовательности SEQ ID NO: 65.

41. Вектор экспрессии, содержащий любой из полинуклеотидов по пп.27-40.

42. Трансформированная клетка-хозяин для продукции антитела и функциональных фрагментов антитела по любому из пп.1-19, содержащая любой из полинуклеотидов по пп.27-40.

43. Трансформированная клетка-хозяин для продукции антитела и функциональных фрагментов антитела по любому из пп.1-19, содержащая вектор экспрессии по п.41.

44. Способ получения антитела по любому из пп.2, 4, 6 и 8-18, предусматривающий стадию культивирования клетки-хозяина по п.42 или 43, и очистки антитела из полученного культивированного продукта.



 

Похожие патенты:

Изобретение относится к биотехнологии. Предложено выделенное антитело, которое специфически связывается по меньшей мере с одним из собачьего интерлейкина-31 (IL-31) или кошачьего IL-31.

Группа изобретений относится к области культивирования клеток. Предложена пластина, выполненная с возможностью переворачивания для образования висячих капель для культивирования клеток, комплект пластин для переноса трехмерных клеточных совокупностей и способ тестирования вещества на токсичность по отношению к клеткам.

Настоящее изобретение относится к области иммунологии. Предложено выделенное биспецифическое антитело, которое связывается с двумя различными областями белка 6 рецептора липопротеинов низкой плотности (LRP6).

Данное изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5 человека, охарактеризованное последовательностями гипервариабельных участков (HVR), и его антигенсвязывающий фрагмент.

Изобретение относится к области биотехнологии, в частности к рекомбинантной продукции факторов свертываемости крови, и может быть использовано для экспрессии фактора свертываемости крови IX человека (hFIX).

Представленная группа изобретений касается слитого белка, ДНК, кодирующей такой белок, рекомбинантного вектора и клетки-хозяина. Охарактеризованный слитый белок содержит фактор VII (FVII) и трансферрин, где указанный трансферрин соединен с С-концом указанного FVII, необязательно через линкер.

Настоящее изобретение относится к области иммунологии и биотехнологии. Предложены антитела к А2 домену тенасцина-С (TNC A2), а также выделенный полинуклеотид, вектор экспрессии, клетка-хозяин и способы получения антитела по изобретению.

Настоящее изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5, охарактеризованное последовательностями HVR.

Изобретение относится к области биотехнологии, конкретно к иммуногенным эпитопам MELK, и может быть использовано в медицине для лечения пациента, страдающего раком или эндометриозом.

Изобретение относится к области биотехнологии и вирусологии. Описан новый штамм вируса ветряной оспы (VZV).

Изобретение относится к области биотехнологии, в частности к рекомбинантной плазмидной ДНК, созданной при помощи новых праймеров CTTCCATATGGAACGAAGGCGTTTGTG и TGTGGATCCAGCTAGTTAGGCATGAAA. Указанная рекомбинантная плазмидная ДНК используется для получения рекомбинантного белка PRAME-F, состоящего из пептида MGSSHHHHHHSSGLVPRGSH слитого с последовательностью природного белка PRAME, путём её экспрессии в бактериальных клетках.

Изобретение относится к биотехнологии и касается способа производства препарата «Мобилан (M-VM3)». Изобретение оптимизирует стадии производства, повышая его рентабельность, делая оптимальным соотношение время производства/количество полученного препарата/количество средств, затраченных на производство.

Изобретение относится к биохимии. Описана молекула нуклеиновой кислоты для генетической терапии мукополисахаридозов.

Изобретение относится к биохимии. Описана конструкция триплетного антигена Treponema pallidum, которая включает три антигена к Treponema pallidum (TP15, TP17 и TP47), а также лидерную последовательность из десяти аминокислот (метка 261) и медь-цинк содержащую супероксиддисмутазу (hSOD) человека.

Группа изобретений относится к области вирусологии и биотехнологии. Бакуловирусный вектор для переноса содержит структуру, в которую встроены сдвоенный промотор и слитая ДНК.

Изобретение относится к биотехнологии. Предложено выделенное антитело, которое специфически связывается по меньшей мере с одним из собачьего интерлейкина-31 (IL-31) или кошачьего IL-31.

Изобретение относится к биотехнологии и представляет собой пептид, который имеет аминокислотную последовательность, состоящую из смежных аминокислот, полученных из белка WT1, и индуцирует WT1-специфические хелперные Т-клетки связыванием с молекулой МНС класса II.

Данное изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5 человека, охарактеризованное последовательностями гипервариабельных участков (HVR), и его антигенсвязывающий фрагмент.

Изобретение относится к биотехнологии. Раскрыт полипептид миметика антитела с функцией распознавания и связывания с цианобактериями, аминокислотная последовательность которого приведена в SEQ ID NO.

Представлена группа изобретений, касающаяся эпитопа, специфичного для вируса гепатита В (ВГВ), полинуклеотида, кодирующего эпитоп, экспрессионного рекомбинантного векора, рекомбинантного микроорганизма, вируса или клетки млекопитающих, способа получения эпитопа и способа получения антитела, специфично связывающегося с эпитопом.

Изобретение относится к биотехнологии. Предложено выделенное антитело, которое специфически связывается по меньшей мере с одним из собачьего интерлейкина-31 (IL-31) или кошачьего IL-31.
Наверх