Способ дифференциации природы происхождения рецидивных кист при цистном эхинококкозе


 

G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2591807:

Государственное бюджетное образовательное учреждение высшего профессионального образования "БАШКИРСКИЙ ГОСУДАРСТВЕННЫЙ МЕДИЦИНСКИЙ УНИВЕРСИТЕТ" Министерства здравоохранения Российской Федерации (RU)

Изобретение относится к области медицины, в частности к хирургии, и предназначено для дифференциации природы происхождения рецидивных кист при цистном эхинококкозе. Осуществляют выделение ДНК из клеток герминативного слоя оболочки первичной и рецидивной эхинококковых кист. Методом полимеразной цепной реакции получают фрагменты маркерного участка гена cox1 Е. granulosus. Проводят анализ полиморфизма длин рестрикционных фрагментов. При обнаружении сходства длин рестрикционных фрагментов первичной и рецидивной эхинококковых кист устанавливают, что рецидивная киста имеет имплантационную природу происхождения. При нахождении различий устанавливают резидуальную или реинвазивную причину возникновения рецидивной кисты. Изобретение обеспечивает получение новых критериев дифференциации природы происхождения послеоперационных рецидивов цистного эхинококкоза. 2 пр.

 

Предлагаемое изобретение относится к медицине, а именно к хирургии и может быть использовано для определения природы происхождения рецидивных эхинококковых кист у лиц, инвазированных ленточным червем Echinococcus granulosus.

Цистный эхинококкоз (ЦЭ) - широко распространенное тяжелое заболевание. В настоящее время достигнуты значительные успехи в диагностике и хирургическом лечении ЦЭ, тем не менее остается проблемой высокий процент пооперационных рецидивов заболевания [Ахмедов С.М., Иброхимов Н.К., Сафаров Б.Дж., Расулов Н.А., Табаров З.В. Резекция печени при эхинококкозе. Анналы хирургической гепатологии. 2014; 19(2): 49-54; Меджидов Р.Т., Султанова Р.С., Меджидов Ш.Р. Профилактика рецидива абдоминального эхинококкоза. Анналы хирургической гепатологии. 2014; 19(3): 63-67; Нартайлаков М.А., Мушарапов Д.Р., Зарипов Ш.А. Новые технологии при хирургическом лечении эхинококкоза печени. Анналы хирургической гепатологии. 2006; 11(3): 52-56].

В организме человека могут развиться имплантационные (при диссеминации зародышевых элементов во время операции), реинвазивные (возникающие при повторном заражении), резидуальные (не распознанные, из-за неравномерного развития кист при сочетанном и множественном эхинококкозе) по природе происхождения рецидивные кисты [Ахмедов И.Г., Османов А.О. Классификация эхинококковых кист, выявленных после хирургического лечения. Хирургия. 2002; 9: 28-32; Дадвани С.А., Мусаев Г.Х., Коваленко Ф.П., Лотов А.Н. Некоторые из причин рецидивов эхинококкоза. Проблемы эхинококкоза: матер. Междунар. науч.-практич. конф. Махачкала, 2000: 47-48]. Определение природы происхождения рецидивных кист является важным и способствует правильному выбору тактики оперативного лечения и адекватной профилактике рецидивов ЦЭ.

Известен способ выявления рецидива эхинококкоза по серологическим реакциям (ИФА, РНГА и др.), дополненный инструментальными методами (УЗИ, КТ, МРТ, рентген).

Разработанные в настоящее время методы диагностики рецидива эхинококкоза имеют следующие недостатки:

- широко используемые инструментальные методы исследования (УЗИ, рентген) не позволяют дифференцировать кисты по причине их возникновения;

- специфичность общепринятых серологических реакций недостаточна для идентификации кисты по природе ее происхождения.

Установлено, что на территории Республики Башкортостан (РБ) встречается вид Е. granulosus с генотипом G1, который имеет генетически полиморфные внутривидовые варианты (штаммы). Нами проведен анализ маркерного фрагмента длиною 397 нуклеотидов митохондриального гена cox1 с координатами 9883-10280 от 5′-концевого участка у распространенных в РБ генетических вариантов Е. granulosus (по данным ″GenBank″, собственных исследований и публикаций [Лукманова Г.И. Идентификация штамма Echinococcus granulosus и генетические факторы риска гидатидозного эхинококкоза на Южном Урале: автореф. дис. … докт. мед. наук. Москва, 2008. 49 с.; Буйдаков В.М. и соавт. Способ идентификации генотипа G1 у изолятов Echinococcus granulosus. Мед.паразитол. - 2010. - №1. - С. 5-8.]).

Выявлено, что генетический полиморфизм обусловлен единичными однонуклеотидными заменами (SNP - single-nucleotide polymorphism) и наличием (или отсутствием) фрагмента из 5 нуклеотидов (GTGGC с координатами 10274-10279). Было установлено, что SNP встречаются по 12 полиморфным позициям. Среди них была выбрана одна - замена цитозина на тимин (С→T) в положении 10154, от 5′-концевого участка гена cox1, которая делит все варианты на 2 группы и ее можно выявить при помощи анализа полиморфизма длин рестрикционных фрагментов (ПДРФ-анализ) продуктов полимеразной цепной реакции (ПЦР) синтеза ДНК. На основании изучения сайтов рестрикции для эндонуклеаз этой полиморфной позиции гена cox1 был модифицирован способ ПЦР-ПДРФ анализа для дифференциации эхинококковых кист по молекулярно-генетическим отличиям.

В доступной научно-медицинской и патентной литературе сведений об известности способа дифференциации природы происхождения послеоперационных рецидивных кист при цистном эхинококкозе у человека не обнаружено.

Задачей изобретения является разработка способа дифференциации природы происхождения послеоперационных рецидивных кист при цистном эхинококкозе у человека с помощью выявления различий в нуклеотидных последовательностях маркерного фрагмента гена cox1 между образцами ДНК первичной и рецидивной кист.

Технический результат изобретения - получение критериев для дифференциации природы происхождения послеоперационных рецидивов цистного эхинококкоза.

Указанный технический результат достигается способом дифференциации природы происхождения рецидивных кист при цистном эхинококкозе, характеризующимся тем, что из клеток герминативного слоя оболочки первичной и рецидивной эхинококковых кист проводят выделение ДНК, получают фрагменты маркерного участка гена cox1 Е. Granulosus методом полимеразной цепной реакции, проводят анализ полиморфизма длин рестрикционных фрагментов и при обнаружении сходства длин рестрикционных фрагментов устанавливают, что рецидивная киста имеет имплантационную природу происхождения, а при нахождении различий устанавливают резидуальную или реинвазивную причину возникновения рецидивной кисты.

Способ доступен по реактивам и оборудованию и осуществляется следующим образом.

У пациента с первичным ЦЭ после операции берут на исследование кисту и из ее клеток выделяют ДНК. Для этого фрагмент герминативной оболочки материнской кисты (2-3 грамма) промывают 3 раза в 3-х объемах стерильного физиологического раствора. Замораживают жидким азотом и растирают в фарфоровой ступке. Растертую ткань суспендируют в 1 мл буфера ТЕ (10 мМ трис-основание, рН=7,4 и 1 мМ ЭДТА, рН=8,0). Выделяют ДНК (с протеиназой К). Для этого к 200 мкл взвеси клеток герминативной оболочки добавляют 300 мкл лизирующего буфера (100 мМ NaCl; 50 мМ трис-HCl, рН=8,0; 50 мМ ЭДТА, рН 8,0; 1% SDS) и протеиназу К (500 мкг на пробу). Пробу инкубируют при температуре 56°С в течение 6-12 часов.

Депротеинизацию и осаждение ДНК осуществляют стандартным фенол-хлороформным методом (Sambrook J., Fritsch Е., Maniatis Т. Commonly used techniques in molecular cloning. Extraction with phenol:chloroform. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. 1987: E3-E4). Затем ДНК осаждают 96° этанолом, инкубируют при температуре -20°С в течение 15-20 минут и центрифугируют 10 минут при 10 000 об/мин. Осадок ДНК промывают 70° этанолом, затем просушивают его на воздухе и растворяют в деионизированной воде.

Для получения маркерных фрагментов гена cox1 применяют метод полимеразной цепной реакции (ПЦР) синтеза ДНК [Способ идентификации возбудителя цистного эхинококкоза в биологическом образце / Лукманова Г.И. и соавт. / Патент РФ №2332465 от 2008 г.]. Для ПЦР используют праймеры следующей структуры: 5′ TGTGTTGATTTTGCCTGG 3′ (прямой) и 5′ GCCACCACAAACCAAGTATC 3′ (обратный).

Устанавливают следующий режим работы термоциклера:

- 1 цикл предварительной денатурации при температуре 94°С в течение 3 мин;

- 35 циклов с параметрами: денатурация при температуре 94°С в течение 30 сек,

- отжиг праймеров при температуре 52°С в течение 30 сек,

- элонгация цепи при температуре 72°С в течение 30 сек;

- финальная инкубация 1 цикл при температуре 72°С в течение 10 мин;

- хранение при температуре 16°С.

Присутствие продуктов амплификации анализируют электрофоретическим разделением смеси в 10% ПААГ, после окрашивания гелей бромистым этидием, с последующей визуализацией в УФ-свете на трансиллюминаторе.

При отсутствии фрагмента GTGGC с координатами 10274-10279 гена cox1 (что характерно для одного из штаммов генотипа G1 Е. granulosus, циркулирующих в РБ), «обратный» праймер не отжигается и поэтому ПЦР-продукта не будет. В случае существования на электрофореграмме ПЦР-продуктов на следующем этапе работы проводят параллельную рестрикцию с использованием эндонуклеаз R. Fok1, R. SfaN1, R. A1w1, R. Mae1. Присутствие на электрофореграмме рестрикционных фрагментов ДНК длиной 55, 118, 95, 128 пар нуклеотидов (пн) укажет на второй из штаммов генотипа G1 Е. granulosus. Обнаружение рестрикционных фрагментов ДНК длиной 55, 118, 223 пн - позволит выявить третий штамм.

На следующем этапе проводят сравнение результатов ПЦР-ПДРФ анализа ДНК клеток первичной и рецидивной кист у обследуемого больного ЦЭ. При обнаружении сходства длин рестрикционных фрагментов устанавливают, что рецидивная киста имеет имплантационную природу происхождения, а при нахождении различий устанавливают резидуальную или реинвазивную причину возникновения рецидивной кисты.

Сущность изобретения иллюстрируется следующими примерами.

Пример 1. Пациент А. обратился в клинику с жалобами на боли в области правого подреберья. При УЗИ органов брюшной полости в правой доле печени (сегмента VIII) выявлено объемное образование размерами 72×61 мм неоднородной структуры смешанной эхогенности с четкими контурами. При осмотре и физикальном исследовании по системам органов других патологических изменений не выявлено. Больной оперирован, выполнена эхинококкэктомия. Взят на анализ фрагмент герминативной оболочки эхинококковой кисты. Проведен описанный выше способ ПЦР-ПДРФ анализа. На электрофореграмме обнаружены фрагменты ДНК длиной 55, 118, 223.

Через 2 года пациент обратился с теми же жалобами. При УЗИ в правой доле печени (сегмента VIII) выявлено объемное образование размерами 30×25 мм. Больной оперирован. Взят на анализ фрагмент герминативной оболочки эхинококковой кисты. Проведен описанный выше способ ПЦР-ПДРФ анализа. На электрофореграмме обнаружены фрагменты ДНК длиной 55,118, 223.

Сравнение результатов ПЦР-ПДРФ анализа ДНК клеток первичной и рецидивной кист показал на их молекулярно-генетическое сходство. На основании полученных данных можно утверждать, что рецидив может иметь имплантационную природу происхождения.

Пример 2. Пациент Р. обратился в клинику с жалобами на ощущение тяжести в правом подреберье. При УЗИ органов брюшной полости в правой доле печени (сегмента VIII) выявлено объемное образование размерами 85×60 мм неоднородной структуры смешанной эхогенности с четкими контурами. Больной оперирован, выполнена эхинококкэктомия. Взят на молекулярно-генетический анализ фрагмент герминативной оболочки эхинококковой кисты. Проведен описанный выше способ ПЦР-ПДРФ анализа. На электрофореграмме обнаружены фрагменты ДНК длиной 55, 118, 95, 128.

Через 3 года пациент обратился с теми же жалобами. При УЗИ в правой доле печени (сегмента VI) выявлено объемное образование размерами 35×25 мм. Больной оперирован. Взят на анализ фрагмент герминативной оболочки эхинококковой кисты. Проведен описанный выше способ ПЦР-ПДРФ анализа. На электрофореграмме фрагменты ДНК не обнаружены.

Сравнение результатов исследований показало, что ДНК клеток первичной и рецидивной кист имеют молекулярно-генетические различия, а значит и разную природу происхождения. На основании этих данных можно утверждать, что причиной рецидива не может быть имплантационная киста, но допустимо предположить резидуальную или реинвазивную природу возникновения кисты.

Способ дифференциации природы происхождения рецидивных кист при цистном эхинококкозе, характеризующийся тем, что из клеток герминативного слоя оболочки первичной и рецидивной эхинококковых кист проводят выделение ДНК, получают фрагменты маркерного участка гена cox1 Е. granulosus методом полимеразной цепной реакции, проводят анализ полиморфизма длин рестрикционных фрагментов и при обнаружении сходства длин рестрикционных фрагментов устанавливают, что рецидивная киста имеет имплантационную природу происхождения, а при нахождении различий устанавливают резидуальную или реинвазивную причину возникновения рецидивной кисты.



 

Похожие патенты:

Изобретение относится к области медицины, а именно к способу прогнозирования риска госпитальной летальности больных острым коронарным синдромом без подъема сегмента ST.

Изобретение относится к медицине и представляет собой способ дифференциальной диагностики стадий гонартроза, включающий исследование крови и определение в ее плазме концентрации мочевой кислоты (МК), в мкМ/л, отличающийся тем, что в мононуклеарной фракции крови также определяют активность миелопероксидазы (МПО), в у.е./мин·мг, и активность ксантиноксидоредуктазы (КОР), в МЕ/г, после чего рассчитывают суммарный коэффициент диагностики К по формуле: при выполнении условия 3.1≤К<3.4 диагностируют I стадию; при выполнении условия 3.4≤К<3.9 диагностируют II стадию; при выполнении условия 3.9≤К<5.2 диагностируют III стадию; при выполнении условия К≥5.2 диагностируют IV стадию гонартроза по шкале Kellgren-Lawrence.
Изобретение относится к медицине, а именно к гнойной хирургии, и может быть использовано для профилактики гипертрофических рубцов при лечении флегмон мягких тканей.

Изобретение относится к области медицины и предназначено для прогнозирования риска развития инфекционных осложнений у больных злокачественными лимфопролиферативными заболеваниями, получающих программную химиотерапию.
Изобретение относится к медицине, а именно к кардиохирургии, и может быть использовано для лабораторной оценки эффективности лечения фондапаринуксом у кардиохирургических больных с гепарин-индуцированной тромбоцитопенией.

Изобретение относится к области медицины, в частности к онкологии и молекулярной биологии, и предназначено для диагностики плоскоклеточного рака легкого (ПКРЛ). Осуществляют получение исходной пары образцов ткани от пациента, где один из образцов получен из предположительно пораженной раком ткани, а второй - из прилегающей гистологически нормальной ткани, выделение и очистку препаратов РНК, синтез кДНК на матрице РНК, амплификацию фрагмента гена CALL и сравнение количества амплифицированного фрагмента ДНК CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани.

Изобретение относится к аналитической химии и касается способа обнаружения наличия микробной биомассы земного типа. Сущность способа заключается в том, что получают тестируемый образец, о котором известно, что он содержит или может содержать микроорганизмы, помещают тестируемый образец в контейнер, отделяют от тестируемого образца компоненты тестируемого образца с микроорганизмами, проводят масс-спектрометрическое исследование компонентов тестируемого образца с микроорганизмами.
Изобретение относится к медицине, а именно к лабораторной диагностике, и может быть использовано для оценки угрозы формирования фетоплацентарной системы и развития плода на фоне обострения цитомегаловирусной инфекции в третьем триместре гестации.

Изобретение относится к медицине, а именно к способу оценки риска развития патологии беременности. Сущность способа состоит в том, что в качестве биомаркеров оценки риска развития патологии беременности используют концентрацию гипоксантина, ксантина, мочевой кислоты, для чего сыворотку крови разводят дистиллированной водой, освобождают от белков, маскирующих определение биомаркеров риска развития патологии беременности.

Изобретение относится к медицине, а именно к диагностике, и может быть использовано для диагностики нарушения трансаминирования глутаминовой кислоты в синцитиотрофобласте плаценты беременных при обострении цитомегаловирусной инфекции на третьем триместре гестации.

Изобретение относится к биотехнологии и касается набора олигонуклеотидов-праймеров для получения первичной структуры F гена вирусов болезни Ньюкасла класса I. Представленный набор состоит из трех пар олигонуклеотидов, имеющих следующую структуру (5′→3′): Представленные олигонуклеотиды не дают перекрестных реакций с родственными видами, позволяют ограничивать манипуляции одноступенчатой процедурой проведения полимеразной цепной реакции (ПЦР).

Изобретение относится к области биохимии. Представлены варианты молекулы нуклеиновой кислоты, связывающейся с SDF-1.

Изобретение относится к области биотехнологии и вирусологии. Описаны способ прогнозирования раннего снижения вирусной нагрузки у человека, инфицированного вирусом гепатита С (ВГС), в ответ на лечение без применения интерферона, способ выбора длительности лечения без интерферона и способ прогнозирования ответа человека, инфицированного ВГС, на лечение без применения интерферона.

Предложенная группа изобретений относится к области медицины. Предложены способ, машиночитаемый носитель и система для определения генетической аномалии плода, которая представляет собой анеуплоидию.

Группа изобретений относится к области биотехнологии, в частности к детекции нуклеиновокислотной последовательности-мишени в анализе с РОСН (расщеплением и гибридизацией РО) на твердой подложке.

Изобретение относится к биотехнологии и молекулярной генетике. Описан способ определения нуклеотидной последовательности (сайта) 5'-R(5mC)GY-3'/3'-YG(5mC)R-5' в заданном положении протяженной ДНК.

Изобретение относится к биохимии. Описан способ ПЦР-секвенирования, включающий следующие стадии: получение образца; амплификация; смешивание; фрагментация; секвенирование и сплайсинг.

Изобретение относится к области медицины, в частности к онкологии и молекулярной биологии, и предназначено для диагностики плоскоклеточного рака легкого (ПКРЛ). Осуществляют получение исходной пары образцов ткани от пациента, где один из образцов получен из предположительно пораженной раком ткани, а второй - из прилегающей гистологически нормальной ткани, выделение и очистку препаратов РНК, синтез кДНК на матрице РНК, амплификацию фрагмента гена CALL и сравнение количества амплифицированного фрагмента ДНК CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани.
Изобретение относится к области биотехнологии и предназначено для неинвазивной диагностики колоректального рака. Осуществляют забор и транспортировку образцов стула пациента, выделение из стула пациента общей ДНК и определение целостности ДНК методом ПЦР-анализа.

Группа изобретений относится к области молекулярной биологии и генодиагностики, а именно к синтетическим праймерам, комплементарным высококонсервативной области гена N генома вируса эпизоотической диареи свиней (ЭДС) и способу выявления ЭДС.

Изобретение относится к области медицины и касается способа прогнозирования риска развития первичной открытоугольной глаукомы (ПОУГ) с неэффективной консервативной терапией у лиц русской национальности, являющихся уроженцами Центрального Черноземья РФ. Сущность способа заключается в том, что производят выделение ДНК из периферической венозной крови. Проводят анализ полиморфизмов генов TNFα(-308G/A TNFα) и осуществляют прогнозирование риска развития ПОУГ с неэффективной консервативной терапией в зависимости от выявленных вариантов по локусу -308G/A TNFα и других предикторов развития данного заболевания по уравнению:P=еy/(1+еy), (1) где «е» - математическая константа, равная 2,72; а «у» рассчитывается по уравнению логистической регрессии: у=15-0,099x1+1,232x2-0,099x3+0,091x4-1,292x5-1,825x6-0,911x7, (2) где x1 - возраст, лет; x2 - наличие сердечно-сосудистых заболеваний: нет - x2=0, да - x2=1; x3 - уровень систолического артериального давления, в мм рт.ст.; x4 - уровень диастолического артериального давления, в мм рт.ст.; x5 - наличие ПОУГ у родственников: нет - x5=0, да - x5=1; x6 - наличие сопутствующей патологии глаз: нет - x6=0, да - x6=1; x7 - генетический вариант по локусу -308G/A TNFα:для варианта AA- x7=1, для варианта AG- x7=2, для варианта GG- x7=3. В случае, если Р больше 60 - прогнозируют риск развития ПОУГ с неэффективной консервативной терапией, если Р меньше 40 - прогнозируют эффективность консервативной терапии ПОУГ, если Р больше 40, но меньше 60 - необходимо более тщательное динамическое наблюдение. 2 ил., 3 пр.
Наверх