Способ раннего прогнозирования невынашивания беременности


 


Владельцы патента RU 2592204:

Федеральное государственное автономное образовательное учреждение высшего образования "Белгородский государственный национальный исследовательский университет" (НИУ "БелГУ") (RU)

Изобретение относится к области медицинской диагностики и может быть использовано для раннего прогнозирования невынашивания беременности. Способ включает выделение РНК из эпителиальных клеток цервикального канала у женщин, проведение обратной транскрипции с получением мДНК, определение экспрессии CASP-3α (отн. ед.) и COX-2 с помощью количественной полимеразной цепной реакции и расчет у1 и у2 по уравнениям линейной дискриминантной функции следующего вида:

у1=-0,8383+155,755*x1+27,2986*x2,

у2=-207,714+3007,030*x1+533,609*x2,

где x1 - уровень экспрессии мРНК CASP-3α (отн. ед.), x2 - уровень экспрессии мРНК COX-2 (отн. ед.). Прогнозируют развитие невынашивания беременности ранних сроков, если y1 больше y2. Прогнозируют прогрессирование беременности в случае, если y2 больше, чем y1. Предложенное изобретение позволяет эффективно прогнозировать невынашивание беременности в 92,10% случаев. Применение данного способа позволит своевременно реализовывать необходимые лечебно-профилактические мероприятия по предупреждению невынашивания беременности. 3 табл.

 

Изобретение относится к области медицинской диагностики, может быть использовано для раннего прогнозирования невынашивания беременности.

Невынашивание беременности ранних сроков представляет собой актуальную проблему современного акушерства, так как является полиэтиологическим состоянием, объединяющим различные нарушения как в репродуктивной системе, так и в организме женщины в целом (Тетруашвили Н.К., Агаджанова А.А. Программа обследования и предгестационой подготовки пациенток с привычным выкидышем (клиническая лекция)//Акуш. и гин. - 2012. - №6. - С. 87-91). Самопроизвольные выкидыши на ранних сроках встречаются в 15% среди всех зарегистрированных случаев беременности. При этом до 80% репродуктивных потерь приходится на I триместр (Carp H.J.A. Recurrent pregnancy loss: causes, controversies and treatment//Informa, 2007. - 290 p.). На самом деле число женщин с невынашиванием может быть несколько выше, так как часть самопроизвольных выкидышей происходит еще до обращения женщины к гинекологу в связи с фактом беременности (Радзинский В.Е., Димитрова В.И., Майскова И.Ю. Неразвивающаяся беременность//М.: Гэотар-медиа, 2009. - 208 с.). Около 1-2% женщин страдают привычным невынашиванием беременности. Привычный выкидыш может быть связан с наличием хромосомных аномалий, тромбофилических состояний у матери, а также с иммунными и эндокринными нарушениями, однако в 50% случаев причина выкидыша оказывается неустановленной (Ortel T.L. Antiphosphlipid syndrome: laboratory testing and diagnostic strategies//Am.J.Hematol. - 2012. - Vol.87, Suppl. 1. - P. 75-81). Поэтому изучение причин невынашивания беременности до сих пор является одной из актуальных проблем в акушерстве и гинекологии.

Среди причин невынашивания беременности одно из лидирующих мест занимают воспалительные заболевания (Kitaya K., Yasuo T. Immunohistochemistrical and Clinicopathological Characterization of Chronic Endometritis//American Journal of Reproductive Immunology. - 2008. - Vol.66, Iss. 5. - P. 410-415). Доказательством роли хронического эндометрита в генезе самопроизвольных выкидышей раннего срока является тот факт, что женщины с хроническим эндометритом имеют достоверно более низкую частоту имплантации эмбриона по сравнению с пациентками с нормальным эндометрием (11% и 58% соответственно) (Ковалева Ю.В. Роль патологии эндометрия в структуре причин невынашивания беременности//Бюллетень ФЦСКЭ им. В.А. Алмазова. - 2010. - №6. - С.35).

Однако диагностика хронического эндометрита в настоящее время представляет собой значительные трудности. В настоящее время для этого используется комплекс клинико-анамнестических данных, а также данных биопсии эндометрия, полученных при аспирационной биопсии или диагностическом выскабливании слизистой полости матки под контролем гистероскопии. При этом диагностическая ценность гистологического исследования для диагностики хронического эндометрита и прогноза невынашивания беременности не установлена (Kasius J.C., Broekmans F.J., Sie-Go D.M., Bourgain C. et al. The reliability of the histological diagnosis of endometritis in asymptomatic IVF cases: a multicenter observer study//Hum Reprod. - 2012. - Vol.27(1). - P. 153). В большинстве случаев при выявлении хронического эндометрита, являющегося причиной невынашивания, специфический возбудитель выявить не удается, что свидетельствует о неспецифическом характере воспаления в связи с изменениями местной иммунореактивности (Cakmak H., Taylor H.S. Implantation failure: molecular and clinical treatment//Hum. Reprod. Update. - 2011. - Vol.17(2). - P. 242-253).

Рассматривая плодово-материнские взаимодействия с точки зрения иммунного ответа, следует подчеркнуть, что взаимодействие матери и плода является иммунологически уникальным, так как должно обеспечивать толерантность к аллогенному плоду и в то же время поддерживать защиту от возможных патогенов. Клинические исследования показали сильную взаимосвязь между внутриматочной бактериальной и вирусной инфекцией и такими осложнениями беременности, как выкидыши, преждевременные роды, задержка внутриутробного развития плода и поздний гестоз (Arechavaleta-Velasco F., Gomez L., Ma Y. et al. Adverse reproductive outcomes in urban women with adeno-associated virus-2 infections in early pregnancy//Hum. Reprod.- 2008. - Vol.- P. 23, 29-36). Таким образом, воспалительный ответ может оказывать огромное влияние на течение беременности.

Выбор определения экспрессии Циклооксигеназы-2 (COX-2) и Каспазы-3α (CASP-3α) в качестве диагностического метода невынашивания беременности связан с высокой специфичностью метода, так как COX-2 является основным ферментом синтеза простагландинов, а CASP-3α является эффекторной протеазой, участвующей в процессе апоптоза (Ахматова Н.К., Киселевский М.В. Врожденный иммунитет: противоопухолевый и противоинфекционный//М.: Практическая медицина, 2008. - 255 с.; Horne A., Stock S., King A. Innate immunity and disorders of female reproductive tract//Reproduction. - 2008. - Vol.135. - P. 739-749).

Так как методов ранней диагностики невынашивания беременности на основании экспрессии CASP-3α и СОХ-2 не выявлено, за аналоги были взяты методы диагностики невынашивания беременности, основанные на определении других иммунологических показателей.

Известен способ прогнозирования невынашивания беременности ранних сроков инфекционного генеза (RU №2444734, опубл. 10.03.2012), основанный на определении уровня растворимой формы рецептора sFlt-1 в сыворотке крови беременной в 1 триместре. При его величине, равной 0,389 нг/мл или ниже, прогнозируют прерывание беременности. Способ позволяет снизить угрозу перинатальных потерь за счет своевременного выявления беременных группы риска и начала адекватных лечебных мероприятий.

Данный способ имеет недостатки. Забор материала для исследования осуществлялся у женщин, имеющих сопутствующую гинекологическую патологию, что, в свою очередь, не дает достоверных данных о том, что именно путем данного способа возможно прогнозирование невынашивания беременности.

Известен способ прогнозирования невынашивания в 1 триместре беременности (RU №2341800, опубл. 20.12.2008), основанный на определении содержания субстанции P(SP) и фактора некроза опухоли (FNO) в сыворотке крови беременной методом ИФА. Затем по формуле рассчитывают прогностический коэффициент К. Если значение прогностического коэффициента К больше, чем 0,48, то у данной беременной прогнозируют угрозу прерывания беременности. Использование способа позволяет повысить точность, чувствительность и специфичность прогнозирования течения первого триместра беременности. Недостатком данного способа является его трудоемкость.

Также существует способ прогнозирования невынашивания во втором триместре беременности (RU №2340899, опубл. 10.12.2008), основанный на определении содержания трансформирующего фактора роста-2 (ТФР-2) в сыворотке крови беременной. Если ТФР-2 меньше 1806,8 пг/мл, то прогнозируют угрозу прерывания беременности. В случае, если ТФР-2 больше 1806,8 пг/мл, то дополнительно определяют уровень субстанции Р (SP) и, если он больше 0,274 нг/мл, то также прогнозируют угрозу прерывания беременности во втором триместре. Использование способа позволяет повысить точность, чувствительность и специфичность прогнозирования течения второго триместра беременности. Недостатками данного способа являются его недостаточная специфичность и высокая трудоемкость.

Известен способ прогнозирования невынашивания беременности на прегравидарном этапе (RU №2184968, опубл. 10.07.2002), в котором проводят исследование иммуногенетического профиля лейкоцитов периферической крови в супружеской паре, при этом на основе показателей HLA-антигенов I, II классов определяют дискриминантную функцию F по формуле

F (x)=0,78·A1+0,74·A9+0,77·A11+1,71·A28-0,94·A29-0,95·B21+5,04·B39-

-1,54·B57-1,87·B65-0,22·Dr5+1,39·Dr7-0,83·MA9+0,56·MA10-1,12·MA28+

+1,73·MA29-0,74·MB5+0,56·MB7+0,71·MB8+1,11·MB12+1,62·MB14-

-0,65·MB27-0,61·MB53-0,83·MDr2-1,60·MDr3-0,51·MDr5-0,67·MDr7-0,46,

где А1, А9, А11, А28, А29 - гены А локуса жены, МА9, МА10, МА28, МА29 - гены А локуса мужа, В21, В39, В57, В65 - гены В локуса жены, МВ5, МВ7, МВ8, МВ12, МВ14, МВ27, МВ53 - гены В локуса мужа, Dr5, Dr7 - гены Dr локуса жены, MDr2, MDr3, MDr5, MDr7 - гены Dr локуса мужа, N - норма, если F (x)>0, P - патология, если F (x)<0. Полученная функция обеспечивает чувствительность решающего правила прогноза 79,4%, специфичность 81%, эффективность 80,7%. Недостатком способа является длительность и трудоемкость его выполнения.

Существуют способы прогнозирования поздних выкидышей. Так, описан способ (RU №2465589, опубл. 27.10.2012), основанный на определении концентрации фактора некроза опухоли альфа (TNF), интерлейкина-1 (IL-1), интерлейкина-6 (IL-6) в сыворотке крови беременной. Дополнительно определяют количество лимфоцитов CD95+(L CD95+), уровень фертильности альфа-2-микроглобулина (FAMB), концентрацию фактора роста плаценты (PGF) и общего IgE. Если полученные значения соответствуют следующим показателям: концентрация TNF (пкг/мл) - 294±39,5; концентрация IL-1 (пкг/мл) - 588±46,3; концентрация IL-6 (пкг/мл) - 85,2±13,1; количество L CD95+ (%) - 14,1±5,2, уровень FAMB (нг/мл) - 215±42, уровень PGF (пкг/мл) - 21±6,2; содержание общего IgE (пкг/мл) - 68±24, то прогнозируется поздний выкидыш. Недостатком этого способа является его низкая чувствительность.

Задачей настоящего изобретения является разработка высокоточного способа прогнозирования невынашивания беременности на основании экспрессии CASP-3α и СОХ-2, пригодного для применения в амбулаторных условиях.

Технический результат - получение критериев оценки риска развития невынашивания беременности, позволяющих определить клинический прогноз и тактику ведения женщины во время беременности, позволяющий снизить экономические затраты и уменьшить количество койко-дней пребывания пациенток в гинекологическом отделении.

В соответствии с поставленной задачей был разработан способ раннего прогнозирования невынашивания беременности, основанный на определении экспрессии CASP-3α и COX-2, включающий:

- выделение рибонуклеиновой кислоты (РНК) из эпителиальных клеток цервикального канала у женщин на ранних сроках беременности;

- обратную транскрипцию с получением кДНК;

- определение экспрессии CASP-3α и COX-2 с помощью количественной полимеразной цепной реакции;

- прогнозирование вероятности невынашивания беременности по уравнениям линейной дискриминантной функции следующего вида:

у1=-0,8383+155,755*x1+27,2986*x2,

у2=-207,714+3007,030*x1+533,609*x2,

где x1 - уровень экспрессии мРНК CASP-3α (отн.ед.), x2 - уровень экспрессии мРНК COX-2 (отн.ед.);

- прогнозирование развития невынашивания беременности ранних сроков, если y1 больше y2;

- прогнозирование прогрессирующей беременности в случае, если y2 больше, чем y1.

Новизна и изобретательский уровень заключается в том, что в настоящее время не известна возможность раннего прогнозирования невынашивания беременности на основании определения экспрессии CASP-3α и COX-2.

Способ осуществляют следующим образом.

Определение экспрессии мРНК CASP-3α и COX-2 проводили методом количественной ПЦР в НИЛ «Молекулярная генетика человека» НИУ «БелГУ».

Материалом для определения экспрессии CASP-3α и COX-2 с целью ранней диагностики невынашивания беременности являются клетки эпителия цервикального канала. Способ разработан с учетом стандарта MIQE (Bustin S., Benes V., Garson G. et al. The MIQE Guidelines: Minimum information for publication of quantitive Real-Time PCR experiments//Clin. Chem. - 2009. - №55, Vol.4. - P. 611-622).

Взятие материала у беременных женщин проводили на сроке беременности 6-10 недель. Группу с невынашиванием составили 100 пациенток с самопроизвольными выкидышами на сроке 6-10 недель, контрольную группу - 60 пациенток, которым был произведен медаборт на тех же сроках.

Шейку матки обнажали в зеркалах, стерильным тампоном удаляли слизь из цервикального канала. Затем с помощью цитощетки производили сбор материала в пробирку Эппендорфа объемом 1,5 мл, содержащую 500 мкл консервирующей среды RNAlater (Ambion).

Если есть необходимость в хранении материала, после помещения материала в раствор RNAlater пробирки оставляют в холодильнике при температуре +4ºС на 1 сутки, затем помещают в морозильную камеру и в дальнейшем хранят при температуре -28ºС. После размораживания образцов сливают надосадочную жидкость и приступают к выделению РНК.

Для выделения РНК из образцов пробирки размораживали при комнатной температуре, затем центрифугировали на 12000 об в течение 5-10 минут, надосадочную жидкость удаляли. Полученный осадок представлял собой взвесь эпителиальных клеток, которые были пригодны для выделения РНК.

После размораживания проб экстракцию РНК проводили методом фенол-хлороформной экстракции, описанным производителем, с использованием реагента Тризол (“Invitrogen”, США).

Качество РНК проверяли методом электрофореза в течение 15 минут при напряжении 10 В/см по интенсивности свечения полос рибосомальной РНК в 1,1% агарозном геле с бромистым этидием. Затем образцы обрабатывали ДНКазой DNAse I RNAse free (“Fermentas”, США) для удаления геномной ДНК согласно инструкции производителя.

Для проведения обратной транскрипции использовали обратную транскриптазу Mint (“Евроген”, Россия). Для инициации реакции использовали олигодезоксинуклеотиды (oligoDT), синтезированные фирмой «Евроген». В реакцию вносили 500 нг РНК, предварительно прогретой до 55 градусов (концентрацию мРНК проверяли на спектрофотометре Nanodrop (“ThermoScientific”, США), и 4 мкл oligoDT (20 мкМ), обратную транскрипцию проводили согласно инструкции производителя.

Качество полученной кДНК оценивали с помощью гель-электрофореза в 1,1% агарозном геле с бромистым этидием. Для дальнейшей ПЦР использовали разведение полученной кДНК со стерильной водой в объеме 2 к 50.

Для количественной ПЦР подбор праймеров генов осуществлялся с помощью базы данных BLAST (www.ncbi.nlm.nih.gov). Одним из условий поиска праймеров было отличие температуры амплификации прямого и обратного праймера не более 2ºС. Все полученные пары праймеров были протестированы на возможность образования «шпилек» и димеров с помощью программы Beacon Designer Free Edition (http://www.premierbiosoft.com/qOligo/Oligo.jsp?PID=1). Кроме того, с целью тестирования на димеры праймеров в программу для ПЦР был добавлен этап анализа кривой плавления (melt curve). Были выбраны следующие праймеры (табл.3). Среди всех генов-нормировщиков по данным литературы (Aflatoonian R., Tuckerman E., Elliott S.L. et al. Menstrual cycle-dependent changes of Toll-like receptors in endometrium//Hum. Reprod. - 2007. - Vol.22. - P. 586-593) и базы данных RT-Primer Database (http://www.rtprimerdb.org/) были выбраны наиболее стабильно экспрессируемые в эпителиоцитах шейки матки и эндометрия гены и проведена их оценка с помощью программы GeNorm-Plus (www.biogazelle.com). В качестве генов-нормировщиков были выбраны бета-актин (beta-actin) и пептидилпропилизомеразаа (PPIA).

Таблица 1
Праймеры для количественной ПЦР
Наименование
гена
Прямой праймер Обратный праймер T отжига, ºС
1 CASP-3α GTGCTATTGTGAGGCGGTTG CACGGATACACAGCCACAGG 55
2 COX-2 ATCTACGGTTTGCTGTGGGG TTCTGTACTGCGGGTGGAAC 57
3 β-актин CAGGCACCAGGGCGTGATGG GATGGAGGGGCCGGACTCGT 64
4 PPIA CCGCCGAGGAAAACCGTGTACT TGGACAAGATGCCAGGACCCGT 64

Для ПЦР в режиме реального времени использовали смесь qPCRmix-HS SYBR с интеркалирующим красителем SYBRI, в который входит высокопроцессивная Taq-полимераза с горячим стартом, смесь нуклеотидтрифосфатов, магний и буферный раствор.

Для приготовления смеси на одну пробирку вносили 2 мклкДНК, по 2 мкл прямого и обратного праймера, 5 мкл смеси qPCRmix-HS SYBR, 14 мкл стерильной воды. Амплификацию проводили на амплификаторе CFX96 («Biorad», США).

Режим амплификации:

1. Предварительная денатурация - 1 цикл 95ºС 5 мин;

2. Денатурация - 1 цикл 95ºС 30 с;

3. Отжиг при соответствующей каждому праймеру температуре (см. таблицу) - 30 с;

4. Элонгация при 68ºС - 30 с.

Количество циклов - 50.

Дополнительным этапом после амплификации была добавлена кривая плавления (melt curve) от 55 до 95 градусов по 6 секунд с целью детекции возможных димеров праймеров.

Полученные результаты выражали в относительных единицах (relative units), вычисляя их по формуле

R=2((Cqref1+Cqref2)/2 - Cqtarget),

где R - нормализованная экспрессия мРНК исследованных генов, Cqref1 и Cqref2 - Cq генов-нормировщиков, Cq target - Cq исследованного гена конкретной женщины.

Статистическую обработку результатов проводили с использованием программы «Statistica 6.0».

Проверка нормальности распределения признаков проводилась с помощью критерия Колмогорова-Смирнова и Шапиро-Уилка.

В случае нормального распределения выборки по данному признаку результат представляли как среднее арифметическое±среднеквадратическое отклонение (M±σ). Для оценки достоверности различий признаков, подчиняющихся закону нормального распределения, использовали t-критерий Стъюдента для двух независимых выборок. В случае отсутствия нормального распределения выборки результат представляли как медиану (нижний квартиль; верхний квартиль). Для корреляционного анализа использовали критерий Спирмена. Различия считали статистически достоверными при уровне значимости p<0,05.

Для создания индивидуального прогноза невынашивания беременности ранних сроков на основании экспрессии CASP-3α и СОХ-2 использовали метод дискриминантного анализа (табл.2).

Таблица 2
Информативные признаки и их коэффициенты дискриминантного сравнительного анализа при самопроизвольных выкидышах и прогрессирующей беременности раннего срока для COX-2 и CASP-3α, N=114, F (2,5)=231,97, p<0,00001
Признак
N=114
F-критерий p-уровень Коэффициенты признака
Невынашивание Прогрессирующая беременность
CASP-3α 267,8731 0,000016 155,7550 3007,030
COX-2 83,3752 0,000264 27,2986 533,609
Constant -0,8383 -207,714

В таблице 2 приведены коэффициенты признаков, которые необходимы для подстановки их в 2 дискриминантных уравнения, которые имеют вид:

- определение значений y1 и y2 по уравнениям линейной дискриминантной функции следующего вида:

у1=-0,8383+155,755*x1+27,2986*x2,

у2=-207,714+3007,030*x1+533,609*x2,

где x1 - уровень экспрессии мРНК CASP-3α (отн.ед.), x2 - уровень экспрессии мРНК COX-2 (отн.ед.);

- прогнозирование развития невынашивания беременности ранних сроков, если y1 больше y2;

- прогнозирование прогрессирующей беременности в случае, если y2 больше, чем y1.

Было обследовано 57 пациенток с самопроизвольными выкидышами на сроках 6-10 недель и 57 пациенток с прогрессирующей беременностью того же срока. Методом количественной ПЦР определяли экспрессию мРНК CASP-3α и COX-2 в эпителии цервикального канала.

В таблице 3 приведена матрица классификации анализа, из которой видно, что 91,22% женщин с самопроизвольными выкидышами ранних сроков были правильно классифицированы, а в группе с прогрессирующей беременностью - 92,98%. Качество распознавания в данной модели составило 92,10%. Достоверность модели была высокой (F=231,97, p<0,00001).

Таблица 3
Матрица классификации дискриминантного анализа
Группа Невынашивание Прогрессирующая
беременность
Всего, % Качество
распознавания, %
CASP-3α 91,22% 8,77% 100 91,22%
COX-2 7,77% 92,98% 100 92,98%
Всего 98,99% 101,75% 200 92,10%

Таким образом, предложенное изобретение работоспособно и позволяет эффективно прогнозировать невынашивание беременности в 92,10% случаев. Применение данного способа позволит своевременно реализовывать необходимые лечебно-профилактические мероприятия по предупреждению невынашивания беременности.

Способ раннего прогнозирования невынашивания беременности, включающий выделение РНК из эпителиальных клеток цервикального канала у женщин, проведение обратной транскрипции с получением кДНК, определение экспрессии CASP-3α и COX-2 с помощью количественной полимеразной цепной реакции и прогноз вероятности невынашивания беременности по уравнениям линейной дискриминантной функции следующего вида:
у1=-0,8383+155,755*x1+27,2986*x2,
у2=-207,714+3007,030*x1+533,609*x2,
где x1 - уровень экспрессии мРНК CASP-3α (отн. ед.), x2 - уровень экспрессии мРНК COX-2 (отн. ед.), при этом прогнозируют развитие невынашивания беременности ранних сроков, если y1 больше y2, и прогнозируют прогрессирование беременности в случае, если y2 больше, чем y1.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к модифицированному тамавидину, и может быть использовано для детекции связанной с биотином субстанции. Получают модифицированный биотин-связывающий белок на основе тамавидина с последовательностью SEQ ID NO: 2, который содержит до 7 мутаций и при этом остаток аспарагина в 115 положении заменен на цистеин.

Изобретение относится к медицине, а именно к трансфузиологии, и может быть использовано для контроля эффективности облучения донорской крови. Способ включает постановку реакции бласттрансформации клеток крови с митогеном фитогемагглютинином и учет результатов реакции путем определения индекса стимуляции лимфоцитов.

Изобретение относится к биохимии. Описано моноклональное антитело, которое специфически связывается с липоарабиноманнаном кислотоустойчивых бацилл, в частности с липоарабиноманнаном туберкулезной бациллы.

Изобретение относится к биотехнологии и представляет собой пептид, который имеет аминокислотную последовательность, состоящую из смежных аминокислот, полученных из белка WT1, и индуцирует WT1-специфические хелперные Т-клетки связыванием с молекулой МНС класса II.

Изобретение относится к области медицины, а именно к лабораторной диагностике, и может быть использовано в диагностике сенсибилизации организма к формальдегиду. Для этого определяют относительное содержание аутоантител к мембранным антигенам паренхимы легких LuM и к β2-гликопротеину.

Изобретение относится к медицине, а именно к акушерству, и может быть использовано для диагностики тяжелой преэклампсии у беременных. Способ включает иммунологическое исследование периферической венозной в 22-37 недель беременности.

Изобретение относится к медицине, а именно к акушерству и отоларингологии, и может быть использовано для прогнозирования внутриутробного инфицирования плода у женщин с гриппом В во втором триместре беременности при анемическом синдроме.

Изобретение относится к медицине, а именно к терапии и хирургии, и может быть использовано для прогнозирования генетической предрасположенности или повышенного риска развития инфекционного эндокардита (ИЭ) у пациентов из группы риска.

Данное изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5 человека, охарактеризованное последовательностями гипервариабельных участков (HVR), и его антигенсвязывающий фрагмент.

Группа изобретений относиться к области медицины, а именно к иммунологии, и может быть использована для диагностики состояния иммунной системы пациента на основе оценки количества наивных Т и В клеток, экспрессирующих TREC и KREC.

Настоящее изобретение относится к медицине, а именно к урологии, и может быть использовано для обнаружения инфекции мочевыводящих путей у пациента. Для этого способ включает получение образца от пациента и обнаружение в указанном образце экспрессии рецептора CD1d на NKT-клетках и BCL6 в тканях мочевого пузыря. При повышении экспрессии CD1d на NKT-клетках и снижении BCL6 в тканях мочевого пузыря диагностируют наличие инфекции мочевыводящих путей. Использование данных биомаркеров позволяет диагностировать наличие инфекции мочевыводящих путей, а также использовать для оценки эффективности лечения. 1 пр., 7 ил.

Изобретение относится к ветеринарной вирусологии, а именно к получению диагностических препаратов. При осуществлении предлагаемого способа получения сыворотки для диагностики алеутской болезни норок (АБН) получают высокоочищенный вирусный антиген путем гомогенизации органов инфицированных АБН норок с последующим трехкратным замораживанием/размораживанием гомогената, дезинтеграции клеточного гомогената трехкратной ультразвуковой обработкой, осаждением неразрушенных клеток двукратным низкоскоростным центрифугированием, последующим осаждением иммунных комплексов, уплотнением осадка низкоскоростным центрифугированием, экстрагированием иммунных комплексов (ИК) минимальными количествами ТНЭ буфера путем трехкратной экстракции на холоду в течение 1-2 часов с последующим низкоскоростным центрифугированием, осаждением ИК высокоскоростным центрифугированием из объединенных экстрактов при 30000 об/мин в течение 2,5 часов, извлечением ИК из осадка минимальными количествами ТНЭ буфера путем трехкратного экстрагирования на холоду в течение 1-2 часов с последующим низкоскоростным центрифугированием, диссоциацией иммунных комплексов в кислой среде в течение 1 часа на холоду, отделением вируса АБН-Ф от антител высокоскоростным ультрацентрифугированием, растворением осадка в минимальном количестве карбонатного буфера, отделением ферритина от вирусных частиц на колонке с сефарозой 6B в системе карбонатного буфера. После чего проводят иммунизацию кроликов микроколичествами очищенного антигена в пять этапов с получением сыворотки с высоким титром антител к вирусу АБН - 1/16384. Технический результат: получение диагностической сыворотки с высоким титром, позволяющей тестировать вирус АБН в различных биологических жидкостях. 3 з.п. ф-лы, 2 пр., 4 ил.

Изобретение относится к области медицины, в частности к неврологии, и может быть использовано для диагностики течения «асимптомного» каротидного атеросклероза. Диагностику течения «асимптомного» каротидного атеросклероза проводят путем иммуноферментного определения в плазме крови биомаркеров. При этом в плазме крови иммуноферментным методом определяют уровни тканевого активатора плазминогена (t-PA), ингибитора активатора плазминогена (PAI-1), адипонектина, асимметричного диметиларгинина (ADMA), а биохимическим методом уровни нитрата, нитрита и оксида азота (NO). Затем каждому биомаркеру присваивают 0 или 1 балл в зависимости от его снижения или повышения относительно нормы. А именно при значении уровней t-PA, адипонектина и оксида азота выше нормы этим биомаркерам присваивают 0 баллов, а при их снижении относительно нормы - 1 балл, при значении уровней PAI-1, ADMA, нитрата и нитрита выше нормы данным биомаркерам присваивают 1 балл, а при их снижении относительно нормы - 0 баллов. После чего рассчитывают сумму баллов и при ее значении менее 4 баллов диагностируют благоприятное течение «асимптомного» каротидного атеросклероза, а при значении 4 и более - неблагоприятное. Способ обеспечивает высокую точность диагностики течения «асимптомного» каротидного атеросклероза за счет специфичности и чувствительности метода совместного определения биомаркеров - t-PA, PAI-1, адипонектина, ADMA, нитрата, нитрита и NO. 3 табл., 2 пр.

Изобретение относится к клинической биохимии и может быть использовано для выделения и определения холестерина множественно модифицированных липопротеинов низкой плотности (ммЛНП) в сыворотке крови человека. Способ заключается в том, что сыворотку крови обрабатывают 20%-ным буферным раствором поливинилпирролидона с молекулярной массой 35000 (ПВП-35000) при объемном соотношении сыворотка:ПВП (1,0:0,84), с последующей инкубацией в течение 10 мин при комнатной температуре, агрегаты ммЛНП осаждают центрифугированием при 9000 об/мин в течение 10 мин при 23°С, декантируют, осадок ммЛНП растворяют в буфере без ПВП-35000 и определяют холестерин в преципитате. При уровне содержания холестерина в ммЛНП более 6,6 мг/дл констатируют повышенный уровень ммЛНП у обследуемого индивидуума. Изобретение может быть использовано для установления наличия субклинического атеросклероза у обследуемого индивидуума, оценки тяжести патологического процесса и разработки прогностических критериев сосудистых осложнений. 2 табл., 2 пр.
Изобретение относится к области медицины и представляет собой способ диагностики ранних стадий наружного генитального эндометриоза путем исследования биологической жидкости. В предлагаемом способе в утренней порции мочи женщин определяют содержание 6-сульфатоксимелатонина и при его концентрации, равной 41 нг/мл и ниже, диагностируют наружный генитальный эндометриоз I-II стадии. Осуществление изобретения позволяет упростить способ диагностики при сохранении высокой точности. 3 пр.

Изобретение относится к медицине, а именно к акушерству и гинекологии, и позволяет прогнозировать угрожающий поздний выкидыш у беременных женщин. Для этого в сроке 5-12 недель гестации определяют относительное количество CD178+ моноцитов гестации в периферической венозной крови. При его значении равном 37,7% или менее в моноцитарном гейте прогнозируют угрожающий поздний выкидыш у женщин с угрозой прерывания беременности ранних сроков и привычным невынашиванием в анамнезе. Использование данного способа позволяет выбрать правильную тактику ведения беременности, провести комплекс лечебно-профилактических мероприятий и снизить риск развития осложнений и неблагоприятных исходов беременности в группе женщин с высоким риском невынашивания беременности. 3 пр., 1 табл.

Изобретение относится к медицине, а именно к гинекологии, и может быть использовано для диагностики вероятности развития локального воспаления в миоматозном узле. Для этого определяют средний уровень иммунореактивности СИР образцов сыворотки крови к антигену Spr-06. При значении СИР к антигену SPR-06 в диапазоне от +11% до +20% или от -21% до -30% прогнозируют течение миомы матки с развитием локального воспаления в миоматозном узле. При значении СИР к антигену SPR-06 выше +20% или ниже -30% диагностируют нарушение питания в миоматозном узле, что является показанием к хирургическому лечению. Использование данного способа позволяет прогнозировать на основании данных анализа крови течение миомы матки с развитием клинической симптоматики. 1 табл.

Изобретение относится к медицине, а именно к гинекологии, и может быть использовано для прогнозирования развития кровотечений у женщин с миомой матки. Способ включает определение уровня аутоантител к TrM-03 в сыворотке крови. При его значении в сравнительном аспекте со средней популяционной нормой в диапазонах от +11% до +20% или от -21% до -30% прогнозируют небольшую вероятность развития маточных кровотечений. Это является показанием к проведению консервативного лечения с дальнейшим контролем показателей указанных аутоантител. При его значении выше +20% и ниже -30% прогнозируют развитие кровотечений, что является показанием к проведению хирургического лечения. Способ позволяет с высокой точностью прогнозировать течение миомы матки и подбирать наиболее подходящий метод лечения для каждой пациентки. 1 табл., 4 пр.

Изобретение относится к медицине, а именно к пульмонологии, аллергологии, кардиологии, функциональной диагностике, и может быть использовано для прогнозирования развития диастолической дисфункции левого и правого желудочков и своевременной коррекции терапии у больных бронхиальной астмой. Сущность способа: оценивают уровень остеопонтина в плазме крови методом твердофазного иммуноферментного анализа, и при значении остеопонтина 36 нг/мл и более прогнозируют развитие диастолической дисфункции обоих желудочков. Предлагаемый способ обеспечивает своевременную коррекцию терапии у больных бронхиальной астмой, дает возможность своевременной коррекции терапии заболевания. 1 табл., 3 пр.
Представленная группа изобретений касается способа получения концентрата культуры клеток бруцелл из штамма Brucella abortus 19 для приготовления бруцеллезных антигенов, способа получения концентрата клеток бруцелл из штамма Brucella abortus 19 для получения сыворотки бруцеллезной диагностической, способа получения единого бруцеллезного антигена РА, РСК и РДСК, способа получения бруцеллезного антигена для роз-бенгал пробы (РБП), способа получения бруцеллезного антигена для кольцевой реакции (КР) с молоком, способа получения сыворотки бруцеллезной диагностической, тест-системы для диагностики бруцеллеза животных в РА, РСК и РДСК, тест-системы для диагностики бруцеллеза животных в РБП и тест-системы для диагностики бруцеллеза животных в КР с молоком. Охарактеризованный способ получения концентрата культуры клеток бруцелл из штамма Brucella abortus 19 для приготовления бруцеллезных антигенов, используемых в диагностических тест-системах, включает получение посевного материала бактериальных клеток и их культивирование в глубинных условиях на жидкой питательной среде с регулированием уровня концентрации растворенного в культуральной среде кислорода на протяжении всего процесса культивирования, нактивацию выросших бактериальных клеток нагреванием с последующим их концентрированием. При этом процесс культивирования бактериальных клеток осуществляют при температуре 36-38°C, в процессе культивирования на этапе накопления бактериальных клеток от концентрации 1,5-2,5 млрд м.к./см3 до концентрации 10 млрд м.к./см3 выдерживают концентрацию растворенного кислорода в культуральной среде в интервале 20-25 мг/л, а свыше 10 млрд м.к./см3 и до достижения бактериальными клетками стационарной фазы роста обеспечивают концентрацию растворенного кислорода в культуральной среде в интервале значений 40-45 мг/л, а концентрирование выросших бактериальных клеток осуществляют посредством осаждения флокулянтом, в качестве которого используют натриевую соль карбоксиметилцеллюлозы (КМЦ), который добавляют в культуральную среду в количестве 0,1-0,15 г по сухому веществу на 1 литр культуральной среды, после чего сливают надосадок с получением концентрата инактивированных бактериальных клеток для последующего приготовления бруцеллезного антигена в РА, РСК, РДСК, антигена РБП; антигена КР с молоком. Изобретения могут быть использованы для диагностики бруцеллеза животных. 9 н. и 29 з.п. ф-лы, 5 пр.
Наверх