Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы



Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы
Фосфодиэстераза 9а в качестве маркера злокачественной опухоли предстательной железы

 


Владельцы патента RU 2592668:

КОНИНКЛЕЙКЕ ФИЛИПС ЭЛЕКТРОНИКС Н.В. (NL)
ДЗЕ ЮНИВЕРСИТИ КОРТ ОФ ДЗЕ ЮНИВЕРСИТИ ОФ ГЛАЗГО (GB)

Группа изобретений относится к области биотехнологии. В частности, изобретение связано с фосфодиэстеразой-9А (PDE9A) для применения ее в качестве маркера злокачественной опухоли предстательной железы, а также для применения PDE9A в качестве маркера для диагностики, детекции, мониторинга или прогнозирования злокачественной опухоли предстательной железы или прогрессии злокачественной опухоли предстательной железы, и иммуноанализом. Способы и иммуноанализ включают следующие стадии: определение уровня PDE9A в образце; определение уровня экспрессии референсного гена в образце; нормализацию измеренного уровня экспрессии PDE9A относительно экспрессии референсного гена и сравнение нормализованного уровня экспрессии с предопределенным граничным значением, выбранным таким образом, чтобы исключить гормон-чувствительную злокачественную опухоль предстательной железы. Причем нормализованный уровень экспрессии, который оказывается ниже граничного значения, является показателем гормон-резистентной злокачественной опухоли предстательной железы. 5 н. и 3 з.п. ф-лы, 15 ил., 3 табл., 3 пр.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение связано с фосфодиэстеразой-9А (PDE9A) для применения ее в качестве маркера злокачественной опухоли предстательной железы (или рака простаты, или рака предстательной железы), а также для применения PDE9A в качестве маркера для диагностики, детекции, мониторинга или прогнозирования злокачественной опухоли предстательной железы или прогрессии злокачественной опухоли предстательной железы. Настоящее изобретение связано также с композицией для диагностики, детекции, мониторинга или прогнозирования злокачественной опухоли предстательной железы или прогрессии злокачественной опухоли предстательной железы, с соответствующим способом и иммуноанализом, со способом диагностики, мониторинга или прогнозирования гормон-резистентной злокачественной опухоли предстательной железы, в отличие от гормон-чувствительной злокачественной опухоли предстательной железы, с соответствующим способом и иммуноанализом, со способом сбора данных, иммуноанализом для диагностики, детекции, мониторинга или прогнозирования злокачественной опухоли предстательной железы или прогрессии злокачественной опухоли предстательной железы, способом идентификации индивида в соответствии с критериями правомочности проведения лечения в связи со злокачественной опухолью предстательной железы, иммуноанализом для стратификации индивида или когорты индивидов в группу лечения злокачественной опухоли предстательной железы. В настоящем изобретении дополнительно предусмотрены фармацевтические композиции и их применение для лечения злокачественной опухоли предстательной железы, в частности, гормон-резистентной предстательной железы.

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

Злокачественная опухоль, или рак, относится к классу заболеваний, при которых проявляются неконтролируемый рост, инвазия и иногда метастазирование группы клеток. Три указанных свойства злокачественности разных типов рака отличают его от доброкачественных опухолей, которые являются самокупирующимися, не инвазирующими и не метастазирующими. Среди мужчин в развитых странах тремя наиболее часто диагностируемыми видами злокачественных опухолей являются рак предстательной железы, легкого и рак ободочной и прямой кишки. В частности, рак простаты является наиболее распространенной злокачественной опухолью у мужчин-европейцев. В 2002 году в Европе у 225000 мужчин был впервые диагностирован рак предстательной железы, и приблизительно 83000 скончалось от указанного заболевания.

Определенные фосфодиэстеразы ассоциированы с развитием злокачественных опухолей. Например, было показано, что фосфодиэстераза PDE7 ассоциирована с хроническим лимфолейкозом (Zhang L et al., PNAS, 2008, 105(49): 19532-7). Однако для многих типов злокачественных опухолей или форм прогрессирующего рака адекватный молекулярный маркер не выявлен.

Злокачественная опухоль предстательной железы, например, традиционно диагностируется по уровню специфического антигена простаты в сыворотке (PSA, prostate-specific antigen). Однако PSA не является специфичным для рака предстательной железы и может быть повышен также и при других обстоятельствах, что приводит к ложно-положительным результатам (злокачественная опухоль не обнаруживается приблизительно у 70% подвергшихся биопсии мужчин с повышенными уровнями PSA). Более того, можно ожидать неподдающееся оценке количество ложно-отрицательных результатов у мужчин, у которых в дальнейшем разовьется рак предстательной железы при наличии "нормальных" результатов теста на PSA.

Следовательно, необходимо создание новой и эффективной альтернативной диагностики для детекции, мониторинга и прогнозирования рака предстательной железы.

КРАТКОЕ СОДЕРЖАНИЕ ИЗОБРЕТЕНИЯ

Настоящее изобретение направлено на удовлетворение указанной потребности, и здесь предложены средства и способы, которые позволяют осуществлять диагностику и детекцию рака предстательной железы.

Указанную выше задачу удается решить с помощью фосфодиэстеразы-9A (PDE9A), используемой в качестве маркера злокачественной опухоли предстательной железы.

Как показали авторы настоящего изобретения, уровень фосфодиэстеразы-9A в линиях клеток злокачественной опухоли предстательной железы и в ткани простаты, полученной из организма пациентов, понижен. Таким образом, PDE9A рассматривается в качестве прогностического биомаркера и определяющего инструмента для стратификации определенных схем лечения, а также прогноза и мониторинга прогрессии рака предстательной железы. В частности, авторами настоящего изобретения было показано, что уровень PDE9A понижается в гормон-резистентных клеточных линиях, полученных из организма человека, также как и в соответствующих образцах ткани человека. Диагностические методы и способы применения PDE9A в качестве маркера рака предстательной железы могут, таким образом, успешно использоваться для (i) детекции и диагностики опасных для жизни форм злокачественной опухоли предстательной железы, (ii) прогнозирования опасных для жизни форм злокачественной опухоли предстательной железы, (iii) мониторинга прогрессии злокачественной опухоли в направлении представляющих угрозу для жизни форм рака простаты и (iv) проведения различий между медленно растущими и представляющими угрозу для жизни формами злокачественной опухоли.

В другом аспекте настоящее изобретение связано с композицией для диагностики, детекции, мониторинга или прогнозирования рака предстательной железы или прогрессии злокачественной опухоли предстательной железы, содержащей аффинный лиганд на основе нуклеиновой кислоты и/или аффинный пептидный лиганд, обладающий сродством к продукту экспрессии PDE9A или к белку PDE9A.

В предпочтительном воплощении настоящего изобретения указанная композиция содержит аффинный лиганд на основе нуклеиновой кислоты или аффинный пептидный лиганд, который модифицирован таким образом, чтобы функционировать в качестве контрастного средства.

В другом предпочтительном воплощении настоящего изобретения указанная композиция содержит набор олигонуклеотидов, специфичных в отношении продукта экспрессии PDE9A, зонд, специфичный в отношении продукта экспрессии PDE9A, аптамер, специфичный в отношении продукта экспрессии PDE9A или белка PDE9A, антитело, специфичное в отношении белка PDE9A, и/или вариант антитела, специфичного в отношении белка PDE9A.

Еще в одном аспекте настоящее изобретение связано с применением PDE9A в качестве маркера для диагностики, детекции, мониторинга или прогнозирования рака предстательной железы или прогрессии злокачественной опухоли предстательной железы.

В другом аспекте настоящее изобретение связано со способом детекции, диагностики, мониторинга или прогнозирования рака предстательной железы или прогрессии злокачественной опухоли предстательной железы, предусматривающим стадию определения уровня PDE9A. В другом аспекте настоящее изобретение связано со способом диагностики, мониторинга или прогнозирования гормон-резистентного рака предстательной железы или прогрессии в направлении развития гормон-резистентного рака предстательной железы, причем указанный способ позволяет отличить гормон-чувствительную злокачественную опухоль предстательной железы от гормон-резистентной злокачественной опухоли предстательной железы, предусматривающим следующие стадии:

(a) определение уровня PDE9A в образце;

(b) определение уровня экспрессии референсного гена в образце;

(c) деление (или нормирование, или нормализацию) измеренного уровня экспрессии PDE9A на уровень экспрессии референсного гена; и

(d) сравнение нормализованного уровня экспрессии с предопределенным граничным значением, выбранным таким образом, чтобы исключить гормон-чувствительную злокачественную опухоль предстательной железы, при этом нормализованный уровень экспрессии, который оказывается ниже граничного значения, является показателем гормон-резистентной злокачественной опухоли предстательной железы, причем указанное граничное значение приблизительно составляет от 2 до 15, предпочтительно около 5.

В другом аспекте настоящее изобретение связано со способом сбора данных, предусматривающим по меньшей следующие стадии:

(a) тестирование у индивида уровня экспрессии PDE9A; и

(b) сравнение уровня экспрессии, определяемого на стадии (a), с контрольным уровнем.

В другом предпочтительном воплощении настоящего изобретения диагностику, детекцию, мониторинг, прогнозирование или сбор данных осуществляют на основе образца, полученного из индивидуального организма.

В другом аспекте настоящее изобретение связано с иммуноанализом для детекции, диагностики, мониторинга или прогнозирования рака простаты или прогрессирования злокачественной опухоли предстательной железы, включающим в себя по меньшей мере следующие стадии:

(a) тестирование образца на предмет определения экспрессии PDE9A,

(b) тестирование контрольного образца на предмет определения экспрессии PDE9A,

(c) определение разницы в уровнях экспрессии PDE9A, определяемых на стадиях (a) и (b); и

(d) вынесение заключения относительно наличия или стадии рака простаты или же прогрессирования злокачественной опухоли предстательной железы на основе результатов, полученных на стадии (c), при этом указанные стадии тестирования основаны на использовании антитела, специфически связывающегося с PDE9A.

В другом аспекте настоящее изобретение связано с иммуноанализом, позволяющим отличить гормон-чувствительный рак предстательной железы от гормон-резистентного рака простаты, предусматривающим осуществление следующих стадий:

(a) определения уровня PDE9A в образце;

(b) определения уровня экспрессии референсного гена в образце;

(c) деления (или нормирования) измеренного уровня экспрессии PDE9A на уровень экспрессии референсного гена; и

(d) сравнение нормализованного уровня экспрессии с предопределенным граничным значением, чтобы исключить гормон-чувствительную злокачественную опухоль предстательной железы, при этом нормализованный уровень экспрессии, который оказывается ниже граничного значения, является показателем гормон-резистентного рака простаты, причем указанное граничное значение приблизительно составляет от 2 до 15, предпочтительно около 5.

В другом аспекте настоящее изобретение связано со способом идентификации индивида как удовлетворяющего критериям [правомочности] назначения лечения от злокачественной опухоли предстательной железы, включающим в себя следующие стадии:

(a) тестирование образца, полученного из организма индивида, на предмет определения экспрессии PDE9A;

(b) тестирование в указанном образце экспрессии референсного гена и/или тестирование в контрольном образце экспрессии PDE9A;

(c) классификацию уровней экспрессии, определяемых на стадии (a), относительно их уровней в контрольных образцах PDE9A, определяемых на стадии (b); и

(d) идентификацию индивида как удовлетворяющего критериям [правомочности] назначения лечения от злокачественной опухоли предстательной железы, при этом полученный из организма индивида образец классифицируется как таковой, имеющий измененный уровень экспрессии PDE9A.

Еще в одном аспекте настоящее изобретение связано с иммуноанализом с целью стратификации индивида или когорты индивидов со злокачественным опухолевым заболеванием предстательной железы, включающим в себя

(a) тестирование образца, полученного из организма индивида, на предмет определения экспрессии PDE9A;

(b) тестирование в указанном образце экспрессии референсного гена и/или тестирование в контрольном образце экспрессии PDE9A;

(с) определение разницы в экспрессии PDE9A на стадии (a) и экспрессии PDE9A и/или референсного гена на стадии (b); и

(d) стратификации индивида или когорты индивидов в группу лечения рака предстательной железы на основании результатов, полученных на стадии (с), при этом полученный из организма индивида образец имеет измененный уровень экспрессии PDE9A.

В другом предпочтительном воплощении настоящего изобретения указанное тестирование или определение экспрессии осуществляется или же дополнительно осуществляется путем измерения уровней нуклеиновой кислоты или белка, или путем определения биологической активности PDE9A или референсного гена.

В другом предпочтительном воплощении настоящего изобретения указанный способ или иммуноанализ включает в себя дополнительную стадию сравнения измеренных уровней нуклеиновой кислоты или белка или же измеряемой биологической активности с контрольным уровнем.

В другом предпочтительном воплощении настоящего изобретения указанный референсный ген является геном домашнего хозяйства, особенно предпочтительно GAPDH или PBGD, или другой фосфодиэстеразой, особенно предпочтительно PDE4D5.

В другом предпочтительном воплощении настоящего изобретения указанный способ или иммуноанализ включает в себя дополнительную стадию определения уровня специфического антигена простаты (PSA).

В другом предпочтительном воплощении настоящего изобретения, в указанном способе или иммуноанализе, как определено выше, индивид, тестированный или классифицированный как индивид, имеющий повышенный уровень экспрессии PDE9A и повышенный уровень PSA, составляющий более чем приблизительно >2,5 нг/мл и приблизительно вплоть до 10 нг/мл, идентифицируется как страдающий злокачественной гормон-чувствительной опухолью предстательной железы; а индивид, классифицированный или тестированный как индивид, имеющий пониженный уровень экспрессии PDE9A и повышенный уровень PSA, составляющий более чем приблизительно >10 нг/мл, идентифицируется как страдающий злокачественной гормон-резистентной опухолью предстательной железы.

В другом предпочтительном воплощении настоящего изобретения указанным выше образцом является образец ткани, образец мочи, образец осадка мочи, образец крови, образец слюны, образец семенной жидкости, образец, содержащий циркулирующие опухолевые клетки, или образец, содержащий секретируемые предстательной железой экзосомы.

Еще в одном аспекте настоящее изобретение связано со стимулирующей фармацевтической композицией, содержащей по меньшей мере один элемент, выбранный из следующей группы:

(a) соединения, непосредственно стимулирующего или модулирующего активность PDE9A, предпочтительно, аллостерического агониста ферментативной активности PDE9A;

(b) соединения, опосредованно стимулирующего или модулирующего активность PDE9A;

(c) белка PDE9A или его биологически активного эквивалента;

(d) нуклеиновой кислоты, кодирующей и экспрессирующей PDE9A;

(e) ингибитора микро-РНК (miRNA), специфичного в отношении различных микро-РНК фосфодиэстеразы-9A;

(f) деметилирующего агента; и

(g) фактора вытеснения фосфодиэстеразы.

Поскольку в линиях клеток, ассоциированных с заболеваниями, фосфодиэстераза-9A подавлена, PDE9A как таковая и агенты, модифицирующие или стимулирующие PDE9A, модифицирующие или стимулирующие экспрессию PDE9A, или же модифицирующие или стимулирующие взаимодействия PDE9A, могут с успехом быть использованы в качестве лекарственных средств. Таким образом, противодействуя наблюдаемому процессу подавления, PDE9A и/или агенты, модифицирующие PDE9A, могут быть использованы в качестве лекарственного средства, например, в качестве лекарственного средства, препятствующего всем или некоторым из эффектов, ассоциированных с низким уровнем экспрессии PDE9A или с ее подавлением.

Еще в одном аспекте настоящее изобретение связано со стимулирующей фармацевтической композицией, предназначенной для лечения или профилактики злокачественной опухоли предстательной железы, содержащей по меньшей мере один элемент, выбранный из следующей группы:

(a) соединения, непосредственно стимулирующего или модулирующего активность PDE9A, предпочтительно, аллостерического агониста ферментативной активности PDE9A;

(b) соединения, опосредованно стимулирующего или модулирующего активность PDE9A;

(c) белка PDE9A или его биологически активного эквивалента;

(d) нуклеиновой кислоты, кодирующей и экспрессирующей PDE9A;

(e) ингибитора микро-РНК, специфичного в отношении различных микро-РНК фосфодиэстеразы-9A;

(f) деметилирующего агента; и

(g) фактора вытеснения фосфодиэстеразы.

Поскольку в линиях клеток, ассоциированных со злокачественной опухолью предстательной железы, фосфодиэстераза-9A подавлена, PDE9A как таковая и агенты, модифицирующие или стимулирующие PDE9A, модифицирующие или стимулирующие экспрессию PDE9A, или же модифицирующие или стимулирующие взаимодействия PDE9A, могут с успехом быть использованы в качестве лекарственных средств для лечения злокачественной опухоли, в частности, для лечения злокачественной опухоли предстательной железы. Таким образом, противодействуя наблюдаемому процессу подавления, PDE9A и/или агенты, модифицирующие PDE9A, могут быть использованы в качестве лекарственного средства, препятствующего низкому уровню экспрессии PDE9A и/или подавлению PDE9A в злокачественных клетках, в частности, в клетках злокачественной опухоли предстательной железы.

Еще в одном аспекте настоящее изобретение связано с ингибирующей фармацевтической композицией, содержащей по меньшей мере один элемент, выбранный из следующей группы:

(a) соединения, непосредственно ингибирующего активность PDE9A, предпочтительно, антагониста ферментативной активности PDE9A;

(b) соединения, опосредованно ингибирующего активность PDE9A;

(c) доминантной негативной формы белка PDE9A или его биологически активного эквивалента;

(d) нуклеиновой кислоты, кодирующей и экспрессирующей доминантную негативную форму PDE9A;

(e) микро-РНК (miRNA), специфичной в отношении PDE9A;

(f) антисмысловой молекулы PDE9A;

(g) ки-РНК (siRNA), специфичной в отношении PDE9A;

(h) аптамера, специфичного в отношении продукта экспрессии PDE9A или белка PDE9A;

(i) малой молекулы или пептидомиметика, способного специфически связываться с белком PDE9A; и

(j) антитела, специфичного в отношении белка PDE9A, и/или варианта антитела, специфичного в отношении белка PDE9A.

В предпочтительном воплощении настоящего изобретения либо указанная ингибирующая, либо указанная стимулирующая фармацевтическая композиция предназначена для лечения злокачественной опухоли предстательной железы в зависимости от уровня экспрессии PDE9A, при этом указанный уровень экспрессии определяется и/или подвергается мониторингу в соответствии со следующими стадиями:

(a) определением уровня PDE9A в образце;

(b) определением уровня экспрессии референсного гена в образце; и

(c) нормализацией, или нормированием, измеренной экспрессии уровня PDE9A относительно экспрессии референсного гена.

Еще в одном, особенно предпочтительном, воплощении настоящего изобретения, в случае повышенных и/или повышающихся уровней PDE9A следует вводить ингибирующую фармацевтическую композицию, а в случае пониженных и/или понижающихся уровней PDE9A следует вводить стимулирующую фармацевтическую композицию.

В другом аспекте настоящее изобретение связано со способом лечения или профилактики злокачественной опухоли, в частности, злокачественной опухоли предстательной железы, предусматривающим введение индивиду

(a) соединения, непосредственно стимулирующего или модулирующего активность PDE9A, предпочтительно, аллостерического агониста ферментативной активности PDE9A;

(b) соединения, опосредованно стимулирующего или модулирующего активность PDE9A;

(c) белка PDE9A или его биологически активного эквивалента;

(d) нуклеиновой кислоты, кодирующей и экспрессирующей PDE9A;

(e) ингибитора микро-РНК, специфичного в отношении различных микро-РНК фосфодиэстеразы-9A;

(f) деметилирующего агента; и/или

(g) фактора вытеснения фосфодиэстеразы.

В предпочтительном воплощении настоящего изобретения указанным выше фактором вытеснения фосфодиэстеразы является пептид, пептидомиметик, малая молекула, антитело или аптамер.

В другом предпочтительном воплощении настоящего изобретения указанная злокачественная опухоль предстательной железы является гормон-резистентной злокачественной опухолью предстательной железы.

Эти и другие характеристики, признаки и задачи настоящего изобретения станут более наглядными после следующего ниже подробного описания, в совокупности с сопроводительными фигурами и примерами, которые лишь в иллюстративных целях демонстрируют принципы данного изобретения.

Настоящее описание приведено лишь для примера и не предназначено для ограничения объема, охватываемого настоящим изобретением.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКОГО МАТЕРИАЛА

Фиг. 1 дает общее представление об образцах, тестируемых в отношении уровня экспрессии. AD означает "андроген-зависимый", AS означает "андроген-чувствительный", и AI означает "андроген-независимый". Образцы, начиная с "LNCaP" и кончая образцом "DuCaP", являются клеточными линиями, а образцы, начиная с "PC-EW" и кончая образцом "PC374", являются ксенотрансплантатами.

На фиг. 2 приведена относительная экспрессия мРНК PDE9A в клеточных линиях и ксенотрансплантатах злокачественной опухоли предстательной железы по сравнению с LNCaP.

На фиг. 3 приведена относительная экспрессия мРНК PDE9A в линиях ксенотрансплантата, нормализованная относительно GAPDH, по сравнению с LNCaP.

На фиг. 4 приведена относительная экспрессия мРНК PDE9A в клеточных линиях злокачественной опухоли предстательной железы, нормализованная относительно GAPDH, по сравнению с LNCaP.

На фиг. 5 показана относительная экспрессия мРНК PDE9A в ксенотрансплантатах и клеточных линиях злокачественной опухоли предстательной железы.

На фиг. 6 показано содержание мРНК PDE9A в ксенотрансплантатах злокачественной опухоли предстательной железы, нормализованная относительно GAPDH.

На фиг. 7 показано содержание PDE9A в клеточных линиях злокачественной опухоли предстательной железы, нормализованная относительно GAPDH.

На фиг. 8 показана относительная экспрессия гена человеческой PDE9A в образцах ткани предстательной железы человека, полученных из организма пациентов. Информация получена в общей сложности из 16 различных образцов, как показано в таблице 1. Группа образцов, обозначенная как "нет", определена как гормон-чувствительные первичные опухоли предстательной железы, а группа образцов, обозначенная как "да", определена как гормон-резистентные опухоли предстательной железы. Показаны индивидуальные значения относительной экспрессии человеческой PDE9A в образцах тканей предстательной железы человека. Результаты нормализованы относительно экспрессии GAPDH и PBGD. Для каждой группы пациентов приведено срединное значение относительно данных, полученных при измерениях.

На фиг. 9 показана относительная экспрессия гена человеческой PDE9A в образцах ткани предстательной железы человека, полученных из организма пациентов. Информация получена в общей сложности из 16 различных образцов, как показано в таблице 1 (включая и удаленные ткани лимфатических узлов). Группа образцов, обозначенная как "нет", определена как гормон-чувствительные первичные опухоли предстательной железы, а группа образцов, обозначенная как "да", определена как гормон-резистентные опухоли предстательной железы. Результаты нормализованы относительно экспрессии GAPDH и PBGD. На данной фигуре изображена ящичковая диаграмма индивидуальных данных измерения относительной экспрессии человеческой PDE9A, где «ящичек»-блок включает в себя 75% всех измерений. Срединное значение относительной экспрессии показано в виде границы между двумя окрашенными «ящичками»-блоками.

На фиг. 10 показана относительная экспрессия гена PDE9A в 96 различных образцах, полученных из панелей Origene HPRT I и II. Показаны индивидуальные значения относительной экспрессии человеческой PDE9A в образцах тканей предстательной железы человека и срединное значение относительно данных, полученных при измерениях, для каждой группы пациентов.

На фиг. 11 показана относительная экспрессия гена PDE9A в 96 различных образцах, полученных из панелей Origene HPRT I и II. На данной фигуре изображена ящичковая диаграмма индивидуальных данных измерения относительной экспрессии человеческой PDE9A, где «ящичек»-блок включает в себя 75% всех измерений. Срединное значение относительной экспрессии показано в виде границы между двумя окрашенными в серый цвет «ящичками»-блоками.

На фиг. 12 приведено представление на кривой ROC экспрессии гена PDE9A на образцах ткани предстательной железы человека, с указанием AUC (площадь под кривой) для попарных сравнений нормы (N) и опухоли.

На фиг. 13 приведен PDE-индекс предстательной железы (PPI, Prostate PDE-Index), то есть относительная экспрессия гена дельта (CT [PDE4D5 человека]-CT [PDE9A человека]). Значения CT человеческой PDE9a вычитывали из значений CT человеческой PDE4D5 индивидуально для каждого образца тестируемой ткани. Информация получена в общей сложности из 96 различных образцов, измеренных на панелях Origene HPRT I и II (см. Примеры). На данной фигуре приведены индивидуальные значения относительной экспрессии человеческого гена дельта (CT [PDE4D5 человека]-CT [PDE9A человека]) на тканях предстательной железы человека. Для каждой группы пациентов указано срединное значение относительно данных, полученных при измерениях.

На фиг. 14 приведен PDE-индекс предстательной железы (PPI), то есть относительная экспрессия гена дельта (CT [PDE4D5 человека]-CT [PDE9A человека]). Значения CT человеческой PDE9a вычитали из значений CT человеческой PDE4D5 индивидуально для каждого образца тестируемой ткани. Информация получена в общей сложности из 96 различных образцов, измеряемых на панелях Origene HPRT I и II (см. Примеры). На данной фигуре изображена ящичковая диаграмма индивидуальных данных измерения относительной экспрессии человеческой PDE9A, где «ящичек»-блок включает в себя 75% всех измерений. Срединное значение относительной экспрессии показано в виде границы между двумя окрашенными в серый цвет «ящичками»-блоками.

На фиг. 15 изображена рабочая референсная кривая (ROC, Receiver Operating Characteristic) экспрессии гена дельта (CT [PDE4D5 человека]-CT [PDE9A человека]) для оценки правомочности диагностического критерия. Приведено представление на кривой ROC экспрессии гена PDE9A на образцах ткани предстательной железы человека, с указанием AUC (площадь под кривой) для попарных сравнений нормы (N) и опухоли.

ПОДРОБНОЕ ОПИСАНИЕ АСПЕКТОВ ИЗОБРЕТЕНИЯ

Авторами настоящего изобретения было обнаружено, что PDE9A сильно подавлена в определенных типах клеток, ассоциированных со злокачественной опухолью предстательной железы, и в человеческих тканях пациентов, и, следовательно, она может быть использована в качестве биомаркера рака предстательной железы. PDE9A, также как и средства, модифицирующие PDE9A или модифицирующие экспрессию PDE9A, могут быть дополнительно использованы в качестве лекарственных средств, в частности, для лечения злокачественной опухоли предстательной железы.

Несмотря на то что настоящее изобретение будет описано со ссылкой на конкретные воплощения, настоящее описание не должно рассматриваться как ограничивающее объем, охватываемый данным изобретением.

Прежде чем перейти к подробному описанию конкретных воплощений настоящего изобретения, следует привести определения, имеющие важное значение для понимания данного изобретения.

Используемые в описании и в прилагаемой формуле изобретения формы единственного числа включают в себя, если в контексте специально не указано иное, также и форму множественного числа.

В контексте настоящего изобретения термины "приблизительно" и "примерно" означают интервал точности, в котором специалист в данной области будет рассматривать технический эффект обсуждаемого признака. Данный термин обычно указывает на отклонение от указанного числового значения на ±20%, предпочтительно, на ±15%, более предпочтительно, на ±10%, и даже еще более предпочтительно, на ±5%.

Следует иметь в виду, что термин «включающий в себя» не является ограничивающим. Для целей настоящего изобретения термин «состоящий из» считается предпочтительным воплощением термина «составляющий», или «в составе». Если в дальнейшем в данном документе какая-либо группа определяется как включающая в себя по меньшей мере определенное число воплощений, это означает, что в нее входит также и группа, которая предпочтительно состоит только из указанных воплощений.

Кроме того, термины "первый", "второй", "третий", или "(a)", "(b)", "(c)", "(d)" и т.д., встречающиеся в данном описании и в прилагаемой формуле изобретения, используются здесь скорее для обособления сходных элементов, а не для указания их последовательности или хронологического порядка. Следует иметь в виду, что используемые таким образом термины при определенных обстоятельствах являются взаимозаменяемыми, и что в описанных здесь воплощениях данного изобретения можно оперировать другими последовательностями, нежели те, которые здесь описаны или проиллюстрированы.

В случае, когда термины "первый", "второй", "третий", или "(a)", "(b)", "(c)", "(d)" и т.д., связаны со стадиями способа или применения, если, как уже было сказано, специально не указано иное, они не образуют определенную временную последовательность или когерентность временных интервалов между стадиями, то есть стадии могут выполняться одновременно, или же такие стадии могут быть разделены интервалами в секунды, минуты, часы, дни, недели, месяцы или даже годы.

Следует иметь в виду, что настоящее изобретение не ограничено какими-либо из описанных здесь методологий, протоколов, белков, бактерий, векторов, реагентов и т.п., поскольку они могут варьировать. Следует также понимать, что используемая здесь терминология приведена только с целью описания конкретных воплощений и не предназначена для ограничения объема, охватываемого настоящим изобретением, который будет определяться только прилагаемой формулой изобретения. Если специально не указано иное, все используемые здесь технические и научные термины имеют такой же смысл, какой обычно подразумевается специалистами в данной области.

Как уже было указано выше, настоящее изобретение в одном из аспектов относится к фосфодиэстеразе-9A (PDE9A) с целью ее применения в качестве маркера рака предстательной железы. Термин "фосфодиэстераза-9A", или "PDE9A", относится ко всем вариантам сплайсинга человеческой фосфодиэстеразы PDE9A, то есть гена человеческой фосфодиэстеразы PDE9A, предпочтительно, к последовательностям, определяемым в базе данных Genbank под номером доступа No: NM_002606 (версия NM_002606.2, GI:48762716 от 9 марта 2009), представляющим собой вариант 1 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001567 (версия NM_001001567.1, GI:48762717 от 9 марта 2009), представляющим собой вариант 2 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001568 (версия NM_ 001001568.1, GI:48762719 от 9 марта 2009), представляющим собой вариант 3 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001569 (версия NM_001001569.1, GI:48762721 от 9 марта 2009), представляющим собой вариант 4 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001570 (версия NM_001001570.1, GI:48762723 от 9 марта 2009), представляющим собой вариант 5 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001571 (версия NM_001001571.1, GI:48762725 от 9 марта 2009), представляющим собой вариант 6 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001572 (версия NM_001001572.1, GI:48762727 от 9 марта 2009), представляющим собой вариант 7 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001573 (версия NM_001001573.1, GI:48762729 от 9 марта 2009), представляющим собой вариант 8 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001574 (версия NM_001001574.1, GI:48762731 от 9 марта 2009), представляющим собой вариант 9 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001575 (версия NM_001001575.1, GI:48762733 от 9 марта 2009), представляющим собой вариант 10 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001576 (версия NM_001001576.1, GI:48762735 от 9 марта 2009), представляющим собой вариант 11 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001577 (версия NM_001001577.1, GI:48762737 от 9 марта 2009), представляющим собой вариант 12 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001578 (версия NM_001001578.1, GI:48762739 от 9 марта 2009), представляющим собой вариант 13 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001579 (версия NM_001001579.1, GI:48762741 от 9 марта 2009), представляющим собой вариант 14 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001580 (версия NM_001001580.1, GI:48762743 от 9 марта 2009), представляющим собой вариант 15 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001581 (версия NM_001001581.1, GI:48762745 от 9 марта 2009), представляющим собой вариант 16 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001582 (версия NM_001001582.1, GI:48762747 от 9 марта 2009), представляющим собой вариант 17 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001583 (версия NM_001001583.1, GI:48762749 от 9 марта 2009), представляющим собой вариант 18 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001584 (версия NM_001001584.2, GI:209954812 от 26 марта 2009), представляющим собой вариант 19 транскрипта PDE9A, в базе данных Genbank под номером доступа No: NM_001001585 (версия NM_001001585.1, GI:48762753 от 9 марта 2009), представляющим собой вариант 20 транскрипта PDE9A.

Более предпочтительно, когда указанный термин связан с нуклеотидными последовательностями, приведенными в SEQ ID NO: 1-20, которые соответствуют последовательностям указанных выше номеров доступа в базе данных Genbank вариантов 1-20 транскриптов PDE9A, и соответствующими им аминокислотными последовательностями, приведенными в SEQ ID NO: 21-40, которые соответствуют последовательностям указанных выше номеров доступа в базе данных Genbank полипептидов PDE9A, кодируемых вариантами транскриптов 1-20. Указанный термин включает в себя также нуклеотидные последовательности, обладающие высокой степенью гомологии с PDE9A, например, последовательности нуклеиновых кислот, которые по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны любой из последовательностей, приведенных в SEQ ID NO: 1-20, или аминокислотные последовательности, которые по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны любой из последовательностей, приведенных в SEQ ID NO: 21-40, или последовательности нуклеиновых кислот, кодирующие аминокислотные последовательности, которые по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны любой из последовательностей, приведенных в SEQ ID NO: 21-40, или аминокислотные последовательности, кодируемые последовательностями нуклеиновых кислот, которые по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны любой из последовательностей, приведенных в SEQ ID NO: 1-20.

Используемый здесь термин "ген PDE9A фосфодиэстеразы человека", "ген PDE9A" или "маркерный ген PDE9A" относится к гену, кодирующему фосфодиэстеразу-9A. Предпочтительно, когда указанный термин относится к гену, экспрессирующему фосфодиэстеразу-9A в виде вариантов сплайсинга 1-20, например, специфической комбинации экзонов, которая обозначена в базе данных Genbank под номером доступа No: NM_002606 (версия NM_002606.2, GI:48762716 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 1, комбинации, которая обозначена в базе данных Genbank под номером доступа NM_001001567 (версия NM_001001567.1, GI:48762717 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 2, комбинации, которая обозначена в базе данных Genbank под номером доступа NM_001001568 (версия NM_001001568.1, GI:48762719 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 3, комбинации, которая обозначена в базе данных Genbank под номером доступа NM_001001569 (версия NM_001001569.1, GI:48762721 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 4, комбинации, которая обозначена в базе данных Genbank под номером доступа NM_001001570 (версия NM_001001570.1, GI:48762723 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 5, комбинации, которая обозначена в базе данных Genbank под номером доступа No: NM_001001571 (версия NM_001001571.1, GI:48762725 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 6, комбинации, которая обозначена в базе данных Genbank под номером доступа NM_001001572 (версия NM_001001572.1, GI:48762727 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 7, комбинации, которая обозначена в базе данных Genbank под номером доступа No: NM_001001573 (версия NM_001001573.1, GI:48762729 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 8, комбинации, которая обозначена в базе данных Genbank под номером доступа NM_001001574 (версия NM_001001574.1, GI:48762731 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 9, комбинации, которая обозначена в базе данных Genbank под номером доступа NM_001001575 (версия NM_001001575.1, GI:48762733 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 10, комбинации, которая обозначена в базе данных Genbank под номером доступа No: NM_001001576 (версия NM_001001576.1, GI:48762735 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 11, комбинации, которая обозначена в базе данных Genbank под номером доступа No: NM_001001577 (версия NM_001001577.1, GI:48762737 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 12, комбинации, которая обозначена в базе данных Genbank под номером доступа No: NM_001001578 (версия NM_001001578.1, GI:48762739 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 13, комбинации, которая обозначена в базе данных Genbank под номером доступа No: NM_001001579 (версия NM_001001579.1, GI:48762741 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 14, комбинации, которая обозначена в базе данных Genbank под номером доступа No: NM_001001580 (версия NM_001001580.1, GI:48762743 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 15, комбинации, которая обозначена в базе данных Genbank под номером доступа No: NM_001001581 (версия NM_1001581.1, GI:48762745 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 16, комбинации, которая обозначена в базе данных Genbank под номером доступа No: NM_001001582 (версия NM_001001582.1, GI:48762747 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 17, комбинации, которая обозначена в базе данных Genbank под номером доступа No: NM_001001583 (версия NM_001001583.1, GI:48762749 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 18, комбинации, которая обозначена в базе данных Genbank под номером доступа No: NM_001001584 (версия NM_001001584.1, GI:48762751 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 19, и комбинации, которая обозначена в базе данных Genbank под номером доступа No: NM_00001585 (версия NM_001001585.1, GI:48762753 от 9 марта 2009), или которая представлена в виде SEQ ID NO: 20.

Указанный термин относится также к молекулам ДНК, полученным на основе мРНК-транскриптов, кодирующих варианты сплайсинга 1-20 фосфодиэстеразы-9A, предпочтительно, молекулам кДНК.

Используемый здесь термин "маркер" или "маркер PDE9A" относится к гену, генетическому элементу или последовательности (нуклеотидной последовательности или аминокислотной последовательности, или белковой последовательности), как было определено выше, уровень экспрессии которой модифицирован, предпочтительно, понижен, в злокачественной клетке или злокачественной ткани, или в образце любого типа, содержащем злокачественные клетки или злокачественные ткани или их порции или фрагменты, по сравнению с контрольным уровнем или состоянием. Указанный термин относится также к любому продукту, экспрессируемому с указанного генетического элемента или последовательности, в частности, к мРНК-транскрипту PDE9A, полипептиду, кодируемому транскриптом PDE9A или его вариантом или фрагментами, также как и к его гомологичным производным, как описано здесь выше. Используемый здесь термин "уровень экспрессии" относится к количеству транскрипта PDE9A и/или производному белка PDE9A из определенного количества клеток или определенной порции ткани, предпочтительно, к количеству транскрипта PDE9A и/или белка PDE9A, получаемого путем стандартной процедуры экстракции нуклеиновой кислоты (например, РНК) или белка. Подходящие способы экстракции известны специалистам в данной области.

Используемый здесь термин "контрольный уровень" (или "контрольное состояние") относится к уровню экспрессии, который может быть определен в одно и то же время и/или при тех же самых или сравнимых условиях, что и тестируемый образец, с использованием образца(образцов), предварительно полученного и хранимого вне организма субъекта/субъектов, стадия(стадии) заболевания которых, например, незлокачественная, известна/известны. Используемый здесь термин "стадия заболевания" или "стадия злокачественного заболевания" относится к любому состоянию или типу клеточного или молекулярного состояния между незлокачественным состоянием клеток и (включительно) терминальным злокачественным состоянием клеток. Предпочтительно, чтобы указанный термин включал в себя различные стадии или уровни пролиферации/развития опухоли в организме между (и исключая) незлокачественным состоянием клеток и (включая) терминальным злокачественным состоянием клеток. Такие стадии развития могут включать в себя все стадии согласно классификационной системе злокачественных опухолей TNM (Tumor, Node, Metastasis, или опухоль, узел, метастаз), согласно классификации Международного Союза по борьбе с раком, UICC, например, стадии 0 и от I до IV. Указанный термин включает в себя также стадии до TNM-стадии 0, например, стадии развития, при которых биомаркеры злокачественной опухоли, известные специалистам в данной области, проявляют модифицированную экспрессию или характер экспрессии.

Уровень экспрессии, как указано выше, предпочтительно может быть, как определено здесь, уровнем экспрессии PDE9A. Альтернативно или дополнительно, уровень экспрессии может быть также уровнем экспрессии любого другого подходящего гена или генетического элемента, экспрессируемого в клетке, предпочтительно, в контексте PDE9A, например, уровнем экспрессии другой фосфодиэстеразы, уровнем экспрессии гена домашнего хозяйства, например, GAPDH или PBGD.

Термин "злокачественный" в контексте настоящего изобретения относится к злокачественной стадии заболевания, как определено выше. Предпочтительный контрольный уровень, в контексте злокачественных контролей, представляет собой экспрессию PDE9A в злокачественных гормон-чувствительных опухолях предстательной железы.

Термин "незлокачественный" в контексте настоящего изобретения относится к состоянию, при котором не удается обнаружить ни доброкачественной, ни злокачественной пролиферации. Подходящие средства для детекции указанных явлений известны в данной области. Предпочтительный контрольный уровень, в контексте незлокачественных контролей, представляет собой экспрессию PDE9A в нормальной, то есть здоровой или незлокачественной ткани, или же экспрессию PDE9A в доброкачественной опухоли предстательной железы. Используемый здесь термин "доброкачественная опухоль предстательной железы" относится к опухоли предстательной железы, которая лишена всех трех свойств злокачественности рака, то есть она не способна к неограниченному росту, агрессивному поведению, не инвазирует в окружающие ее ткани и не метастазирует. Обычно под доброкачественной опухолью предстательной железы подразумевается умеренная и непрогрессирующая неоплазия предстательной железы или опухолевое заболевание, лишенное инвазивных свойств злокачественной опухоли. Кроме того, обычно доброкачественные опухоли предстательной железы инкапсулированы, и таким образом ингибируется их способность вести себя наподобие злокачественной. Доброкачественная опухоль или здоровое состояние могут быть определены любым подходящим, независимым молекулярным, гистологическим или физиологическим методом, известным специалистам в данной области.

Альтернативно, контрольный уровень может быть определен статистическим методом на основе результатов, полученных путем анализа ранее определяемого уровня (уровней) экспрессии маркерного гена PDE9A согласно изобретению в образце, полученном из организма субъекта, состояние здоровья которого известно. Кроме того, контрольный уровень может быть получен из базы данных о характере экспрессии ранее тестированных субъектов или клеток. Более того, уровень экспрессии маркерных генов согласно изобретению в подвергаемом тестированию биологическом образце можно сравнить с множеством контрольных уровней, которые определены на многочисленных характеристических образцах. Предпочтительно использовать контрольный уровень, определяемый на характеристическом образце, полученном из ткани такого типа, которая сходна с биологическим образцом, полученным из организма пациента. Особенно предпочтительно использовать образец (образцы), полученный из организма субъекта/субъектов, состояние здоровья которого расценивается как незлокачественное в соответствии с приведенным выше определением, то есть оно относится к состоянию здоровья, при котором не удается обнаружить ни доброкачественной, ни злокачественной пролиферации. В другом воплощении настоящего изобретения, контрольный уровень может быть определен из характеристического образца, полученного из организма субъекта, у которого диагностирован рак предстательной железы, например, из гормон-независимой или гормон-резистентной злокачественной опухоли предстательной железы.

Альтернативно, характеристические образцы могут включать в себя материал, полученный из клеточных линий, например, из иммортализованных линий злокачественных клеток, или же могут быть получены из тканевых ксенотрансплантатов. Предпочтительно, чтобы материал, полученный из клеточных линий злокачественной опухоли предстательной железы или материал, полученный из тканевых ксенотрансплантатов с тканью предстательной железы человека, в частности, с доброкачественной и полученной из опухоли ткани предстательной железы человека, мог содержаться в характеристическом образце согласно настоящему изобретению. Примеры предпочтительных злокачественных клеточных линий включают в себя линии клеток PC346P, PC346B, LNCaP, VCaP, DuCaP, PC346C, PC3, DU145, PC346CDD, PC346Flul, PC346Flu2. Примеры предпочтительных ксенотрансплантатов включают в себя PC295, PC310, PC-EW, PC82, PC133, PC135, PC324 и PC374. Предпочтительно, чтобы могла быть использована полная панель клеточных линий и ксенотрансплантатов, например, человеческая панель PC346. Кроме того, предпочтительными являются клеточные линии и ксенотрансплантаты, описанные у Marques et al., 2006, Eur. Urol., 49(2): 245-57.

Еще в одной предпочтительной альтернативе, характеристические образцы могут быть получены из ткани пациента или панелей тканей или коллекций тканей, полученных в клинических условиях. Такие образцы могут, например, быть получены из организма пациентов-мужчин, подвергшихся хирургическому вмешательству. Образцы могут быть получены из любой ткани подходящего типа, например, из ткани предстательной железы или лимфатических узлов. Предпочтительными примерами коллекций тканей пациентов являются ткани, полученные в результате хирургических вмешательств (например, простатэктомии).

Кроме того, предпочтительно использовать стандартное значение уровней экспрессии маркера PDE9A согласно изобретению в популяции с известным статусом состояния здоровья. Указанное стандартное значение может быть получено любым известным в данной области способом. Например, в качестве стандартного значения можно использовать среднее значение ±2 SD (стандартное отклонение) или же среднее ±3 SD.

Кроме того, контрольный уровень может быть также определен в то же самое время, что и тестируемый образец, и/или в условиях, сходных или сравнимых с таковыми тестируемого образца, с использованием (a) полученного ранее и хранимого образца (образцов) из организма субъектов/субъекта, статус заболевания которого признан злокачественным, то есть у которого независимо была диагностирована злокачественная опухоль определенного типа, например, рак предстательной железы, в частности, гормон-зависимый, гормон-чувствительный или гормон-резистентный рак предстательной железы.

В контексте настоящего изобретения, контрольный уровень, определяемый на основе биологического образца, о которым известно, что он не является злокачественным, называется "нормальным контрольным уровнем". В случае, если контрольный уровень определяется на основе злокачественного биологического образца, например, образца, полученного из организма субъекта, у которого независимо была диагностирована злокачественная опухоль предстательной железы, в частности, гормон-зависимый, гормон-чувствительный или гормон-резистентный рак предстательной железы, его можно назвать "злокачественным контрольным уровнем".

Используемый здесь термин "рак простаты", или "рак предстательной железы", или "злокачественная опухоль предстательной железы", связан со злокачественной опухолью предстательной железы в мужской репродуктивной системе, которая возникает, когда клетки предстательной железы мутируют и начинают бесконтрольно размножаться. Обычно опухоль предстательной железы связана с повышенным уровнем специфического антигена простаты (PSA). В одном из воплощений настоящего изобретения термин "рак предстательной железы" ассоциирован со злокачественной опухолью, при которой уровни PSA превышают значение 4,0. В другом воплощении указанный термин относится к злокачественной опухоли, при которой уровни PSA превышают значение 2,0. Термин "уровень PSA" относится к концентрации PSA в крови, в нг/мл.

Термин "гормон-зависимый рак предстательной железы" означает, что рост и/или пролиферация злокачественной опухоли предстательной железы или клеточных линий злокачественной опухоли предстательной железы зависят от стимуляции мужским половым гормоном.

Термин "гормон-чувствительный рак предстательной железы" означает, что рост и/или пролиферация злокачественной опухоли предстательной железы или клеточных линий злокачественной опухоли предстательной железы являются чувствительными к стимуляции мужским половым гормоном. Термин "чувствительный" относится к ситуациям, при которых злокачественная опухоль предстательной железы или клеточные линии злокачественной опухоли предстательной железы проявляют характерную биохимическую или клеточную реакцию в присутствии мужских половых гормонов, но при этом для их роста и/или пролиферации мужской половой гормон не является необходимым.

Термин "гормон-резистентный рак предстательной железы" означает, что рост и пролиферация злокачественной опухоли предстательной железы или клеточных линий злокачественной опухоли предстательной железы резистентны к стимуляции мужским половым гормоном. Указанный термин относится также и к поздней стадии развития злокачественной опухоли простаты, которая, как было определено выше, уже не восприимчива к введению анти-гормонов, предпочтительно, анти-андрогенов. Используемый здесь термин "мужской половой гормон" относится к андрогену, предпочтительно, к тестостерону, андростендиону, дигидротестостерону, дегидроэпиандростерону, андростендиолу или андростерону.

Еще в одном из аспектов настоящее изобретение относится к применению PDE9A в качестве маркера для диагностики, детекции, мониторинга или прогнозирования рака предстательной железы или прогрессии злокачественной опухоли предстательной железы.

Используемый здесь термин "диагностирование злокачественной опухоли предстательной железы" означает, что субъект или индивид может считаться страдающим раком предстательной железы, если, как было указано выше, уровень экспрессии маркера PDE9A согласно изобретению модифицирован, предпочтительно, снижен или подавлен, по сравнению с контрольным уровнем, предпочтительно, как было определено выше, по сравнению с нормальным контрольным уровнем. Термин "диагностирование" относится также к заключению, выносимому на основании указанного процесса сравнения.

Термин "модифицированный" или "модифицированный уровень экспрессии" в контексте настоящего изобретения, таким образом, означает изменение в уровне экспрессии. Уровни экспрессии считаются "измененными", когда экспрессия гена PDE9A, например, в анализируемом образце, отличается, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем 50% от контрольного уровня, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с контрольным уровнем. Контрольный уровень может быть либо нормальным контрольным уровнем, либо злокачественным контрольным уровнем, как было определено здесь выше. Если требуется провести сравнение со злокачественным контрольным уровнем, дополнительное сравнение с нормальным контрольным уровнем является предпочтительным. Такое дополнительное сравнение позволяет определить тенденцию модификации, то есть то, имеет ли место повышение или снижение уровня экспрессии.

Термин "модифицированный" относится предпочтительно к снижению или подавлению уровня экспрессии маркера PDE9A или к полному ингибированию экспрессии маркера PDE9A, если сравнивать тестируемый образец с контрольным уровнем. Контрольный уровень, как было определено выше, может быть либо нормальным контрольным уровнем, либо злокачественным контрольным уровнем. В предпочтительном воплощении настоящего изобретения контрольный уровень является злокачественным контрольным уровнем, полученным из или ассоциированным с гормон-зависимыми опухолями или тканями предстательной железы, более предпочтительно, полученным из или ассоциированным с гормон-чувствительными опухолями или тканями предстательной железы. Термины "сниженный уровень экспрессии" или "подавленный уровень экспрессии", или "уменьшение уровня экспрессии" (которые могут быть использованы синонимично), в контексте настоящего изобретения означают, таким образом, снижение уровня экспрессии PDE9A между анализируемой ситуацией, например, ситуацией, когда образец получен из организма пациента, и характеристическим образцом, который может иметь либо нормальный контрольный уровень, либо злокачественный контрольный уровень, получаемый на любой подходящей стадии злокачественной опухоли, известной специалисту в данной области, предпочтительно, на стадии гормон-зависимой стадии опухоли предстательной железы, более предпочтительно, гормон-чувствительной стадии опухоли предстательной железы. Подразумевается, что уровни экспрессии "снижены" или "подавлены", когда экспрессия гена PDE9A уменьшается, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем 50% по сравнению с контрольным уровнем, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с контрольным уровнем, предпочтительно, по сравнению с гормон-зависимым или гормон-чувствительным контрольным уровнем опухоли предстательной железы.

В дальнейшем воплощении дополнительное сходство в характере суммарной экспрессии гена между образцом, полученным из организма субъекта, и характеристическим образцом, который, как было определено здесь выше, является злокачественным, указывает на то, что данный субъект страдает злокачественной опухолью. В другом воплощении настоящего изобретения, диагностику можно комбинировать с выяснением уровней экспрессии дополнительных биомаркеров злокачественных опухолей. Например, можно проверить уровень экспрессии таких биомаркеров как PSA. Злокачественную опухоль, в частности, злокачественную опухоль предстательной железы, можно считать диагностированной, если уровень экспрессии маркера PDE9A согласно изобретению модифицирован, предпочтительно, снижен или подавлен, по сравнению с контрольным уровнем, как было определено здесь выше, например, как определено выше, по сравнению с нормальным контрольным уровнем.

В особенно предпочтительном воплощении рак предстательной железы можно считать диагностированным, если уровень экспрессии PDE9A, как было определено выше, уменьшен на величину, составляющую от 20% до 80%, предпочтительно на величину, составляющую 30%, 40%, 50%, 60% или 70%, в тестируемом образце по сравнению с контрольным уровнем, предпочтительно по сравнению с контрольным уровнем экспрессии, полученным из гормон-зависимого опухолевого контроля, более предпочтительно, из гормон-чувствительного контроля опухоли предстательной железы. В другом предпочтительном воплощении гормон-резистентный рак предстательной железы можно считать диагностированным, если уровень экспрессии PDE9A, как было определено выше, снижен на величину, составляющую от 20% до 90%, предпочтительно на величину, составляющую 30%, 40%, 50%, 60%, 70% или 80%, в тестируемом образце по сравнению с контрольным уровнем. Контрольный уровень может быть либо нормальным контрольным уровнем, либо злокачественным контрольным уровнем, предпочтительно, полученным из гормон-зависимой или гормон-чувствительной злокачественной опухоли предстательной железы.

Используемый здесь термин "детекция злокачественной опухоли предстательной железы" означает, что в организме может быть определено наличие злокачественного заболевания или расстройства, или что злокачественное заболевание или расстройство может быть идентифицировано в организме. Указанные определение или идентификация злокачественного заболевания или расстройства могут быть достигнуты путем сравнения, как было определено выше, уровня экспрессии маркера PDE9A согласно изобретению и нормального контрольного уровня. Злокачественная опухоль, в частности, злокачественная опухоль предстательной железы, может быть детектирована, когда уровень экспрессии маркера PDE9A сходен, как было определено выше, со злокачественным контрольным уровнем. В предпочтительном воплощении настоящего изобретения злокачественная опухоль предстательной железы может быть детектирована, если уровень экспрессии маркера PDE9A сходен со злокачественным контрольным уровнем установленной злокачественной клетки или клеточной линии предстательной железы, например линии клеток предстательной железы, как указано выше.

Используемый здесь термин "мониторинг злокачественной опухоли предстательной железы" относится к сопроводительной процедуре диагностики или детекции злокачественного заболевания или расстройства, например, в процессе проведения лечебных процедур или в течение определенного временнóго периода, обычно в течение 2 месяцев, 3 месяцев, 4 месяцев, 6 месяцев, 1 года, 2 лет, 3 лет, 5 лет, 10 лет или любого другого временнóго периода. Термин "сопроводительная" означает, что состояние болезни, как было определено здесь выше, и, в частности, изменения указанного состояния болезни можно детектировать путем сравнения уровня экспрессии маркера PDE9A согласно изобретению в образце с нормальным или со злокачественным контрольным уровнем, как было определено выше, предпочтительно, с контрольным уровнем экспрессии, полученным из гормон-зависимого опухолевого контроля, более предпочтительно, из гормон-чувствительного контроля злокачественной опухоли предстательной железы, с любым интервалом периодичности, например, каждую неделю, каждые 2 недели, каждый месяц, каждые 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 или 12 месяцев, каждые 1,5 года, каждые 2, 3, 4 года, 5, 6, 7, 8, 9 или 10 лет, в течение любого временнóго периода, например, в течение 2 недель, 3 недель, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 месяцев, 1,5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 или 20 лет, соответственно. Злокачественный контрольный уровень может быть получен на основе образцов, соответствующих различным стадиям развития злокачественной опухоли, например, стадиям 0 и от I до IV, согласно TNM-системе классификации. В предпочтительном воплощении настоящего изобретения указанный термин относится к сопроводительной процедуре диагностики злокачественной опухоли предстательной железы, более предпочтительно, к гормон-зависимой и гормон-чувствительной злокачественным опухолям простаты. В дальнейшем воплощении мониторинг может быть использован также и в качестве сопроводительной процедуры при гормон-резистентном раке предстательной железы, например, в процессе проведения лечебной процедуры. Мониторинг может также включать в себя детекцию экспрессии дополнительных генов или генетических элементов, например, генов домашнего хозяйства, таких как GAPDH или PBGD, или же других фосфодиэстераз, предпочтительно, PDE4D5.

Используемый здесь термин "прогнозирование рака предстательной железы" относится к предсказанию течения или исхода диагностированного или детектируемого злокачественного заболевания, например, в течение определенного временнóго периода, в процессе лечения или после лечения. Указанный термин относится также к определению шансов выживания или восстановления после болезни, а также к предварительной оценке прогнозируемого периода выживания субъекта. Прогноз может, в частности, включать в себя оценку вероятности выживания субъекта в течение некоторого периода в будущем, например, в течение 6 месяцев, 1 года, 2 лет, 3 лет, 5 лет, 10 лет или любого другого временнóго периода.

Используемый здесь термин "прогрессирование рака предстательной железы" относится к переходу между различными стадиями развития злокачественной опухоли предстательной железы, например, к переходу из стадий 0 и I в стадию IV, согласно классификации TNM, или в любую другую стадию или подстадию, начиная со здорового состояния и вплоть до терминальной стадии злокачественной опухоли. Обычно такие переходы сопровождаются модификацией уровня экспрессии PDE9A, предпочтительно, его снижением, в тестируемом образце, по сравнению с образцом, полученным из организма того же самого индивида и исследованным ранее, например, по сравнению с образцом, полученным из гормон-зависимой опухоли предстательной железы или опухолевого контроля, или из гормон-чувствительной опухоли предстательной железы или опухолевого контроля. Прогрессирование рака предстательной железы может считаться детектированным или диагностированным, если уровень экспрессии PDE9A, как определено здесь выше, снижается по величине от 3% до 50%, предпочтительно на величину 10%, 15%, 20% или 25% в тестируемом образце по сравнению с образцом, полученным из организма того же самого индивида и исследованным ранее. Модификация может быть детектирована с любым временным интервалом, предпочтительно через 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 месяцев, 1,5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 или 20 лет, то есть указанная выше величина может быть оценена путем сравнения уровня экспрессии PDE9A в первой временнóй точке и во второй временнóй точке после указанного выше периода. В специфическом воплощении прогрессирование может оказаться прогрессией в сторону гормон-резистентной злокачественной опухоли предстательной железы.

В особенно предпочтительном воплощении настоящего изобретения термин "прогрессирование злокачественной опухоли предстательной железы" относится к переключению с гормон-зависимого состояния злокачественной опухоли предстательной железы на гормон-чувствительное состояние злокачественной опухоли предстательной железы, к переключению с гормон-чувствительного состояния злокачественной опухоли предстательной железы на гормон-резистентное состояние злокачественной опухоли простаты, или с гормон-зависимого или гормон-чувствительного состояния злокачественной опухоли предстательной железы на гормон-резистентное состояние злокачественной опухоли простаты.

Можно считать прогрессию от гормон-зависимого или гормон-чувствительного состояния злокачественной опухоли предстательной железы к гормон-резистентному состоянию злокачественной опухоли предстательной железы детектированной или диагностированной, если уровень экспрессии PDE9A, как было определено выше, снижается по величине от 3% до 50%, предпочтительно на величину 10%, 15%, 20% или 25% в тестируемом образце по сравнению с образцом, полученным из организма того же самого индивида, у которого ранее была диагностирована гормон-чувствительная или гормон-зависимая злокачественная опухоль предстательной железы. Прогрессию можно также считать детектированной, если проведено сравнение с тестированными образцами, полученными из организма других индивидов, тестированными образцами из тканевых коллекций, с уровнями, полученными из баз данных, и т.п.

Модификация может быть детектирована с временным интервалом, предпочтительно через 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 месяцев, 1,5, 2, 3, 4 года, 5, 6, 7, 8, 9, 10, 15 или 20 лет, то есть указанная выше величина может быть оценена путем сравнения уровня экспрессии PDE9A в первой временнóй точке и во второй временнóй точке после указанного выше периода.

В дальнейшем воплощении настоящее изобретение относится к диагностике и детекции предрасположенности к развитию рака предстательной железы, более предпочтительно, гормон-резистентного рака предстательной железы. "Предрасположенность к развитию рака предстательной железы", а в частности, "предрасположенность к развитию гормон-резистентного рака предстательной железы", в контексте настоящего изобретения, представляет собой состояние риска развития злокачественной опухоли предстательной железы, в частности, гормон-резистентной злокачественной опухоли предстательной железы. В предпочтительном варианте предрасположенность к развитию гормон-резистентного рака предстательной железы может иметь место в ситуациях, как было определено ранее, когда уровень экспрессии PDE9A ниже злокачественного контрольного уровня, например, характеристического (или ссылочного, или стандартного) уровня экспрессии, полученного на основе тканей или образцов из организма субъекта, который определенно страдает гормон-чувствительным раком предстательной железы. Используемый здесь термин "ниже" означает, что уровень экспрессии PDE9A снижен приблизительно на 40%-80% по сравнению со злокачественным контрольным уровнем, предпочтительно, снижен приблизительно на 50%.

Альтернативно, предрасположенность к развитию злокачественной опухоли предстательной железы, в контексте настоящего изобретения, может иметь место в ситуациях, при которых, как было определено выше, уровень экспрессии PDE9A установлен, и при которых, кроме того, не выявляется модификация уровня экспрессии или характер экспрессии альтернативных маркеров злокачественной опухоли, например, PSA. Подходящие дополнительные маркеры злокачественной опухоли известны специалистам в данной области.

Таким образом, предрасположенность к развитию злокачественной опухоли предстательной железы, в частности, гормон-резистентного рака предстательной железы, может считаться диагностированной или детектированной, если имеет место одна из указанных выше ситуаций.

Разница между уровнями экспрессии тестируемого биологического образца и контрольного уровня может быть нормализована относительно уровня экспрессии дополнительных контрольных нуклеиновых кислот, например, генов домашнего хозяйства, уровни экспрессии которых, как известно, не меняются в зависимости от злокачественного или незлокачественного состояния клеток. Примеры контрольных генов включают в себя, помимо прочих, ген β-актина, ген глицеринальдегид-3-фосфатдегидрогеназы (GAPDH), порфобилиногендезаминазы (PBGD) и рибосомного белка P1. Нормализацию можно произвести и в отношении других фосфодиэстераз, предпочтительно, в отношении фосфодиэстеразы человека, характер экспрессии которой не изменяется на разных стадиях опухолевого процесса. Предпочтительной фосфодиэстеразой является PDE4D5 или любая другая изоформа семейства PDE4D, например, PDE4D1, PDE4D2, PDE4D3, PDE4D4, PDE4D6, PDE4D8 или PDE4D9.

В контексте настоящего изобретения подразумевается также, что используемые здесь термины "диагностирование" и "прогнозирование" распространяются также и на прогностический вероятностный анализ. PDE9A в качестве маркера может, соответственно, быть использована клинически при принятии решений относительно подходов и способов лечения, включая терапевтическое вмешательство или диагностические критерии, такие как контроль [за развитием] заболевания. В соответствии с настоящим изобретением, можно получить промежуточный результат исследования состояния субъекта. Такой промежуточный результат можно сочетать с дополнительной информацией, в помощь лечащему врачу, медицинским сестрам или другому персоналу, в установлении диагноза заболевания, которым страдает тот или иной субъект. Альтернативно, настоящее изобретение может быть использовано для детекции злокачественных клеток в ткани, полученной из организма субъекта, что предоставит врачу дополнительную информацию для диагностики заболевания, которым страдает данный субъект.

Субъектом или индивидом, которого надлежит подвергнуть диагностике, мониторингу, или в отношении которого предстоит детектировать или прогнозировать злокачественную опухоль предстательной железы, прогрессирование злокачественной опухоли предстательной железы или предрасположенность к возникновению злокачественной опухоли предстательной железы, в соответствии с настоящим изобретением, является животное, предпочтительно, млекопитающее, более предпочтительно, человек.

Особенно предпочтительным, как известно специалистам в данной области, является использование медицинского оборудования, в котором используется молекулярная визуализация, например, технологий магнитно-резонансной томографии (MRI) и/или многофотонной ионизационной времяпролетной масс-спектроскопии (MPI), в контексте использования PDE9A в качестве маркера для диагностики, детекции, мониторинга или прогнозирования прогрессии злокачественной опухоли предстательной железы. Например, PDE9A может быть использована в качестве маркера для диагностики, детекции, мониторинга или прогнозирования рака предстательной железы или прогрессии рака предстательной железы в таких подходах как MRI или MPI, которые позволяют в режиме реального времени детектировать диагностический маркер в организме субъекта.

Еще в одном из аспектов настоящее изобретение относится к композиции для диагностики, детекции, мониторинга или прогнозирования злокачественной опухоли предстательной железы или прогрессии злокачественной опухоли предстательной железы, или же предрасположенности к злокачественной опухоли предстательной железы у индивида. Композиция согласно настоящему изобретению может включать в себя аффинный лиганд на основе нуклеиновой кислоты и/или аффинный пептидный лиганд, обладающий сродством к продукту экспрессии PDE9A или к белку PDE9A.

Используемый здесь термин "аффинный лиганд на основе нуклеиновой кислоты, обладающий сродством к продукту экспрессии PDE9A", относится к молекуле нуклеиновой кислоты, способной специфически связываться с PDE9A-транскриптом или с молекулой ДНК, полученной из вариантов сплайсинга 1-20 фосфодиэстеразы PDE9A, даже более предпочтительно с ДНК-последовательностью, приведенной в последовательностях SEQ ID NO: 1-20, или с последовательностью, комплементарной ДНК-последовательности, приведенной в последовательностях SEQ ID NO: 1-20, или с соответствующей молекулой РНК. Аффинный лиганд на основе нуклеиновой кислоты может быть способен также к специфическому связыванию с ДНК-последовательностью, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична любой из последовательностей, приведенных в последовательностях SEQ ID NO: 1-20, или с ДНК-последовательностью, кодирующей аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична любой из последовательностей, приведенных в последовательностях SEQ ID NO: 21-40, или с любым из фрагментов указанных последовательностей.

Используемый здесь термин "аффинный пептидный лиганд, обладающий сродством к белку PDE9A" относится к пептидной молекуле, способной к специфическому связыванию с белком PDE9A. Предпочтительно, чтобы указанная пептидная молекула была способна специфически связываться с белком или полипептидом, содержащим аминокислотную последовательность, приведенную в последовательностях SEQ ID NO: 21-40. Аффинный пептидный лиганд может также быть способен к специфическому связыванию с белком или полипептидом, содержащим аминокислотную последовательность, кодируемую последовательностью ДНК, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична любой из последовательностей, приведенных в последовательностях SEQ ID NO: 1-20, или с белком или полипептидом, содержащим аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична любой из последовательностей, приведенных в последовательностях SEQ ID NO: 21-40, или с любым из фрагментов указанных последовательностей. Термин "пептид" относится к аминокислотной последовательности любого типа, содержащей более чем 2 аминокислоты, например, полипептидные структуры, белковые структуры или их функциональные производные. Кроме того, пептид можно комбинировать с дополнительными химическими фрагментами или функциональными группами.

Используемый здесь термин "продукт экспрессии" относится к PDE9A-транскрипту или молекуле мРНК, образующейся в результате экспрессии гена PDE9A. В более предпочтительном варианте указанный термин относится к PDE9A-транскрипту, прошедшему стадию процессинга, как определено здесь выше, например, через последовательности, приведенные в SEQ ID NO: 1-20.

В предпочтительном воплощении настоящего изобретения композиция согласно изобретению содержит аффинный на основе нуклеиновой кислоты и/или пептидный лиганды, выбранные из группы, состоящей из набора олигонуклеотидов, специфичных в отношении продукта экспрессии PDE9A, зонда, специфичного в отношении продукта экспрессии PDE9A, аптамера, специфичного в отношении продукта экспрессии PDE9A или в отношении белка PDE9A, антитела, специфичного в отношении белка PDE9A, и варианта антитела, специфичного в отношении белка PDE9A.

Композиция согласно изобретению может, например, содержать набор олигонуклеотидов, специфичных в отношении продукта экспрессии PDE9A и/или зонда, специфичного в отношении продукта экспрессии PDE9A. Используемый здесь термин "олигонуклеотид, специфичный в отношении продукта экспрессии PDE9A" относится к нуклеотидной последовательности, которая комплементарна смысловой или антисмысловой цепи вариантов сплайсинга 1-20 фосфодиэстеразы PDE9A. Предпочтительно, чтобы указанный олигонуклеотид был комплементарен последовательности ДНК, приведенной в последовательностях SEQ ID NO: 1-20, или последовательности ДНК, комплементарной последовательностям, приведенным в SEQ ID NO: 1-20. Олигонуклеотидная последовательность может быть также комплементарна последовательности ДНК, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична любой из последовательностей, приведенных в SEQ ID NO: 1-20, или последовательности ДНК, кодирующей аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична любой из последовательностей, приведенных в последовательностях SEQ ID NO: 21-40.

Указанный олигонуклеотид может иметь любую подходящую длину и последовательность, известные специалистам в данной области, как производное от любой из последовательностей SEQ ID NO: 1-20 или комплементарных им последовательностей. Обычно такой олигонуклеотид может иметь длину от 8 до 60 нуклеотидов, предпочтительно, от 10 до 35 нуклеотидов, более предпочтительно, длину в 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 или 33 нуклеотида. Олигонуклеотидные последовательности, специфичные в отношении продукта экспрессии PDE9A, могут быть определены с помощью программного обеспечения, известного специалистам в данной области.

В дальнейшем воплощении настоящего изобретения олигонуклеотидные последовательности могут быть комплементарны последовательностям, локализованным в консервативной области PDE9A, предпочтительно, между экзоном 10 и экзоном 22 гена PDE9A, более предпочтительно, последовательностям, локализованным в пограничной области между экзоном 19 и экзоном 20 гена PDE9A, или же последовательностям, локализованным исключительно в экзоне 19, 20 или 21 гена PDE9A, даже более предпочтительно, последовательностям между экзоном 20 с одной стороны, и всеми нуклеотидами экзона 21 с другой стороны.

Например, олигонуклеотид, используемый в качестве прямого праймера, может быть локализован в экзоне 19 гена PDE9A, а олигонуклеотид, используемый в качестве обратного праймера, может быть локализован в экзоне 20 гена PDE9A. В предпочтительном воплощении, олигонуклеотид, используемый в качестве прямого праймера, может быть комплементарен последовательности, локализованной на экзоне 20, а олигонуклеотид, используемый в качестве обратного праймера, может быть комплементарен последовательности, локализованной на экзоне 21.

В предпочтительном воплощении настоящего изобретения набор олигонуклеотидов имеет последовательности, приведенные в SEQ ID NO: 41 и SEQ ID NO: 42. Кроме того, предпочтительными являются олигонуклеотиды, имеющие или содержащие последовательности, приведенные в SEQ ID NO: 45 и/или SEQ ID NO: 46.

Используемый здесь термин "зонд, специфичный в отношении продукта экспрессии PDE9A" означает нуклеотидную последовательность, которая комплементарна смысловой или антисмысловой цепи вариантов сплайсинга 1-20 фосфодиэстеразы PDE9A. Предпочтительно, чтобы указанный зонд был комплементарен последовательности ДНК, приведенной в последовательностях SEQ ID NO: 1-20, или последовательности ДНК, комплементарной последовательностям, приведенным в SEQ ID NO: 1-20. Последовательность зонда может быть также комплементарна последовательности ДНК, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична любой из последовательностей, приведенных в SEQ ID NO: 1-20, или последовательности ДНК, кодирующей аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична любой из последовательностей, приведенных в последовательностях SEQ ID NO: 21-40.

Указанный зонд может иметь любую подходящую длину и последовательность, известные специалистам в данной области, как производное от любой из последовательностей SEQ ID NO: 1-20 или комплементарных им последовательностей. Обычно такой зонд может иметь длину от 6 до 300 нуклеотидов, предпочтительно от 15 до 60 нуклеотидов, более предпочтительно длину в 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 или 50 нуклеотидов. Последовательности зонда, специфичные в отношении продукта экспрессии PDE9A, могут быть определены с помощью программного обеспечения, известного специалистам в данной области.

В дальнейшем воплощении настоящего изобретения последовательности зонда могут быть комплементарны последовательности, локализованной в консервативной области PDE9A, предпочтительно, между экзоном 10 и экзоном 22 гена PDE9A. Более предпочтительно, чтобы последовательность зонда могла быть комплементарна последовательностям, локализованным в пограничной области между экзоном 19 и экзоном 20 гена PDE9A, или же последовательностям, локализованным исключительно в экзоне 19, 20 или 21 гена PDE9A, даже более предпочтительно, чтобы последовательность зонда могла быть комплементарна последовательностям между экзоном 20 с одной стороны, и всеми нуклеотидами экзона 21 с другой стороны. В предпочтительном воплощении, олигонуклеотид, применимый в качестве зонда, может быть комплементарен последовательности, локализованной между последними 16 основаниями экзона 20 и первыми 5 основаниями экзона 21 гена PDE9A.

Если такой зонд предполагается использовать для количественных реакций ПЦР, например, ПЦР в режиме реального времени, зонд может быть сконструирован таким образом, чтобы он был локализован в промежуточном положении между связывающими положениями прямого и обратного праймеров. Предпочтительно, чтобы зонд мог быть сконструирован таким образом, чтобы он был локализован поблизости от одного из праймерных олигонуклеотидов. Более предпочтительно, чтобы он мог быть локализован поблизости от прямых праймеров.

В предпочтительном воплощении настоящего изобретения зонд имеет последовательность, приведенную в SEQ ID NO: 43 или SEQ ID NO: 47.

Композиция согласно изобретению может, дополнительно или альтернативно, содержать аптамер, специфичный в отношении продукта экспрессии или белка фосфодиэстеразы PDE9A. Используемый здесь термин "аптамер, специфичный в отношении продукта экспрессии PDE9A" относится к короткой молекуле нуклеиновой кислоты, например, РНК, ДНК, PNA (пептид-нуклеиновая кислота), CNA, HNA, LNA или ANA или любой другой подходящий формат нуклеиновых кислот, известный специалистам в данной области, который способен специфически связываться с вариантами сплайсинга 1-20 фосфодиэстеразы-9A, предпочтительно, к молекуле ДНК, полученной в результате вариантов сплайсинга 1-20 фосфодиэстеразы-9A. Более предпочтительно, чтобы аптамерная молекула нуклеиновой кислоты могла специфически связываться с последовательностью ДНК, приведенной в последовательностях SEQ ID NO: 1-20 или их двухцепочечных производных. Нуклеиновая кислота-аптамер согласно изобретению может также связываться с молекулой РНК, соответствующей PDE9A-транскрипту, предпочтительно, с молекулой РНК, соответствующей ДНК-последовательности, приведенной в последовательностях SEQ ID NO: 1-20.

Нуклеиновая кислота-аптамер может, кроме того, быть способна к специфическому связыванию с последовательностью ДНК, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична любой из последовательностей, приведенных в SEQ ID NO: 1-20, или с последовательностью ДНК, кодирующей аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична любой из последовательностей, приведенных в SEQ ID NO: 21-40, или с молекулами РНК, соответствующими указанным последовательностям.

Специфичность нуклеиновой кислоты-аптамера в отношении вариантов сплайсинга 1-20 фосфодиэстеразы-9A может быть обеспечена путем специфического связывания с последовательностями, присутствующими исключительно в указанных вариантах сплайсинга.

Нуклеиновые кислоты-аптамеры могут быть получены в соответствии с любым подходящим способом, известным специалистам в данной области, например, путем in vitro селекции или SELEX-методами. Предпочтительно, чтобы нуклеиновые кислоты-аптамеры могли быть получены и/или сконструированы в соответствии с тем, как предложено в руководстве Ellington and Szostak, 1990, Nature, 346: 818-822. Нуклеиновую кислоту-аптамер согласно изобретению можно дополнительно комбинировать с добавочными фрагментами, например, со взаимодействующими элементами наподобие биотина или ферментативных функциональных групп, таких как элементы рибозимов.

Используемый здесь термин "аптамер, специфичный в отношении белка PDE9A" относится к короткому пептиду, способному ко взаимодействию и специфическому связыванию белка PDE9A. Пептид-аптамер предпочтительно может быть способен к специфическому связыванию с белком или полипептидом, содержащим аминокислотную последовательность, приведенную в последовательностях SEQ ID NO: 21-40. Пептид-аптамер может также быть способен к специфическому связыванию с белком или полипептидом, содержащим аминокислотную последовательность, кодируемую последовательностью ДНК, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична любой из последовательностей, приведенных в в SEQ ID NO: 1-20, или с белком или полипептидом, содержащим аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична любой из последовательностей, приведенных в SEQ ID NO: 21-40. Обычно пептид-аптамер является вариабельной пептидной петлей, содержащей, например, от 10 до 20 аминокислот. В контексте настоящего изобретения пептид-аптамер предпочтительно может быть присоединен к одному или обоим концам каркасной структуры. Каркасной структурой может быть любая молекула, предпочтительно, белок, который имеет хорошую растворимость. Подходящие каркасные молекулы должны быть известны специалистам в данной области. Предпочтительной каркасной молекулой, применимой в контексте настоящего изобретения, является бактериальный белок тиоредоксин-A. Петля пептида-аптамера предпочтительно может быть встроена в редуцирующий активный сайт каркасной молекулы. Альтернативно, стафилококковый протеин A и его домены, а также производные этих доменов, такие как протеин Z или липокалины, могут, в контексте настоящего изобретения, быть использованы в качестве каркасных структур.

Пептиды-аптамеры могут быть получены в соответствии с любым подходящим способом, известным специалистам в данной области, например, посредством двугибридных дрожжевых систем.

В другом предпочтительном воплощении настоящего изобретения композиция может включать в себя, или может дополнительно содержать, антитело, специфичное в отношении белка PDE9A, предпочтительно, моноклональное антитело или поликлональное антитело. Также предпочтительными являются варианты или фрагменты антител, такие как одноцепочечное антитело, диа-тело, мини-тело, одноцепочечный Fv-фрагмент (sc(Fv)), Sc(Fv)2-антитело, Fab-фрагмент или F(ab')2-фрагмент на основе моноклонального, специфичного в отношении PDE9A, антитела, малые модульные иммунофармацевтические средства (SMIP), белок, слитый со связывающим доменом иммуноглобулина, оверблюженное антитело, VHH-содержащее антитело, и т.п. Антитело может быть моно-, бивалентным, трехвалентным или мультивалентным. Антитело может быть любой природы, например, мышиным, человеческим или химерным, или же гуманизированным мышиным антителом. В специфическом воплощении настоящего изобретения коммерчески доступные анти-PDE9A-антитела, такие как H00005152-M01 (Abnova Taiwan Corp) или NBP1-00641 (Novus Biologicals, Inc.), могут содержаться в композиции или же могут быть использованы в диагностических целях.

Антитела могут быть получены в соответствии с любым подходящим способом, известным специалистам в данной области. Поликлональные антитела могут быть получены путем иммунизации животных выбранным антигеном, тогда как моноклональные антитела определенной специфичности могут быть получены с использованием гибридомной технологии, разработанной Köhler and Milstein (Köhler and Milstein, 1976, Eur. J. Immunol., 6: 511-519).

Аффинный лиганд, как описано здесь выше, можно метить различными маркерами, или же его можно детектировать вторичным аффинным лигандом, меченным различными маркерами, чтобы реализовать детекцию, визуализацию и/или количественное определение. Это может быть осуществлено с помощью любых подходящих меток, которые могут быть конъюгированы с аффинным лигандом, способным к взаимодействию с продуктом экспрессии с PDE9A или с белком PDE9A, или же с любым вторичным аффинным лигандом, с использованием любой подходящей технологии или любых способов, известных специалистам в данной области. Термин "вторичный аффинный лиганд" относится к молекуле, которая способна связываться с аффинным лигандом, как определено здесь выше (то есть "первичным аффинным лигандом", в контексте системы с двумя взаимодействующими аффинными лигандами). Связывающее взаимодействие предпочтительно является специфическим взаимодействием.

Примеры меток, которые могут быть конъюгированы с первичными и/или вторичными аффинными лигандами, включают в себя флуоресцентные метки или металлы (например, флуоресцеин, родамин, фикоэритрин, флуорескамин), хромофорные метки (например, родопсин), хемилюминесцентные соединения (например, люминал, имидазол), а также биолюминесцентные белки (например, люциферин, люцифераза), гаптены (например, биотин).

В особенно предпочтительном воплощении аффинный лиганд, который предполагается использовать в качестве зонда, в частности, зонда, специфичного в отношении продукта экспрессии PDE9A, как определено здесь выше, можно метить флуоресцентной меткой наподобие 6-FAM, HEX, TET, ROX, Cy3, Cy5, красителя Texas Red или родамина, и/или в то же самое время меткой, вызывающей гашение, такой как TAMRA, Dabcyl, Black Hole Quencher, BHQ-I или BHQ-2. Ряд других полезных флуоресцентных меток и хромофоров описан у Stryer, 1968, Science, 162: 526-533. Аффинные лиганды можно также метить ферментами (например, пероксидазой хрена, щелочной фосфатазой, бета-лактамазой), радиоактивными изотопами (например, 3H, 14C, 32P, 33P, 35S, 125I, 11C, 13N, 15O, 18F, 64Cu, 62Cu, 124I, 76Br, 82Rb, 68Ga или 18F) или частицами (например, золотом).

Разные типы меток могут быть конъюгированы с аффинным лигандом в результате различных химических взаимодействий, например, реакция с аминной или с тиольной группой. Однако могут быть использованы и другие реактивные группы, отличные от аминной и тиольной, например, альдегиды, карбоновые кислоты и глутамин. В предпочтительном воплощении настоящего изобретения аффинный лиганд на основе нуклеиновой кислоты или аффинный лиганд пептида согласно изобретению могут быть модифицированы таким образом, чтобы они функционировали в качестве контрастного средства.

Используемый здесь термин "контрастное средство" относится к молекулярному соединению, которое способно специфически взаимодействовать с маркером PDE9A и которое можно детектировать на аппаратуре, расположенной вне организма человека или животного. Предпочтительно, чтобы такие контрастные средства подходили для применения в магнитно-резонансной томографии (MRI) или многофотонной ионизационной времяпролетной масс-спектроскопии (MPI). Термин "специфически взаимодействующее" относится к свойству молекулярного соединения предпочтительно взаимодействовать с маркером PDE9A на поверхности клеток, находящихся внутри организма человека или животного, по сравнению с другими белками, которые экспрессируются такими клетками. Предпочтительные контрастные средства, которые могут быть сконструированы, также как композиции контрастных средств, будут способны к специфической детекции молекул, имеющих любую из нуклеотидных последовательностей SEQ ID NO: 1-20 или любую из аминокислотных последовательностей SEQ ID NO: 21-40, или их производных, или гомологических вариантов, как определено здесь выше. Предпочтительными контрастными средствами являются, как определено здесь выше, аптамеры, специфичные в отношении продукта экспрессии PDE9A или в отношении белка PDE9A, а также, как определено выше, антитела, специфичные в отношении белка PDE9A.

Контрастные средства, помимо их свойства, связанного со способностью специфически распознавать маркер PDE9A, будут, как правило, содержать дополнительную молекулу, которая детектируется при использовании специфической технологии детекции. Таким образом, используемый здесь термин "модифицированы таким образом, чтобы они функционировали" относится к любым подходящим модификациям, известным специалистам в данной области, которые могут быть необходимы для применения контрастного средства в методах молекулярной визуализации, в частности, в MRI или MPI. Например, если в качестве средства для детекции используется флуоресцентная спектроскопия, такие молекулы могут включать в себя в качестве детектируемых маркерных молекул флуорофоры, которые при особой длине волны могут переходить в возбужденное состояние. Альтернативно, может быть использована радиоактивная метка, например, радиоизотоп, как описано здесь выше. Что касается предпочтительных контрастных средств в соответствии с настоящим изобретением, которые являются подходящими для MRI, то контрастные средства, такие как описанные выше антитела, могут содержать маркерную молекулу, которая детектируется методом MRI. Такие детектируемые метки включают в себя, например, USPIOS и 19Fluor.

В специфическом воплощении настоящего изобретения композиция может дополнительно содержать вспомогательные ингредиенты, такие как буферы для ПЦР, dNTP (дезоксинуклеотидтрифосфаты), полимеразу, ионы, такие как двухвалентные катионы или одновалентные катионы, растворы для гибридизации, вторичные аффинные лиганды, такие, например, как вторичные антитела, распознаваемые красители, а также любое другое подходящее соединение или жидкость, необходимые для реализации детекции на основе любого из аффинных лигандов или контрастных средств, как определено здесь выше, которые известны специалистам в данной области.

В другом аспекте настоящее изобретение относится к применению лиганда на основе нуклеиновой кислоты или пептидного лиганда, аффинного в отношении продукта экспрессии PDE9A или белка PDE9A, как определено здесь выше, для получения композиции для диагностики, детекции, мониторинга или прогнозирования рака предстательной железы, или прогрессии злокачественной опухоли предстательной железы, или же предрасположенности к раку предстательной железы у индивида, как было описано выше.

В предпочтительном воплощении настоящее изобретение относится к применению набора олигонуклеотидов, специфичных в отношении продукта экспрессии PDE9A, и/или зонда, специфичного в отношении продукта экспрессии PDE9A, как определено выше, для получения композиции для диагностики, детекции, мониторинга или прогнозирования рака предстательной железы, или прогрессии злокачественной опухоли предстательной железы, или же предрасположенности к раку предстательной железы у индивида, как было описано выше. В другом предпочтительном воплощении настоящее изобретение относится к применению аптамера, специфичного в отношении продукта экспрессии PDE9A или белка PDE9A, как определено здесь выше, для получения композиции для диагностики, детекции, мониторинга или прогнозирования рака предстательной железы, или прогрессии злокачественной опухоли предстательной железы, или же предрасположенности к раку предстательной железы у индивида, как было описано выше.

В другом предпочтительном воплощении настоящее изобретение относится к применению антитела, специфичного в отношении белка PDE9A, или варианта антитела, специфичного в отношении белка PDE9A, как определено здесь выше, для получения композиции для диагностики, детекции, мониторинга или прогнозирования рака предстательной железы, или прогрессии злокачественной опухоли предстательной железы, или же предрасположенности к раку предстательной железы у индивида, как было описано выше.

В предпочтительном воплощении настоящего изобретения композиция, как было указано выше, является диагностической композицией.

В другом аспекте настоящее изобретение относится к диагностическому набору для детекции, мониторинга или прогнозирования рака предстательной железы, или прогрессии злокачественной опухоли предстательной железы, или же предрасположенности к раку предстательной железы, включающему в себя набор олигонуклеотидов, специфичных в отношении продукта экспрессии PDE9A, зонд, специфичный в отношении продукта экспрессии PDE9A, и/или аптамер, специфичный в отношении продукта экспрессии PDE9A или белка PDE9A, и/или антитело, специфичное в отношении белка PDE9A, и вариант антитела, специфичного в отношении белка PDE9A.

Обычно диагностический набор согласно изобретению содержит одно или несколько средств, позволяющих осуществить специфическую детекцию PDE9A, как определено здесь выше. Средства или ингредиенты диагностического набора могут, согласно настоящему изобретению, быть заключены в один или несколько контейнеров или отдельных элементов. Природа указанных средств определяется способом детекции, для выполнения которого предназначен данный набор. Когда детекция предполагается на уровне экспрессии мРНК PDE9A, то есть через продукт экспрессии PDE9A, средства, содержащиеся в наборе, могут быть представлены набором олигонуклеотидов, специфичных в отношении продукта экспрессии PDE9A, и/или зонда, специфичного в отношении продукта экспрессии PDE9A, как определено здесь выше, который необязательно должен быть меченым, в соответствии с известными в данной области способами, например, описанными выше метками. Дополнительно или альтернативно, в наборе может содержаться аптамер, специфичный в отношении продукта экспрессии PDE9A. Когда детекция предполагается на уровне белка PDE9A, средства, содержащиеся в наборе, могут быть представлены антителами или соединениями, содержащими антиген-связывающий фрагмент антитела, или вариантами антител, специфичными в отношении белка PDE9A, как описано здесь выше. Дополнительно или альтернативно, в наборе может содержаться аптамер, специфичный в отношении белка PDE9A. Альтернативно, диагностический набор может содержать контрастное средство, как определено здесь выше.

Наличие специфических белков можно детектировать также с помощью других соединений, которые специфически взаимодействуют с PDE9A, например, специфических субстратов или лигандов.

Предпочтительно, чтобы диагностический набор согласно настоящему изобретению содержал реагенты для экспрессии продукта PDE9A или белка PDE9A. Такие детектирующие реагенты включают в себя, например, буферные растворы, метки или жидкости для отмывки, и т.п. Кроме того, такой набор может содержать такое количество известной молекулы нуклеиновые кислоты или белка, которое можно использовать для калибровки набора, или в качестве внутреннего контроля. Обычно диагностический набор для детекции продукта экспрессии PDE9A может дополнительно содержать вспомогательные ингредиенты, такие как буферы для ПЦР, dNTP (дезоксинуклеотидтрифосфаты), полимераза, ионы, такие как двухвалентные катионы или одновалентные катионы, растворы для гибридизации и т.п. Диагностический набор для детекции белков PDE9A также может содержать вспомогательные ингредиенты, такие как вторичные аффинные лиганды, например, вторичные антитела, распознаваемые красители, а также любое другое подходящее соединение или жидкость, необходимые для реализации детекции белка на основе любого из аффинных лигандов или контрастных средств, как определено здесь выше, которые известны специалистам в данной области. Такие ингредиенты известны специалистам в данной области и могут варьировать, в зависимости от применяемого способа. Дополнительно, указанный набор может содержать листочек-вкладыш с инструкцией и/или может содержать информацию относительно интерпретации полученных результатов.

В другом аспекте настоящее изобретение относится к способу детекции, диагностики, мониторинга или прогнозирования рака предстательной железы, или прогрессии злокачественной опухоли предстательной железы у индивида, включающий в себя по меньшей мере стадию определения уровня PDE9A в образце. Используемый здесь термин "определения уровня PDE9A" относится к определению наличия или количества продуктов экспрессии PDE9A, например, транскрипта(транскриптов) PDE9A, и/или к определению наличия и/или количества белка(белков) PDE9A. Таким образом, используемый здесь термин "уровень PDE9A" означает наличие или количество продуктов экспрессии PDE9A, например, транскрипта(транскриптов) PDE9A, и/или определение наличия и/или количества белка (белков) PDE9A. Определение наличия и/или количества продуктов экспрессии PDE9A, например, транскрипта(транскриптов) PDE9A или белка (белков), может быть выполнено любым известным в данной области способом.

В предпочтительном воплощении настоящего изобретения определение наличия и/или количества продуктов экспрессии PDE9A, например, транскрипта(транскриптов) PDE9A и/или белка (белков) PDE9A, производят путем измерения уровней нуклеиновой кислоты или белка или путем определения биологической активности PDE9A. Таким образом, уровень (уровни) экспрессии PDE9A может быть определен посредством способа, включающего в себя детекцию мРНК, кодируемой геном PDE9A, детекцию белка PDE9A, кодируемого транскриптом PDE9A, и/или детекцию биологической активности белка PDE9A.

Например, измерение уровня нуклеиновой кислоты, экспрессирующей PDE9A, может быть осуществлено путем выделения молекул нуклеиновой кислоты (например, РНК или кДНК), полученных из образца, в агарозе или в полиакпиламидном геле, с последующей гибридизацией с олигонуклеотидными зондами, специфичными в отношении PDE9A, как определено здесь выше. Альтернативно, уровень экспрессии может быть определен путем мечения нуклеиновой кислоты, полученной из образца, с последующим выделением на секвенирующем геле. Образцы нуклеиновой кислоты могут быть помещены на геле, таким образом, чтобы нуклеиновая кислота пациента и контрольная или стандартная нуклеиновая кислота находились в соседних дорожках. Сравнение уровней экспрессии может быть осуществлено визуально или с помощью денситометра. Способы детекции мРНК или продуктов экспрессии известны специалистам в данной области. Обычно для таких целей может быть использован анализ назерн-блоттинга.

Альтернативно, уровень нуклеиновой кислоты, экспрессирующей PDE9A, может быть детектирован с использованием ДНК-матрицы или микрочипа. Обычно образцы нуклеиновых кислот субъектов, предназначенные для тестирования, проходят обработку и мечение, предпочтительно, флуоресцентной меткой. Впоследствии такие молекулы нуклеиновой кислоты могут быть использованы для гибридизации с иммобилизованными зафиксированными зондами, соответствующими маркерному гену PDE9A согласно настоящему изобретению, или известному биомаркеру, или маркерным генам злокачественных опухолей. Средства, подходящие для выполнения анализов на микрочипе, известны специалистам в данной области.

В стандартных устройствах, ДНК-матрица или микрочип содержит высокую плотность иммобилизованных зондов для детекции числа генов. Зонды на матрице комплементарны одной или нескольким частям последовательности маркерного гена или полной кодирующей области маркерного гена. В настоящем изобретении в качестве зонда для ДНК-матрицы может быть использован ассоциированный с PDE9A полинуклеотид любого типа, с тем лишь условием, чтобы указанный полинуклеотид давал возможность специфически отличать экспрессию PDE9A от экспрессии других генов. Обычно в качестве зондов используют кДНК, ПЦР-продукты и олигонуклеотиды. Предпочтительно, чтобы в качестве зонда мог быть использован зонд, включающий в себя специфические части вариантов сплайсинга 1-20 фосфодиэстеразы-9A. Кроме того, для определения экспрессии PDE9A может быть выполнено также определение экспрессии других генов, например, дополнительных генов биомаркеров или маркеров злокачественных опухолей.

Способ, основанный на детекции ДНК-матрицы или микрочипа, обычно включает в себя следующие стадии: (1) Выделение мРНК из образца и, необязательно, превращение мРНК в кДНК, а затем мечение указанной РНК или кДНК. Способы выделения РНК, превращения ее в кДНК и мечения нуклеиновых кислот описаны в руководствах по технологии микрочипов. (2) Гибридизацию нуклеиновых кислот, полученных на стадии 1, с зондами к маркерным генам. Нуклеиновые кислоты из образца можно метить красителем, таким как флуоресцентные красители Cy3 (красный) или Cy5 (голубой). Обычно контрольный образец метят другим красителем. (3) Детекцию гибридизации нуклеиновых кислот из образца с зондами и определение, хотя бы качественное, а чаще количественное, количества мРНК, кодирующей PDE9A, в образце и/или дополнительных исследуемых маркерных генов. Разница в уровнях экспрессии между образцом и контролем может быть оценена на основе различий в интенсивности сигналов. Последние могут быть измерены и подвергнуты анализу с помощью соответствующего программного обеспечения, такого как программное обеспечение, например, предлагаемое компанией Affymetrix, но им не ограничиваясь.

Нет ограничения в отношении количества проб, соответствующих используемым маркерным генам, которые наносятся на ДНК-матрицу. Маркерный ген может быть представлен также двумя или более зондами, гибридизующимися с разными частями гена. Зонды создаются отдельно для каждого маркерного гена. Такой зонд обычно является олигонуклеотидом, содержащим 5-50 нуклеотидных остатков. Более длинные ДНК могут быть синтезированы путем ПЦР или же химическим путем. Способы синтеза таких олигонуклеотидов и нанесения их на субстрат хорошо известны в области технологий микрочипов. Гены, отличные от маркерных генов, также могут быть нанесены на ДНК-матрицу. Например, зонд, полученный для гена, уровень экспрессии которого изменен незначительно, может быть нанесен на ДНК-матрицу для нормирования результатов анализа или для сравнения результатов анализа множества матриц или разных анализов.

Альтернативно, уровень нуклеиновой кислоты, экспрессирующей PDE9A, может быть детектирован путем количественной ОТ-ПЦР, предпочтительно, путем ПЦР в режиме реального времени с последующей обратной транскрипцией мРНК-транскрипта PDE9A. Обычно, в качестве первой стадии, транскрипт подвергают обратной транскрипции в молекулу кДНК, в соответствии с любым подходящим способом, известным специалистам в данной области. Подход, связанный с количественной ПЦР или с ПЦР в режиме реального времени, может затем быть выполнен на основе первой цепи ДНК, полученной, как описано выше.

Предпочтительно, чтобы зонды Taqman или зонды «молекулярный маяк» в качестве основных зондов указанного типа на основе FRET-технологии могли быть использованы для детекции методом количественной ПЦР. В обоих случаях такие зонды, предпочтительно, PDE9A-зонды, как определено здесь выше, служат в качестве внутренних зондов, которые используются в сочетании с обратными праймерами, которые фланкируют область представляющей интерес мишени, предпочтительно, олигонуклеотидов PDE9A, как было определено выше. При амплификации сегмента-мишени такой зонд может селективно связываться с продуктами на идентифицируемой последовательности между праймерными сайтами, вызывая таким образом усиление FRET-сигнала по сравнению с частотой мишени.

Предпочтительно, чтобы зонд Taqman, используемый в методе количественной ПЦР, согласно настоящему изобретению, мог содержать, как было определено выше, олигонуклеотид PDE9A длиной приблизительно в 22-30 оснований, который мечен по обоим концам FRET-парой. Обычно на 5'-конце будет находиться флюорофор с более короткой длиной волны, такой как флуоресцеин (например, FAM), на 3'-конец обычно метят гасителем флуоресценции с большей длиной волны (например, TAMRA) или нефлуоресцентным соединением-гасителем (например, гаситель Black Hole Quencher). Предпочтительно, чтобы зонды, используемые для количественной ПЦР, в частности, PDE9A-зонды, как определено здесь выше, не содержали на своем 5'-конце гуанин (G), расположенный рядом с репортерным красителем, с тем, чтобы избежать тушения репортерной флуоресценции после деградации зонда.

При применении зонда «молекулярный маяк» для количественной ПЦР согласно настоящему изобретению предпочтительно используют FRET-взаимодействия для детекции и количественного подсчета ПЦР-продукта, при этом каждый зонд имеет флуоресцентно меченный 5'-конец и 3'-конец, меченный гасителем флуоресценции. Структура зонда в такой конфигурации в виде шпильки или в виде структуры типа «стебель-петля» предпочтительно содержит «стебель» с двумя короткими связывающимися друг с другом концами и с петлей с длинной внутренней областью, специфичной а отношении мишени, приблизительно в 20-30 оснований.

Альтернативные механизмы детекции, которые также могут быть использованы в контексте настоящего изобретения, направлены на зонд, построенный таким образом, что в нем имеется только структура петли и отсутствует короткая комплементарная область стебля. Альтернативный подход на основе FRET для количественной ПЦР, который также может быть использован в контексте настоящего изобретения, основан на использовании двух гибридизующихся зондов, которые связываются с соседними участками на мишени, при этом первый зонд имеет донорную флуоресцентную метку на 3'-конце, а второй зонд имеет акцепторную флуоресцентную метку на 5'-конце.

Измерение белковых уровней белка PDE9A или любых полученных из него фрагментов, гомологов или производных, может быть выполнено с использованием любой подходящей технологии детекции, известной в данной области. Предпочтительно, чтобы белковый уровень PDE9A и его производных мог быть определен иммунологически, например, с применением антитела, специфичного в отношении белка PDE9A, предпочтительно, антитела, которое определено здесь выше. Альтернативно, могут быть использованы варианты или фрагменты антитела, как определено здесь выше. В настоящем изобретении предусмотрено также применение пептидных аффинных лигандов наподобие аптамеров, специфичных, как определено здесь выше, в отношении белка PDE9A.

Определение белковых уровней белка PDE9A может быть выполнено, например, путем выделения белков из образца на полиакриламидном геле, с последующей идентификацией белка PDE9A с использованием специфически связывающихся антител в анализе вестерн-блоттинга. Альтернативно, белки могут быть выделены с использованием систем двумерного гель-электрофореза. Двумерный гель-электрофорез хорошо известен в данной области и обычно включает в себя изоэлектрическое фокусирование в направлении одной оси, с последующим ДСН-ПААГ-электрофорезом в направлении другой оси. Анализ двумерных ДСН-ПААГ-гелей может быть предпринят путем определения интенсивности белковых пятен на геле, или же он может быть предпринят путем иммунной детекции. В других воплощениях, белковые образцы подвергают анализу методом масс-спектроскопии.

В контексте настоящего изобретения, PDE9A-специфические антитела могут быть помещены на подложку и иммобилизованы. Белки, полученные из образцов или тканей, которые должны быть подвергнуты анализу, можно затем смешать с антителами. После этого можно осуществить реакцию детекции, например, с помощью второго аффинного лиганда, как определено здесь выше, предпочтительно, с помощью специфического антитела.

Иммунологические тесты, которые могут быть использованы в контексте настоящего изобретения, в частности, для диагностических целей согласно изобретению, включают в себя, например, системы конкурентного и неконкурентного анализа с использованием технологий, таких как вестерн-блоттинг, радиоиммуноанализ, такой как RIA (радиоконкурентный анализ), ELISA (твердофазный иммуноферментный анализ), "сэндвич"-иммуноанализы, анализы иммунопреципитации, реакции преципитации, реакции диффузной преципитации в геле, иммунодиффузионные анализы, анализы агглютинации, например, латекс-агглютинация, анализы фиксации комплемента, иммунорадиометрические анализы, флуоресцентные иммуноанализы, например, FIA (сцепленный с флуоресценцией иммуноанализ), хемилюминесцентные иммуноанализы, электрохемилюминесцентный иммуноанализ (ECLIA) и иммуноанализы с использованием белка A. Такие анализы являются рутинными и хорошо известны специалистам в данной области.

Кроме того, аффинность связывания антитела с антигеном и скорость диссоциации взаимодействия антитела с антигеном может быть определена путем анализов конкурентного связывания. Одним из примеров анализа конкурентного связывания является радиоиммуноанализ, включающий в себя инкубацию меченого антигена (например, 3H или 125I) с соответствующим антителом в присутствии возрастающих количеств немеченого антигена, и детекцию указанного антитела, связанного с меченым антигеном. Аффинность представляющего интерес антитела в отношении конкретного антигена и скорости диссоциации могут быть определены из данных, полученных путем любого подходящего анализа, например, путем распределения Скэтчарда. Конкуренция со вторым антителом может быть также определена с помощью радиоиммуноанализов. В этом случае антиген можно инкубировать с соответствующим антителом, конъюгированным с меченым соединением (например, 3H или 125I), в присутствии возрастающих количеств немеченого вторичного антитела.

Кроме того, предпочтительно, чтобы аптамеры, специфичные в отношении белка PDE9A, как было определено выше, могли быть использованы в способе детекции белков PDE9A. Такие аптамеры предпочтительно могут быть помечены, с тем, чтобы можно было осуществлять детекцию лиганд-белкового взаимодействия.

Определение биологической активности PDE9A может быть осуществлено с использованием молекулярных или ферментативных анализов, специфичных в отношении соответствующей функции или функций PDE9A. Предпочтительно, чтобы система считывания была основана на превращении цГМФ под действием фосфодиэстеразы. Подходящие для этого технологии должны быть известны специалистам в данной области. В дальнейшем предпочтительном воплощении анализ определения биологической активности PDE9A может быть осуществлен в сочетании с ингибированием активности других изоформ PDE9 и/или других фосфодиэстераз, предпочтительно, других фосфодиэстераз, способных к осуществлению превращения цГМФ. Такое ингибирование активности может быть осуществлено любыми подходящими способами, известными специалистам в данной области, предпочтительно, путем применения подходящих антисмысловых нуклеотидов, молекул ки-РНК или микро-РНК, более предпочтительно, путем специфической гибридизации антисмысловых нуклеотидов, специфических молекул ки-РНК или микро-РНК, а также молекул наподобие BAY 73-6691, запринаста, SCH51866, силденафила и варденафила.

В другом предпочтительном воплощении биологическая активность PDE9A может быть тестирована с помощью специфическиъх ингибиторов DE9A. Применение таких ингибиторов можно, например, сочетать с системой считывания на основе превращения субстрата цГМФ. Типичные пригодные для применения ингибиторы PDE9A включают в себя антисмысловые молекулы, молекулы ки-РНК или молекулы микро-РНК.

Уровень PDE9A можно также детектировать способами, включающими в себя гистологические или клеточно-биологические технологии. Обычно могут быть использованы визуальные технологии, такие как световая микроскопия или иммунофлуоресцентная микроскопия, также как и проточная цитометрия или люминометрия. Наличие белка PDE9A в клетке может, например, детектироваться или определяться путем удаления подвергаемых тестированию клеток из образцов, как определено здесь выше. В указанных способах могут быть использованы также срезы тканей или биопсийные образцы. В дальнейшем могут быть добавлены также лиганды, аффинные в отношении PDE9A, предпочтительно, антитела или аптамеры. Обычно такие аффинные лиганды метят, предпочтительно, флуоресцентными метками, как определено здесь выше. Такая процедура позволяет детектировать PDE9A, производить ее количественное определение, а кроме того, позволяет определять распределение и относительный уровень ее экспрессии.

Такие процедуры включают в себя применение способов визуализации. Подходящие способы визуализации известны специалистам в данной области. Обычные подходящие для применения способы включают в себя флуориметрическую, люминометрическую и/или ферментативную технологии. Обычно детекцию и/или количественное определение флуоресценции производят путем экспонирования флуоресцентных меток на свету с определенной длиной волны, а затем определения и/или количественной оценки испускаемого света со специфической длиной волны. Присутствие люминесцентно-меченого аффинного лиганда можно детектировать и/или количественно оценить по люминесценции, развиваемой в процессе химической реакции. Детекция ферментативной реакции осуществляется благодаря изменению цвета в образце в результате химической реакции.

В дальнейшем, предпочтительном, воплощении уровень PDE9A может быть определен с помощью подходящих технологий молекулярной визуализации, например, магнитно-резонансной томографии (MRI) и/или многофотонной ионизационной времяпролетной масс-спектроскопии (MPI), и/или с применением подходящих контрастных средств, например, контрастных средств, определяемых выше.

В дальнейшем, предпочтительном, воплощении способ детекции, диагностики, мониторинга или прогнозирования злокачественной опухоли рака предстательной железы, или же прогрессирования злокачественной опухоли предстательной железы согласно настоящему изобретению включает в себя дополнительную стадию сравнения измеряемой нуклеиновой кислоты или белковых уровней, или измеряемой биологической активности с контрольным уровнем. Используемый здесь термин "контрольный уровень" относится к экспрессии маркера PDE9A или других подходящих маркеров в контроле злокачественной опухоли или в незлокачественном контроле, как определено здесь выше. Статус, природа, количество и состояние контрольного уровня может быть откорректировано в соответствии с потребностями. Предпочтительно, чтобы мог быть использован незлокачественный контрольный уровень. Используемый здесь термин "сравнение" относится к любому подходящему способу определения, расчета, оценки или обработки данных.

Еще в одном из вариантов, в качестве дальнейшей, дополнительной, стадии принятие решения о наличии или стадии рака предстательной железы или прогрессии злокачественной опухоли предстательной железы может быть основано на результатах стадии сравнения. Злокачественная опухоль предстательной железы может быть диагностирована или прогнозирована, или же прогрессия злокачественной опухоли предстательной железы может быть диагностирована или прогнозирована в указанном способе, в соответствии с надлежащими приведенными здесь выше определениями, в контексте PDE9A в качестве маркера рака, или злокачественной опухоли, предстательной железы.

В другом воплощении настоящее изобретение относится к способу детекции, диагностики, мониторинга или прогнозирования злокачественной опухоли рака предстательной железы, или же прогрессирования злокачественной опухоли предстательной железы, включающему в себя по меньшей мере следующие стадии:

(a) тестирование по меньшей мере в одном образце, полученном из организма по меньшей мере одного индивида, который предположительно страдает от рака предстательной железы, экспрессии продукта экспрессии PDE9A или белка PDE9A;

(b) тестирование по меньшей мере в одном контрольном образце, полученном из организма по меньшей мере одного индивида, который не страдает от рака, экспрессии продукта экспрессии PDE9A или белка PDE9A;

(c) определение различия в экспрессии на стадиях (a) и (b); и

(d) принятие решения относительно наличия или стадии злокачественной опухоли предстательной железы или прогрессии злокачественной опухоли предстательной железы на основе результатов, полученных на стадии (c).

В одном из воплощений, стадии a), b), c) и/или d) указанного способа диагностики могут быть предприняты вне организма человека или животного, например, в образцах, полученных из организма пациента или индивида.

В другом аспекте настоящее изобретение относится к способу диагностики, мониторинга или прогнозирования гормон-резистентного рака предстательной железы или же прогрессии злокачественной опухоли предстательной железы в направлении гормон-резистентной злокачественной опухоли предстательной железы, где указанный способ дает возможность отличить гормон-резистентный рак предстательной железы от гормон-чувствительного рака предстательной железы и включает в себя следующие стадии:

(a) определение уровня PDE9A в образце;

(b) определение уровня экспрессии референсного гена в образце;

(c) нормирование измеренного уровня экспрессии PDE9A по экспрессии референсного гена; и

(d) сравнение нормализованного уровня экспрессии с предопределенным граничным значением, выбранным таким образом, чтобы исключался гормон-чувствительный рак предстательной железы, причем нормализованный уровень экспрессии, который ниже граничного значения, является показателем гормон-резистентного рака предстательной железы, при этом указанное граничное значение приблизительно составляет от 2 до 15, предпочтительно примерно 5.

Уровень PDE9A может быть определен по нуклеиновой кислоте, белку или по уровню активности, как описано здесь выше. Предпочтительным является определение количества транскрипта(транскриптов) и/или белка PDE9A. Кроме того, может быть определен уровень референсного гена в образце. Используемый здесь термин "референсный ген" относится к любому подходящему гену, например, к любому постоянно экспрессируемому и непрерывно детектируемому гену, продукту гена, белку или варианту белка в любом выбранном организме. Указанный термин включает в себя также такие продукты гена как экспрессируемые белки, пептиды, полипептиды, а также их модифицированные варианты. Следовательно, данное изобретение включает в себя также характеристические белки, полученные на основе референсного гена. Включенными являются также разновидности транскриптов, полученных с указанных референсных генов, а также их модификации или связанные с ними вторичные параметры. Альтернативно или дополнительно, другие характеристические параметры также могут быть использованы для характеристических целей, например, концентрации метаболитов, размеры клеток и т.п.

Экспрессия может предпочтительно быть осуществлена в одном и том же образце, то есть уровень PDE9A и референсного гена может быть определен в одном и том же образце. Если тестирование осуществляют в одном и том же образце, может быть предпринят, как здесь описано, подход однократной детекции или многократной детекции. Предпочтительно, чтобы в случае многократной детекции были использованы олигонуклеотиды и зонды, имеющие последовательности SEQ ID NO: 7, 8 и 9 или последовательности SEQ ID NO: 45, 46 и 47. Для осуществления многократной детекции концентрация праймеров и/или олигонуклеотидов зонда может быть модифицирована. Кроме того, модифицирована может быть также концентрация и наличие дополнительных ингредиентов, таких как буферы, ионы и т.п., например, они могут быть повышены или понижены по сравнению с рекомендациями производителей.

В специфическом воплощении настоящего изобретения может быть определена экспрессия более чем одного референсного гена или непрерывно экспрессируемого гена. Например, может быть определена экспрессия 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 30 или более референсных генов. Результаты таких измерений могут быть либо подсчитаны отдельно, либо они могут быть объединены, в порядке получения среднего показателя экспрессии. Кроме того, характер экспрессии референсного гена может быть определен и/или использован в качестве основы для дальнейших шагов. Такой характер может быть основан на известном поведении экспрессии генов при определенной злокачественной опухоли, в частности, при определенных состояниях или стадиях рака предстательной железы.

Кроме того, результаты экспрессии можно сравнивать с уже известными результатами из ссылочных случаев или из баз данных. Такое сравнение может дополнительно включать в себя процедуру нормализации, в порядке улучшения статистической значимости результатов.

В альтернативном воплощении настоящего изобретения, вместо определения уровня экспрессии референсного гена в образце, может быть определена экспрессия дополнительного маркера злокачественной опухоли или непостоянно экспрессируемого гена. Например, может быть определена экспрессия гена, о котором известно, что он угнетен в процессе гормон-резистентной злокачественной опухоли предстательной железы, или о котором известно, что он усилен в процессе гормон-чувствительной злокачественной опухоли предстательной железы.

В дальнейшем воплощении, могут быть осуществлены также оба определения экспрессии, то есть определение экспрессии референсного гена и дополнительного гена злокачественной опухоли или биомаркерного гена.

Результаты экспрессии могут быть нормализованы в соответствии с любым подходящим способом, известным специалистам в данной области, например, в соответствии со статистическими способами нормализации, такими как стандартная оценка, T-тест Стьюдента, стьюдентизированный остаточный тест, стандартизованный моментальный тест или показатель коэффициента вариации. Обычно такие тесты или соответствующие формулы, которые должны быть известны специалистам в данной области, будут использованы для стандартизации данных по экспрессии, чтобы определить различия между реальными вариациями в уровнях экспрессии генов и вариациями, обусловленными процессами измерения.

На основе результатов экспрессии, полученных на стадиях (a) и (b), и/или нормализованных результатов, полученных на стадии (c), может быть осуществлено сравнение с граничным значением экспрессии PDE9A. Граничное значение, ниже которого уровень экспрессии PDE9A свидетельствует о наличии гормон-резистентного рака предстательной железы, исключая, таким образом, гормон-чувствительный рак или формы опухоли предстательной железы, приблизительно составляет от 2 до 15, от 2 до 14,5, от 2 до 14, от 2 до 13,5, от 2 до 13, от 2 до 12,5, от 2 до 12, от 2 до 11,5, от 2 до 11, от 2 до 10,5, от 2 до 10, от 2 до 9,5, от 2 до 9, от 2 до 8,5, от 2 до 8, от 2 до 7,5, от 2 до 7, от 2 до 6,5, от 2 до 6, от 2 до 5,5, от 2 до 5, или от 2,5 до 15, от 3 до 15, от 3,5 до 15, от 4 до 15, от 4,5 до 15, от 5 до 15, от 5 до 15. Более предпочтительно, чтобы граничное значение составляло около 5, например, 4,9, 4,8, 4,7, 4,6, 4,5, 4,4, 4,3, 4,2, 4,1, или 5,9, 5,8, 5,7, 5,6, 5,5, 5,4, 5,3, 5,2, 5,1.

В особо предпочтительном воплощении, указанное граничное значение следует использовать в отношении генов домашнего хозяйства в качестве референсного гена. Даже еще более предпочтительно, чтобы указанное граничное значение было использовано в отношении генов GAPDH и/или PBGD в качестве референсного гена.

В другом аспекте настоящее изобретение относится к способу диагностики, мониторинга или прогнозирования злокачественной гормон-чувствительной опухоли предстательной железы, или же опухоли, прогрессирующей в направлении злокачественной гормон-чувствительной опухоли предстательной железы, при этом указанный способ позволяет отличить незлокачественную стадию, предпочтительно здоровое состояние, от злокачественной гормон-чувствительной опухоли предстательной железы, и включает в себя стадии

(a) определения уровня PDE9A,

(b) определения уровня экспрессии референсного гена в образце;

(c) нормирование измеренного уровня экспрессии PDE9A относительно экспрессии референсного ссылочного гена;

и сравнение нормализованного уровня экспрессии предопределенным граничным значением, выбранным в целях исключения доброкачественной опухоли предстательной железы, при этом нормализованный уровень экспрессии, который выше граничного значения, является показателем злокачественной гормон-чувствительной опухоли предстательной железы, причем указанное граничное значение составляет от 1,5 до 3, предпочтительно около 2. Указанный способ может быть осуществлен так, как описано здесь выше. В контексте указанного способа, использование PDE4D5 в качестве ссылочного гена является предпочтительным. Более того, особенно предпочтительным являются реакции многократной детекции с соответствующими олигонуклеотидами и зондами, имеющими последовательности SEQ ID NO: 45, 46 и 47 (PDE9A), вместе с олигонуклеотидами и зондами, имеющими последовательности SEQ ID NO: 48, 49 и 50 (PDE4D5). Для осуществления многократной детекции концентрацию праймеров и/или олигонуклеотидов зонда можно модифицировать. Кроме того, может быть модифицирована также и концентрация и наличие дополнительных ингредиентов, таких как буферы, ионы и т.п., например, они могут быть повышены или понижены по сравнению с рекомендациями производителей.

На основе результатов экспрессии, полученных на стадиях (a) и (b), и/или нормализованных результатов, полученных на стадии (c), может быть осуществлено сравнение с граничным значением экспрессии PDE9A. Граничное значение, ниже которого уровень экспрессии PDE9A свидетельствует о здоровом состоянии, то есть об отсутствии злокачественной опухоли предстательной железы, исключая, таким образом, наличие гормон-чувствительного рака или форм опухоли предстательной железы, приблизительно составляет от 1,5 до 3, от 1,75 до 3, от 2 до 3, от 2,25 до 3, от 2,5 до 3, от 2,75 до 3. Более предпочтительно, чтобы граничное значение составляло около 2, например, 1,9, 1,8, 1,7, 1,6, 1,5, 2,9, 2,8, 2,7, 2,6, 2,5, 2,4, 2,3, 2,2, 2,1.

Используемый здесь термин "образец" может быть тем же самым образцом или образцом, сходным с тем, который используется для детекции уровня гена PDE9A и референсного гена. Использование одного и того же образца является предпочтительным.

Помимо определения референсного гена в одном и том же образце, следует изучить также и контрольный образец. В данном контексте, указанный анализ включает в себя детекцию экспрессии PDE9A в контрольном образце. Контролем предпочтительно является здоровая ткань или же ткань, полученная из доброкачественной опухоли предстательной железы.

Граничное значение может представлять собой граничное значение PDE9A в образцах крови, например, в образцах сыворотки или плазмы, образцах мочи или образцах осадка мочи, и т.п., как описано здесь ниже.

Если измеренный и/или нормализованный уровень экспрессии PDE9A выше указанного граничного значения, это может рассматриваться как указание на то, что индивид страдает от рака предстательной железы, в частности, от гормон-зависимой или гормон-независимой злокачественной опухоли предстательной железы.

В предпочтительном воплощении настоящего изобретения, граничным значением является граничное значение для PDE9A в образцах крови, например, в образцах сыворотки или плазмы, образцах мочи или образцах осадка мочи. В особенно предпочтительном воплощении настоящего изобретения, граничным значением является граничное значение для белка или полипептида PDE9A, или любого их производного, как определено здесь выше, в образце мочи. В другом, особенно предпочтительном, воплощении настоящего изобретения, граничным значением является граничное значение для белка или полипептида PDE9A, или любого их производного, как определено здесь выше, в клетках, содержащихся в моче, или в экзосомах, секретируемых из клеток, содержащихся в моче. И даже в еще более предпочтительном воплощении настоящего изобретения, граничным значением является граничное значение для белка или полипептида PDE9A, или любого их производного, как определено здесь выше, в образце осадка мочи и в клетках, содержащихся в образце осадка мочи, или в экзосомах, секретируемых из клеток, содержащихся в образце осадка мочи.

Если измеренный и/или нормализованный уровень экспрессии PDE9A выше указанного граничного значения, это может рассматриваться как указание на то, что данный индивид не страдает от гормон-резистентного рака предстательной железы. Указанное значение может дополнительно указывать на то, что данный индивид страдает от злокачественной опухоли предстательной железы, отличной от гормон-резистентной злокачественной опухоли предстательной железы, в частности, от гормон-зависимой или гормон-чувствительной злокачественной опухоли предстательной железы.

В другом аспекте настоящее изобретение относится к способу сбора данных, включающему в себя по меньшей мере следующие стадии:

(a) тестирование индивида на предмет определения экспрессии; и

(b) сравнение экспрессии, определяемой на стадии (a), с контрольным уровнем.

Тестирование на предмет определения экспрессии PDE9A может быть осуществлено в соответствии со стадиями, которые определены здесь выше. Предпочтительно, чтобы тестирование могло быть осуществлено в виде измерения уровней нуклеиновой кислоты или белка PDE9A, или же путем определения биологической активности PDE9A, более предпочтительно, в соответствии с описанными здесь выше средствами для таких измерений. Тестирование может быть осуществлено у индивида, то есть in vivo, или же вне организма индивида, то есть ex vivo или in vitro. Используемый здесь термин "контрольный уровень", в контексте способа сбора данных, относится к экспрессии маркера PDE9A или других подходящих маркеров в злокачественном контроле или незлокачественном контроле, как определено здесь выше. Статус, природа, количество и состояние контрольного уровня может быть откорректировано в соответствии с необходимостью. Предпочтительно, чтобы мог быть использован незлокачественный контрольный уровень. Более предпочтительно, чтобы мог быть использован контрольный уровень, полученный на стадиях гормон-чувствительной злокачественной опухоли предстательной железы. Сравнение экспрессии с контрольным уровнем может быть осуществлено в соответствии с любым подходящим способом установления, расчета, оценки или обработки данных, и в частности, с целями, стоящими при детектировании различий между двумя этими наборами данных. Может быть осуществлена статистическая оценка значимости различий. Подходящие для этого статистические методы известны специалистам в данной области. Полученные данные и информация могут храниться, накапливаться или обрабатываться соответствующими информационными или компьютерными методами или средствами, известными специалистам в данной области, и/или могут быть представлены в соответствующем виде, позволяющем практикующим специалистам использовать такие данные для одной или нескольких последующих дедуктивных или заключительных стадий.

В другом аспекте настоящее изобретение относится к иммуноанализу для детекции, диагностики, мониторинга или прогнозирования рака предстательной железы или прогрессии злокачественной опухоли предстательной железы, включающему в себя по меньшей мере следующие стадии:

(a) тестирование образца, полученного из организма индивида, на предмет экспрессии PDE9A,

(b) тестирование контрольного образца на предмет экспрессии PDE9A,

(c) определение различия в экспрессии PDE9A на стадиях (a) и (b); и

(d) принятие решения о наличии или относительно стадии злокачественной опухоли предстательной железы или прогрессии злокачественной опухоли на основе результатов, полученных на стадии (c).

Указанный иммуноанализ предпочтительно основан на применении антитела, специфически связывающегося с PDE9A, например, одного или нескольких из указанных выше антител против PDE9A. Альтернативно, указанный иммуноанализ может быть осуществлен или сочетан с любым другим подходящим агентом. Например, такой анализ может быть объединен с детекцией нуклеиновых кислот или же со способами ферментативного тестирования, как определено в настоящем описании.

Еще в одном из аспектов настоящее изобретение относится к иммуноанализу, предназначенному для различения гормон-чувствительной и гормон-резистентной злокачественной опухоли предстательной железы, включающему в себя следующие стадии:

(a) определение уровня PDE9A в образце;

(b) определение уровня экспрессии референсного гена в образце;

(c) нормирование измеренного уровня экспрессии PDE9A относительно экспрессии референсного ссылочного гена; и

(d) сравнение нормализованного уровня экспрессии предопределенным граничным значением, выбранным в целях исключения гормон-чувствительной злокачественной опухоли предстательной железы, при этом нормализованный уровень экспрессии, который ниже граничного значения, является показателем злокачественной гормон-резистентной опухоли предстательной железы, причем указанное граничное значение составляет предпочтительно от 2 до 15. Предпочтительно граничное значение составляет около 5.

Уровень PDE9A может предпочтительно быть определен по уровню белка или активности, как описано здесь выше. Предпочтительным является определение количества белка PDE9A с помощью специфических антител против PDE9A, например, одного или нескольких указанных выше антител против PDE9A. Альтернативно, указанный иммуноанализ может быть осуществлен или сочетан с любым другим подходящим агентом или может быть объединен с детекцией наличия или количества нуклеиновых кислот или же со способами ферментативного тестирования, как определено в настоящем описании.

Кроме того, как определено здесь выше, может быть определен уровень референсного гена в образце. Для детекции референсного гена может быть определено количество продукта экспрессии указанного гена (то есть белка), предпочтительно, с помощью одного или нескольких подходящих антител, известных специалистам в данной области. Альтернативно, определение референсного гена может быть осуществлено посредством любого другого подходящего агента или может быть объединено с детекцией наличия или количества нуклеиновых кислот или же со способами ферментативного тестирования, определяемыми в настоящем описании.

На основе результатов экспрессии, полученных на стадиях (a) и (b), и/или нормализованных результатов, полученных на стадии (c), может быть осуществлено сравнение с граничным значением экспрессии PDE9A. Граничное значение, ниже которого уровень экспрессии PDE9A свидетельствует о наличии гормон-резистентного рака предстательной железы, исключая, таким образом, гормон-чувствительный рак или формы опухоли, в указанном иммуноанализе приблизительно составляет от 2 до 15, от 2 до 14,5, от 2 до 14, от 2 до 13,5, от 2 до 13, от 2 до 12,5, от 2 до 12, от 2 до 11,5, от 2 до 11, от 2 до 10,5, от 2 до 10, от 2 до 9,5, от 2 до 9, от 2 до 8,5, от 2 до 8, от 2 до 7,5, от 2 до 7, от 2 до 6,5, от 2 до 6, от 2 до 5,5, от 2 до 5, или от 2,5 до 15, от 3 до 15, от 3,5 до 15, от 4 до 15, от 4,5 до 15, от 5 до 15, от 5 до 15. Более предпочтительно, чтобы граничное значение составляло около 5, например, 4,9, 4,8, 4,7, 4,6, 4,5, 4,4, 4,3, 4,2, 4,1, или 5,9, 5,8, 5,7, 5,6, 5,5, 5,4, 5,3, 5,2, 5,1.

Указанное граничное значение может быть граничным значением для PDE9A в образцах крови, например, в образцах сыворотки или плазмы, образцах мочи или в образцах осадка мочи, и т.п., как описано здесь выше.

Если измеряемый и/или нормализованный уровень экспрессии PDE9A выше указанного граничного значения, это может рассматриваться как указание на то, что данный индивид не страдает от гормон-резистентного рака предстательной железы. Указанное значение может дополнительно свидетельствовать о том, что данный индивид страдает злокачественной опухолью предстательной железы, отличающейся от гормон-резистентного рака предстательной железы, в частности, он может страдать гормон-зависимым раком предстательной железы или гормон-чувствительным раком предстательной железы.

В другом аспекте настоящее изобретение относится к иммуноанализу, позволяющему отличить незлокачественную стадию, предпочтительно, стадию здоровья, от злокачественной гормон-чувствительной опухоли предстательной железы, включающему в себя следующие стадии:

(a) определение уровня PDE9A;

(b) определение уровня экспрессии референсного гена в образце;

(c) нормирование измеренного уровня экспрессии PDE9A относительно экспрессии референсного ссылочного гена; и

сравнение нормализованного уровня экспрессии с предопределенным граничным значением, выбранным в целях исключения доброкачественной опухоли предстательной железы, при этом нормализованный уровень экспрессии, который выше граничного значения, является показателем злокачественной гормон-чувствительной опухоли предстательной железы, причем указанное граничное значение составляет предпочтительно от 1,5 до 3, предпочтительно, около 2. Уровень PDE9A предпочтительно может быть определен по количеству белка или уровню активности, как описано здесь выше. Предпочтительным является определение количества белка PDE9A с помощью специфических антител против PDE9A, например, одного или нескольких из указанных здесь выше антител против PDE9A. Альтернативно, такой иммуноанализ может быть осуществлен с любым другим подходящим агентом или же может быть объединен с определением других объектов. Например, указанный анализ может быть объединен с детекцией наличия или количества нуклеиновых кислот или же со способами ферментативного тестирования, как определено в настоящем описании.

Кроме того, как определено здесь выше, может быть определен уровень референсного гена в образце. Для детекции референсного гена может быть определено количество продукта экспрессии указанного гена (то есть белка), предпочтительно, с помощью одного или нескольких подходящих антител, известных специалистам в данной области. Альтернативно, определение референсного гена может быть осуществлено посредством любого другого подходящего агента или может быть объединено с детекцией наличия или количества нуклеиновых кислот или же со способами ферментативного тестирования, определяемыми в настоящем описании.

На основе результатов экспрессии, полученных на стадиях (a) и (b), и/или нормализованных результатов, полученных на стадии (c), может быть осуществлено сравнение с граничным значением экспрессии PDE9A. Граничное значение, ниже которого уровень экспрессии PDE9A свидетельствует о состоянии здоровья, то есть об отсутствии злокачественной опухоли предстательной железы, исключая, таким образом, гормон-чувствительный рак или формы опухоли предстательной железы, приблизительно составляет от 1,5 до 3, от 1,75 до 3, от 2 до 3, от 2,25 до 3, от 2,5 до 3, от 2,75 до 3. Более предпочтительно, чтобы граничное значение составляло около 2, например, 1,9, 1,8, 1,7, 1,6, 1,5, 2,9, 2,8, 2,7, 2,6, 2,5, 2,4, 2,3, 2,2 или 2,1.

Указанное граничное значение может быть граничным значением для PDE9A в образцах крови, например, в образцах сыворотки или плазмы, образцах мочи или в образцах осадка мочи, и т.п., как описано здесь выше.

Если измеряемый и/или нормализованный уровень экспрессии PDE9A выше указанного граничного значения, это может рассматриваться как указание на то, что данный индивид страдает от рака предстательной железы, в частности, от гормон-зависимой или гормон-чувствительной злокачественной опухоли предстательной железы.

В другом аспекте настоящее изобретение относится к способу идентификации индивида в отношении приемлемости терапии против злокачественной опухоли предстательной железы, включающему в себя следующие стадии:

(a) тестирование в образце, полученном из организма индивида, уровня экспрессии PDE9A;

(b) тестирование в указанном образце уровня экспрессии референсного гена и/или тестирование в контрольном образце уровня экспрессии PDE9A;

(c) классификацию уровней экспрессии со стадии (a) относительно уровней со стадии (b); и

(d) идентификацию индивида в отношении приемлемости назначения терапии против злокачественной опухоли предстательной железы, при этом образец, полученный из организма указанного индивида, классифицируется как таковой, имеющий измененный уровень экспрессии PDE9A.

Уровень PDE9A может быть определен, как было описано выше, по уровню нуклеиновой кислоты, белка или уровню активности. Предпочтительным является определение количества транскрипта (транскриптов) и/или белка. Кроме того, как описано здесь выше, может быть определен уровень референсного гена. Тестирование в отношении экспрессии референсного гена может быть осуществлено в том же самом образце, который был использован для определения PDE9A. Если тестирование осуществляют в одном и том же образце, может быть предпринят подход однократной детекции или многократной детекции. Предпочтительно, чтобы в случае многократной детекции могли быть использованы олигонуклеотиды и зонды, имеющие последовательности SEQ ID NO: 7, 8 и 9. Для осуществления многократной детекции концентрация праймеров и/или олигонуклеотидов зонда может быть модифицирована. Кроме того, модифицирована может быть также концентрация и наличие дополнительных ингредиентов, таких как буферы, ионы и т.п., например, они могут быть повышены или понижены по сравнению с рекомендациями производителей. Альтернативно, тестирование на предмет экспрессии референсного гена может быть осуществлено в другом образце, предпочтительно, в контрольном образце, как определено здесь выше. Предпочтительно, чтобы таким контрольным образцом мог быть контрольный образец, полученный из организма того же самого индивида, что и тестируемый образец, или чтобы контрольный образец был получен из другого источника или индивида. Далее, контрольный образец может быть либо образцом, полученным из той же самой ткани, предпочтительно, из ткани предстательной железы, или же может быть получен из другого типа ткани. Примерами предпочтительных альтернативных типов тканей являются ткань стромы предстательной железы, эпителиальная ткань мочевого пузыря и эпителиальная ткань уретры. Кроме того, анализ тестируемого образца на предмет экспрессии референсного гена и тестирование контрольного образца на предмет экспрессии PDE9A могут быть объединены.

В дальнейшем воплощении контрольный образец также может быть тестирован на предмет экспрессии референсного гена. В случае, когда более чем один образец тестируют на предмет экспрессии референсного гена, полученные результаты по экспрессии могут быть сравнены и/или усреднены, или нормализованы в соответствии с любым подходящим статистическим методом, известным специалистам в данной области.

Используемый здесь термин "классификация уровней экспрессии со стадии (a) относительно уровней со стадии (b)" означает, что сравнивают экспрессию PDE9A в тестируемом образце и экспрессию PDE9A в контрольном образце, например, после нормализации относительно соответствующих нормированных стандартов. В соответствии с исходом сравнения, тестируемый образец относят к образцам с уровнем экспрессии, сходным с экспрессией в контрольном образце, к образцам с повышенным уровнем экспрессии по сравнению с контрольным образцом или с пониженным уровнем экспрессии по сравнению с контрольным образцом. Указанный термин дополнительно означает, что экспрессию PDE9A в тестируемом образце и экспрессию референсного гена в том же самом тестируемом образце сравнивают, например, после нормализации относительно дополнительного гена в качестве нормированного стандарта. В соответствии с исходом сравнения, тестируемый образец относят к образцам с уровнем экспрессии, сходным с экспрессией референсного гена, к образцам с повышенным уровнем экспрессии по сравнению с референсным геном или с пониженным уровнем экспрессии по сравнению с референсным геном.

В соответствии с классификацией результатов экспрессии, индивида могут счесть подходящим для проведения терапии против злокачественной опухоли предстательной железы, когда уровни экспрессии PDE9A снижены. Используемый здесь термин "измененный" относится либо к пониженному, либо к повышенному уровню экспрессии PDE9A. Уровень экспрессии считается "пониженным", когда экспрессия гена PDE9A в тестируемом образце снижена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем на 50% по сравнению с уровнем экспрессии PDE9A в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с уровнем экспрессии PDE9A в контрольном образце; или когда экспрессия гена PDE9A снижена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или или более чем на 50% по сравнению с экспрессией референсного гена в контрольном образце, или снижена по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с экспрессией референсного гена. В специфическом воплощении, экспрессия референсного гена также может быть нормализована или приведена в соответствие с экспрессией дополнительных генов или маркеров, например, генов домашнего хозяйства. Сходным образом, уровень экспрессии PDE9A считается "повышенным", когда экспрессия гена PDE9A в тестируемом образце повышена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем на 50% по сравнению с уровнем экспрессии PDE9A в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с экспрессией PDE9A в контрольном образце; или когда экспрессия гена PDE9A повышена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем на 50% по сравнению с экспрессией референсного гена в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с экспрессией референсного гена.

В специфическом воплощении, экспрессия референсного гена также может быть нормализована или приведена в соответствие с экспрессией дополнительных генов или маркеров, например, генов домашнего хозяйства.

Еще в одном аспекте настоящее изобретение относится к иммуноанализу для стратификации индивида или когорты индивидов со злокачественной опухолью предстательной железы, включающему в себя следующие стадии:

(a) тестирование в образце, полученном из организма индивида, уровня экспрессии PDE9A;

(b) тестирование в указанном образце уровня экспрессии референсного гена и/или тестирование в контрольном образце уровня экспрессии PDE9A;

(c) определение различия в экспрессии со стадии (a) и в экспрессии со стадии (b); и

(d) стратификацию индивида или когорты индивидов для проведения терапии против злокачественной опухоли предстательной железы на основе результатов, полученных на стадии (с), при этом образец, полученный из организма указанного индивида, имеет измененный уровень экспрессии PDE9A.

Тестирование экспрессии PDE9A предпочтительно может быть осуществлено через определение количества белка PDE9A или определение уровня активности PDE9A, как описано здесь выше. Предпочтительным является определение количества белка PDE9A с помощью антител, специфичных в отношении PDE9A, например, одного или нескольких из указанных здесь антител против PDE9A. Альтернативно, указанный иммуноанализ может быть осуществлен с любым другим подходящим агентом, или же он может быть объединен с определением других показателей. Например, указанный анализ может быть объединен с детекцией наличия или количества нуклеиновых кислот или со способами тестирования ферментов, как описано здесь выше. Кроме того, может быть определен уровень референсного гена, как описано здесь выше. Тестирование экспрессии референсного гена может быть осуществлено в том же самом образце, который используется и для определения PDE9A. Если тестирование осуществляется в одном и том же образце, может быть предпринят, как здесь описано, подход однократной детекции или параллельной или многократной детекции. Предпочтительно, чтобы в случае параллельной или многократной детекции могли быть использованы по-разному меченные первичные и вторичные антитела.

Альтернативно, тестирование экспрессии референсного гена может быть осуществлено в другом образце, предпочтительно, в контрольном образце, как определено здесь выше. Предпочтительно, чтобы такой контрольный образец мог быть контрольным образцом из организма того же самого индивида, что и тестируемый образец, или чтобы контрольный образец был получен из другого источника или индивида. Кроме того, указанный контрольный образец может быть либо образцом, полученным из той же самой ткани, предпочтительно, ткани предстательной железы, либо образцом, полученным из другого типа ткани. Примерами предпочтительных альтернативных типов тканей являются стромальная ткань предстательной железы, эпителиальная ткань мочевого пузыря и эпителиальная ткань уретры.

Кроме того, анализ тестируемого образца на предмет экспрессии референсного гена можно объединить с тестированием контрольного образца на предмет экспрессии PDE9A. В дальнейшем воплощении контрольный образец также может быть тестирован на предмет экспрессии референсного гена. В случае тестирования более чем одного образца на предмет экспрессии референсного гена, результаты, полученные по экспрессии, могут быть сравнены и/или усреднены, или нормализованы, в соответствии с любым подходящим статистическим методом, известным специалистам в данной области.

Используемый здесь термин "определение разницы в экспрессии PDE9A со стадии (a) и экспрессии PDE9A и/или референсного гена со стадии (b)" означает, что проводится сравнение экспрессии PDE9A в тестируемом образце и экспрессии PDE9A в контрольном образце, например, после нормализации относительно соответствующих нормированных стандартов. В соответствии с исходом сравнения, тестируемый образец относят к образцам с уровнем экспрессии, сходным с экспрессией в контрольном образце, к образцам с повышенным уровнем экспрессии по сравнению с контрольным образцом или с пониженным уровнем экспрессии по сравнению с контрольным образцом. Указанный термин дополнительно означает, что альтернативно или дополнительно, экспрессию PDE9A в тестируемом образце и экспрессию референсного гена в том же самом тестируемом образце сравнивают, например, после нормализации относительно дополнительного гена в качестве нормированного стандарта. В соответствии с исходом сравнения, тестируемый образец относят к образцам с уровнем экспрессии, сходным с экспрессией референсного гена, или к образцам с отличающимся уровнем экспрессии. Указанная разница может выражаться либо в повышенной экспрессии по сравнению с референсного геном, либо в пониженной экспрессии по сравнению с референсным геном.

Используемый здесь термин "стратификация индивида или когорты индивидов для проведения терапии против рака предстательной железы" означает, что индивида идентифицируют как принадлежащего к группе сходных индивидов, для которых оптимальной формой терапии является лечение злокачественной опухоли предстательной железы, предпочтительно, лечение гормон-резистентной злокачественной опухоли предстательной железы, в соответствии с результатом испытательного теста по экспрессии, как описано здесь выше, в частности, в соответствии с обнаруженным различием в уровне экспрессии PDE9A и уровне экспрессии референсного гена или PDE9A в различных образцах. В соответствии с определением разницы в экспрессии, индивид может быть идентифицирован как принадлежащий к группе сходных индивидов, для которых оптимальной формой терапии является лечение злокачественной опухоли предстательной железы, когда уровни экспрессии PDE9A изменены, то есть понижены или повышены. Уровень экспрессии считается "пониженным", когда экспрессия гена PDE9A в тестируемом образце снижена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем на 50% по сравнению с уровнем экспрессии в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с уровнем экспрессии в контрольном образце; или когда экспрессия гена PDE9A в тестируемом образце снижена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем на 50% по сравнению с экспрессией референсного гена в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с экспрессией референсного гена. В специфическом воплощении экспрессия референсного гена также может быть нормализована или приведена в соответствие с экспрессией дополнительных генов или маркеров, например, генов домашнего хозяйства. Сходным образом, уровень экспрессии PDE9A считается "повышенным", когда экспрессия гена PDE9A в тестируемом образце повышена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем на 50% по сравнению с уровнем экспрессии PDE9A в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с экспрессией PDE9A в контрольном образце; или когда экспрессия гена PDE9A повышена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем на 50% по сравнению с экспрессией референсного гена в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с экспрессией референсного гена. В специфическом воплощении экспрессия референсного гена также может быть нормализована или приведена в соответствие с экспрессией дополнительных генов или маркеров, например, генов домашнего хозяйства.

Индивид, которого сочли подходящим для проведения терапии против рака предстательной железы или которого стратифицировали в группу лечения от рака предстательной железы, как описано здесь выше, может получить любое подходящее терапевтическое лечение, известное специалистам в данной области. Обычно индивид, которого сочли подходящим для проведения терапии против рака предстательной железы или которого стратифицировали в соответствующую лечебную группу в связи с пониженной экспрессией PDE9A, может считаться страдающим гормон-резистентной злокачественной опухолью предстательной железы или склонным к развитию гормон-резистентной злокачественной опухоли предстательной железы в будущем, например, в течение последующих 1-24 месяцев. Соответственным образом идентифицированный или стратифицированный индивид может быть подвергнут лечению с помощью фармацевтической композиции согласно настоящему изобретению, например, так, как описано ниже. В дальнейшем воплощении, соответственным образом идентифицированный индивид может быть подвергнут лечению с помощью фармацевтической композиции согласно настоящему изобретению в сочетании с дополнительной противораковой терапией. Термин "дополнительная противораковая терапия" относится к любым типам лечения злокачественных опухолей, известным специалистам в данной области. Предпочтительными являются формы терапии, известные для лечения гормон-резистентного рака предстательной железы. Указанный термин включает в себя, например, все подходящие формы химиотерапии, радиационной терапии, хирургии, терапии с использованием антител и т.п.

Альтернативно, соответственным образом идентифицированный или стратифицированный индивид может также быть подвергнут лечению с помощью только одного вида или нескольких видов противораковой терапии, таких как химиотерапия, радиационная терапия, хирургия, терапия с использованием антител и т.п. Предпочтительными являются формы терапии, обычно используемые для лечения злокачественной опухоли предстательной железы, более предпочтительно, виды противораковой терапии, используемые для лечения гормон-резистентной злокачественной опухоли предстательной железы.

В дальнейшем воплощении настоящего изобретения способ классификации на установление соответствия или иммуноанализ для стратификации, как описано здесь выше, может быть использован также для мониторинга лечения индивида, например, индивида, который классифицирован как страдающий гормон-резистентным раком предстательной железы. Процесс мониторинга может быть осуществлен в виде регистрации анализа в течение продолжительного периода, например, во время сеанса лечения или после его окончания, в течение 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 недель, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 месяцев, или 1, 2, 3 или более лет. Стадии такой регистрации могут быть осуществлены с соответствующими интервалами, например, каждую неделю, каждые 2 недели, каждые 3 недели, каждый месяц, каждые 2 месяца, каждые 3 месяца, каждые 6 месяцев, каждые 12 месяцев и т.д. В дальнейшем воплощении настоящего изобретения любая указанная выше схема лечения может быть подкорректирована, например, усилена или ослаблена, или же изменена любым подходящим образом, в соответствии с результатами процесса мониторинга.

Тестирование экспрессии PDE9A может быть осуществлено в соответствии с описанными здесь выше стадиями. Предпочтительно, чтобы тестирование могло быть осуществлено в результате измерения уровней белка PDE9A, более предпочтительно согласно описанным здесь выше вариантам таких измерений. В качестве контролей или контрольных образцов могут быть использованы указанные здесь выше контроли. В особо предпочтительном воплощении, стадии тестирования могут быть основаны на применении антитела, специфически связывающегося с PDE9A, например, коммерчески доступного анти-PDE9A-антитела, такого как H00005152-М01 или NBP1-00641. Злокачественная опухоль может быть диагностирована или прогнозирована, или же прогрессия злокачественной опухоли может быть диагностирована или прогнозирована на основании указанного иммуноанализа, или же индивид может быть идентифицирован как соответствующий диагнозу рака предстательной железы, или индивид или когорта индивидов может быть стратифицирована на основании иммуноанализа, согласно приведенным здесь выше соответствующим определениям, в контексте PDE9A в качестве маркера злокачественной опухоли. Соответственно, указанное тестирование или определение экспрессии PDE9A может быть осуществлено, или может быть дополнительно осуществлено, путем измерения уровней нуклеиновой кислоты или белка, или путем определения биологической активности PDE9A. Сходные измерения могут быть выполнены в отношении референсного гена.

В особенно предпочтительном воплощении настоящего изобретения референсным геном является ген домашнего хозяйства или другая фосфодиэстераза. В организме человека примеры "генов домашнего хозяйства" включают в себя, помимо прочих, β-актин, глицеринальдегид-3-фосфатдегидрогеназу (GAPDH), порфобилиногендезаминазу (PBGD) и рибосомный белок P1. Помимо указанных генов, в качестве генов домашнего хозяйства может быть использован любой другой подходящий ген, пока экспрессия или транскрипция указанного гена проявляется на стабильном, немодифицированном уровне, в частности, в процессе развития разных стадий злокачественной опухоли, более предпочтительно, в процессе развития разных стадий злокачественной опухоли предстательной железы, еще более предпочтительно, в процессе перехода гормон-чувствительной злокачественной опухоли предстательной железы в гормон-резистентные состояния злокачественной опухоли предстательной железы. Особенно предпочтительным является ген или транскрипт, или продукт экспрессии, или белок GAPDH. Следующим особо предпочтительным является ген или транскрипт, или продукт экспрессии, или белок PBGD. Данные по экспрессии гена домашнего хозяйства могут быть получены из одного или нескольких образцов, полученных из организма одного и того же индивида или нескольких индивидов, например, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 1000, 5000, 10000 или более. Данные по экспрессии могут быть получены также из баз данных или из коллекций данных, доступных специалистам в данной области.

Используемый здесь термин "другая фосфодиэстераза" относится к другим фосфодиэстеразам, которые не являются PDE9A. Для того, чтобы такие фосфодиэстеразы были подходящими в качестве референсных генов, они должны стабильно экспрессироваться и обеспечивать непрерывную выработку детектируемого продукта гена, продукта экспрессии, белка или белкового варианта в выбранном организме. Особенно предпочтительными являются фосфодиэстеразы семейства PDE4D, например, PDE4D1, PDE4D2, PDE4D3, PDE4D4, PDE4D5, PDE4D6, PDE4D8 и PDE4D9. Более предпочтительной является фосфодиэстераза PDE4D5.

Соответственно, нормализация и/или сравнение с GAPDH, PBGD и, в частности, с PDE4D5, предпочтительно может быть использована для описанных выше способов диагностики и иммуноанализа на основе граничного значения, способов идентификации или иммуноанализов для распознавания или стратификации индивидов. Соответствующие стадии определения могут осуществляться либо в отдельных реакциях, либо, что особенно предпочтительно, в многократных реакциях. Для осуществления многократной детекции может быть модифицирована концентрация олигонуклеотидов праймеров и/или зондов. Кроме того, концентрация и наличие дополнительных ингредиентов, таких как буферы, ионы и т.п., могут быть модифицированы, например, путем увеличения или уменьшения по сравнению с рекомендациями производителя.

В дальнейшем воплощении настоящего изобретения способ идентификации индивида в отношении применимости к нему лечения злокачественной опухоли предстательной железы на основе экспрессии PDE9A, как описано здесь выше, дополнительно может быть объединен с одним или несколькими способами идентификации на основе экспрессии одного или нескольких различных биомаркеров. Предпочтительным является определение уровня специфического антигена простаты (PSA). Таким образом, если обнаруживается, что уровень PSA составляет приблизительно от 2 до 10 нг/мл, например, приблизительно 2, 3, 4, 5, 6, 7, 8, 9 или 10 нг/мл, индивида можно считать страдающим злокачественной, гормон-чувствительной опухолью предстательной железы или имеющим риск развития злокачественной, гормон-чувствительной опухоли предстательной железы в ближайшем будущем, то есть в течение следующих 1, 2, 3, 4, 5, 6 месяцев. Если обнаруживается, что уровень PSA составляет около 10 нг/мл, например, 11, 12, 15, 20 и т.д., индивида можно считать страдающим злокачественной, гормон-резистентной опухолью предстательной железы или имеющим риск развития злокачественной, гормон-резистентной опухоли предстательной железы в ближайшем будущем.

В предпочтительном воплощении настоящего изобретения диагностика, детекция, мониторинг или прогнозирование, как было указано выше, осуществляются на образце, полученном из организма индивида. Используемый здесь термин "образец, полученный из организма индивида" относится к любому биологическому материалу, полученному из организма индивида соответствующими способами, известными специалистам в данной области. Образец, используемый в контексте настоящего изобретения, должен предпочтительно быть собран клинически приемлемым образом, более предпочтительно, таким образом, чтобы нуклеиновые кислоты (в частности, РНК) или белки оставались сохранными.

Биологические образцы могут включать в себя ткани и жидкости организма, такие как кровь, пот, мокрота или слюна, семенная жидкость и моча, а также испражнения или образцы стула. Кроме того, биологический образец может содержать клеточный экстракт или клеточную популяцию, включая эпителиальную клетку, предпочтительно, злокачественную эпителиальную клетку или эпителиальную клетку, полученную из ткани, которая считается пораженной злокачественной опухолью. Даже более предпочтительно, чтобы биологический образец мог содержать клеточную популяцию, полученную из железистой ткани, например, такой образец мог бы быть получен из предстательной железы индивида мужского пола. Кроме того, клетки, в случае необходимости, могут быть очищены из тканей и жидкостей организма, а затем использованы в качестве биологического образца.

Образцы, особенно после первоначальной обработки, могут быть объединены. Однако могут быть использованы также и необъединенные образцы. В специфическом воплощении настоящего изобретения содержание биологического образца может быть подвержено стадии обогащения. Например, образец может быть приведен в контакт с лигандами, специфичными в отношении клеточной мембраны или клеточных органелл определенного типа клеток, например, клеток предстательной железы, функционализированных, например, магнитными частицами. Материал, концентрированный магнитными частицами, может в дальнейшем быть использован на стадиях детекции и анализа, как было сказано здесь выше или будет описано ниже.

В специфическом воплощении настоящего изобретения могут быть взяты и/или использованы образцы, полученные в результате биопсии или резекций. Такие образцы могут включать в себя клетки или клеточные лизаты.

Кроме того, клетки, например опухолевые клетки, могут быть обогащены в результате фильтрации жидких образцов или образцов биологических жидкостей, например, крови, мочи, пота и т.д. Такие процессы фильтрации могут также быть объединены со стадиями обогащения на основе лиганд-специфических взаимодействий, как описано здесь выше.

В особенно предпочтительном воплощении настоящего изобретения образцом может быть образец ткани, образец мочи, образец осадка мочи, образец крови, образец слюны, образец семенной жидкости, образец, содержащий циркулирующие опухолевые клетки, или образец, содержащий экзосомы, секретируемые предстательной железой.

Еще в одном аспекте настоящее изобретение относится к стимулирующей фармацевтической композиции, содержащей по меньшей мере один элемент, выбранный из группы, состоящей из (a) соединения, напрямую стимулирующего или модулирующего активность PDE9A, предпочтительно, аллостерического агониста ферментативной активности PDE9A; (b) соединения, опосредованно стимулирующего или модулирующего активность PDE9A; (c) белка PDE9A или его биологически активного эквивалента; (d) нуклеиновой кислоты, кодирующей и экспрессирующей PDE9A; (e) ингибитора микро-РНК, специфичного в отношении молекул микро-РНК фосфодиэстеразы 9A; (f) деметилирующего агента; и (g) фактора, замещающего фосфодиэстеразу, предпочтительно, пептида, пептидомиметика, малой молекулы, антитела или аптамера.

Используемый здесь термин "соединение, напрямую стимулирующее или модулирующее активность PDE9A" относится к соединению, которое в результате прямого взаимодействия с PDE9A способно повышать активность PDE9A в отношении деградации цГМФ. Таким соединением может быть любое соединение, которое непосредственно взаимодействует с PDE9A и которое положительным образом влияет на каталитическую активность PDE9A. Таким соединением может предпочтительно быть аллостерический агонист каталитической активности PDE9A, например, гомотропный аллостерический модулятор. Предпочтительными аллостерическими агонистами фосфодиэстеразы-9A являются цГМФ или аналоги цГМФ. Другими непосредственно стимулирующими соединениями, предусмотренными настоящим изобретением, являются ионы, предпочтительно, биологически активные одно- и двухвалентные катионы, такие как Ca2+, Mg2+.

Используемый здесь термин "соединение, опосредованно стимулирующее или модулирующее активность PDE9A" относится к соединению, которое путем взаимодействия с соединением, напрямую взаимодействующим с PDE9A ("непрямой интерактор"), или через непрямой путь обмена, не участвующий во взаимодействии с PDE9A, способно повышать активность PDE9A в отношении деградации цГМФ. Таким соединением может быть любое соединение (любой прямой интерактор), которое непосредственно взаимодействует с интерактором, то есть с соединением, напрямую взаимодействующим с PDE9A. Таким соединением может быть любой прямой интерактор интерактора PDE9A. Эффект, передаваемый прямым интерактором интерактора PDE9A, может быть либо положительным, в случае, если интерактор PDE9A сам по себе оказывает положительное влияние на активность PDE9A, или отрицательным, в случае, если интерактор PDE9A оказывает отрицательное влияние на активность PDE9A. Обычно положительно действующие непрямые интеракторы могут стимулировать агонистический эффект прямых интеракторов, например, провоцировать повышение концентрации аллостерически действующих соединений, таких как цГМФ или его аналогов, путем ингибирования процессов деградации цГМФ, не обеспечиваемых фосфодиэстеразой-9A, путем повышения продукции цГМФ, и т.д.

Альтернативно, такие положительно действующие непрямые интеграторы могут вызывать модификацию поведения связывания напрямую связывающих белков, что приводит к повышению активности PDE9A. Обычно отрицательным образом действующие непрямые интеракторы могут оказывать ингибирующее воздействие на ингибиторы PDE9A. Примерами таких взаимодействий являются ферментативные активности, вызывающие деградацию ингибиторов PDE9A, или белки, способные к связыванию или гашению ингибиторов PDE9A.

Альтернативно, такие взаимодействия могут ингибировать активности, приводящие к деградации PDE9A, например, протеиназные ингибиторы. Дальнейшие примеры и их воплощение должны быть известны специалистам в данной области.

Альтернативно, непрямая стимуляция активности PDE9A может быть передана соединениями, активирующими, защищающими или поддерживающими экспрессию эндогенный ген PDE9A. Примерами таких соединений являются специфические факторы транскрипции PDE9A, стабилизирующие специфическую мРНК фосфодиэстеразы-9A активности или факторы сплайсинга PDE9A. Дополнительные примеры и их осуществление должны быть известны специалистам в данной области.

"Белок PDE9A" может быть белком PDE9A, как определено здесь выше. В частности, это может быть белок, кодируемый вариантами сплайсинга 1-20 человеческой фосфодиэстеразы-9A, более предпочтительно, он может иметь аминокислотную последовательность, определяемую в базе данных Genbank под номером доступа No: NM_002606 (версия NM_002606.2, GI:48762716 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001567 (версия NM_001001567.1, GI:48762717 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001568 (версия NM_ 001001568.1, GI:48762719 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001569 (версия NM_001001569.1, GI:48762721 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001570 (версия NM_001001570.1, GI:48762723 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001571 (версия NM 001001571.1, GI:48762725 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001572 (версия NM_001001572.1, GI:48762727 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001573 (версия NM_001001573.1, GI:48762729 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001574 (версия NM_001001574.1, GI:48762731 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001575 (версия NM_001001575.1, GI:48762733 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001576 (версия NM_001001576.1, GI:48762735 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001577 (версия NM_001001577.1, GI:48762737 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001578 (версия NM_001001578.1, GI:48762739 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001579 (версия NM_001001579.1, GI:48762741 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001580 (версия NM_001001580.1, GI:48762743 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001581 (версия NM_001001581.1, GI:48762745 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001582 (версия NM_001001582.1, GI:48762747 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001583 (версия NM_001001583.1, GI:48762749 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001584 (версия NM_001001584.2, GI:48762751 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001585 (версия NM_001001585.1, GI:48762753 от 9 марта 2009), и даже более предпочтительно, он может иметь аминокислотную последовательность, приведенную в любой из последовательностей SEQ ID NO: 21-40.

"Белок PDE9A", используемый в данном контексте, содержит также аминокислотные последовательности, которые по меньшей мере на 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны любой из последовательностей, приведенных в SEQ ID NO: 21-40, и аминокислотные последовательности, кодируемые нуклеотидными последовательностями, которые по меньшей мере на 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны любой из последовательностей, приведенных в SEQ ID NO: 1-20. Гомологичные варианты фосфодиэстеразы-9A, в частности, те, которые указаны выше, предпочтительно, имеют функциональность PDE9A, то есть обладают способностью к деградации цГМФ. В дальнейшем воплощении настоящего изобретения гомологичные варианты фосфодиэстеразы-9A могут дополнительно иметь характер внутриклеточной или внутритканевой локализации, сходный или идентичный таковому фосфодиэстеразы-9A.

В другом предпочтительном воплощении область или гомология между гомологичными вариантами фосфодиэстеразы-9A и фосфодиэстеразой-9A могут быть сосредоточены в C-концевой части данного белка. Например, гомологичные варианты могут содержать N-концевой домен, присутствующий в PDE9A, и остальную часть данного белка, имеющую степень гомологии по отношению к PDE9A, которая указана здесь выше. N-концевая часть гомологичных вариантов может содержать аминокислоты 1-120, 1-110, 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20 или 1-10, полученные из PDE9A.

Используемый здесь термин "биологически активный эквивалент PDE9A" относится к белку PDE9A, который способен выполнять все или основную часть функций PDE9A. Предпочтительно, чтобы он относился к белкам, способным к деградации цГМФ. В дальнейшем воплощении настоящего изобретения биологически активные эквиваленты PDE9A могут, дополнительно или альтернативно, иметь характер внутриклеточной или внутритканевой локализации, сходный или идентичный таковому фосфодиэстеразы-9A. Биологически активные эквиваленты PDE9A могут также содержать варианты PDE9A, как определено здесь выше. PDE9A или биологически активные эквиваленты PDE9A согласно настоящему изобретению могут быть получены рекомбинантным путем любым подходящим способом, известным специалистам в данной области. Таким образом, настоящее изобретение охватывает также способы получения PDE9A или биологически активных эквивалентов фосфодиэстеразы-9A.

Соответственно, настоящее изобретение распространяется также на векторы, содержащие полинуклеотиды, кодирующие PDE9A или биологически активные эквиваленты фосфодиэстеразы-9A, как определено здесь выше, хозяйские клетки и продуцирование PDE9A или биологически активных эквивалентов PDE9A с помощью рекомбинантных технологий.

Подходящими векторами могут быть, например, фаговые, плазмидные, вирусные или ретровирусные векторы. Ретровирусные векторы могут быть компетентными в отношении репликации или дефективными в отношении репликации. В последнем случае размножение вируса обычно происходит только в комплементарных хозяйских клетках. Полинуклеотиды, кодирующие PDE9A или биологически активные эквиваленты PDE9A, могут быть соединены с вектором или носителем, содержащим селективный маркер, свидетельствующий о размножении в хозяйской клетке. Соответствующая полинуклеотидная вставка может быть оперативно связана с подходящим промотором, таким как промотор PL фага лямбда, с промоторами lac, trp, phoA и tac E. coli, ранним и поздним промоторами SV40 и с промоторами ретровирусных LTR, или же с промотором PSA. Другие подходящие промоторы известны специалистам в данной области. Экспрессирующие конструкции могут дополнительно содержать сайты инициации транскрипции, терминации, а также, в транскрибируемой области, участок связывания рибосомы для трансляции. Кодирующая часть транскриптов, экспрессируемая данными конструкциями, предпочтительно будет включать в себя кодон инициации трансляции в начале и терминирующий кодон (UAA, UGA или UAG), соответственно, расположенный на конце транслируемого полипептида.

Полипептиды или белки могут быть гликозилированы или могут быть негликозилированы, или же они могут быть модифицированы каким-либо иным образом. Кроме того, полипептиды или белки могут также включать в себя модифицированный начальный метиониновый остаток, в некоторых случаях, вследствие процессов, опосредованных организмом хозяина. Кроме того, полипептид, белок или пептид может быть модифицирован путем ацетилирования, ПЭГилирования, гезилирования (hesylation), формилирования, фосфорилирования, амидирования, дериватизации с помощью известных защитных/блокирующих групп, путем специфического химического расщепления, протеолитического расщепления, соединения с клеточным лигандом или другим белком, или гапилирования (hapylation), то есть слияния с глицин-богатым гомо-аминокислотным полимером (HAP), и т.д. Такие модификации могут быть произведены с помощью подходящих технологий, известных специалистам в данной области. Кроме того, полипептид, белок или вариант может содержать одну или несколько неклассических аминокислот.

Кроме того, PDE9A или биологически активные эквиваленты фосфодиэстеразы-9A согласно изобретению могут быть синтезированы химическим путем с использованием технологий, известных в данной области, например, с помощью пептидного синтезатора.

"Нуклеиновая кислота, кодирующая и экспрессирующая PDE9A", содержащаяся в стимулирующей фармацевтической композиции, как определено здесь выше, относится к любому подходящему элементу-носителю, содержащему экспрессируемый ген PDE9A. Предпочтительно, чтобы такой элемент-носитель мог содержать последовательность, определяемую в базе данных Genbank под номером доступа No: NM_002606 (версия NM_002606.2, GI:48762716 от 9 марта 2009), в базе данных Genbank под номером доступа NM_001001567 (версия NM_001001567.1, GI:48762717 от 9 марта 2009), в базе данных Genbank под номером доступа NM_001001568 (версия NM_001001568.1, GI:48762719 от 9 марта 2009), в базе данных Genbank под номером доступа NM_001001569 (версия NM_001001569.1, GI:48762721 от 9 марта 2009), в базе данных Genbank под номером доступа NM_001001570 (версия NM_001001570.1, GI:48762723 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001571 (версия NM_001001571.1, GI:48762725 от 9 марта 2009), в базе данных Genbank под номером доступа NM_001001572 (версия NM_001001572.1, GI:48762727 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001573 (версия NM_001001573.1, GI:48762729 от 9 марта 2009), в базе данных Genbank под номером доступа NM_001001574 (версия NM_001001574.1, GI:48762731 от 9 марта 2009), в базе данных Genbank под номером доступа NM_001001575 (версия NM_001001575.1, GI:48762733 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001576 (версия NM_001001576.1, GI:48762735 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001577 (версия NM_001001577.1, GI:48762737 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001578 (версия NM_001001578.1, GI:48762739 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001579 (версия NM_001001579.1, GI:48762741 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001580 (версия NM_001001580.1, GI:48762743 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001581 (версия NM_1001581.1, GI:48762745 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001582 (версия NM_001001582.1, GI:48762747 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001583 (версия NM_001001583.1, GI:48762749 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_001001584 (версия NM_001001584.1, GI:48762751 от 9 марта 2009), в базе данных Genbank под номером доступа No: NM_00001585 (версия NM_001001585.1, GI:48762753 от 9 марта 2009), более предпочтительно, нуклеотидные последовательности, приведенные в последовательностях SEQ ID NO: 1-20. Такой элемент-носитель может также содержать нуклеотидные последовательности, имеющие высокую степень гомологии с PDE9A, например, последовательности нуклеиновых кислот, которые по меньшей мере на 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны любой из последовательностей, приведенных в SEQ ID NO: 1-20, или последовательности нуклеиновых кислот, кодирующие аминокислотные последовательности, которые по меньшей мере на 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны любой из последовательностей, приведенных в SEQ ID NO: 21-40. Альтернативно, указанный носитель может содержать геномную последовательность фосфодиэстеразы-9A, предпочтительно, последовательность, определяемую в банке данных Genbank под номером доступа No: AB017602 (версия AB017602.1, GI:6681700 от 24 марта 2009), которая соответствует последовательности SEQ ID NO: 44. Более предпочтительно, чтобы носитель мог содержать геномную последовательность PDE9A, как определено в SEQ ID NO: 44.

Кроме того, биологически активные эквиваленты фосфодиэстеразы-9A, как определено здесь выше, могут содержаться в носителе согласно изобретению.

Полинуклеотид, кодирующий PDE9A, предпочтительно может быть соединен с вектором, содержащим селективный маркер, свидетельствующий о размножении в клетке человека. В предпочтительном воплощении полинуклеотидная вставка может быть оперативно связана с промотором PSA.

В одном из воплощений настоящего изобретения нуклеиновые кислоты, кодирующие и экспрессирующие PDE9A, как определено здесь выше, могут быть обеспечены путем применения терапевтических средств живой природы. Используемый здесь термин "терапевтические средства живой природы" означает, что PDE9A или биологически активные эквиваленты фосфодиэстеразы-9A, как определено здесь выше, экспрессируются в любом подходящем живом носителе. Соответственно, настоящее изобретение относится к полинуклеотидам, которые являются подходящими для экспрессии в живой клетке. Настоящее изобретение относится также к векторам, содержащим такие полинуклеотиды, подходящим хозяйским клеткам и к получению полипептидов с использованием рекомбинантных технологий в указанных хозяйских клетках.

Термин "живой носитель" относится к любой подходящей живой хозяйской клетке или вирусу, известным специалистам в данной области. Репрезентативные примеры подходящих хозяев включают в себя, но не ограничены перечисленным, бактериальные клетки, такие как кишечная палочка или молочнокислая бактерия, грибковые клетки, такие как клетки дрожжей, простейших, клетки насекомых или животные клетки. Предпочтительно, чтобы указанный термин относился к аттенуированным бактериям, аттенуированным грибковым клеткам или аттенуированным клеткам простейших. Репрезентативные примеры подходящих вирусов включают в себя вирусы из группы аденовирусов, ретровирусов или лентивирусов, предпочтительно, аттенуированных вирусов из группы аденовирусов, ретровирусов или лентивирусов. В предпочтительном воплощении могут быть использованы пробиотиотические бактериальные клетки, в частности, пробиотиотические клетки кишечной палочки или молочнокислой бактерии. Более предпочтительно, клетки Escherichia coli Nissle 1973, и еще более предпочтительно, клетки Lactobacillus casei или Lactobacillus zeae 393.

"Микро-РНК-ингибитор, специфичный в отношении микро-РНК PDE9A", содержащийся в стимулирующей фармацевтической композиции, как определено здесь выше, относится к молекуле нуклеиновой кислоты, кодирующей последовательность нуклеиновой кислоты, комплементарную микро-РНК PDE9A или молекуле микро-РНК. Используемый здесь термин "комплементарность" относится к полной комплементарности между микро-РНК-ингибитором нуклеиновой кислоты (смысловая молекула) и микро-РНК (антисмысловая молекула) без какого бы то ни было несовпадения, а также ситуаций, при которых нуклеиновая кислота содержит какие бы то ни было несовпадения и/или добавки, пропуски нуклеотидов по сравнению с молекулой микро-РНК. В других воплощениях две указанные молекулы содержат одно или несколько несовпадений оснований или отличаются по общему числу нуклеотидов (в результате добавок или делеций). В дальнейших воплощениях "комплементарный" микро-РНК-ингибитор молекулы нуклеиновой кислоты содержит по меньшей мере десять последовательных нуклеотидов, имеющих идеальную комплементарность последовательности, содержащейся в молекуле микро-РНК.

Обычно молекулы микро-РНК-ингибиторы нуклеиновой кислоты представляют собой образующиеся в природе молекулы ДНК или РНК или молекулы синтетической нуклеиновой кислоты, содержащие в своей последовательности один или более модифицированных нуклеотидов, которые могут быть однотипными или могут относиться к одному или нескольким разным типам.

Настоящим изобретением предусмотрено, например, что такая молекула микро-РНК-ингибитора нуклеиновой кислоты содержит по меньшей мере один элемент рибонуклеотидного остова и по меньшей мере один элемент дезоксирибонуклеотидного остова. Кроме того, молекула микро-РНК-ингибитора нуклеиновой кислоты может содержать одну или несколько модификаций остова РНК в 2'-O-метильной группе или 2'-O-метоксиэтильной группе (также называемой "2'-O-метилированием"), которые препятствуют деградации под действием нуклеазы в культуральной среде, и, что важно, также препятствуют эндонуклеолитическому расщеплению под действием нуклеазы РНК-индуцированного комплекса сайленсинга, приводя к необратимому ингибированию микро-РНК. Другая возможная модификация, которая является функциональным эквивалентом 2'-O-метилированию, включает в себя замкнутые нуклеиновые кислоты (LNA, locked nucleic acids), представляющие собой аналоги нуклеиновой кислоты, содержащие один или несколько нуклеотидных мономеров LNA, как определено здесь выше.

Другой класс сайленсеров экспрессии микро-РНК, используемых в контексте настоящего изобретения, содержит химически сконструированные олигонуклеотиды, называемые "антагомирами", которые представляют собой одноцепочечные молекулы РНК, конъюгированные с холестерином. Такие молекулы могут содержать от 19 до 25 нуклеотидов. Предпочтительно, чтобы такие молекулы содержали 20, 21, 22, 23 или 24 нуклеотида. Более предпочтительно, чтобы указанные молекулы содержали 23 нуклеотида (дальнейшие детали можно почерпнуть из публикации Krutzfeldt et al, 2005, Nature, 438: 685-689).

В другом воплощении настоящего изобретения микро-РНК-ингибиторы, как определено здесь выше, могут быть обеспечены в виде экспрессирующих векторов для встраивания в ткань или клетки. Альтернативно, такие векторы могут также быть встроены в терапевтические средства живой природы, как определено здесь выше.

Обычно РНК могут продуцироваться из трансгенов, полученных в виде трансфицирующих или транзитных экспрессирующих векторов или носителей. Например, конкурирующие ингибиторы микро-РНК могут быть получены в виде транскриптов, экспрессируемых с сильных промоторов, содержащих более чем один, предпочтительно, множество, тандемных участков, связывающихся с представляющей интерес микро-РНК. "Микро-РНК-затравка", как описано у Ebert et al., 2007, Nat. Methods, 4: 721-726, является иллюстративным, неограничивающим примером такой технологии.

"Деметилирующий агент", содержащийся в стимулирующей фармацевтической композиции, как определено здесь выше, относится к агенту, способному к деметилированию хроматиновых структур, предпочтительно, промоторных областей, более предпочтительно, промотора PDE9A. Примерами деметилирующих агентов, которые могут быть использованы в контексте настоящего изобретения, являются 5-аза-2'-дезоксицитидин и 5-азацитидин, которые реактивируют гены, неуместным образом молчащие вследствие структурных изменений хроматина, которые участвуют в метилировании ДНК и которые могут обратить указанные изменения и, следовательно, восстановить принципиальные клеточные пути метаболизма. Обычно это приводит к реэкспрессии и возврату некоторых аспектов трансформированного состояния. 5-азацитидин и 5-аза-2'-дезоксицитидин обычно инактивируют цитозин-С5-ДНК-метилтрансферазы путем образования стабильных комплексов между 5-аза-2'-дезоксицитидиновыми остатками в ДНК и указанным ферментом, таким образом имитируя стабильное переходное состояние интермедиата, когда он связан с ферментом метилтрансферазой.

Дополнительным агентом, который может содержаться в стимулирующей фармацевтической композиции согласно настоящему изобретению, как таковым или в сочетании с 5-аза-2'-дезоксицитидином и/или 5-азацитидином, является трихостатин A (TSA).

"Фактор вытеснения фосфодиэстеразы", содержащийся в стимулирующей фармацевтической композиции, как определено здесь выше, относится к соединению, которое способно помешать или нарушить взаимодействие фосфодиэстераз, в частности, PDE9A, со взаимодействующим партнером или интеракторами. Такой процесс может в конечном итоге привести к ассоциации фосфодиэстераз, в частности, PDE9A, с другими взаимодействующими партнерами, нежели до того, и, вследствие этого, к перераспределению фосфодиэстераз. Такие новые взаимодействующие партнеры могут заблокировать PDE, в частности PDE9A, и, соответственно, модифицировать клеточное поведение, например, оказывая разные воздействия на связывание рецептора или другие низлежащие активности. Примерами белковых партнеров, которые могли бы участвовать в такой реакции вытеснения, и/или которые способны к блокированию PDE, в частности, PDE9A, являются заякоривающие белки, такие как белки AKAP, каркасные белки, такие как DISC1, бета-аррестин или RACKl, регуляторные белки, такие как XAP2/AIP/ARA9, такие белки как субъединицы PKA-R или белки EPAC, или рецепторы, такие как бета-1-адреноцептор, а также такие ферменты как ERK.

Предпочтительными факторами вытеснения фосфодиэстеразы являются пептиды, пептидомиметики, малые молекулы, антитела и аптамеры.

"Пептид", в контексте факторов вытеснения фосфодиэстеразы, относится к отрезку аминокислот, присутствующих в молекуле фосфодиэстеразы или представляющих такую молекулу, в частности, PDE9A, или взаимодействующих, или блокирующих белков, как определено здесь выше. Указанный отрезок аминокислот, содержащийся в пептиде, может иметь длину от 5 до 100 аминокислот, предпочтительно, от 10 до 50 аминокислот, более предпочтительно, от 20 до 30 аминокислот. Указанные отрезки могут быть полностью идентичны фосфодиэстеразе или белковому интерактору или его части, или могут содержать вариации последовательности. Например, пептидная последовательность может содержать вплоть до 25% модифицированных аминокислотных остатков во всех положениях, предпочтительно, модификации, которые не изменяют структурные свойства или связывающие свойства молекулы. Аминокислотная последовательность, присутствующая в пептиде, может, альтернативно, представлять собой пространственные домены фосфодиэстеразы или белок-интерактор и, соответственно, содержать в непосредственной близости от себя отрезки аминокислот, которые в первичной последовательности молекул не примыкают друг к другу.

"Пептидомиметик", в контексте факторов вытеснения фосфодиэстеразы, представляет собой малую белковоподобную цепь, созданную для имитации пептида. Такой пептидомиметик может быть результатом модификации существующего пептида, например, пептида, определяемого здесь выше, с целью изменения свойств молекулы. Пептидомиметик может быть результатом модификации, которая изменяет стабильность молекулы или ее связывающую способность. Обычно такие модификации приводят к изменениям пептида, которые обычно в природе не происходят. Например, пептидомиметик согласно настоящему изобретению может иметь измененный пептидный остов или может содержать неприродные аминокислоты. Предпочтительно, чтобы пептидомиметик согласно настоящему изобретению мог имитировать молекулу фосфодиэстеразы, в частности, PDE9A, или, как определено здесь выше, взаимодействующий или блокирующий белок.

В одном из воплощений настоящего изобретения пептидомиметик может блокировать взаимодействие между PDE, в частности, PDE9A, и ее интерактором. В другом воплощении настоящего изобретения пептидомиметик может усиливать взаимодействие между PDE, в частности, PDE9A, и ее интерактором.

Способы и технологии получения пептидомиметиков, также как и анализы для тестирования пептидомиметиков, известны специалистам в данной области.

"Малые молекулы", в контексте факторов вытеснения фосфодиэстеразы, относятся к малым органическим соединениям, которые предпочтительно являются биологически активными, то есть представляют собой биомолекулу, но предпочтительно не являются полимерами. Такое органическое соединение может иметь любую подходящую форму или химическое свойство. Такое соединение может быть природным соединением, например, вторичными метаболитами, или искусственным соединением, которое сконструировано и получено de novo. В одном из воплощений настоящего изобретения малая молекула способна блокировать взаимодействие между PDE, в частности, PDE9A, и ее интерактором. В другом воплощении настоящего изобретения малая молекула может усиливать взаимодействие между PDE, в частности, PDE9A, и ее интерактором. Способы и технологии идентификации и получения малых молекул, также как и анализы для тестирования малых молекул, известны специалистам в данной области.

"Антитело" или "аптамер", в контексте факторов вытеснения фосфодиэстеразы, относятся к антителу, специфичному в отношении PDE9A, или к варианту или фрагменту антитела, как определено здесь выше, или, как определено здесь выше, к аптамеру, специфичному в отношении PDE9A, обладающему способностью препятствовать или нарушать взаимодействие между PDE, в частности, PDE9A, и одним или несколькими из ее интеракторов. Альтернативно, указанные термины могут также относиться к антителам или аптамерам, связывающимся с любым каким-нибудь одним или несколькими из интеракторов PDE9A, как описано здесь выше, которые, из соображений вероятности, обладают способностью препятствовать или нарушать взаимодействие между PDE, в частности, PDE9A, и одним или несколькими из ее интеракторов. Способы и получения или тестирования антител или аптамеров описаны здесь выше и/или известны специалистам в данной области.

В одном из воплощений настоящего изобретения стимулирующая фармацевтическая композиция может дополнительно включать в себя дополнительные соединения, активные в отношении злокачественных клеток, например, цитотоксические соединения или другие химиотерапевтические или радиоактивные терапевтические соединения, известные специалистам в данной области.

Еще в одном из аспектов настоящее изобретение относится к ингибирующей фармацевтической композиции, содержащей по меньшей мере один элемент, выбранный из группы, состоящей из (a) соединения, напрямую ингибирующего активность PDE9A, предпочтительно, антагониста ферментативной активности PDE9A; (b) соединения, опосредованно ингибирующего активность PDE9A; (c) доминантной негативной формы белка PDE9A или его биологически активного эквивалента; (d) нуклеиновой кислоты, кодирующей и экспрессирующей доминантную негативную форму PDE9A; (e) микро-РНК, специфичной в отношении PDE9A; (f) антисмысловой молекулы PDE9A; (g) ки-РНК, специфичной в отношении PDE9A; (h) аптамера, специфичного в отношении продукта экспрессии PDE9A или в отношении белка PDE9A; (i) малой молекулы или пептидомиметика, способного специфически связываться с белком PDE9A; и (j) антитела, специфичного в отношении белка PDE9A, и/или варианта антитела, специфичного в отношении белка PDE9A.

Используемый здесь термин "соединение, непосредственно ингибирующее активность PDE9A" относится к соединению, которое способно понижать активность PDE9A. Такое соединение может быть любым интерактором PDE9A, который отрицательно влияет на каталитическую активность PDE9A. Такое соединение предпочтительно может быть антагонистом каталитической активности PDE9A.

Используемый здесь термин "соединение, опосредованно ингибирующее активность PDE9A" относится к соединению, которое способно понижать активность PDE9A путем взаимодействия с прямым интерактором PDE9A ("непрямой интерактор"), или через непрямой путь обмена, не участвующий во взаимодействии с PDE9A. Таким соединением может быть любой прямой интерактор интерактора PDE9A. Эффект, передаваемый прямым интерактором интерактора PDE9A, может быть отрицательным либо в случае, если интерактор PDE9A сам по себе оказывает отрицательное влияние на активность PDE9A, или отрицательным в случае, если интерактор PDE9A оказывает положительное влияние на активность PDE9A.

Особенно предпочтительными являются ингибиторы фосфодиэстераз, в особенности любая из указанных здесь изоформ PDE9. Примерами подходящих фосфодиэстеразных ингибиторов, которые могут отдельно или в любом сочетании быть включены в ингибирующую фармацевтическую композицию согласно настоящему изобретению, являются BAY 73-669, SCH51866 и запринаст. Дополнительные примеры подходящих ингибиторов известны специалистам в данной области, а также рассматриваются в настоящем изобретении. Подробности структуры, эффективности, подходящих составов и т.д. ингибиторов должны быть известны специалистам в данной области и/или могут быть почерпнуты из соответствующих учебников или публикаций, например, Joseph A. Beavo, Sharron H. Francis, Miles D Houslay, Cyclic Nucleotide Phosphodiesterase in Health and Disease, CRC Press 2006.

Определяемые здесь выше соединения-ингибиторы можно составлять, определять их дозировки, использовать или вводить в соответствии с представленными здесь подробностями. В частности, для определения необходимых концентраций IC50 и производителей может быть использована следующая таблица ингибиторов (приведенных в качестве примеров):

Соединение IC50 Производитель
BAY 73-669 55 нМолей Sigma-Aldrich
SCH 51866
Запринаст Tocris

Альтернативно, такие отрицательно действующие непрямые интеграторы могут вызывать модификацию поведения связывания напрямую связывающих белков, что приводит к повышению активности PDE9A. Обычно отрицательным образом действующие непрямые интеракторы могут оказывать ингибирующее воздействие на активаторы PDE9A. Примерами таких взаимодействий являются ферментативные активности, вызывающие деградацию активаторов PDE9A, или белки, способные к связыванию или гашению активаторов PDE9A. Альтернативно, такие взаимодействия могут положительно модулировать активности, приводящие к деградации PDE9A, например, протеиназы. Дальнейшие примеры и их воплощение должны быть известны специалистам в данной области.

Альтернативно, непрямое ингибирование активности PDE9A может быть осуществлено соединениями, инактивирующими, препятствующими или нарушающими экспрессию эндогенного гена(генов) PDE9A. Примерами таких соединений являются специфические интеракторы факторов транскрипции PDE9A, которые ингибируют и/или препятствуют связыванию факторов транскрипции и лежащего в основе транскрибирующего механизма с промоторами гена PDE9A, специфически дестабилизируя активности (молекул) мРНК фосфодиэстеразы-9A или факторы, ингибирующие факторы сплайсинга, специфичные в отношении PDE9A. Дополнительные примеры и их осуществление должны быть известны специалистам в данной области.

Используемая здесь "нуклеиновая кислота, кодирующая и экспрессирующая доминантную негативную форму белка опухолевого маркера" относится к любой нуклеиновой кислоте, способной экспрессировать мутантную форму природным образом возникающего белка или полипептида. Таким образом, указанный термин относится к нуклеиновой кислоте, кодирующей (a) вариант(варианты) PDE9A, который содержит антиморфиновую модификацию, в частности, такую, которая негативно сказывается на PDE9A. Обычно такой характер изменения может иметь место, когда антиморфиновый вариант может взаимодействовать с PDE9A, но блокирует некоторую характеристику ее функции. Предпочтительно, чтобы, такие варианты могли содержать или быть лишены специфических доменов PDE9A, например, одного или нескольких доменов белок-белковых взаимодействий или доменов димеризации, доменов комплексообразования, одного или нескольких ассоциированных с мембраной доменов, и т.п.

Используемый здесь термин "микро-РНК, специфичная в отношении PDE9A" относится к короткой одноцепочечной молекуле РНК, обычно длиной в 18-27 нуклеотидов, которая регулирует экспрессию гена PDE9A. Молекулы микро-РНК кодируются генами, с ДНК которых они транскрибированы, но не транслированы в белок. В природной среде микро-РНК сначала транскрибируются в виде первичных транскриптов или при-микро-РНК, с кэпом и поли-A-хвостовой частью, и в результате процессинга превращаются в короткие, структуры стебель-петля, длиной в 70 нуклеотидов, известные как пре-микро-РНК в клеточном ядре. Указанный процессинг осуществляется у животных белковым комплексом, известным как микропроцессорный комплекс, содержащий нуклеазу Drosha связывающий двухцепочечную РНК белок Pasha. Указанные пре-микро-РНК в результате процессинга превращаются затем в зрелые микро-РНК в цитоплазме путем взаимодействия с эндонуклеазой Dicer, которая также инициирует образование РНК-индуцируемого комплекса сайленсинга (RISC). После интеграции в активный комплекс RISC, микро-РНК могут спариваться основаниями с комплементарными им молекулами мРНК и ингибировать трансляцию или могут индуцировать деградацию мРНК посредством каталитически активных членов комплекса RISC, например, белки Argonaute. Обычно зрелые молекулы микро-РНК по меньшей мере частично комплементарны молекулам мРНК, соответствующим продукту экспрессии согласно изобретению и полностью или частично подавляют экспрессию гена. Предпочтительно, чтобы микро-РНК согласно настоящему изобретению могли быть на 100% комплементарны их последовательностям-мишеням. Альтернативно, они могут иметь 1, 2 или 3 несовпадения, например, у концевых остатков или в центральной части молекулы. Молекулы микро-РНК согласно настоящему изобретению могут иметь длину приблизительно в 18-27 нуклеотидов, например, 18, 19, 20, 21, 22, 23, 24, 25, 26 или 27 нуклеотидов. Предпочтительными являются 21-23-меры.

Микро-РНК, имеющие 100% комплементарность, предпочтительно могут быть использованы для деградации нуклеиновых кислот согласно настоящему изобретению, тогда как микро-РНК, имеющие менее чем 100% комплементарность, предпочтительно могут быть использованы для блокирования процессов трансляции.

Термин "антисмысловая молекула PDE9A" относится к нуклеиновым кислотам, соответствующим последовательностям, содержащимся в SEQ ID NO: 1 или 6 или комплементарной им цепи. Предпочтительно, чтобы антисмысловая молекула согласно изобретению содержала последовательность, комплементарную по меньшей мере части продукта экспрессии PDE9A согласно настоящему изобретению. Поскольку могут быть использованы антисмысловые молекулы, комплементарные кодирующей области последовательности PDE9A, предпочтительны те из них, которые комплементарны транскрибируемой и нетранслируемой области.

Обычно антисмысловая технология может быть использована для контролирования, то есть снижения или терминации экспрессии гена, с помощью антисмысловой ДНК или РНК или посредством образования тройной спирали. В одном из воплощений антисмысловая молекула может быть получена внутри организма, например, внутриклеточно, путем транскрипции с экзогенной последовательности. Вектор или его часть могут быть транскрибированы, продуцируя антисмысловую нуклеиновую кислоту согласно изобретению. Такой вектор должен будет содержать последовательность, кодирующую антисмысловую нуклеиновую кислоту согласно изобретению. Такой вектор может остаться в эписоме или может интегрироваться в хромосому, только бы он мог транскрибироваться с образованием требуемой антисмысловой молекулы. Соответствующие векторы могут быть сконструированы с помощью технологий рекомбинантной ДНК, известных специалистам в данной области. Векторы могут быть плазмидными, вирусными или другими известными в данной области векторами, используемыми для репликации и экспрессии в клетках позвоночных, например, векторами, определяемыми здесь выше. В другом воплощении антисмысловая молекула может быть введена отдельно. В качестве примера, 5'-кодирующая область нуклеиновой кислоты PDE9A согласно настоящему изобретению может быть использована для создания антисмыслового олигонуклеотида РНК или ДНК длиной приблизительно от 6 до 50 нуклеотидов. Предпочтительно, чтобы олигонуклеотид составлял в длину по меньшей мере 10 нуклеотидов, по меньшей мере 17 нуклеотидов, по меньшей мере 25 нуклеотидов или по меньшей мере 50 нуклеотидов.

Антисмысловые нуклеиновые кислоты согласно изобретению обычно содержат последовательность, комплементарную по меньшей мере части РНК-транскрипта представляющего интерес гена. Однако абсолютной комплементарности не требуется, хоть она и предпочтительна. Упоминаемая здесь последовательность, "комплементарная по меньшей мере части РНК-транскрипта", означает последовательность, имеющую комплементарность, достаточную для того, чтобы была возможность гибридизоваться с РНК, с формированием стабильного дуплекс-триплексного образования в случае двухцепочечных антисмысловых нуклеиновых кислот. Способность к гибридизации будет зависеть как от степени комплементарности, так и от длины антисмысловой нуклеиновой кислоты. Обычно чем больше гибридизующаяся нуклеиновая кислота, тем больше несовпадений оснований с последовательностью РНК согласно изобретению она может содержать и все еще образовывать стабильный дуплекс или триплекс. Специалист в данной области может установить допустимую степень несовпадений с помощью стандартных процедур по определению точки плавления гибридизованного комплекса.

Предпочтительно, чтобы антисмысловые молекулы, комплементарные 5'-концу транскрипта, например, 5'-нетранслируемой последовательности, вплоть до и включая инициирующий кодон AUG, могли быть использованы для ингибирования трансляции. В следующем предпочтительном воплощении могут быть использованы также последовательности, комплементарные 3'-нетранслируемым последовательностям мРНК.

Антисмысловая молекула согласно настоящему изобретению может быть ДНК или РНК, или их химерные смеси или производные, или их модифицированные версии, одноцепочечные или двухцепочечные. Антисмысловая молекула, предпочтительно, антисмысловой олигонуклеотид или любая другая антисмысловая молекула нуклеиновой кислоты согласно настоящему изобретению, или молекула ки-РНК согласно настоящему изобретению может быть модифицирована на уровне фрагмента основания, сахарного фрагмента или фосфатного остова, например, для улучшения стабильности молекулы, гибридизации, и т.д. Указанная молекула может включать в себя другие добавочные группы, такие как пептиды (например, для нацеливания на рецепторы хозяйских клеток in vivo), или средства, облегчающие транспорт через клеточную мембрану или гематоэнцефалический барьер, расщепляющие средства, запускающие процесс гибридизации, или интеркалирующие средства. Указанная молекула может, соответственно, быть конъюгирована с другой молекулой, например, с пептидом, с запускающим процесс гибридизации перекрестно сшивающим средством, с транспортировочным средством, с расщепляющим средством, запускающим процесс гибридизации, и т.п.

Антисмысловая молекула или антисмысловой олигонуклеотид, молекула микро-РНК или ки-РНК, может содержать по меньшей мере один модифицированный фрагмент основания, который выбран из группы, включающей в себя 5-фторурацил, 5-бромурацил, 5-хлорурацил, 5-йодурацил, гипоксантин, ксантин, 4-ацетилцитозин, 5-(карбокси-гидроксилметил)урацил, 5-карбоксиметил-аминометил-2- тиоуридин, 5-карбоксиметил-аминометилурацил, дигидроурацил, бета-D-галактозилквеозин, инозин, N6-изопентениладенин, 1-метил-гуанин, 1-метилинозин, 2,2-диметилгуанин, 2-метиладенин, 2-метилгуанин, 3-метилцитозин, 5-метилцитозин, N6-аденин, 7-метил-гуанин, 5-метил-аминометилурацил, 5-метоксиаминометил-2-тиоурацил, бета-D-маннозилквеозин, 5'-метоксикарбоксиметилурацил, 5-метоксиурацил, 2-метилтио-N6-изопентениладенин, урацил-5-оксиуксусная кислота, псевдоурацил, квеозин, 2-тиоцитозин, 5-метил-2-тиоурацил, 2-тиоурацил, 4-тиоурацил, 5-метилурацил, метиловый эфир урацил-5-оксиуксусной кислоты, урацил-5-оксиуксусная кислота, 5-метил-2-тиоурацил, 3-(3-амино-3-N-2-карбоксипропил)урацил и 2,6-диаминопурин. Указанная молекула может также содержать по меньшей мере один модифицированный сахарный фрагмент, выбранный из группы, включающей в себя, но не ограниченной перечисленным, арабинозу, 2-фторарабинозу, ксилозу и гексозу. В другом воплощении указанная молекула содержит, альтернативно или дополнительно, по меньшей мере, один модифицированный фосфатный остов, например, фосфоротиоат, фосфородитиоат, фосфороамидотиоат, фосфорамидат, фосфородиамидат, метилфосфонат, сложный алкилфосфотриэфир и формацеталь или его аналоги.

В другом воплощении, указанная антисмысловая молекула, например, антисмысловой олигонуклеотид, может быть альфа-аномерным олигонуклеотидом, то есть олигонуклеотидом, который образует специфические двухцепочечные гибриды с комплементарной РНК, в которых цепи расположены параллельно друг другу.

Термин "ки-РНК, специфичная в отношении PDE9A" относится к конкретному типу антисмысловых молекул, а именно, к малым ингибирующим РНК-дуплексам, которые индуцируют путь РНК-интерференции (РНК-и) для отрицательной регуляции экспрессии гена опухолевого маркера согласно таблице 1. Такие молекулы ки-РНК могут варьировать по длине, которая может составлять приблизительно от 18 до 28 нуклеотидов, например, они могут иметь 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 или 28 нуклеотидов в длину. Предпочтительно, чтобы указанная молекула имела длину в 21, 22 или 23 нуклеотидов. Молекула ки-РНК согласно настоящему изобретению может иметь разную степень комплементарности в отношении своей мРНК-мишени, предпочтительно, в отношении антисмысловой цепи. Молекулы ки-РНК могут иметь неспаренные перекрывающиеся основания на 5'- или 3'- конце смысловой цепи и/или антисмысловой цепи.

Используемый здесь термин "ки-РНК" включает в себя дуплексы двух отдельных цепей, а также одинарные цепи, которые могут образовывать шпилечные структуры, содержащие дуплексную область. Предпочтительно, чтобы ки-РНК могла быть двухцепочечной, при этом чтобы указанная молекула двухцепочечной ки-РНК содержала первую и вторую цепь, где каждая цепь молекулы ки-РНК приблизительно содержала бы от 18 примерно до 23 нуклеотидов в длину, причем чтобы первая цепь молекулы ки-РНК содержала нуклеотидную последовательность, имеющую достаточную степень комплементарности для нацеливания на РНК через механизм РНК-интерференции, а вторая цепь указанной молекулы ки-РНК содержала бы нуклеотидную последовательность, которая комплементарна первой цепи.

Способы конструирования подходящих ки-РНК, направленных на данную нуклеиновую кислоту-мишень, известны специалистам в данной области.

Используемый здесь термин "аптамер, специфичный в отношении продукта экспрессии PDE9A или специфичный в отношении белка PDE9A" относится к короткому пептиду(пептидам), способному к взаимодействию и специфическому связыванию с белком(белками) PDE9A. Пептид-аптамер(аптамеры) предпочтительно может быть способен к специфическому связыванию с белком(белками) или полипептидом(полипептидами), содержащим аминокислотную последовательность, приведенную в SEQ ID NO: 2. Пептид-аптамер(аптамеры) может также быть способен к специфическому связыванию с белком(белками) или полипептидом(полипептидами), содержащим аминокислотную последовательность (последовательности), кодируемую ДНК-последовательностью (последовательностями), которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности, приведенной в SEQ ID NO: 2, или с белком или полипептидом, содержащим аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности, приведенной в SEQ ID NO: 2. Обычно (а) пептид-аптамер(аптамеры) является вариабельной пептидной петлей, содержащей, например, от 10 до 20 аминокислот. В контексте настоящего изобретения пептид-аптамер предпочтительно может быть присоединен к одному или к обоим концам каркасной структуры. Каркасной структурой может быть любая молекула, предпочтительно, белок, который имеет хорошую растворимость. Подходящие каркасные молекулы известны специалистам в данной области. Предпочтительной каркасной молекулой, применимой в контексте настоящего изобретения, является бактериальный белок тиоредоксин-A. Петля пептида-аптамера предпочтительно может быть встроена в редуцирующий активный сайт каркасной молекулы. Альтернативно, стафилококковый протеин A и его домены, а также производные этих доменов, такие как протеин Z или липокалины, могут быть использованы в качестве каркасных структур в контексте настоящего изобретения. Пептиды-аптамеры могут быть получены в соответствии с любым подходящим способом, известным специалистам в данной области, например, посредством двугибридных дрожжевых систем.

В предпочтительном воплощении указанный выше пептидный аптамер способен связываться с белком или полипептидом PDE9A, предпочтительно, с белком или полипептидом, соответствующим последовательности SEQ ID NO: 2, и снижать биологическую активность и/или ферментативную активность указанного/указанных белка(белков) по меньшей мере на 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или по меньшей мере на 98% или 99% по сравнению с контрольным уровнем, полученным из необработанного образца.

Используемая здесь "малая молекула, способная специфически связываться с белком PDE9A" относится к низкомолекулярному органическому соединению, которое предпочтительно является биологически активным, то есть является биомолекулой, но предпочтительно, не является полимером. Такое органическое соединение может иметь соответствующую форму или химическое свойство. Такое соединение может быть природным соединением, например, вторичным метаболитом, или искусственным соединением, которое сконструировано и получено de novo. В одном из воплощений настоящего изобретения малая молекула способна блокировать взаимодействие между PDE, в частности, PDE9A, и ее интерактором. Способы и технологии идентификации и получения малых молекул, а также способы анализа для тестирования малых молекул известны специалистам в данной области.

Используемый здесь термин "пептидомиметик, способный специфически связываться с белком PDE9A", в контексте настоящего изобретения относится к низкомолекулярной белковоподобной цепи, сконструированной для имитации пептида и способной связываться с белком PDE9A. Такой пептидомиметик может быть результатом модификации существующего пептида, например, пептида или пептидного аптамера, как определено здесь выше, в целях изменения свойств молекулы. Пептидомиметик может быть результатом модификации, которая изменяет стабильность молекулы или ее связывающую способность. Такие модификации обычно включают в себя такие изменения пептида, которые не происходят в природе. Например, пептидомиметик согласно настоящему изобретению может иметь измененный пептидный остов или может содержать неприродные аминокислоты. Предпочтительно, чтобы пептидомиметик согласно настоящему изобретению мог заменять молекулу фосфодиэстеразы, в частности, PDE9A, или взаимодействующий с ней или блокирующий ее белок. В одном из воплощений настоящего изобретения пептидомиметик может блокировать взаимодействие между PDE, в частности, PDE9A, и ее интерактором. Способы и технологии получения пептидомиметиков, а также способы анализа для тестирования пептидомиметиков известны специалистам в данной области.

Ингибирующая фармацевтическая композиция согласно настоящему изобретению может содержать также антитело, специфичное в отношении белка PDE9A, и/или вариант антитела, специфичный в отношении белка PDE9A, например, антитело или вариант антитела, определяемые здесь выше.

В предпочтительном воплощении такое антитело или фрагмент антитела может быть способен ингибировать биологическую активность и/или ферментативную активность PDE9A.

Специалистам в данной области должно быть известно о возможности нацеливания и разрушения злокачественных гормон-чувствительных клеток и тканей злокачественной опухоли предстательной железы с использованием конъюгированных антител, специфичных в отношении PDE9A. Таким образом, в специфическом воплощении настоящего изобретения антитело или фрагмент антитела, как определено здесь выше, может быть конъюгирован с терапевтическим или цитотоксическим средством. Термин "терапевтическое средство" относится к любому соединению, лекарственному средству, малой молекуле или медикаменту, которые могут оказывать терапевтическое воздействие на клетку, ткань или целый организм. Примеры таких средств известны специалистам в данной области. Термин "цитотоксическое средство" относится к любому соединению, лекарственному средству, малой молекуле, которые могут оказывать цитотоксическое воздействие на клетку или ткань. Такие средства могут, например, содержать соединения, которые активируют системы эндогенных цитотоксических эффекторов, также как и радиоактивных изотопов, голотоксинов, модифицированных токсинов, каталитических субъединиц токсинов или любых молекул или ферментов, аномально присутствующих в клетке или на поверхности клетки, которые при определенных условиях вызывают гибель клетки. Указанный термин может также включать в себя радиоактивные изотопы, известные в данной области, дополнительные антитела (или их фиксирующие комплемент части), которые связываются с наследственной или индуцированной системой эндогенных цитотоксических эффекторов, тимидинкиназой, эндонуклеазой, РНКазой, альфа-токсином, рицином, абрином, экзотоксином-А Pseudomonas, дифтерийным токсином, сапорином, момордином, гелонином, антивирусным белком лаконоса, альфа-сарцином и холерным токсином. Указанный термин относится также к цитотоксическим пролекарствам. Под "цитотоксическим пролекарством" подразумевается нетоксическое соединение, которое под действием фермента, обычно присутствующего в клетке, превращается в цитотоксическое соединение. Цитотоксические пролекарства, которые могут быть использованы согласно изобретению, включают в себя глутамиловые производные бензойной кислоты, ипритный алкилирующий агент, фосфатные производные этопозида или митомицина C, цитозин-арабинозид, даунорубицин и феноксиацетамидные производные доксорубицина.

В дальнейшем воплощении в настоящем изобретении предусмотрены также процедуры скрининга и способы идентификации аптамера, специфичного в отношении продукта экспрессии или белка PDE9A, соединения, непосредственно стимулирующего или модулирующего активность PDE9A, аллостерического агониста ферментативной активности PDE9A, ингибитора микро-РНК, специфичного в отношении микро-РНК PDE9A, антагомира, специфически деметилирующего PDE9A агента, PDE9A-специфичного фактора вытеснения фосфодиэстеразы, PDE9A-специфичного пептидомиметика и PDE9A-специфичной малой молекулы или лекарственного средства, как определено здесь выше. Такие процедуры скрининга могут включать в себя стадии (a) продуцирования клеток, которые экспрессируют PDE9A в качестве полипептида либо в виде секретируемого белка, либо в виде мембранного белка клеточной поверхности, либо в виде внутриклеточного компонента, (b) приведение полипептида, полученного на стадии (a), в контакт с тестируемым образцом, потенциально содержащим взаимодействующую молекулу, например, аптамер, специфичный в отношении белка PDE9A, соединение, непосредственно стимулирующее или модулирующее активность PDE9A, соединение, опосредованно стимулирующее или модулирующее активность PDE9A, аллостерический агонист ферментативной активности PDE9A, PDE9A-специфичный фактор вытеснения фосфодиэстеразы, PDE9A-специфичный пептидомиметик или PDE9A-специфичная малая молекула или лекарственное средство; и (c) идентификации взаимодействующей молекулы путем изучения связывания и/или ингибирования, или модуляции активности PDE9A.

Альтернативно, такие процедуры скрининга могут включать в себя стадии (a) приведения тестируемого образца, потенциально содержащего напрямую или опосредованно взаимодействующую молекулу, например, аптамер, специфичный в отношении транскрипта PDE9A, ингибитор микро-РНК, специфичный в отношении микро-РНК PDE9A, антагомир, специфически деметилирующий PDE9A агент, PDE9A-специфичный фактор вытеснения фосфодиэстеразы, PDE9A-специфичный пептидомиметик и PDE9A-специфичную малую молекулу или лекарственное средство, в контакт с одной или более клетками, которые экспрессируют PDE9A в качестве транскрипта, (b) детекции уровня экспрессии указанной последовательности; и (c) идентификации взаимодействующей молекулы путем изучения связывания и/или модуляции, или снижения уровня экспрессии PDE9A.

Настоящее изобретение охватывает также аптамер, специфичный в отношении продукта экспрессии или белка PDE9A, соединение, непосредственно стимулирующее или модулирующее активность PDE9A, аллостерический агонист ферментативной активности PDE9A, ингибитор микро-РНК, специфичный в отношении микро-РНК PDE9A, антагомир, специфически деметилирующий PDE9A агент, PDE9A-специфичный фактор вытеснения фосфодиэстеразы, PDE9A-специфичный пептидомиметик и PDE9A-специфичную малую молекулу или лекарственное средство, получаемые или полученные в результате процедуры скрининга или описанного здесь выше способа.

Еще в одном из аспектов настоящее изобретение относится к стимулирующей фармацевтической композиции, как определено здесь выше, для лечения или профилактики злокачественной опухоли, в частности, для лечения злокачественной опухоли предстательной железы.

Кроме того, еще в одном из аспектов настоящее изобретение относится к применению (a) соединения, непосредственно стимулирующего или модулирующего активность PDE9A, предпочтительно, аллостерического агониста ферментативной активности PDE9A; (b) соединения, опосредованно стимулирующего или модулирующего активность PDE9A; (c) белка PDE9A или его биологически активного эквивалента; (d) нуклеиновой кислоты, кодирующей и экспрессирующей PDE9A; (e) ингибитора микро-РНК, специфичного в отношении микро-РНК PDE9A; (f) деметилирующего агента; и/или (g) фактора вытеснения фосфодиэстеразы, предпочтительно, пептида, пептидомиметика, малой молекулы, антитела или аптамера, для получения стимулирующей фармацевтической композиции для лечения или профилактики рака, в частности, злокачественной опухоли предстательной железы, предпочтительно, для лечения гормон-резистентной злокачественной опухоли предстательной железы.

В другом аспекте настоящее изобретение относится к способу лечения или профилактики злокачественной опухоли, в частности, злокачественной опухоли предстательной железы, предпочтительно, лечения гормон-резистентной злокачественной опухоли предстательной железы, предусматривающему введение (a) соединения, непосредственно стимулирующего или модулирующего активность PDE9A, предпочтительно, аллостерического агониста ферментативной активности PDE9A; (b) соединения, опосредованно стимулирующего или модулирующего активность PDE9A; (c) белка PDE9A или его биологически активного эквивалента; (d) нуклеиновой кислоты, кодирующей и экспрессирующей PDE9A; (e) ингибитора микро-РНК, специфичного в отношении микро-РНК PDE9A; (f) деметилирующего агента; и/или (g) фактора вытеснения фосфодиэстеразы, предпочтительно, пептида, пептидомиметика, малой молекулы, антитела или аптамера, индивиду, в частности, индивиду, который страдает от злокачественной опухоли или у которого прогнозируют развитие злокачественной опухоли.

В другом предпочтительном воплощении указанная стимулирующая фармацевтическая композиция, как определено выше, или указанная фармацевтическая композиция, как определено выше, может быть использована для лечения злокачественной опухоли предстательной железы, в зависимости от уровня экспрессии PDE9A, где указанный уровень экспрессии определяется и/или отслеживается в соответствии со стадиями

a) определения уровня PDE9A в образце;

(b) определения уровня экспрессии референсного гена в образце; и

(c) нормализации измеренного уровня экспрессии PDE9A относительно экспрессии референсного гена. Уровень PDE9A может быть определен по нуклеиновой кислоте, белку или уровню активности, как описано здесь выше. Предпочтительным является определение количества транскрипта(транскриптов) и/или белка PDE9A. Кроме того, может быть определен уровень референсного гена, как определено здесь выше. Предпочтительным референсным геном, в контексте данного воплощения, является PDE4D5, как описано здесь выше.

Используемый здесь термин "в зависимости от уровня экспрессии PDE9A" означает, что выбор того, вводить ли ингибирующую фармацевтическую композицию или стимулирующую фармацевтическую композицию, может быть сделан после определения уровня PDE9A в образце, предпочтительно, по сравнению с референсным геном, таким как ген PDE4D5.

В особенно предпочтительном воплощении настоящего изобретения для повышенных и/или повышающихся уровней PDE9A следует вводить ингибирующую фармацевтическую композицию согласно настоящему изобретению, а для пониженных и/или понижающихся уровней PDE9A следует вводить стимулирующую фармацевтическую композицию согласно настоящему изобретению.

Используемый здесь термин "повышенный" в данном контексте означает, что уровень экспрессии гена PDE9A в тестируемом образце повышен, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем 50% по сравнению с уровнем экспрессии гена PDE9A в контрольном образце, или повышен по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с экспрессией PDE9A в контрольном образце; или когда экспрессия гена PDE9A повышена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, или более чем 50% по сравнению с экспрессией референсного гена в контрольном образце, или повышена по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с экспрессией референсного гена. В специфическом воплощении экспрессия референсного гена также может быть нормализована или приведена в соответствие с экспрессией дополнительных генов или маркеров, например, генов домашнего хозяйства. В качестве предпочтительного контрольного образца или характеристической точки могут быть использованы незлокачественный контроль, здоровая ткань, ткань или клетки, полученные из организма здорового индивида или из тканей доброкачественной опухоли, или данные, полученные на их основе, и т.п. Альтернативно, может быть использован любой другой контрольный образец или контрольная точка.

Используемый здесь термин "повышающийся" относится к соответствующим образом определенным значениям уровня экспрессии, которые имеют тенденцию возрастать в продолжение определенного временнóго периода, то есть которые становятся выше после повторных стадий определения, например, через каждые 4 недели, 6 недель, два месяца, 4 месяца, 6 месяцев, 8 месяцев, 12 месяцев, 1,5 года, 2 года, 2,5 года, и т.д. "Повышающийся" уровень экспрессии PDE9A может, соответственно, быть повышен на величину, составляющую от 0,5% до 100% и более, при каждом сеансе тестирования, предпочтительно он может быть повышен на 10%, 20%, 30%, 40%, 50% и т.д. Само по себе повышение зависит от частоты тестирования, и значимость может быть соответствующим образом откорректирована осведомленным в этом отношении специалистом в данной области.

В предпочтительном воплощении, повышенный или повышающийся уровень PDE9A может быть определен на ранних стадиях развития злокачественной опухоли предстательной железы, то есть вплоть до стадии гормон-чувствительной злокачественной опухоли предстательной железы. Альтернативно, гистологические определения могут предоставить независимую информацию относительно стадии злокачественной опухоли предстательной железы. В зависимости от такого независимого определения, может быть диагностирована стадия доброкачественной опухоли предстательной железы или стадия гормон-зависимой опухоли. В такой ситуации повышенный или повышающийся уровень PDE9A (по сравнению с незлокачественным или здоровым контролем или стадией) может послужить сигналом для назначения ингибирующей фармацевтической композиции согласно настоящему изобретению.

Альтернативно, может дополнительно быть определен уровень PSA. В случае, когда наблюдается низкий уровень PSA, ниже 2,0-3,0 нг/мл, повышенный или повышающийся уровень PDE9A может послужить сигналом для назначения ингибирующей фармацевтической композиции согласно настоящему изобретению.

Используемый здесь термин "пониженный" в данном контексте означает, что уровень экспрессии гена PDE9A в тестируемом образце понижен, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем 50% по сравнению с уровнем экспрессии гена PDE9A в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с экспрессией PDE9A в контрольном образце; или что экспрессия гена PDE9A понижена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем 50% по сравнению с уровнем экспрессии референсного гена в контрольном образце, или понижена по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с экспрессией референсного гена. В специфическом воплощении экспрессия референсного гена может быть также нормализована или откорректирована в соответствии с экспрессией дополнительных генов или маркеров, например, генов домашнего хозяйства. В качестве предпочтительного контрольного образца или характеристической точки могут быть использованы злокачественный контроль, в частности, гормон-чувствительная или гормон-зависимая злокачественная опухоль предстательной железы, или данные, полученные на их основе, и т.п. Альтернативно, может быть использован любой другой контрольный образец или контрольная точка.

Термин "понижающийся" относится к соответствующим образом определенным значениям уровня экспрессии, которые имеют тенденцию понижаться в продолжение определенного временнóго периода, то есть которые становятся ниже после повторных стадий определения, например, через каждые 4 недели, 6 недель, два месяца, 4 месяца, 6 месяцев, 8 месяцев, 12 месяцев, 1,5 года, 2 года, 2,5 года, и т.д. "Повышающийся" уровень экспрессии PDE9A может, соответственно, быть повышен на величину, составляющую от 0,5% до 100% и более, при каждом сеансе тестирования, предпочтительно он может быть повышен на 10%, 20%, 30%, 40%, 50% и т.д. Само по себе повышение зависит от частоты тестирования, и значимость может быть соответствующим образом откорректирована осведомленным в этом отношении специалистом в данной области.

В предпочтительном воплощении, пониженный или понижающийся уровень PDE9A может быть определен после повышения PDE9A вплоть до опухолевой стадии гормон-чувствительной злокачественной опухоли предстательной железы. Альтернативно, гистологические определения могут предоставить независимую информацию относительно стадийности опухоли предстательной железы. В зависимости от такого независимого определения, может быть диагностирована стадия гормон-чувствительной опухоли. В такой ситуации пониженный или понижающийся уровень PDE9A (по сравнению с начальной опухолевой стадией) может послужить сигналом для назначения стимулирующей фармацевтической композиции согласно настоящему изобретению.

Альтернативно, может дополнительно быть определен уровень PSA. В случае, когда наблюдается уровень PSA, приблизительно составляющий 20 нг/мл и/или выше, пониженный или понижающийся уровень PDE9A может послужить сигналом для назначения стимулирующей фармацевтической композиции согласно настоящему изобретению.

В следующем специфическом воплощении настоящего изобретения рассматривается способ мониторинга развития злокачественной опухоли предстательной железы, который включает в себя определение PDE9A, предпочтительно, в сочетании с определением референсного гена, как описано здесь выше, в продолжение определенного временнóго периода, то есть после повторных стадий определения, например, через каждые 4 недели, 6 недель, два месяца, 4 месяца, 6 месяцев, 8 месяцев, 12 месяцев, 1,5 года, 2 года, 2,5 года, 3 года, 4 года или через любой другой подходящий временнóй период, и т.д. Указанный способ может обеспечить данные по повышению или понижению PDE9A по сравнению с контрольными образцами, например, с незлокачественными контролями, со злокачественными контролями или с более ранними данными, полученными из организма одного и того же индивида. Указанные данные могут быть использованы для изображения или выведения кривой зависимости экспрессии PDE9A от времени. С помощью соответствующих статистических методов, известных специалистам в данной области, может быть определено положение внутри указанной кривой. В зависимости от положения внутри указанной кривой, то есть в области увеличивающихся значений или в области спада на указанной кривой, можно диагностировать наличие или дальнейшее развитие гормон-зависимой/гормон-чувствительной злокачественной опухоли предстательной железы. Соответственно, нужно рассматривать применение либо ингибирующей фармацевтической композиции согласно настоящему изобретению, либо стимулирующей фармацевтической композиции согласно настоящему изобретению. Предпочтительно, чтобы любое такое определение можно было сочетать с определением вторичных биомаркеров, например, маркеров злокачественной опухоли предстательной железы, в частности, PSA. В случае низких уровней PSA (вплоть до уровней от 4,0 до 10,0 нг/мл) данные по PDE9A можно рассматривать в свете раннего рака предстательной железы, то есть доброкачественной или гормон-зависимой/гормон-чувствительной опухоли предстательной железы. В случае более высоких уровней PSA (приблизительно выше чем уровни от 4,0 до 10,0 нг/мл, более предпочтительно выше чем 20 нг/мл) данные по PDE9A можно рассматривать в отношении более продвинутого рака предстательной железы, то есть гормон-резистентной злокачественной опухоли предстательной железы.

Фармацевтическую композицию согласно настоящему изобретению можно вводить пациенту, субъекту или индивиду с помощью различных систем доставки, известных специалистам в данной области, например, путем инкапсулирования в липосомы, микрочастицы, микрокапсулы, рекомбинантные клетки, способные к экспрессии данного соединения, рецептор-опосредованного эндоцитоза, конструкции нуклеиновой кислоты как части ретровируса или другого вектора, и т.п. Способы введения могут быть местными, энтеральными или парэнтеральными и могут включать в себя внутрикожный, внутримышечный, внутрибрюшинный, внутривенный, подкожный, интраназальный, ингаляционный, эпидуральный и пероральный пути. Указанную композицию можно вводить любым из приемлемых путей, например, путем инфузии или болюсной инъекции, посредством абсорбции через эпителиальную или слизисто-кожную выстилки (например, слизистую полости рта, слизистую прямой кишки и кишечника, и т.д.), или посредством ингаляции, и можно вводить совместно с другими биологически активными средствами. Введение может быть системным или локальным. Предпочтительным способом локального введения является введение путем прямой инъекции. В другом воплощении фармацевтическая композиция может быть доставлена прямо во внутренние органы, полости организма, и прочее, с применением визуализирующих устройств, используемых для наведения инъекционной иглы прямо в представляющий интерес участок. Фармацевтическая композиция может быть доставлена также в область поражения в время хирургического вмешательства. Еще в одном воплощении, композиция может быть доставлена в составе системы с контролируемым высвобождением.

Предпочтительно, чтобы фармацевтическая композиция была представлена в форме, которая подходит для перорального, локального или системного введения. В предпочтительном воплощении фармацевтическую композицию вводят локально, перорально или системно.

В специфическом воплощении настоящего изобретения стимулирующая или ингибирующая фармацевтическая композиция может быть доставлена после иммуноанализа для стратификации или способа идентификации индивида в отношении правомочности того, что его следует лечить от злокачественной опухоли предстательной железы, как описано здесь выше, в частности, для классификации индивида в отношении наличия пониженного уровня PDE9A.

В дальнейшем воплощении фармацевтическая композиция содержит терапевтически эффективное количество ингредиентов фармацевтической композиции согласно настоящему изобретению, как определено здесь выше, и фармацевтически приемлемый носитель. Термин "фармацевтически приемлемый" означает одобренный регламентирующим учреждением или другой общепризнанной фармакопеей для применения на животных, а более предпочтительно, на человеке. Используемый здесь термин "носитель" относится к разбавителю, адъюванту, наполнителю или носителю, в составе с которы вводят активное начало. Такой носитель является фармацевтически приемлемым, то есть нетоксичным для реципиента в используемой дозе и концентрации.

Обычно указанные ингредиенты либо поставляют отдельно, либо смешивают вместе в единую дозированную форму, например, в виде сухого лиофилизированного порошка или безводного концентрата в герметически запаянном контейнере, таком как ампула или пакетик-саше, с указанием количества активного ингредиента.

Фармацевтическая композиция согласно изобретению может быть составлена в нейтральной или солевой формах.

Предпочтительно, чтобы фармацевтическую композицию можно было вводить непосредственно или в сочетании с любым подходящим адъювантом, известным специалистам в данной области. Композицию согласно изобретению можно вводить животному, предпочтительно, млекопитающему. Под используемым здесь термином "млекопитающее" подразумевается то же содержание, которое обычно понимают под этим любые рядовые специалисты в данной области. Под термином "млекопитающее" подразумевается, в частности, человек.

Термин "вводят" означает введение терапевтически эффективной дозы указанной композиции. Под "терапевтически эффективным количеством" подразумевается доза, которая вызывает эффекты, ради получения которых ее вводят, предпочтительно, чтобы таким эффектом была индукция и усиление PDE9A. Точная доза будет зависеть от цели лечения и будет устанавливаться специалистом в данной области с помощью известных технологий. Как описано выше и известно в данной области, может потребоваться корректировка системной доставки в зависимости от места введения, возраста, массы тела, общего состояния здоровья, пола, диеты, времени введения, лекарственного взаимодействия и степени тяжести состояния, и она будет осуществляться специалистом в данной области в результате стандартного экспериментирования.

Концентрация активных ингредиентов или соединений фармацевтической композиции согласно настоящему изобретению может быть дополнительно откорректирована до требуемого режима дозирования, предполагаемой длительности применения, точного количества и соотношения всех ингредиентов композиции и дополнительных факторов и параметров, известных специалистам в данной области.

Активные агенты или соединения согласно настоящему изобретению могут быть введены отдельно или в сочетании с другими воздействиями. В предпочтительном воплощении фармацевтическая композиция согласно настоящему изобретению может быть введена в сочетании с антигормональным лечением, например, антиандрогенным лечением.

Фармацевтическая композиция согласно настоящему изобретению может также содержать любой подходящий консервант, известный специалисту в данной области.

Кроме того, лекарственные препараты согласно настоящему изобретению могут содержать также соединения, которые обладают антиоксидантным действием, являются ловушками свободных радикалов, обладают противоэриматозным, противовоспалительным или противоаллергическим действием, в дополнение или усиление их действия.

В другом предпочтительном воплощении настоящего изобретения активные компоненты фармацевтической композиции, как определено здесь выше, могут быть слиты с подходящим белковым носителем, например, с Ig Fc-рецепторными белками или полимерными Ig-рецепторами. Предпочтительно, чтобы в качестве белков слияния могли быть использованы PDE9A или ее биологически активные эквиваленты, как определено здесь выше. Партнеры слияния могут быть предусмотрены на N- или C-концах.

Если фармацевтическая композиция согласно настоящему изобретению предназначена для введения в виде живой клетки или средства живой природы, как определено здесь выше, трансформированные и подготовленные клетки могут быть введены пациенту в любой подходящей форме, известной специалистам в данной области. Предпочтительно, чтобы средства живой природы могли быть введены в виде композиции, содержащей микроорганизм, например, молочнокислую бактерию, как описано выше, в количестве от 102 до 1012 клеток, предпочтительно, от 103 до 108 клеток.

В другом предпочтительном воплощении настоящего изобретения соотношение между двумя или более ингредиентами в фармацевтической композиции или лекарственном средстве может быть соответствующим образом откорректировано по усмотрению специалиста в данной области.

Соответствующие анализы, необязательно, могут быть выполнены для идентификации оптимальных соотношений и/или интервалов доз ингредиентов фармацевтических композиций согласно изобретению. Точная доза и соотношение ингредиентов, которые будут использованы в фармацевтической композиции, как определено здесь выше, будет, помимо прочего, зависеть от пути введения конкретного типа заболевания или расстройства, и она остается на усмотрение практикующего специалиста, с учетом обстоятельств, связанных с каждым пациентом. Эффективные дозы или соотношение ингредиентов могут быть экстраполированы на основании кривых доза-ответ, полученных на системах in vitro или на модельных (животных) тест-системах. Типичная доза может составлять, например, от 0,001 до 1000 мкг; однако дозы, которые ниже или выше указанного примерного интервала также рассматриваются, при этом следует особенно учитывать указанные выше факторы.

В другом аспекте настоящее изобретение относится к медицинскому набору, содержащему ингредиент ингибирующей или стимулирующей фармацевтической композиции согласно настоящему изобретению. Предпочтительно, чтобы настоящее изобретение относилось к медицинскому набору для лечения или профилактики злокачественной опухоли, в частности, злокачественной опухоли предстательной железы, предпочтительно, гормон-резистентной злокачественной опухоли предстательной железы, при этом чтобы указанный набор содержал по меньшей мере один элемент, выбранный из группы, состоящей из

(a) соединения, непосредственно стимулирующего или модулирующего активность PDE9A, предпочтительно, аллостерического агониста ферментативной активности PDE9A;

(b) соединения, опосредованно стимулирующего или модулирующего активность PDE9A;

(c) белка PDE9A или эквивалентной ей биологической активности;

(d) нуклеиновой кислоты, кодирующей и экспрессирующей PDE9A;

(e) ингибитора микро-РНК, специфичного в отношении микро-РНК PDE9A;

(f) деметилирующего агента; и

(g) фактора вытеснения фосфодиэстеразы.

Медицинский набор, который может быть использован в контексте введения фармацевтической композиции, как определено здесь выше, в частности, набор согласно настоящему изобретению, может быть использован для лечения или профилактики злокачественной опухоли, в частности, злокачественной опухоли предстательной железы, предпочтительно, гормон-резистентной злокачественной опухоли предстательной железы.

Ингредиенты медицинского набора могут, согласно настоящему изобретению, содержаться в одном или нескольких контейнерах или отдельных объектах. Предпочтительно, чтобы они могли быть составлены в виде фармацевтических композиций или медикаментов, более предпочтительно, чтобы они могли быть составлены в виде, описанном здесь выше, в контексте фармацевтических композиций согласно изобретению, например, чтобы они могли содержать соответствующие фармацевтические носители, и прочее. Особенно предпочтительными являются композиции для местного введения, как было указано выше, в контексте фармацевтических композиций согласно изобретению. Медицинский набор согласно настоящему изобретению необязательно может содержать также документацию, в которой указано применение или способ употребления данного медицинского набора и его компонентов. Предпочтительно, чтобы инструкции, содержащиеся в медицинском наборе согласно изобретению, могли содержать рекомендованные варианты лечения, режимы введения дозировок и прочее. Медицинский набор может содержать также листочек-вкладыш с инструкцией, и/или в нем может быть предоставлена дополнительная информация по применению, дозировкам и т.д. Медицинский набор согласно изобретению можно вводить пациенту в любом подходящем режиме введения дозировок, известном специалистам в данной области. Предпочтительно, чтобы медицинский набор или набор компонентов мог вводиться один раз в неделю, более предпочтительно 2 раза, 3 раза, 4 раза, 5 раз или 6 раз в неделю, а наиболее предпочтительно ежедневно или 2 раза в день, или еще чаще, если не указано иное. В процессе проведения лечения можно значительно увеличивать временные интервалы между введениями дозировок, а в случае необходимости, можно существенно уменьшать временные интервалы между введениями дозировок, например, [вводить их] несколько раз в день. В предпочтительным случае можно осуществлять мониторинг ответа на лечение с помощью описанных здесь способов и дополнительных способов, известных специалистам в данной области, и дозировки могут быть, соответственно, оптимизированы, например, по времени, по количеству и/или по составу. Прогресс можно отслеживать при мониторинге путем периодической оценки. Предусмотрено также, что стимулирующий медицинский набор используется в подходах с совместной терапией, то есть при совместном введении с другими медикаментами или лекарственными средствами, например, антибиотиками, противовирусными медикаментами или иммуноглобулинами IgG или IgA, противораковыми медикаментами и, предпочтительно, антигормональными медикаментами, более предпочтительно, антиандрогенами, как указано здесь выше.

Дальнейший специфический аспект настоящего изобретения относится к набору, содержащему ингредиенты для определения экспрессии PDE9A, как определено здесь выше, вместе с ингредиентами медицинского набора для лечения злокачественной опухоли предстательной железы, в частности, гормон-резистентной злокачественной опухоли предстательной железы, как определено здесь выше.

Дальнейшим, особенно предпочтительным воплощением настоящего изобретения является то, что злокачественной опухолью, которую диагностируют, детектируют, подвергают мониторингу или прогнозируют, или же прогрессию которой диагностируют, детектируют, подвергают мониторингу или прогнозируют, или которая подлежит лечению с использованием фармацевтической композиции, как было указано выше, или способа лечения согласно настоящему изобретению, является злокачественная опухоль предстательной железы.

В другом особенно предпочтительном воплощении настоящего изобретения, злокачественной опухолью, подлежащей диагностике, детекции, мониторингу или прогнозированию, или же прогрессию которой диагностируют, детектируют, подвергают мониторингу или прогнозируют, или которая подлежит лечению с использованием фармацевтической композиции, как было указано выше, или способа лечения согласно настоящему изобретению, является гормон-резистентная злокачественная опухоль предстательной железы. Термин "гормон-резистентная злокачественная опухоль предстательной железы" означает, что рост и пролиферация злокачественной опухоли или линий клеток злокачественной опухоли резистентны к стимуляции под действием мужского полового гормона. Указанный термин относится также к поздней стадии развития злокачественной опухоли предстательной железы, которая более не восприимчива к введению анти-гормонов, предпочтительно, анти-андрогенов, как определено здесь выше.

Обычно прогрессия злокачественной опухоли предстательной железы сопровождается смещением опоры эндокринных контролей на паракринные и в конечном итоге на аутокринные контроли, а также тем, что этот комплексный процесс считается результатом изменений, которые возникают на молекулярном уровне клеточного контроля. В силу наличия вероятности метастатического распространения опухолей на этой стадии гормон-резистентные злокачественные опухоли предстательной железы являются основной мишенью при диагностике и лечении согласно настоящему изобретению, в частности, в соответствии с представленными выше воплощениями. Следующие примеры и фигуры приведены только в иллюстративных целях. Таким образом, следует понимать, что примеры и фигуры не являются ограничительными. Специалист в данной области может с легкостью представить себе дополнительные модификации раскрытых здесь принципов.

ПРИМЕРЫ

Пример 1 - анализ количественной ОТ-ПЦР

Из клеточных линий и ксенотрансплантатов человеческих тканей, указанных на фиг. 1 (дальнейшие подробности см. также в публикации Marques et al., 2006, Eur. Urol, 49(2): 245-57), выделяли РНК, и путем проведения стандартных процедур транскрибировали ее в кДНК. Полученные кДНК образцов “LNCaP"-”DuCaP", которые являются клеточными линиями, и образцов ”PC-EW"-”PC374", которые являются ксенотрансплантатами, тестировали в отношении уровней PDE9A.

Количественная ОТ-ПЦР: Материалы и методы

Образцы РНК обрабатывали ДНКазой, чтобы убедиться, что в них нет примесей ДНК. Перед синтезом кДНК образцы РНК обрабатывали ДНКазой (DnaseI, In Vitrogen) в течение 30 мин при 37ºC. Затем 1 мкг образца РНК обрабатывали реактивом Superscript Vilo (In Vitrogen), чтобы синтезировать первую цепь ДНК для анализа количественной ПЦР, согласно инструкциям производителей. Затем образцы ДНК в течение 30 мин при 37ºC обрабатывали реактивом RnaseH1.

Полученную в результате ДНК разбавляли до конечной концентрации 50-60 нг/мкл, из которых по 5 мкл добавляли к каждой реакционной лунке 96-луночного планшета для оптических реакций.

Реакции количественной ПЦР предпринимали, используя установку ABI Prism 7300 в реакционном объеме 15 мкл, согласно следующему протоколу:

7,5 мкл реактива Platinum qPCR SuperMix-UDG with ROX (In Vitrogen)

2,2 мкл воды, не содержащей нуклеазу

0,1 мкл зонда 100 пмоль/мкл

0,1 мкл прямого праймера 100 пмоль/мкл

0,1 мкл обратного праймера 100 пмоль/мкл

Суммарный объем в каждой реакционной лунке составлял 15 мкл, включая кДНК.

Проводили 40 циклов собственно ПЦР по следующей программе:

Этап Повторения циклов Температура (оC) Время
1 1 50 2 секунды
2 1 95 2 минуты
3 40 95 15 секунд
60 1 минута

Праймеры количественной ОТ-ПЦР и зонды (TAQMAN)

Для PDE9A-ОТ-ПЦР были использованы следующие олигонуклеотидные праймеры:

Прямой праймер 5'-CGAGGAGCTGAAGCGGATA-3' (SEQ ID NO: 41), обратный праймер 5'-CCCCAGACGTCAAGCTGTC-3' (SEQ ID NO: 42), дающий начало продукту длиной 71.

В качестве зонда использовали последовательность 5'-TGACGCCATGAAAGAGTTACA-3' (SEQ ID NO: 43).

Набор зондов конструировали для нацеливания на консервативные C-концевые области PDE-изоформы. Ампликон создавали таким образом, чтобы он находился в оптимальном диапазоне Taqman-анализов по технологии ABI Prism. Все анализы предпринимали в четырех повторах для получения максимально надежных данных. Был включен также ссылочный зонд GAPDH, с которым соразмеряли все последующие данные.

Количественная ОТ-ПЦР: аналитические данные

Для нормализации и сравнения разных ОТ-ПЦР-экспериментов использовали подход -ddCt. Значения Ct получали путем подбора с помощью ручного управления пороговых значений, когда каждый набор зондов амплифицировался экспоненциально со сравнимой эффективностью. В частности, были проведены следующие этапы:

1). Разницу в числе циклов (Ct) между ссылочным геном и представляющим интерес геном (GAPDH вычитали из представляющего интерес гена) вычисляли для получения dCt экспериментального образца (ES, experimental sample).

2). Один образец выбирали в качестве стандарта для сравнения с (LNCaP) (C), и для него вычисляли dCt.

3). Изменение в разнице числа циклов можно было получить в виде dCt(ES)-dCt( C )=ddCt

4). Конечные сравнимые значения экспрессии можно получить в виде 2-ddCt, с тем, чтобы учесть удвоение ДНК после каждого цикла, а следовательно, выявить количество мРНК по сравнению с LNCaP.

Такая операция дает значение по сравнению с LNCaP (который будет иметь значение 1), то есть значение >1 считали повышением экспрессии, а значение <1 считали понижением экспрессии.

Соответственно, считалось, что эффективность удлинения всех реакций ПЦР заключена в определенной области, в результате приводящей к значению 1.

Процентный подход к нормализации и сравнению разных ОТ-ПЦР-экспериментов

Для каждого набора зондов получали значение Ct (число циклов). Это осуществляли путем нахождения исходного уровня, который пересекается с кривыми амплификации в время их экспоненциальной фазы. Исходные уровни определялись динамически, в соответствии с кривыми, получаемыми в каждом эксперименте. Затем GOI-значения Ct (пересечение или цикл) вычитали из значения Ct для GAPDH-стандарта.

Согласно формуле Ct(GAPDH)-Ct(GOI)=dCt, при условии, что GOI-значения Ct всегда больше, чем значение dCt референсного гена, получаются отрицательные числа, то есть значение -dCt. На основе удвоения эффект каждого цикла и абсолютные значения были определены в соответствии с величиной сравнительной экспрессии = 2-dCt. В связи с тем, что в результате таких расчетов получаются очень малые значения, для удобства полученную величину умножали на 1000.

Уровни экспрессии для PDE9A, полученные в результате такого подхода, представлены на фиг. 2-7.

Результаты, представленные на фиг. 2-7, показывают, что транскрипция PDE9A в тканях и в линиях злокачественных клеток предстательной железы человека зависит от статуса активности андрогенного рецептора (AR) в клетках данного типа. В случае наличия AR и чувствительности клетки к андрогенной/гормональной стимуляции может наблюдаться значительная транскрипция PDE9A, тогда как при отсутствии активного AR транскрипция PDE9A совсем минимальна.

Пример 2 - Количественный анализ ОТ-ПЦР на образцах ткани человека

Относительную экспрессию гена человеческой PDE9A оценивали в тканях злокачественной опухоли предстательной железы, полученных из организма гормон-чувствительных/отвечающих пациентов в сравнении с гормон-рефрактерными/резистентными к кастрации пациентами.

Материалы и методы

Подробности в связи с образцами, используемыми для измерений количественной ПЦР в экспериментах по экспрессии гена PDE, приведены ниже в таблице 1:

Все образцы были получены у пациентов-мужчин (возраст на момент лечения 49-90 лет). В колонке "Ткань" указан тип ткани, который был взят во время оперативного вмешательства, либо ткань простаты, либо лимфатические узлы для определения стадии. В колонке "Тип ткани" указан подход в отношении резекции ткани. Если не указано иное, резекцию ткани осуществляли в процессе хирургии предстательной железы (простатэктомия). TURP означает трансуретральную резекцию предстательной железы.

Данная панель кДНК включает в себя 6 образцов, полученных из организма пациентов с гормон-чувствительной злокачественной опухолью предстательной железы, и 8 образцов, полученных из организма пациентов с гормон-резистентной злокачественной опухолью предстательной железы. Последовательности праймера и зонда, используемые для человеческой PDE9A:

Последовательность смыслового праймера: GCAGAGCGACCGTGAGAAG (SEQ ID NO: 45)

Последовательность антисмыслового праймера: AGGACAAACTTGATGAACCCAATC (SEQ ID NO: 46)

Последовательность зонда: CCTGTGGCACCGTTCATGGACCGAGACTCACAGG (FAM-меченного) (SEQ ID NO: 47).

PDE9A-специфические праймеры предварительно смешивали с FAM-зондами для осуществления количественной ПЦР в режиме реального времени (qPCR) и использовали в разведении 1:20, согласно инструкциям производителя (PrimerDesign, UK). Образцы кДНК человека (подробности относительно образцов, которые были использованы в данном исследовании, см. в таблицах 1 и 2) помещали в стандартные, qPCR-ready, 96-луночные микротитровальные (MT) планшеты.

16 образцов тканей, полученных из организмов 16 разных пациентов, распределяли в 96-луночном MT-планшете, при этом каждая из используемых 16 лунок планшета содержала приблизительно 2-3 нг кДНК, полученной в результате обратной транскрипции РНК.

К каждой из используемых лунок MT-планшета добавляли по 15 мкл реактива GeneAmp mastermix (2x) (Applied Biosystems), 13,5 мкл воды, не содержащей РНКазу/ДНКазу, и 2 мкл смеси праймеров PrimerDesign PerfectProbe primermix (PrimerDesign, UK). Все образцы анализировали в соответствии со следующим протоколом ПЦР: 2 мин при 50ºC, 10 мин при 95ºC, 15 сек при 95ºC, 30 сек при 50ºC, до регистрации флуоресценции, 15 сек при 72ºC, и три последних этапа повторяли 50 раз.

Во всех вычислениях, связанных со значениями экспрессии генов, были использованы следующие процедуры: значения CT порядка 40 или выше, или ниже 16 были исключены из соображений очень плохого качества. (Исследованные здесь гены имели среднее значение CT, составляющее ~33).

Для нормализации значений CT был использован следующий подход: значения CT пересчитывали на относительное число копий гена на основе калибровочных кривых. Калибровочные кривые получали из независимых измерений при различных разведениях кДНК. Потом осуществляли нормализацию экспрессии PDE-9a путем деления числа копий PDE-9a на среднее число копий генов домашнего хозяйства (глицеринальдегид-3-фосфат-дегидрогеназы (GAPDH) и порфобилиногендезаминазы (PBGD)).

Относительная экспрессия человеческой PDE9A в тканях предстательной железы человека (гормон-чувствительной относительно гормон-резистентной), включая образцы тканей резецированных лимфатических узлов

Уровень экспрессии гена изоформы PDE9A человека определяли на тканях предстательной железы, как описано выше. Уровни относительной экспрессии определяли в "гормон-чувствительной" и "гормон-резистентной" тканях предстательной железы. При начальном изучении статуса экспрессии PDE9A человека включали только образцы первичной злокачественной опухоли предстательной железы, то есть все образцы, полученные из резецированных лимфатических узлов, были исключены.

Как можно понять из фиг. 8 и 9, экспрессия PDE9A в гормон-резистентных опухолях предстательной железы обычно понижена по сравнению с гормон-чувствительными опухолями предстательной железы. Следовательно, можно сделать заключение, что пониженные уровни активности цАМФ/цГМФ-PDE являются благоприятными для усиленной пролиферации клеток. В течение долгого времени считалось, что мутации или амплификация гена, граничащего с геном андрогенного рецептора, активация других клеточных сигнальных путей могут быть основой для перехода от гормон-чувствительного роста клеток к гормон-резистентному. Путь цАМФ-ПКА является одним из путей, которые участвуют в таком изменении гормон-связанного роста. Изменение в уровне экспрессии PDE9A при переходе от гормон-чувствительной ткани предстательной железы человека к гормон-резистентной подтверждает такую точку зрения.

Пример 3 - Детекция PDE9A и PDE4D5 в анализах количественной ОТ-ПЦР в образцах тканей человека (панели I и II человеческих тканей предстательной железы от компании Origene)

Относительную экспрессию гена человеческой PDE9A и человеческой PDE4D5 в качестве референсного (стандартного) гена оценивали на разных панелях пациентов.

Материалы и методы

Подробности относительно образцов, используемых для измерений количественной ПЦР в экспериментах по экспрессии гена PDE, приведены ниже в таблицах 2 и 3:

Панели I и II человеческих тканей предстательной железы от компании Origene, используемые в описанных далее экспериментах, получены из организма пациентов мужского пола (в возрасте 48-87 лет). Колонка "ткань" относится к ткани, которая была взята в процессе хирургических вмешательств. Колонка "внешний вид" указывает на патологический статус среза ткани, которая была использована для выделения РНК, и которая в конечном итоге была использована для измерения qPCR. "Нормальная" в данном контексте означает нормальную прилежащую ткань (NAT, normal adjacent tissue), которая является тканью, взятой из хирургического материала (обычно это радикальная простатэктомия или TURP (трансуретральная резекция предстательной железы)), но которая выглядит как ткань с нормальной/здоровой морфологией и гистологией и, следовательно, используется в качестве контроля. Определение "патологически измененная" означает следующее: не-неопластическая ткань, то есть и не нормальная, в том, что в ней при диагностике обнаруживаются разные типы патологических аномалий (но не опухоли). Они включают в себя такую гистопатологию как воспаление или доброкачественная гиперплазия (примеры: колит, болезнь Крона, эндометриоз, эмфизема, бронхит). "Опухолевая" определяется как неопластическая ткань, которая, на основании патолого-диагностики может быть либо доброкачественной, либо злокачественной (например, аденома, аденокарцинома, саркома). В колонке "диагноз" указана причина плановой операции (например, злокачественная опухоль мочевого пузыря у пациента 9, но была обнаружена также и злокачественная опухоль ткани предстательной железы). В колонке "опухолевая стадия" представлена оценка по шкале Глисона, если она применима (то есть в случае наличии опухолевой ткани). В колонках “нормальная", “патологически измененная” и “опухолевая” указан процент соответствующей ткани, обнаруженной при гистологическом анализе на срезе ткани, используемой для выделения РНК. Панель I человеческих тканей предстательной железы от компании Origene включает в себя 7 нормальных образцов (нормальную прилежащую ткань, NAT), 11 образцов гиперплазии (доброкачественная гиперплазия предстательной железы, BPH - Benign prostate hyperplasia), 20 патологически измененных образцов и 10 образцов опухоли предстательной железы. Из указанных опухолевых образцов 7 получены из опухолей, имеющих оценку 7 или выше по шкале Глисона. Панель II человеческих тканей предстательной железы от компании Origene включает в себя 8 нормальных образцов (нормальную прилежащую ткань), 1 образец гиперплазии (доброкачественная гиперплазия предстательной железы, BPH) и 39 образцов опухоли предстательной железы. Из указанных опухолевых образцов 10 получены из организма доноров, получивших оценку до 6 по шкале Глисона, а 29 получены из опухолей, которые имеют оценку 7 или выше по шкале Глисона.

Последовательности праймеров, используемые для человеческой PDE4D5:

Последовательность смыслового праймера: GCAGCATGAGAAGTCCAAGA (SEQ ID NO: 48),

Последовательность антисмыслового праймера: TGTATGTGCCACCGTGAAAC (SEQ ID NO: 49),

Последовательность зонда: TCGGTTTCTCCCAAGCTCTCTCCAGTGATAAACCGA (FAM-меченного) (SEQ ID NO: 50).

Последовательности праймера и зонда, используемые для человеческой PDE9A:

Последовательность смыслового праймера: GCAGAGCGACCGTGAGAAG (SEQ ID NO: 45)

Последовательность антисмыслового праймера: AGGACAAACTTGATGAACCCAATC (SEQ ID NO: 46)

Последовательность зонда: CCTGTGGCACCGTTCATGGACCGAGACTCACAGG (FAM-меченного) (SEQ ID NO: 47).

PDE9A-специфические праймеры предварительно смешивали с FAM-зондами для осуществления количественной ПЦР в режиме реального времени (qPCR) и использовали в разведении 1:20, согласно инструкциям производителя (PrimerDesign, UK). Образцы кДНК человека (подробности описания образцов см. выше в таблицах 2 и 3) помещали в стандартные, qPCR-ready, 96-луночные микротитровальные (MT) планшеты. 48 образцов тканей, полученных из организмов 48 разных пациентов, распределяли в 96-луночном MT-планшете, при этом каждая из используемых 16 лунок планшета содержала приблизительно 2-3 нг кДНК, полученной в результате обратной транскрипции РНК.

Содержание кДНК в каждой лунке нормализовали на основе qPCR по генам “домашнего хозяйства”, таким как бета-актин, GAPDH, бета-2-микроглобулин, так, чтобы не требовалось дальнейшей нормализации содержания кДНК.

К каждой из используемых лунок MT-планшета добавляли по 15 мкл реактива GeneAmp mastermix (2x) (Applied Biosystems), 13,5 мкл воды, не содержащей РНКазу/ДНКазу, и 2 мкл смеси праймеров PrimerDesign PerfectProbe primermix (PrimerDesign, UK). Все образцы анализировали в соответствии со следующим протоколом ПЦР: 2 мин при 50ºC, 10 мин при 95ºC, 15 сек при 95ºC, 30 сек при 50ºC, до регистрации флуоресценции, 15 сек при 72ºC, и три последних этапа повторяли 50 раз. Во всех вычислениях, связанных со значениями экспрессии генов, были использованы следующие процедуры: значения CT порядка 40 или выше, или ниже 16 были исключены из соображений очень плохого качества. (Исследованные здесь гены имели среднее значение CT, составляющее ~32). Для нормализации значений CT по разным планшетам qPCR, было расчитано срединное значение CT образцов "нормальной" ткани, и относительные значения экспрессии для “патологически измененных” образцов, образцов с "гиперплазией", а также “опухолевых” образцов по сравнению с указанным значением были определены путем вычисления соотношений между значениями CT “патологически измененных” образцов, образцов с "гиперплазией", а также “опухолевых” образцов и значением CT образцов "нормальной" ткани. Обычно это давало относительные значения экспрессии ~1. В случае, когда экспрессию гена анализировали многократно (с использованием множества планшетов одной и той же панели), относительные значения экспрессии каждого индивидуального образца усредняли.

Относительная экспрессия человеческой PDE9A в ткани предстательной железы человека

Уровень экспрессии гена изоформы PDE-9a человека определяли на тканях предстательной железы человека, как описано выше. Относительные уровни экспрессии определяли в четырех описанных тканях предстательной железы ("нормальной", “патологически измененной”, "гиперпластической", "опухолевой"). Представленные уровни экспрессии для групп “патологически измененной”, "гиперпластической" и "опухолевой" рассчитывали, как было показано выше, в виде нормализованного значения путем составления отношения значений CT для каждой индивидуальной ткани пациента из “патологически измененной”, "гиперпластической", "опухолевой" групп к среднему значению CT "нормальной" группы. То же самое было сделано и для каждой индивидуальной ткани пациента из "нормальной" группы, так, чтобы значение срединной экспрессии для этой группы составляло 1.

Для проверки того, действительно ли экспрессия гена PDE9A человека в среднем значительно повышена в разных опухолевых тканях по сравнению с нормальной тканью предстательной железы, использовали t-тест Стьюдента. Значения p, полученные из попарных сравнений: T-тест нормы по сравнению с опухолью: p=0,02.

Как можно видеть из фиг. 10 и 11, в разных опухолевых тканях можно обнаружить экспрессию человеческой PDE9A, отличающуюся от таковой в нормальной ткани предстательной железы.

Receiver-Operator-Curve (ROC)-анализ экспрессии PDE9A

Впоследствии был предпринят Receiver-Operator-Curve (ROC)-анализ для определения AUC (площади под кривой, Area Under Curve) для разных попарных сравнений. Такие операционные характеристические кривые экспрессии гена человеческой PDE9A для установления диагностических возможностей представлены на фиг. 12. ROC-анализ предоставил доказательства того, что отличить злокачественную ткань предстательной железы от нормальной можно на основе измерения экспрессии человеческой PDE9A.

PDE-индекс предстательной железы (PPI) - относительная экспрессия человеческой PDE9A в ткани предстательной железы человека, нормализованная относительно человеческой PDE4D5, для эффективного выявления различий между доброкачественными и злокачественными заболеваниями предстательной железы

Уровень экспрессии изоформ человеческих генов PDE9A и PDE4D5 определеляли на тканях предстательной железы, как описано выше. Относительные уровни экспрессии были определены в четырех описанных тканях предстательной железы ("нормальной", “патологически измененной”, "гиперпластической", "опухолевой"). Уровень относительной экспрессии PDE9A рассчитывали путем вычитания индивидуальных значений CT для PDE9A от индивидуальных значений CT для PDE4D5. Обычно это дает распределение значений "нормальной" экспрессии вокруг 0 (между -1 и +1). Более того, оптимальным граничным значением между образцами не-опухолевых тканей ("нормальная", “патологически измененная”, "гиперпластическая") и опухолевой ткани ("опухолевая") является значение от -1 до +1.

Такой подход позволяет успешно проводить сравнение значений CT для PDE9A с внутренним контролем, а именно, с PDE4D5. Следовательно, необязательно нормализовать образцы соответствующих клинических групп пациентов относительно числа нормальных образцов, которые не всегда могут быть доступны в ситуации реального тестирования. Такой тест можно проводить в виде простого анализа с человеческой PDE4D5 в качестве внутреннего стандартного контроля для получения PDE-индекса предстательной железы, который определяется как дельта (CT [PDE4D5 человека]-CT [PDE9A человека]).

Для проверки того, действительно ли у человека дельта экспрессии гена дельта (CT [PDE4D5 человека]-CT [PDE9A человека]) в среднем значительно повышена в разных опухолевых тканях по сравнению с нормальной тканью предстательной железы, использовали t-тест Стьюдента. Значения p, полученные из попарных сравнений: T-тест нормы по сравнению с опухолью: p=0,024.

Как можно видеть из фиг. 13 и 14, в разных опухолевых тканях можно обнаружить экспрессию человеческой PDE9A, существенно отличающуюся от таковой в нормальной ткани предстательной железы.

Receiver-Operator-Curve (ROC)-анализ экспрессии PDE9A

Впоследствии был предпринят Receiver-Operator-Curve (ROC)-анализ для определения AUC (площади под кривой) для разных попарных сравнений. Такие операционные характеристические кривые экспрессии гена PDE9A для установления диагностических возможностей представлены на фиг. 15. ROC-анализ предоставил доказательства того, что отличить злокачественную ткань предстательной железы от нормальной можно на основе измерения экспрессии человеческой PDE9A.

Настоящая заявка включает в себя следующие дополнительные воплощения:

Пункт 1: Фосфодиэстераза-9A (PDE9A) для применения в качестве маркера злокачественной опухоли.

Пункт 2: Композиция для диагностики, детекции, мониторинга или прогнозирования злокачественной опухоли или прогрессии злокачественной опухоли, содержащая аффинный лиганд на основе нуклеиновой кислоты и/или пептидный аффинный лиганд, обладающий сродством к продукту экспрессии PDE9A или к белку PDE9A.

Пункт 3: Композиция по пункту 2, в которой указанный аффинный лиганд на основе нуклеиновой кислоты или пептидный аффинный лиганд модифицирован таким образом, чтобы функционировать в качестве контрастного средства.

Пункт 4: Композиция по пункту 2, в которой указанный аффинный лиганд представляет собой набор олигонуклеотидов, специфичных в отношении продукта экспрессии PDE9A, зонд, специфичный в отношении продукта экспрессии PDE9A, аптамер, специфичный в отношении продукта экспрессии PDE9A или белка PDE9A, антитело, специфичное в отношении белка PDE9A, и/или вариант антитела, специфичный в отношении белка PDE9A.

Пункт 5: Применение PDE9A в качестве маркера для диагностики, детекции, мониторинга или прогнозирования злокачественной опухоли предстательной железы или прогрессии злокачественной опухоли предстательной железы.

Пункт 6: Способ детекции, диагностики, мониторинга или прогнозирования злокачественной опухоли предстательной железы или прогрессии злокачественной опухоли предстательной железы, предусматривающий по меньшей мере стадию определения уровня PDE9A в образце.

Пункт 7: Способ по пункту 6, согласно которому стадию определения осуществляют путем измерения уровней нуклеиновой кислоты или белка или путем определения биологической активности PDE9A.

Пункт 8: Способ по пункту 7, согласно которому указанный способ включает в себя дополнительную стадию сравнения измеренных уровней нуклеиновой кислоты или белка или измеренной биологической активности с контрольным уровнем.

Пункт 9: Способ сбора данных, предусматривающий по меньшей следующие стадии:

(a) тестирование у индивида уровня экспрессии PDE9A; и

(b) сравнение уровня экспрессии, определяемого на стадии (a), с контрольным уровнем.

Пункт 10: Применение по пункту 2 или способ по любому из пунктов 6-9, согласно которому указанные диагностика, детекция, мониторинг или прогнозирование, или сбор данных следует проводить на образце, полученном из организма индивида.

Пункт 11: Иммуноанализ для детекции, диагностики, мониторинга или прогнозирования злокачественной опухоли предстательной железы, включающий в себя по меньшей мере следующие стадии:

(a) тестирование образца, полученного из организма индивида, на предмет экспрессии PDE9A,

(b) тестирование контрольного образца на предмет экспрессии PDE9A,

(c) определение разницы в экспрессии PDE9A на стадиях (a) и (b); и

(d) вынесение решения относительно наличия или стадии злокачественной опухоли предстательной железы или прогрессирования злокачественной опухоли предстательной железы на основе результатов, полученных на стадии (c),

при этом указанные стадии тестирования основаны на использовании антитела, специфически связывающегося с PDE9A.

Пункт 12: Применение или способ по пункту 10 или иммуноанализ по пункту 11, согласно которому указанным образцом является образец ткани, образец мочи, образец осадка мочи, образец крови, образец слюны, образец семенной жидкости или образец, содержащий циркулирующие опухолевые клетки.

Пункт 13: Фармацевтическая композиция, содержащая по меньшей мере один элемент, выбранный из следующей группы:

(a) соединения, непосредственно стимулирующего или модулирующего активность PDE9A, предпочтительно, аллостерического агониста ферментативной активности PDE9A;

(b) соединения, опосредованно стимулирующего или модулирующего активность PDE9A;

(c) белка PDE9A или его биологически активного эквивалента;

(d) нуклеиновой кислоты, кодирующей и экспрессирующей PDE9A;

(e) ингибитора микро-РНК, специфичного в отношении различных микро-РНК фосфодиэстеразы-9A;

(f) деметилирующего агента; и

(g) фактора вытеснения фосфодиэстеразы, предпочтительно, пептида, пептидомиметика, малой молекулы, антитела или аптамера.

Пункт 14: Фармацевтическая композиция для лечения или профилактики злокачественной опухоли, содержащая по меньшей мере один элемент, выбранный из следующей группы:

(a) соединения, непосредственно стимулирующего или модулирующего активность PDE9A, предпочтительно, аллостерического агониста ферментативной активности PDE9A;

(b) соединения, опосредованно стимулирующего или модулирующего активность PDE9A;

(c) белка PDE9A или его биологически активного эквивалента;

(d) нуклеиновой кислоты, кодирующей и экспрессирующей PDE9A;

(e) ингибитора микро-РНК, специфичного в отношении различных микро-РНК фосфодиэстеразы-9A;

(f) деметилирующего агента; и

(g) фактора вытеснения фосфодиэстеразы, предпочтительно, пептида, пептидомиметика, малой молекулы, антитела или аптамера.

Пункт 15: Применение

(a) соединения, непосредственно стимулирующего или модулирующего активность PDE9A, предпочтительно, аллостерического агониста ферментативной активности PDE9A;

(b) соединения, опосредованно стимулирующего или модулирующего активность PDE9A;

(c) белка PDE9A или его биологически активного эквивалента;

(d) нуклеиновой кислоты, кодирующей и экспрессирующей PDE9A;

(e) ингибитора микро-РНК, специфичного в отношении различных микро-РНК фосфодиэстеразы-9A;

(f) деметилирующего агента; и/или

(g) фактора вытеснения фосфодиэстеразы, предпочтительно, пептида, пептидомиметика, малой молекулы, антитела или аптамера,

для получения фармацевтической композиции, предназначенной для лечения или профилактики злокачественной опухоли.

Пункт 16: Фосфодиэстераза по пункту 1, композиция по любому из пунктов 2-4, применение по пункту 5, 10 или 12, способ по любому из пунктов 6-10 или 12, иммуноанализ по пункту 11 или 12, фармацевтическая композиция по пункту 13 или 14, или применение по пункту 15, где указанная злокачественная опухоль является злокачественной опухолью предстательной железы.

Пункт 17: Фосфодиэстераза, применение, композиция, способ, иммуноанализ или фармацевтическая композиция по пункту 16, где указанная злокачественная опухоль предстательной железы является гормон-резистентной злокачественной опухолью предстательной железы.

1.Способ детектирования гормон-резистентной злокачественной опухоли предстательной железы или прогрессии в направлении гормон-резистентной злокачественной опухоли предстательной железы, где указанный способ позволяет различить гормон-чувствительную и гормон-резистентную злокачественные опухоли предстательной железы и включает следующие стадии:
(a) определение уровня PDE9A в образце;
(b) определение уровня экспрессии референсного гена в образце;
(c) нормализацию измеренного уровня экспрессии PDE9A относительно экспрессии референсного гена; и
(d) сравнение нормализованного уровня экспрессии с предопределенным граничным значением, выбранным таким образом, чтобы исключить гормон-чувствительную злокачественную опухоль предстательной железы, причем нормализованный уровень экспрессии, который оказывается ниже граничного значения, является показателем гормон-резистентной злокачественной опухоли предстательной железы, причем указанное граничное значение приблизительно составляет от 2 до 15, предпочтительно приблизительно 5.

2. Способ диагностики гормон-резистентной злокачественной опухоли предстательной железы или прогрессии в направлении гормон-резистентной злокачественной опухоли предстательной железы, где указанный способ позволяет различить гормон-чувствительную и гормон-резистентную злокачественные опухоли предстательной железы и включает следующие стадии:
(a) определение уровня PDE9A в образце;
(b) определение уровня экспрессии референсного гена в образце;
(c) нормализацию измеренного уровня экспрессии PDE9A относительно экспрессии референсного гена; и
(d) сравнение нормализованного уровня экспрессии с предопределенным граничным значением, выбранным таким образом, чтобы исключить гормон-чувствительную злокачественную опухоль предстательной железы, причем нормализованный уровень экспрессии, который оказывается ниже граничного значения, является показателем гормон-резистентной злокачественной опухоли предстательной железы, причем указанное граничное значение приблизительно составляет от 2 до 15, предпочтительно приблизительно 5.

3. Способ мониторинга гормон-резистентной злокачественной опухоли предстательной железы или прогрессии в направлении гормон-резистентной злокачественной опухоли предстательной железы, где указанный способ позволяет различить гормон-чувствительную и гормон-резистентную злокачественные опухоли предстательной железы и включает следующие стадии:
(a) определение уровня PDE9A в образце;
(b) определение уровня экспрессии референсного гена в образце;
(c) нормализацию измеренного уровня экспрессии PDE9A относительно экспрессии референсного гена; и
(d) сравнение нормализованного уровня экспрессии с предопределенным граничным значением, выбранным таким образом, чтобы исключить гормон-чувствительную злокачественную опухоль предстательной железы, причем нормализованный уровень экспрессии, который оказывается ниже граничного значения, является показателем гормон-резистентной злокачественной опухоли предстательной железы, причем указанное граничное значение приблизительно составляет от 2 до 15, предпочтительно приблизительно 5.

4. Способ прогнозирования гормон-резистентной злокачественной опухоли предстательной железы или прогрессии в направлении гормон-резистентной злокачественной опухоли предстательной железы, где указанный способ позволяет различить гормон-чувствительную и гормон-резистентную злокачественные опухоли предстательной железы и включает следующие стадии:
(a) определение уровня PDE9A в образце;
(b) определение уровня экспрессии референсного гена в образце;
(c) нормализацию измеренного уровня экспрессии PDE9A относительно экспрессии референсного гена; и
(d) сравнение нормализованного уровня экспрессии с предопределенным граничным значением, выбранным таким образом, чтобы исключить гормон-чувствительную злокачественную опухоль предстательной железы, причем нормализованный уровень экспрессии, который оказывается ниже граничного значения, является показателем гормон-резистентной злокачественной опухоли предстательной железы, причем указанное граничное значение приблизительно составляет от 2 до 15, предпочтительно приблизительно 5.

5. Способ по любому из пп. 1-4 где указанный референсный ген представляет собой ген домашнего хозяйства, предпочтительно GAPDH или PBGD, или является другой фосфодиэстеразой, предпочтительно PDE4D5.

6. Способ по любому из пп. 1-4, где указанный способ включает дополнительную стадию определения уровня специфического антигена простаты (PSA).

7. Способ по п. 5, согласно которому индивид, классифицированный или тестированный как индивид, имеющий повышенный уровень экспрессии PDE9A и повышенный уровень PSA, составляющий от более чем приблизительно >2,5 нг/мл до приблизительно 10 нг/мл, идентифицируется как страдающий злокачественной гормон-чувствительной опухолью предстательной железы; а индивид, классифицированный или тестированный как индивид, имеющий пониженный уровень экспрессии PDE9A и повышенный уровень PSA, составляющий более чем приблизительно >10 нг/мл, идентифицируется как страдающий злокачественной гормон-резистентной опухолью предстательной железы.

8. Иммуноанализ для различения гормон-чувствительной и гормон-резистентной злокачественных опухолей, включающий стадии:
(a) определение уровня PDE9A в образце;
(b) определение уровня экспрессии референсного гена в образце;
(c) нормализацию измеренного уровня экспрессии PDE9A относительно экспрессии референсного гена; и
(d) сравнение нормализованного уровня экспрессии с предопределенным граничным значением, выбранным таким образом, чтобы исключить гормон-чувствительную злокачественную опухоль предстательной железы, причем нормализованный уровень экспрессии, который оказывается ниже граничного значения, является показателем гормон-резистентной злокачественной опухоли предстательной железы, причем указанное граничное значение приблизительно составляет от 2 до 15, предпочтительно приблизительно 5.



 

Похожие патенты:

Группа изобретений относится к медицине и касается способа определения резистентности субъекта к лечению рака с использованием 2,2-диметил-N-((S)-6-оксо-6,7-дигидро-5Н-дибензо[b,d]-азепин-7-ил)-N′-(2,2,3,3,3-пентафторпропил)малонамида, включающего измерение уровня биомаркера, присутствующего в биологическом образце, полученном у упомянутого субъекта, где биомаркер представляет собой IL6 и/или IL8, и где повышенный уровень IL6 и/или IL8 свидетельствует о наличии резистентности к указанному лечению.
Изобретение относится к области биотехнологии и предназначено для неинвазивной диагностики колоректального рака. Осуществляют забор и транспортировку образцов стула пациента, выделение из стула пациента общей ДНК и определение целостности ДНК методом ПЦР-анализа.

Изобретение относится к области биохимии, в частности к применению Axl в качестве биомаркера для распознавания наступления эпителиально-мезенхимального перехода (EMT) у субъекта, где показателем наступления EMT является повышающая регуляция экспрессии Axl.

Изобретение относится к области медицины. Предложен способ оценки чувствительности субъекта к возникновению рака предстательной железы, включающий определение в образце уровня фрагментов MR-pro-ADM, MR-pro-ANP и копептина длиной по крайней мере 12 аминокислот и соотнесение указанного уровня фрагментов с риском возникновения рака предстательной железы у субъекта, где субъект еще не был диагностирован как такой, который имеет рак, и/или не имеет рака.

Группа изобретений относится к медицине, а именно к онкологии, и может быть использована для повышения лечебного действия режима химиотерапии на пациента, страдающего раком поджелудочной железы, путем добавления бевацизумаба к режиму химиотерапии.

Изобретение относится к биотехнологии, конкретно к стоматологии и медицинской генетике, и может быть использовано для прогнозирования злокачественной трансформации эрозивно-язвенной формы красного плоского лишая (КПЛ) слизистой оболочки полости рта (СОПР).

Изобретение относится к области медицины, а именно к способу диагностики острого лимфобластного лейкоза у пациента, включающий выявление признаков лейкоза, тестирование клеток крови на лейкоз, инкубирование клеток крови фактором, идуцирующим лейкоз, с тем, чтобы индуцировать экспрессию клеточных поверхностных маркеров, которые являются признаком лейкоза, где фактор, индуцирующий лейкоз - это супернатант Aspergillus flavus, EBV-инфицированный CCL87 супернатант, очищенная EBV культура или их комбинации.

Группа изобретений относится к медицине, а именно к иммунологии, и может быть использована для анализа того, будет ли пациент отвечать терапевтически на способ лечения рака, включающий введение иммуногенной композиции.

Настоящее изобретение относится к набору для применения в in vitro прогностическом способе для определения или предсказания in vivo терапевтического ответа в пораженных клетках или тканях на лечение заболевания, имеющего этиологию, связанную с избыточной пролиферацией клеток, с использованием сердечного гликозида.

Группа изобретений относится к медицине, а именно к исследованию органокомплекса после проведения гастро-/панкретодуоденальной или дистальной резекции по поводу протоковой аденокарциномы поджелудочной железы.

Изобретение относится к области медицины и предназначено для оценки индивидуального генетического риска атеросклероза. Осуществляют взятие крови, выделение ДНК и генотипирование митохондриальной ДНК.

Изобретение относится к области медицинской диагностики. Предложен способ прогнозирования характера поражения желчного пузыря у женщин, больных хроническим калькулезным холециститом, русской национальности, являющихся уроженками Центрального Черноземья России.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития хронического калькулезного холецистита (ХКХ). У женщин русской национальности, являющихся уроженками Центрального Черноземья России, осуществляют забор крови, выделение ДНК и анализ полиморфизмов генов интерлейкинов.

Изобретение относится к области медицины и касается способа прогнозирования риска развития первичной открытоугольной глаукомы (ПОУГ) с неэффективной консервативной терапией у лиц русской национальности, являющихся уроженцами Центрального Черноземья РФ.
Изобретение относится к области медицины, в частности к хирургии, и предназначено для дифференциации природы происхождения рецидивных кист при цистном эхинококкозе.

Изобретение относится к биотехнологии и касается набора олигонуклеотидов-праймеров для получения первичной структуры F гена вирусов болезни Ньюкасла класса I. Представленный набор состоит из трех пар олигонуклеотидов, имеющих следующую структуру (5′→3′): Представленные олигонуклеотиды не дают перекрестных реакций с родственными видами, позволяют ограничивать манипуляции одноступенчатой процедурой проведения полимеразной цепной реакции (ПЦР).

Изобретение относится к области биохимии. Представлены варианты молекулы нуклеиновой кислоты, связывающейся с SDF-1.

Изобретение относится к области биотехнологии и вирусологии. Описаны способ прогнозирования раннего снижения вирусной нагрузки у человека, инфицированного вирусом гепатита С (ВГС), в ответ на лечение без применения интерферона, способ выбора длительности лечения без интерферона и способ прогнозирования ответа человека, инфицированного ВГС, на лечение без применения интерферона.

Предложенная группа изобретений относится к области медицины. Предложены способ, машиночитаемый носитель и система для определения генетической аномалии плода, которая представляет собой анеуплоидию.

Группа изобретений относится к области биотехнологии, в частности к детекции нуклеиновокислотной последовательности-мишени в анализе с РОСН (расщеплением и гибридизацией РО) на твердой подложке.

Изобретение относится к области биотехнологии и представляет собой способ определения неспецифической устойчивости патогенных микроорганизмов к антибиотикам и факта присутствия бактериальных биопленок на основании измерения каталитической активности фосфодиэстераз, расщепляющих циклический дигуанозинмонофосфат, с пороговой чувствительностью 50 пг/мл, включающий: 1) выделение фосфодиэстеразы-мишени из лизированных бактериальных клеток; 2) связывание фосфодиэстеразы биотинилированными антителами, специфичными к некаталитическим доменам фосфодиэстеразы; 3) аффинную очистку комплексов, сформированных фосфодиэстеразой-мишенью и биотинилированным антителом при помощи парамагнитных частиц, содержащих нейтравидин или его аналоги, связывающие биотин; 4) взаимодействие комплексов фосфодиэстераза/биотинилированное антитело, иммобилизованных на парамагнитных частицах, с комплексами, содержащими с-di-GMP в форме G-квадруплексов с интеркалированным красителем, сопровождающееся падением интенсивности флуоресценции по мере разрушения комплексов интеркалирующего красителя c-di-GMP; 5) измерение падения флуоресценции при гидролизе c-di-GMP и разрушении комплекса c-di-GMP с интеркалирующим красителем с последующим количественным определением активности фосфодиэстеразы на основании калибровочных кривых, построенных с использованием известных количеств рекомбинантного фермента фосфодиэстеразы, идентичного исследуемой мишени; 6) выявление повышенного уровня фосфодиэстеразной активности, обнаруживаемого тестируемыми антибиотикоустойчивыми бактериальными штаммами, способными к формированию биопленок, по сравнению с уровнем фосфодиэстеразной активности, обнаруживаемым для контрольных штаммов бактерий того же вида, не обладающих антибиотикоустойчивостью и способностью к формированию биопленок.
Наверх