Способ получения радиофармацевтического препарата "астат-211"


 


Владельцы патента RU 2593017:

Федеральное государственное бюджетное образовательное учреждение высшего образования "Московский государственный университет имени М.В. Ломоносова" (МГУ) (RU)

Настоящее изобретение относится к области преобразования химических элементов и источникам радиоактивности, предназначенным для медицинских целей, в частности к способу получения радиофармацевтического препарата «Астат-211» из облученной мишени, включающему возгонку радионуклида при температуре 700÷850°C в течение 4÷6 минут, с его осаждением в слабощелочном буферном физиологическом растворе с pH от 7.5 до 9, где в качестве мишени используют Bi естественного изотопного состава, который облучается α-частицами с энергией 29÷31 МэВ. Изобретение обеспечивает значительное уменьшение времени получения устойчивых форм 211At, тропных к щитовидной железе, снижение дозовых нагрузок на персонал, занятый в процессе изготовления препарата, и повышение эффективности синтеза препарата. 1 з.п. ф-лы, 1 ил., 5 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к области преобразования химических элементов и источникам радиоактивности, предназначенным для медицинских целей, в частности к способам получения радиофармацевтического препарата "Астат-211".

Уровень техники

В настоящее время при неуклонном росте заболеваемости населения раком щитовидной железы проблема радиотерапии этого вида онкологических заболеваний является весьма актуальной.

Основной метод радионуклидной терапии онкологических заболеваний щитовидной железы, который используется в настоящее время, заключается во введении в организм изотонического раствора с радионуклидом 131J, тройного к щитовидной железе и обладающего большей селективностью воздействия на опухолевые ткани щитовидной железы по сравнению с методом дистанционной гамма-терапии.

Этот способ имеет следующие недостатки. Используемый в качестве действующего фактора изотоп 131J является источником бета- и гамма-излучения, имеющего длину поглощения в тканях человеческого организма порядка нескольких сантиметров, что не позволяет обеспечить локальность воздействия на опухолевые ткани. Кроме того, изотоп 131J имеет достаточно большой период полураспада - 8.04 суток. Указанные свойства приводят к существенному облучению здоровых органов в процессе нахождения в организме пациента изотопа 131J до его естественного выведения. Из-за большого периода полураспада 131J существует проблема радиационной безопасности окружающей среды и обслуживающего медицинского персонала, связанная с естественным выведением изотопа из организма пациента и необходимостью специальных мер по утилизации радиоактивных продуктов жизнедеятельности пациента. Медицинский персонал подвергается воздействию достаточно сильно проникающего гамма-излучения изотопа 131J при введении препарата в организм больного (Ю.Н. Касаткин, И.И. Пурижанский, В.Д. Лыжина, П.И. Лисенков, Е.В. Кижаев. Московский Медицинский Журнал "В помощь практическому врачу". М., 1999, февраль, с. 17-19).

По этим причинам, большой интерес вызывают работы с радиофармацевтическим препаратом «Астат-211» для лечения онкологических заболеваний щитовидной железы, позволяющим существенно снизить радиационную нагрузку на пациента и обслуживающий медицинский персонал (Юминов О.А.; Тултаев А.В.; Кижаев Е.В.; Фотина О.В.; Платонов С.Ю.; Еременко Д.О.; Алиев Р.А. Патент №2182022 «Способ лечения онкологических заболеваний щитовидной железы»). Наиболее близким по технической сущности и цели к заявленному изобретению является способ получения радиофармацевтического препарата «Астат-211», представленный в описании изобретения по патенту RU 2191033, согласно которому радионуклид 211At нарабатывают на циклотроне У-120 НИИЯФ МГУ с помощью ядерной реакции - 209Bi(α, 2n)211At при бомбардировке толстой мишени из Bi естественного изотопного состава α-частицами с энергией (29÷31) МэВ. Выделение 211At из облученной мишени проводят методом возгонки при 500°С с последующим осаждением его паров в изотоническом растворе (Юминов О.А.; Тултаев А.В.; Кижаев Е.В.; Фотина О.В.; Платонов С.Ю.; Еременко Д.О.; Алиев Р.А. Патент №2191033 «Радиофармацевтический препарат "Астат-211" для лечения онкологических заболеваний щитовидной железы»).

Известному способу-прототипу присущи следующие недостатки:

1) указанный способ занимает более 1 часа, что при периоде полураспада 211At - 7.24 ч существенно снижает конечную активность препарата.

2) длительный процесс синтеза радиофармацевтического препарата приводит к распаду устойчивых форм 211 At, тройных к щитовидной железе.

3) длительность синтеза радиофармацевтического препарата приводит к повышенным дозовым нагрузкам на персонал, занятый в процессе изготовления.

Раскрытие изобретения

Задачей настоящего изобретения является создание экспрессного способа получения радиофармацевтического препарата "Астат-211" для лечения онкологических заболеваний щитовидной железы, позволяющего за короткое время получить устойчивые формы 211 At, тропные к щитовидной железе, существенно снизить дозовые нагрузки на персонал, занятый в процессе изготовления, и сохраняющего достоинства способа-прототипа: его эффективность в лечении онкологических заболеваний щитовидной железы, локальность воздействия на опухолевые ткани, радиационную безопасность для медицинского персонала и окружающей среды.

Техническим результатом изобретения является значительное уменьшение времени получения устойчивых форм 211At, тропных к щитовидной железе, снижение дозовых нагрузок на персонал, занятый в процессе изготовления препарата, и повышение эффективности синтеза препарата.

Поставленная задача решается тем, что радиофармацевтический препарат "Астат-211" изготавливают с использованием радионуклида 211At, который получают из облученной мишени методом возгонки радионуклида при температуре (700÷850)°С в течение (4÷6) минут с его осаждением в слабощелочном буферном физиологическом растворе с РН от 7.5 до 9.0. В качестве мишени предпочтительно использовать Bi естественного изотопного состава, который облучается α-частицами с энергией (29÷31) МэВ. Осаждение паров, содержащих радионуклид 211At, осуществляют параллельно с возгонкой.

Изобретение поясняется графиком (чертеж) зависимости доли W выделенного в течение 5 минут из облученной мишени нуклида 211At, от температуры возгонки, Т. ♦ - экспериментальные значения, кривая - результат аппроксимации функцией W=A/(1+B ехр(-K*Т)), где А=146.97, В=491.45, K=0.635/°С.

Осуществление изобретения

Радиофармацевтический препарат получают следующим образом. Радионуклид 211At нарабатывают с помощью ядерной реакции - 209Bi(α,2n)211At при бомбардировке толстой (200÷300 мкм) мишени из Bi естественного изотопного состава α-частицами с энргией (29÷31) МэВ. Выделение 211 At из облученной мишени проводят методом возгонки при температуре (700÷850)°С в течение (4÷6) минут, с его осаждением в слабощелочном (РН от 7.5 до 9) буферном физиологическом растворе, стабилизирующем устойчивые формы 211At, тройные к щитовидной железе (см. Примеры). В указанных примерах препарат «Астат-211» вводили лабораторным животным (крысам) в хвостовую вену объемом (0.3÷0.5) мл и активностью (80÷100) мкКи. Через три часа после введения животные подвергались эвтаназии. Содержание радионуклида 211At в щитовидной железе определялось методом сравнения скоростей счета от исследуемой щитовидной железы и эталона в колодезном счетчике (например, детектор для измерения гамма-излучения сцинтилляционный с колодцем на основе NaI(Tl) - 76 BP 76/3 (ORTEC, США) или аналоги). Известно, что значение накопления препарата в щитовидной железе на уровне 5%, позволяет достичь требуемого терапевтического эффекта при лечении онкологических заболеваний щитовидной железы (Yuminov О.А., Fotina O.V., Priselkova А.В., Tultaev A.V., Platonov S.Yu, Eremenko D.O., Drozdov V.A. «Internal dose assessment for 211 At alpha-emitter in isotonic solution as radiopharmaceutical», Nuclear Instruments and Methods in Physics Research B, (2003) V. 212, p. 516-520).

Дальнейшее повышение температуры возгонки относительно величины, характеризующей верхний предел заявленного интервала значений (850°С), нецелесообразно ввиду того, что уже при 800°С из облученной мишени в течение 5 мин выделяется более 98% наработанного радионуклида (см. чертеж). При возгонке 211 At из облученной висмутовой мишени используется лабораторная трубчатая печь, обеспечивающая указанный температурный режим и градиент температуры не более 10°С на 80 мм рабочей области (например, печь RT 50/250/13/В180 фирмы Nabertherm (Германия) или аналоги).

Полученный препарат представляет собой стерильный слабощелочной (РН от 7.5 до 9) физиологический раствор с 211At. Период полураспада 211At - 7.24 ч. 58% ядер 211At распадается в результате К-захвата с образованием изотопа 211Ро, который в свою очередь также распадается путем эмиссии α-частицы с энергией 7.45 МэВ и периодом полураспада 0.5 с; 42% ядер 211At испускают α-частицы с энергией 5.9 МэВ. Получаемый заявляемым способом радиофармацевтический препарат имеет следующие характеристики: удельная активность (на момент изготовления) - (1.0÷50.0) мКи/мл; радионуклидная чистота >98%; РН от 7.5 до 9.0. Перед использованием радиофармацевтического препарата для терапевтических целей его растворяют в физиологическом растворе с РН, соответствующим РН концентрированного радиофармацевтического препарата для достижения требуемой удельной активности. Затем препарат фасуют во флаконы для лекарственных средств, которые герметизируются резиновой пробкой и завальцовываются алюминиевым колпачком.

При реализации заявляемого способа получения радиофармацевтического препарата "Астат-211" возможно использование известных из уровня техники средств, в частности, использованных при возгонке вещества облученной мишени при его нагревании и осаждении паров, содержащих наработанный радионуклид, в жидкости (Основы аналитической химии, под редакцией академика. РАН Ю.А. Золотова, т. 1, М.: Высшая школа, 1996).

Использование радиофармацевтического препарата "Астат-211" для лечения онкологических заболеваний щитовидной железы осуществляют следующим образом. В организм пациента, имеющего медицинские показания к применению метода радиотерапии щитовидной железы, вводят внутривенно радиофармацевтический препарат "Астат-211" в количестве (10÷15) мл при удельной активности (1÷4) мКи/мл. Активность вводимого препарата определяют медицинскими показаниями. Препарат вводят однократно на курс лечения, который при необходимости повторяют через 30-60 дней до 3 раз в зависимости от достигнутого эффекта - резорбции опухоли. Контроль эффективности лечения проводят традиционными методами. Срок годности препарата 15 часов с момента изготовления.

Ниже представлены примеры реализации заявляемого изобретения.

Пример 1

Температура возгонки - 800°С.

Длительность выделения - 5 мин.

РН буферного физиологического раствора -6.0±0.5.

Накопление препарата в щитовидной железе лабораторных животных - (0.5±0.2) % от введенной активности (9 лабораторных животных).

Пример 2

Температура возгонки - 800°С.

Длительность выделения - 5 мин.

РН буферного физиологического раствора -8.5±0.5.

Накопление препарата в щитовидной железе лабораторных животных - (5.0±1.0) % от введенной активности (9 лабораторных животных).

Пример 3

Температура возгонки - 800°С.

Длительность выделения - 5 мин.

РН буферного физиологического раствора - 10.5±0.5.

Накопление препарата в щитовидной железе лабораторных животных - (1.0±0.3)% от введенной активности (9 лабораторных животных).

Пример 4

Температура возгонки - 700°С.

Длительность выделения - 15 мин.

РН буферного физиологического раствора - 8.5±0.5.

Накопление препарата в щитовидной железе лабораторных животных - (4.5±0.3)% от введенной активности (9 лабораторных животных).

Пример 5

Температура возгонки - 850°С

Длительность выделения - 4 мин.

РН буферного физиологического раствора - 8.5±0.5

Накопление препарата в щитовидной железе лабораторных животных - (4.0±0.3)% от введенной активности (9 лабораторных животных).

1. Способ получения радиофармацевтического препарата «Астат-211» из облученной мишени, включающий возгонку радионуклида 211At при температуре 700÷850°C в течение 4÷6 минут, с его осаждением в слабощелочном буферном физиологическом растворе с pH от 7.5 до 9, где в качестве мишени используют Bi естественного изотопного состава, который облучается α-частицами с энергией 29÷31 МэВ.

2. Способ по п. 1, характеризующийся тем, что осаждение паров, содержащих радионуклид 211At, осуществляют в процессе возгонки.



 

Похожие патенты:

Изобретение относится к области медицины, в частности к способу иммунотерапии солидных опухолей. Способ иммунотерапии солидных опухолей, заключающийся в вакцинации пациента комбинацией препарата экзосом и олигодезоксинуклеотида Р-типа, при этом препарат включает экзосомы, выделенные культурой клеток K562/i-S9, и содержит белок, антигены CEA, 5Т4, лиганды FasL и TRAIL, а олигодезоксинуклеотид Р-типа представляет собой последовательность нуклеотидов GGGGCGCCGTGATGGCGAGCGCGCC, указанную комбинацию вводят подкожно в течение не менее 2 месяцев и не реже 1 раза в неделю в эффективном количестве, предпочтительно в дозах 0,01-0,04 мг/кг каждый.

Группа изобретений относится к комбинированной терапии солидной опухоли или рака. Предложены: фармацевтический продукт в виде комбинированного препарата указанного назначения, содержащий в качестве активного агента {3-[5-(4-хлор-фенил)-1H-пирроло[2,3-b]пиридин-3-карбонил-2,4-дифтор-фенил]-амид}пропан-1-сульфоновой кислоты или его фармацевтически приемлемую соль и пег-интерферон альфа-2а; набор того же назначения, включающий вышеперечисленные активные агенты; применение {3-[5-(4-хлор-фенил)-1H-пирроло[2,3-b]пиридин-3-карбонил-2,4-дифтор-фенил]-амид}пропан-1-сульфоновой кислоты или его соли и пег-интерферона альфа-2а в лечении солидной опухоли или рака; применение {3-[5-(4-хлор-фенил)-1H-пирроло[2,3-b]пиридин-3-карбонил-2,4-дифтор-фенил]-амид}пропан-1-сульфоновой кислоты или его соли и пег-интерферона альфа-2а для производства лекарственного средства для лечения солидной опухоли или рака.

Изобретение относится к новым соединениям формулы 10 и способу их получения. Соединения обладают свойствами ингибиторов рецепторной тирозинкиназы типа I и могут быть использованы при лечении гиперпролиферативных нарушений.

Данное изобретение относится к соединениям или их фармацевтически приемлемым солям общей формулы I, где R1 представляет собой ;R2 выбирают из группы, состоящей из замещенного или незамещенного фенила и , и ; и R3, R4, R5 и R6 все представляют собой Н, также к соединениям II и III.

Изобретение относится к химиотерапии. Предложен способ лечения рака, отличающегося от меланомы, заключающийся в апоптозе раковых клеток.

Изобретение относится к медицине, а именно к онкологии, и касается лечения рака у человека. Для этого вводят соединение формулы в интервале суточных доз от 20 мг до 1500 мг.
Изобретение относится к медицине, а именно к онкологии. Сочетают хирургический метод лечения с интраоперационной внутриартериальной химиотерапией.

Изобретение относится к соединениям формулы I и их фармацевтически приемлемым солям, где R1, R2, R3, R4, R5 и R6 имеют значения, указанные в формуле изобретения. Соединения формулы I являются ингибиторами тирозинкиназ III типа, и, в частности, cFMS.

Настоящее изобретение относится к новым трициклическим производным пиррола формулы (I) или их фармацевтически приемлемым солям, которые модулируют активность протеинкиназ, выбранных из MPS1, PIM-1 и PIM-2.

Изобретение относится к ингибиторам HDAC формулы (I) или их фармацевтически приемлемым солям, эфирам или стереоизомерам, где R1 представляет собой водород или галоген; R2 представляет собой водород, C1-4-алкил; R3 представляет собой фенил, незамещенный или замещенный один, или два, или три раза галогеном, C1-4-алкилом, C1-4-алкокси, C1-4-алкилсульфонилом, циано, трифторметилом, фенилом, фенокси, пирролилом, имидазонилом, оксазолилом или ди C1-4-алкиламино-C1-4-алкокси; нафталинил; хинолинил; C3-7-циклоалкил; фенилалкил, где фенил может быть не замещен или один или два раза замещен галогеном, C1-4-алкокси, фенилом; нафталинилалкил; фенилциклоалкил; пиримидинил; фенилсульфонил, где фенил может быть не замещен или один или два раза замещен галогеном, фенилом; или фенилкарбонил, где фенил может быть не замещен или один или два раза замещен галогеном, C1-4-алкокси; R4 представляет собой водород или C1-4-алкил; Y представляет собой -СН2- или -С=O; или R4 и Y вместе с атомом углерода, к которому R4 присоединен, могут образовывать фенильное кольцо или пиридиновое кольцо, которое может быть не замещено или дополнительно замещено галогеном; при условии, что R2 представляет собой C1-4алкил; А представляет собой -С=O, -СН2- или -СН-алкил, при условии, что А и Y одновременно не представляют собой -С=O.

Изобретение относится к фармацевтической промышленности, а именно к способу производства Крофелемера, включающему определенные стадии. Стадия А включает выделение частично очищенного Крофелемера путем перемешивания смеси сырого латекса растительного происхождения или вымороженного порошка латекса растительного происхождения и воды при температуре в диапазоне от 35°С до 45°С.

Изобретение относится к области медицины и касается средств для коррекции дисбиотических нарушений микробиоценоза желудочно-кишечного тракта. Предлагаемая синбиотическая композиция выполнена в твердой дозированной форме в виде капсул и включает, мас.

Изобретение относится к полиглицериновым загустителям и составам, содержащим полиглицериновые загустители, которые могут применяться в разнообразных целях, включая гигиену тела человека.

Настоящее изобретение относится к области биотехнологии, конкретно к применению полипептида, меченного радиоактивной меткой 99mTс, для визуализации экспрессии рецептора человеческого эпидермального фактора роста 2 типа (HER2), и может быть использовано в диагностике опухолевых заболеваний.

Изобретение относится к способам получения полиглицериновых загустителей. Описан способ получения полиглицериновой композиции, включающий взаимодействие одного или более глицериновых мономеров с инициатором полимеризации, представляющим собой диэфир глюкозидов формулы:, где Z представляет собой узловую структуру, такую как производное метилглюкозы; каждая Nu представляет собой полинуклеофильную группу, содержащую -ОН; каждая Hphob представляет собой гидрофобную группу, такую как олеат; каждая L′ представляет собой первичную связывающую группу, такую как -О-; h принимает значения от 1 до 12; b принимает значения от 1 до 11; h+b равно, по меньшей мере, 4 и h/h+b составляет более 0,35.

Настоящее изобретение относится к соединению, характеризующемуся Формулой I: где: Z представляет собой узловую структуру, представляющую собой полинуклеофильный остаток, полученный из метилглюкозида, сорбитана, диглицерина или триглицерина; каждая G представляет собой независимо выбранную группу (поли)глицерина; каждая (Hphob) представляет собой независимо выбранную гидрофобную функциональную группу, представляющую собой олеат; каждая группа L, L′, и L″ представляет собой -О-; каждая (Nu) представляет собой независимо выбранную нуклеофильную группу; x принимает значения от 1 до 12; h принимает значения от 0 до 11; y принимает значения от 0 до 5; а принимает значения от 0 до 11; сумма x+h+a принимает значения от 4 до 12; и сумма h+y принимает значения от 1 до 12, при условии, что если Z является полинуклеофильным остатком, полученным из сорбитана, то x составляет от 1 до 3, h=1, а составляет от 0 до 2, у составляет от 1 до 3, и x+h+a+y=4.

Изобретение относится к средству для профилактики и лечения фосфатного нефролитиаза. Указанное средство представляет собой экстракт сбора из лекарственного растительного сырья, где сбор включает 1-3 ч.
Изобретение относится к фармацевтической промышленности, а именно к средству, обладающему иммуномодулирующим и противовирусным действием. Средство, обладающее иммуномодулирующим и противовирусным действием в виде мази, которая содержит вазелин медицинский, ланолин безводный, персиковое масло, альфа-токоферола ацетат, интерферон альфа-2b человеческий рекомбинантный, аскорбиновую кислоту, раствор альбумина сывороточного человеческого 10%, кальция пантотенат, воду очищенную, взятые в определенном количестве.
Настоящее изобретение относится к гелю для обнаружения зубного налета, подходящему для применения в полости рта, включающему 0,2-1,5 мас.% ксантановой камеди, 0,2-3 мас.% карбоксиметилцеллюлозы и краситель в концентрации, достаточной для видимого окрашивания зубного налета после нанесения геля, где указанный гель имеет предел текучести в модели Гершеля-Балкли от 30 до 45 дин/см2, вязкость в модели Гершеля-Балкли составляет от 30 до 45 Пуаз, и индекс течения в модели Гершеля-Балкли составляет от 0,5 до 0,6.

Группа изобретений относится к области косметологии и описывает косметическую композицию и косметический способ макияжа и/или ухода за кожей. Композиция характеризуется тем, что включает смесь гидрофобных частиц аэрогеля диоксида кремния и смесь двух масел на основе углеводородов, причем первое масло выбирают из изогексадекана, изододекана или смеси по меньшей мере двух разных линейных алканов, которые предпочтительно являются летучими, содержащих от 10 до 14 атомов углерода и отличающихся друг от друга числом атомов углерода на по меньшей мере 1, второе масло выбирают пентаэритритилтетраоктаноата, гидрогенизированных полиизобутенов, жидких фракций масла ши, изостеарилнеопентаноата, абрикосового масла и их смесей.
Изобретение относится к фармацевтической промышленности, в частности к лекарственному составу, обладающему антибактериальным действием. Натуральный лекарственный состав, обладающий антибактериальным действием в отношении бактерий птичьего происхождения, содержит растительный активный ингредиент на основе таннина в комбинации с носителями, причем указанный растительный активный ингредиент представляет собой природный экстракт каштана (Castanea sativa). Лекарственный крем. Лекарственный порошок. Лекарственная мазь. Лекарственная суспензия. Лекарственные капсулы. Применение лекарственного состава. Вышеописанные составы обладают выраженным антибактериальным действием в отношении бактерий птичьего происхождения. 7 н.п. ф-лы, 2 табл., 2 пр.
Наверх