Способы лечения с использованием селективных ингибиторов bcl-2



Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2
Способы лечения с использованием селективных ингибиторов bcl-2

 


Владельцы патента RU 2593231:

ЭббВи Айэленд Анлимитед Компани (BM)

Группа изобретений относится к медицине, фармакологии и касается применения 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамида, или 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-гидрокси-4-метилциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамида, или их фармацевтически приемлемых солей для получения лекарственного средства. Данное средство может быть использовано для лечения аутоиммунных заболеваний - системной красной волчанки, волчаночного нефрита или синдрома Шегрена у пациента, которому вводят терапевтически эффективное количество такого средства, например, в пределах от 0,001 мг/кг до 1000 мг/кг. Лекарственное средство может быть использовано в комбинации со связующим белком для дополнительного повышения эффективности соединения в желаемом месте действия. Изобретения обеспечивают наиболее избирательное ингибирование активности антиапоптозных белков Bcl-2 с наиболее низкой аффинностью, чем ингибирование активности других белков семейства Bcl-2, включая Bcl-xL, что требует меньших доз используемых соединений. 2 н. и 10 з.п. ф-лы, 9 пр., 12 ил., 4 табл.

 

Информация о родственных заявках

Настоящая заявка испрашивает приоритет заявки на патент США № 61/416689, поданной 23 ноября 2010, содержание которой включено в настоящий документ посредством ссылки.

Область техники, к которой относится изобретение

Настоящее изобретение относится к способам лечения системной красной волчанки, волчаночного нефрита и синдрома Шегрена с использованием соединений, которые избирательно ингибируют активность антиапоптозных белков Bcl-2. В частности, настоящее изобретение относится к лечению с использованием соединений, которые избирательно ингибируют активность белков Bcl-2 с более низкой аффинностью, чем для ингибирования активности других белков семейства Bcl-2, включая Bcl-xL.

Уровень техники

Антиапоптозные белки Bcl-2 ассоциированы с рядом заболеваний. Следовательно, в терапевтических областях имеется существующая потребность в соединениях, которые ингибируют активность антиапоптозных белков Bcl-2. Семейство белков Bcl-2 является ключевым регулятором зависимого от митохондрий апоптоза ядерных клеток и состоит из антиапоптозных (Bcl-xL, Bcl-2, Bcl-w, A1, Mcl-1) и проапоптозных (Bak, Bax, Bid, Bim, Bad, Bik, Bmf, Noxa, Puma) членов.

В общем, экспрессия белка Bcl-1 ассоциирована со многими физиологическими функциями, включая ингибирование апоптоза в организме, приводящего в некоторых случаях к пролиферации клеток, на которые оказывает воздействие ингибирование Bcl-2. По существу, ингибирование белка Bcl-2 может снизить пролиферацию клеток, приводя к улучшенным результатам при лечении и профилактике рака.

Описано участие белков Bcl-2 в развитии рака мочевого пузыря, рака головного мозга, рака молочной железы, рака костного мозга, рака шейки матки, хронического лимфоцитарного лейкоза, колоректального рака, рака пищевода, гепатоцеллюлярного рака, лимфобластного лейкоза, фолликулярной лимфомы, лимфоидных новообразований Т-клеточного или В-клеточного происхождения, меланомы, миелогенного лейкоза, миеломы, рака ротовой полости, рака яичников, немелкоклеточного рака легких, рака предстательной железы, мелкоклеточного рака легких, рака селезенки и тому подобное в одновременно находящейся на рассмотрении PCT заявке на патент США 2004/36770, опубликованной как WO 2005/049593, и PCT US 2004/37911, опубликованной как WO 2005/024636.

Сущность изобретения

Один вариант осуществления настоящего изобретения относится к способу лечения системной красной волчанки (SLE) или волчаночного нефрита введением терапевтически эффективного количества соединения, которое избирательно ингибирует белки Bcl-2. Селективные ингибиторы Bcl-2 обычно имеют следующую формулу (I):

где

А1 представляет собой N или CH;

В1 представляет собой OR1 или NHR1;

Y1 представляет собой CN, NO2, CF3, F или Cl;

R1 представляет собой (CH2)nR2;

R2 представляет собой циклоалкил или гетероциклил; где гетероциклил и циклоалкил необязательно замещены одним или более независимо выбранными R4, OR4, OH, CN или F;

R3 представляет собой гетероарил; где гетероарил необязательно замещен одним или более независимо выбранными NH2, Cl или F;

R4 представляет собой алкил, циклоалкил, гетероциклил или спирогетероциклил; где алкил необязательно замещен одним или более F;

R5 представляет собой дейтерий;

каждый R6 независимо выбран из СН3, спироциклопропила и ОН;

m равно 0, 1, 2, 3, 4, 5 или 6;

n равно 0 или 1; и

p равно 0, 1 или 2.

Способ лечения SLE или волчаночного нефрита также может включать введение фармацевтически приемлемой соли селективного ингибитора Bcl-2. Обычно селективный ингибитор Bcl-2 имеет аффинность связывания (Ki) ниже чем примерно 1 нМ для Bcl-2. В еще одном варианте осуществления селективный ингибитор Bcl-2 имеет аффинность связывания (Ki) ниже чем примерно 100 пмоль для Bcl-2. Селективный ингибитор Bcl-2 также может иметь аффинность связывания (Ki) для Bcl-2, которая примерно в 500 раз ниже, чем аффинность связывания для Bcl-xL. В данном варианте осуществления селективный ингибитор Bcl-2 может включать N-({5-хлор-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индазол-4-ил)окси]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-{[4-({[(2S)-4-циклопропилморфолин-2-ил]метил}амино)-3-нитрофенил]сульфонил}-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({5-хлор-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индол-5-ил)окси]-N-({4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]-3-нитрофенил}сульфонил)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4,4-дифторциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-(1Н-бензимидазол-4-илокси)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-фтор-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({3-хлор-4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]фенил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-(1Н-бензимидазол-4-илокси)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-цианоциклогексил)метил]амино}-3-нитрофенил)сульфонил)бензамид; N-({5-хлор-6-[(цис-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси)бензамид; N-[(3-хлор-4-{[4-фтор-1-(оксетан-3-ил)пиперидин-4-ил]метокси}фенил)сульфонил]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-циано-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-2-(1Н-индол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)- N-[(4-{[(4-фтортетрагидро-2Н-пиран-4-ил)метил]амино}-3-нитрофенил)сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({3-хлор-4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]фенил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-фтор-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-2-(1Н-индазол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-{[4-({[(2R)-4-циклопропилморфолин-2-ил]метил}амино)-3-нитрофенил]сульфонил}-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-цианоциклогексил]метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; транс-2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-морфолин-4-илциклогексил)амино]-3-нитрофенил}сульфонил)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-{[4-({(3R)-1-[2-фтор-1-(фторметил)этил]пирролидин-3-ил}амино)-3-нитрофенил]сульфонил}-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; транс-N-({5-хлор-6-[(4-гидроксициклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси)бензамид; N-({3-хлор-4-[(транс-4-гидроксициклогексил)метокси]фенил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({5-хлор-6-[(транс-4-гидроксициклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индазол-4-ил)окси]бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[транс-4-(морфолин-4-ил)циклогексил]амино}-3-нитрофенил)сульфонил]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(цис-4-гидрокси-4-метилциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-циано-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-2-(1Н-индазол-4-илокси)бензамид; N-[(5-хлор-6-{[4-фтор-1-(оксетан-3-ил)пиперидин-4-ил]метокси}пиридин-3-ил)сульфонил]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-метилпиперазин-1-ил)амино]-3-нитрофенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; транс-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-метоксициклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; транс-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-морфолин-4-илциклогексил)амино]-3-нитрофенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]-3-нитрофенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(3R)-1-(2,2-дифторэтил)пирролидин-3-ил]амино}-3-нитрофенил)сульфонил]бензамид; N-({5-хлор-6-[(транс-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси]бензамид; N-({5-хлор-6-[(цис-1-фтор-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси]бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-метоксициклогексил)метил]амино}-3-нитрофенил)сульфонил]бензамид; N-({5-хлор-6-[(транс-1-фтор-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-гидрокси-4-метилциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-[(3-амино-1Н-индазол-4-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-метоксициклогексил)метил]амино}-3-нитрофенил)сульфонил]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(2-оксаспиро[3.5]нон-7-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-циано-6-[(транс-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-2-(1Н-индазол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индол-5-ил)окси]-N-{[3-нитро-4-({[4-(оксетан-3-ил)морфолин-2-ил]метил}амино)фенил]сульфонил)бензамид; N-({5-хлор-6-[(транс-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индазол-4-ил)окси]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(5-циано-6-{[4-фтор-1-(оксетан-3-ил)пиперидин-4-ил]метокси}пиридин-3-ил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-гидроксициклогексил)метил]амино}-3-нитрофенил)сульфонил]бензамид; N-({5-хлор-6-[(транс-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-2-[(3-хлор-1Н-индазол-4-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)бензамид; 4-[4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}(2Н8)пиперазин-1-ил]-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({5-хлор-6-[(транс-1-фтор-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(6-{[(цис-4-гидрокси-4-метилциклогексил)метил]амино}-5-нитропиридин-3-ил)сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-нитро-6-[(тетрагидро-2Н-пиран-4-илметил)амино]пиридин-3-ил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({6-[(транс-4-гидрокси-4-метилциклогексил)метокси]-5-(трифторметил)пиридин-3-ил}сульфонил)-2-(1Н-индазол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(цис-4-этил-4-гидроксициклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; и 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индол-5-илокси)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)бензамид.

Другой вариант осуществления настоящего изобретения относится к способу лечения синдрома Шегрена введением терапевтически эффективного количества соединения, которое избирательно ингибирует белки Bcl-2. Селективные ингибиторы Bcl-2 обычно имеют следующую формулу (I):

где

А1 представляет собой N или CH;

В1 представляет собой OR1 или NHR1;

Y1 представляет собой CN, NO2, CF3, F или Cl;

R1 представляет собой (CH2)nR2;

R2 представляет собой циклоалкил или гетероциклил; где гетероциклил и циклоалкил необязательно замещены одним или более независимо выбранными R4, OR4, OH, CN или F;

R3 представляет собой гетероарил; где гетероарил необязательно замещен одним или более независимо выбранными NH2, Cl или F;

R4 представляет собой алкил, циклоалкил, гетероциклил или спирогетероциклил; где алкил необязательно замещен одним или более F;

R5 представляет собой дейтерий;

каждый R6 независимо выбран из СН3, спироциклопропила и ОН;

m равно 0, 1, 2, 3, 4, 5 или 6;

n равно 0 или 1; и

p равно 0, 1 или 2.

Способ лечения синдрома Шегрена может также включать введение фармацевтически приемлемой соли селективного ингибитора Bcl-2. Обычно селективный ингибитор Bcl-2 имеет аффинность связывания (Ki) ниже чем примерно 1 нМ для Bcl-2. В еще одном варианте осуществления селективный ингибитор Bcl-2 имеет аффинность связывания (Ki) ниже чем примерно 100 пмоль для Bcl-2. Селективный ингибитор Bcl-2 также может иметь аффинность связывания (Ki) для Bcl-2, которая примерно в 500 раз ниже, чем аффинность связывания (Ki) для Bcl-xL. В данном варианте осуществления селективный ингибитор Bcl-2 может включать N-({5-хлор-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индазол-4-ил)окси]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-{[4-({[(2S)-4-циклопропилморфолин-2-ил]метил}амино)-3-нитрофенил]сульфонил}-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({5-хлор-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индол-5-ил)окси]-N-({4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]-3-нитрофенил}сульфонил)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4,4-дифторциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-(1Н-бензимидазол-4-илокси)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-фтор-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({3-хлор-4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]фенил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-(1Н-бензимидазол-4-илокси)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-цианоциклогексил)метил]амино}-3-нитрофенил)сульфонил)бензамид; N-({5-хлор-6-[(цис-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси)бензамид; N-[(3-хлор-4-{[4-фтор-1-(оксетан-3-ил)пиперидин-4-ил]метокси}фенил)сульфонил]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-циано-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-2-(1Н-индол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-фтортетрагидро-2Н-пиран-4-ил)метил]амино}-3-нитрофенил)сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({3-хлор-4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]фенил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-фтор-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-2-(1Н-индазол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-{[4-({[(2R)-4-циклопропилморфолин-2-ил]метил}амино)-3-нитрофенил]сульфонил}-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-цианоциклогексил]метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; транс-2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-морфолин-4-илциклогексил)амино]-3-нитрофенил}сульфонил)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-{[4-({(3R)-1-[2-фтор-1-(фторметил)этил]пирролидин-3-ил}амино)-3-нитрофенил]сульфонил}-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; транс-N-({5-хлор-6-[(4-гидроксициклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси)бензамид; N-({3-хлор-4-[(транс-4-гидроксициклогексил)метокси]фенил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({5-хлор-6-[(транс-4-гидроксициклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индазол-4-ил)окси]бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[транс-4-(морфолин-4-ил)циклогексил]амино}-3-нитрофенил)сульфонил]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(цис-4-гидрокси-4-метилциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-циано-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-2-(1Н-индазол-4-илокси)бензамид; N-[(5-хлор-6-{[4-фтор-1-(оксетан-3-ил)пиперидин-4-ил]метокси}пиридин-3-ил)сульфонил]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-метилпиперазин-1-ил)амино]-3-нитрофенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; транс-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-метоксициклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; транс-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-морфолин-4-илциклогексил)амино]-3-нитрофенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]-3-нитрофенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(3R)-1-(2,2-дифторэтил)пирролидин-3-ил]амино}-3-нитрофенил)сульфонил]бензамид; N-({5-хлор-6-[(транс-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси]бензамид; N-({5-хлор-6-[(цис-1-фтор-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси]бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-метоксициклогексил)метил]амино}-3-нитрофенил)сульфонил]бензамид; N-({5-хлор-6-[(транс-1-фтор-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-гидрокси-4-метилциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-[(3-амино-1Н-индазол-4-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-метоксициклогексил)метил]амино}-3-нитрофенил)сульфонил]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(2-оксаспиро[3.5]нон-7-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-циано-6-[(транс-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-2-(1Н-индазол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индол-5-ил)окси]-N-{[3-нитро-4-({[4-(оксетан-3-ил)морфолин-2-ил]метил}амино)фенил]сульфонил)бензамид; N-({5-хлор-6-[(транс-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индазол-4-ил)окси]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(5-циано-6-{[4-фтор-1-(оксетан-3-ил)пиперидин-4-ил]метокси}пиридин-3-ил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-гидроксициклогексил)метил]амино}-3-нитрофенил)сульфонил]бензамид; N-({5-хлор-6-[(транс-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-2-[(3-хлор-1Н-индазол-4-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)бензамид; 4-[4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}(2Н8)пиперазин-1-ил]-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({5-хлор-6-[(транс-1-фтор-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(6-{[(цис-4-гидрокси-4-метилциклогексил)метил]амино}-5-нитропиридин-3-ил)сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-нитро-6-[(тетрагидро-2Н-пиран-4-илметил)амино]пиридин-3-ил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({6-[(транс-4-гидрокси-4-метилциклогексил)метокси]-5-(трифторметил)пиридин-3-ил}сульфонил)-2-(1Н-индазол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(цис-4-этил-4-гидроксициклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; и 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индол-5-илокси)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)бензамид.

Краткое описание фигур

На фигуре 1 показано (А) влияние обработки неселективным ингибитором Bcl-2 (соединение 2) на число лимфоцитов (слева) и число тромбоцитов (справа), а также влияние (В) обработки селективным ингибитором (соединение 1) на число лимфоцитов (слева) и число тромбоцитов (справа) в периферической крови мышей (NZB×NZW)F1. Фигуры (C), (D), (E), (F), (G), (H) и (I) дополнительно иллюстрируют влияние соединений 1, 17, 5, 7, 8, 9 и 12, соответственно, на число лимфоцитов (слева) и число тромбоцитов (справа) в периферической крови мышей C57BL/6.

На фигуре 2 показано влияние обработки селективным ингибитором Bcl-2 (соединение 3) у мышей на лимфоциты и тромбоциты. В частности, на фигуре 2 показано влияние обработки мышей NZBWF1 соединением 3 в дозах 30 мг/кг и 100 мг/кг по сравнению с обработкой носителем phosal, используемым в качестве контроля, и также показана экспозиция соединения 3, которая оценивалась через 24 ч после введения последней дозы.

На фигуре 3 показано снижение числа Т-клеток и В-клеток у мышей, обработанных селективным ингибитором Bcl-2 (соединение 3) в различных дозах, по сравнению с обработкой носителем phosal. В частности, на фигуре 3 показано снижение числа CD4+ Т-клеток, CD8+ Т-клеток и CD19+ В-клеток у мышей, обработанных соединением 3 в дозах, включающих 30 мг/кг, 100 мг/кг и 300 мг/кг.

На фигуре 4 показана эффективность обработки селективным ингибитором Bcl-2 (соединением 1) на спонтанной мышиной модели (NZB×NZW)F1 волчанки при оценке по (А) частоте проявления тяжелой протеинурии (PU ≥300 мг/дл) и (В) кумулятивной выживаемости Каплана-Мейера. На фигуре 4 дополнительно показана эффективность обработки селективным ингибитором Bcl-2 (соединением 17) на спонтанной мышиной модели (NZB×NZW)F1 волчанки при оценке по (С) частоте проявления тяжелой протеинурии (PU ≥300 мг/дл) и (D) кумулятивной выживаемости Каплана-Мейера. Звездочки обозначают статистическую значимость P<0,05.

На фигуре 5 показано влияние обработки селективным ингибитором Bcl-2 (соединением 1), а также обработки микофенолата мофетилом (MMF) на подавление продукции титра анти-дц ДНК-антител на спонтанной модели SLE для соединения 1 в дозах 30 мг/кг и 100 мг/кг, и для MMF в дозе 100 мг/кг по сравнению с контрольными носителями. Звездочки обозначают статистическую значимость P<0,05.

На фигуре 6 приведены репрезентативные снимки, показывающие снижение количества инфильтратов в ткани почек мышей со спонтанным волчаночным нефритом, после введения селективного ингибитора Bcl-2 (соединения 1) по данным гистологической оценки. Увеличение 200×.

На фигуре 7 показаны изменения в баллах гистологической оценки ткани почек, обработанной по одной из трех схем обработки: обработка носителем, обработка соединением 1 в дозе 30 мг/кг и 100 мг/кг, и обработка MMF в дозе 100 мг/кг, по детектированию гистологических признаков гломерулонефрита, изменений канальцев и периваскулярных инфильтратов. В частности, на фигуре 7 показано статистически достоверное ослабление гломерулонефрита, изменений канальцев и периваскулярных инфильтратов у мышей, обработанных соединением 1 в дозах 30 мг/кг и 100 мг/кг.

На фигуре 8 показано отложение иммуноглобулина G (IgG), В-клеток и Т-клеток в ткани почек у мышей со спонтанным волчаночным нефритом, которым вводили носитель phosal, соединение 1 в дозах 30 мг/кг и 100 мг/кг и MMF в дозе 100 мг/кг. В частности, у мышей, обработанных соединением 1, наблюдали снижение отложения IgG, В-клеток и Т-клеток по сравнению с носителем phosal.

На фигуре 9 показана эффективность обработки селективным ингибитором Bcl-2 (соединением 1), MMF и BAFFR3-Ig на модели IFNα-индуцированной SLE, которую оценивали по (А) частоте проявления тяжелой протеинурии (PU ≥300 мг/дл) и (В) кумулятивной выживаемости Каплана-Мейера. Звездочки обозначают статистическую значимость P<0,05.

На фигуре 10 показана продукция анти-дц ДНК-антител у IFNα-индуцированных мышей (NZB×NZW)F1, обработанных селективным ингибитором Bcl-2 (соединением 1) в пределах доз 3-30 мг/кг, по сравнению с контрольным носителем по данным уровня иммуноглобулина G (IgG).

На фигуре 11 приведены репрезентативные снимки, показывающие снижение количества перидуктулярных инфильтратов в подчелюстной слюнной железе на спонтанной мышиной модели после обработки селективным ингибитором Bcl-2 (соединением 1), увеличение 200×.

На фигуре 12 показаны изменения в баллах гистологических исследований ткани подчелюстной слюнной железы, обработанной по одной из трех схем обработки: обработка носителем phosal, обработка селективным ингибитором Bcl-2 (соединением 1) в дозе 10 мг/кг и обработка соединением 1 в дозе 30 мг/кг и 100 мг/кг.

Подробное описание изобретения

Способы по настоящему изобретению направлены на лечение различных болезненных состояний путем введения пациенту, нуждающемуся в этом, терапевтически эффективного количества селективного ингибитора Bcl-2. Экспрессия Bcl-2 может играть роль в развитии и прогрессировании болезненных состояний, ассоциированных с рядом аутоиммунных расстройств. Ингибирование белка Bcl-2 также может оказывать положительное влияние на лечение аутоиммунных заболеваний, включающих системную красную волчанку (SLE), волчаночный нефрит и синдром Шегрена.

Участие белков Bcl-2 в развитии иммунных и аутоиммунных заболеваниях описано в публикациях Current Allergy and Asthma Reports 2003, 3, 378-384; British Journal of Haematology 2000, 110(3), 584-590; Blood, 2000, 95(4), 1283-1290; и New England Journal of Medicine 2004, 351(14), 1409-1418. Вовлечение белков Bcl-2 в развитие артрита раскрыто в одновременно находящейся на рассмотрении предварительной заявке на патент США № 60/988479. Участие белков Bcl-2 в отторжении трансплантата костного мозга раскрыто в одновременно находящейся на рассмотрении предварительной заявке на патент США № 11/941196.

Если в настоящем описании не указано иное, то научные и технические термины, использованные в настоящем изобретении, будут иметь значения, которые обычно понимаются специалистами в данной области. Значение и объем терминов должны быть недвусмысленными, однако в случае любой скрытой неопределенности определения, приведенные в настоящем документе, будут иметь преимущества над любым словарным или внешним определением. В настоящей заявке использование «или» означает «и/или», если не указано иное. Кроме того, использование термина «включая», а также других форм, таких как «включает» и «включенный», не является ограничивающим. При обращении к использованию слов «содержать», или «содержит», или «содержащий» в настоящей патентной заявке (включая формулу изобретения) заявители отмечают, что если по контексту не требуется иное, то данные слова используются на основе и четкого понимания, что они в большей степени интерпретируются как включительно, а не исключительно, и заявители подразумевают интерпретировать каждое из этих слов, таким образом, в толковании настоящей патентной заявки, включая формулу изобретения, приведенную ниже. В отношении переменной, которая имеет место более чем один раз в любом заместителе или в соединении по изобретению, или любых других формулах, приведенных в настоящем документе, то ее определение в каждом случае не зависит от ее определения в другом случае. Комбинации заместителей допустимы, если только такие комбинации приводят к стабильным соединениям. Стабильные соединения представляют собой соединения, которые можно выделить с подходящей степенью чистоты из реакционной смеси.

Термины «лечить», «проводить лечение» и «лечение» относятся к способу ослабления или отмены заболевания и/или его сопутствующих симптомов.

Термины «предупреждать», «предупреждение» и «профилактика» относятся к способу предупреждения начала заболевания и/или его сопутствующих симптомов или к способу защиты субъекта от развития у него заболевания. Используемые в настоящем документе термины «предупреждать», «предупреждение» и «профилактика» также включают замедление начала заболевания и/или его сопутствующих симптомов и снижение риска развития у субъекта заболевания.

Термин «терапевтически эффективное количество» относится к такому количеству соединения, введения которого достаточно для предупреждения развития или ослабления до некоторой степени одного или более симптомов состояния или расстройства, которое подвергается лечению.

Термин «модулировать» относится к способности соединения повышать или снижать функцию или активность белка Bcl-2.

Используемый в настоящем описании термин «композиция» предназначен для включения продукта, содержащего определенные ингредиенты в определенных количествах, а также любого продукта, который получен, прямо или опосредованно, из комбинации определенных ингредиентов в определенных количествах. Под выражением «фармацевтически приемлемый» понимается, что носитель, разбавитель или эксципиент должен быть совместим с другими ингредиентами композиции и не должен оказывать вредного действия на его реципиента.

Термин «субъект» предназначен в настоящем описании для включения животных, таких как млекопитающие, включая, но не ограничиваясь ими, приматов (например, людей), коров, овец, коз, лошадей, собак, кошек, кроликов, крыс, мышей и тому подобное. В подходящих вариантах осуществления субъектом является человек.

Болезненные состояния, которые можно лечить способами по настоящему изобретению, включают состояния, которые возникают в результате аутоиммунного и воспалительного процесса, в частности, системной красной волчанки (SLE), волчаночного нефрита, синдрома Шегрена и их комбинаций. SLE представляет собой хроническое системное аутоиммунное заболевание (или аутоиммунное заболевание соединительной ткани), которое оказывает влияние на любую систему организма. Как это имеет место при других аутоиммунных заболеваниях, иммунная система атакует клетки и ткань организма, приводя к воспалению и повреждению ткани. Наиболее часто при SLE поражается сердце, суставы, кожа, легкие, кровеносные сосуды, печень, почки и нервная система. Следовательно, болезненные состояния, при которых SLE поражает почки, можно назвать волчаночным нефритом. Кроме того, синдром Шегрена, также известный как «болезнь Микулича» и «синдром сухого глаза», является системным аутоиммунным заболеванием, при котором иммунные клетки атакуют и разрушают экзокринные железы, которые вырабатывают слезы и слюну. По существу, пациенты, страдающие синдромом Шегрена, как правило, страдают пониженной способностью адекватно продуцировать слюну и слезы, что приводит к неадекватной сухости в ротовой полости и сухости в глазах. Соответственно, в одном варианте осуществления способы по настоящему изобретению относятся к лечению SLE и волчаночного нефрита. В еще одном варианте осуществления способы по изобретению относятся к лечению синдрома Шегрена.

Как отмечалось, способы по настоящему изобретению включают лечение селективным ингибитором Bcl-2. Важно отметить, что термин «Ki» используется в качестве объективной оценки сравнительной аффинности связывания. Соединение, которое имеет более высокую аффинность связывания для субстрата-мишени по сравнению со вторым субстратом, будет иметь значение Ki для субстрата-мишени, которое ниже, чем для второго субстрата. Это обусловлено тем фактом, что соединение обладает более высокой аффинностью для субстрата-мишени, и меньшая концентрация соединения необходима для связывания и проявления эффекта на субстрате-мишени по сравнению со вторым субстратом. Например, селективные ингибиторы Bcl-2 имеют более высокую аффинность для белков Bcl-2 по сравнению с белками Bcl-xL, означая, что требуется меньшая концентрация селективного ингибитора Bcl-2 для проявления эффекта на ингибиторе Bcl-2 по сравнению с концентрацией, необходимой для проявления эффекта на белках Bcl-xL. Как указывается в настоящем документе, выражение, утверждающее, что соединение имеет аффинность конкурентного связывания (Ki) для Bcl-2 ниже, чем аффинность связывания (Ki) для Bcl-xL, следует понимать, что соединение имеет более селективную аффинность для Bcl-2, чем для Bcl-xL, о чем свидетельствует значение Ki для Bcl-2, которое ниже, чем значение Ki для Bcl-xL.

В частности, выражение «селективный ингибитор Bcl-2» относится к соединениям, которые имеют аффинность связывания (Ki) (а) ниже чем примерно 500 нМ, ниже чем примерно 400 нМ, ниже чем примерно 300 нМ, ниже чем примерно 200 нМ, ниже чем примерно 100 нМ, ниже чем примерно 50 нМ, ниже чем примерно 25 нМ, ниже чем примерно 10 нМ, ниже чем примерно 5 нМ, ниже чем примерно 1 нМ, ниже чем примерно 900 пмоль, ниже чем примерно 800 пмоль, ниже чем примерно 700 пмоль, ниже чем примерно 600 пмоль, ниже чем примерно 500 пмоль, ниже чем примерно 400 пмоль, ниже чем примерно 300 пмоль, ниже чем примерно 200 пмоль, ниже чем примерно 100 пмоль, ниже чем примерно 50 пмоль для Bcl-2; и (b) аффинность конкурентного связывания (Ki) для Bcl-2, которая по меньшей мере примерно в 500, по меньшей мере примерно в 1000, по меньшей мере примерно в 2000, по меньшей мере примерно в 2500, по меньшей мере примерно в 3500 и по меньшей мере примерно в 4000 раз ниже, чем аффинность связывания (Ki) для Bcl-xL. В некоторых вариантах осуществления настоящего изобретения соединения, являющиеся селективными ингибиторами Bcl-2, которые можно использовать в способах по настоящему изобретению, представляют собой соединения, имеющие аффинность связывания (Ki) ниже чем примерно 100 пмоль для Bcl-2, и аффинность связывания (Ki) для Bcl-2, которая примерно в 500 раз ниже, чем аффинность связывания для Bcl-xL, аффинность связывания (Ki) ниже чем примерно 100 пмоль для Bcl-2, и аффинность связывания (Ki) для Bcl-2, которая примерно в 1000 раз ниже, чем аффинность связывания для Bcl-xL, аффинность связывания (Ki) ниже чем примерно 100 пмоль для Bcl-2, и аффинность связывания (Ki) для Bcl-2, которая примерно в 2000 раз ниже, чем аффинность связывания для Bcl-xL, аффинность связывания (Ki) ниже чем примерно 100 пмоль для Bcl-2, и аффинность связывания (Ki) для Bcl-2, которая примерно в 2500 раз ниже, чем аффинность связывания для Bcl-xL, аффинность связывания (Ki) ниже чем примерно 100 пмоль для Bcl-2, и аффинность связывания (Ki) для Bcl-2, которая примерно в 3000 раз ниже, чем аффинность связывания для Bcl-xL, аффинность связывания (Ki) ниже чем примерно 100 пмоль для Bcl-2, и аффинность связывания (Ki) для Bcl-2, которая примерно в 3500 раз ниже, чем аффинность связывания для Bcl-xL, аффинность связывания (Ki) ниже чем примерно 100 пмоль для Bcl-2, и аффинность связывания (Ki) для Bcl-2, которая примерно в 4000 раз ниже, чем аффинность связывания для Bcl-xL.

Соединения, представляющие собой селективные ингибиторы Bcl-2, которые можно использовать в способах по настоящему изобретению, в общем можно рассматривать как любое соединение, имеющее следующую формулу (I):

где

А1 представляет собой N или CH;

В1 представляет собой OR1 или NHR1;

Y1 представляет собой CN, NO2, CF3, F или Cl;

R1 представляет собой (CH2)nR2;

R2 представляет собой циклоалкил или гетероциклил; где гетероциклил и циклоалкил необязательно замещены одним или более независимо выбранными R4, OR4, OH, CN или F;

R3 представляет собой гетероарил; где гетероарил необязательно замещен одним или более независимо выбранными NH2, Cl или F;

R4 представляет собой алкил, циклоалкил, гетероциклил или спирогетероциклил; где алкил необязательно замещен одним или более F;

R5 представляет собой дейтерий;

каждый R6 независимо выбран из СН3, спироциклопропила и ОН;

m равно 0, 1, 2, 3, 4, 5 или 6;

n равно 0 или 1; и

p равно 0, 1 или 2.

Способы получения селективных ингибиторов Bcl-2, таких как те, которые охвачены формулой (I) и которые можно использовать в способах по настоящему изобретению, описаны в заявке на патент США 12/787682, поданной 26 мая 2010, в заявке на патент США 12/793418, поданной 3 июня 2010, которая является продолжением в части заявки на патент США 12/631404, поданной 4 декабря 2009 и в заявке на патент США 12/793413, поданной 3 июня 2010, которая является продолжением в части заявки на патент США 12/631367, поданной 4 декабря 2009, содержание которых включено в настоящий документ посредством ссылки.

В отношении различных соединений, являющихся селективными ингибиторами Bcl-2, входящих в объем настоящего изобретения, должно быть понятно, что переменные группы в настоящем описании представлены системой идентификации (заглавные буквы с цифровыми и/или буквенными надстрочными индексами) и могут быть специфически обозначены.

Понятно, что присущие валентности сохраняются для всех групп и их комбинаций, что одновалентные группы, содержащие более одного атома, пишутся слева направо и присоединяются по их левым концам, и двухвалентные группы также пишутся слева направо.

Также понятно, что конкретный вариант осуществления переменной группы в настоящем документе может быть одинаковым или различным в качестве другого конкретного варианта осуществления, имеющего ту же систему идентификации.

Используемый в настоящем документе термин «алкенил» означает прямую или разветвленную углеводородную цепь, содержащую от 2 до 10 атомов углерода и содержащую по меньшей мере одну углерод-углеродную двойную связь. Термин «Cx-Cy алкил» означает прямую или разветвленную углеводородную цепь, содержащую по меньшей мере одну углерод-углеродную двойную связь, содержащую от x до y атомов углерода. Термин «С2-C4 алкил» означает алкенильную группу, содержащую 2-4 атома углерода. Репрезентативные примеры алкенила включают, но не ограничиваются ими, бута-2,3-диенил, этенил, 2-пропенил, 2-метил-2-пропенил, 3-бутенил, 4-пентенил, 5-гексенил, 2-гептенил, 2-метил-1-гептенил и 3-деценил.

Термин «алкенилен» означает двухвалентную группу, полученную из углеводорода с прямой или разветвленной цепью из 2-4 атомов углерода, и содержит по меньшей мере одну углерод-углеродную двойную связь. Термин «Cx-Cy алкилен» означает двухвалентную группу, полученную из прямой или разветвленной углеводородной цепи, содержащей по меньшей мере одну углерод-углеродную двойную связь и содержащую от x до y атомов углерода. Репрезентативные примеры алкенилена включают, но не ограничиваются ими, -СН=СН- и -СН2СН=СН-.

Используемый в настоящем документе термин «алкил» означает прямую или разветвленную насыщенную углеводородную цепь, содержащую от 1 до 10 атомов углерода. Термин «Cx-Cy алкил» означает насыщенный углеводород с прямой или разветвленной цепью, содержащий от x до y атомов углерода. Например, «С2-C10 алкил» означает насыщенный углеводород с прямой или разветвленной цепью, содержащий 2-10 атомов углерода. Примеры алкила включают, но не ограничиваются ими, метил, этил, н-пропил, изопропил, н-бутил, втор-бутил, изобутил, трет-бутил, н-пентил, изопентил, неопентил, н-гексил, 3-метилгексил, 2,2-диметилпентил, 2,3-диметилпентил, н-гептил, н-октил, н-нонил и н-децил.

Термин «алкилен» означает двухвалентную группу, полученную из прямой или разветвленной насыщенной углеводородной цепи из 1-10 атомов углерода, например из 1-4 атомов углерода. Термин «Cx-Cy алкилен» означает двухвалентную группу, полученную из насыщенного углеводорода с прямой или разветвленной цепью, содержащего от x до y атомов углерода. Например, «С2-C6 алкилен» означает насыщенный углеводород с прямой или разветвленной цепью, содержащий 2-6 атомов углерода. Примеры алкилена включают, но не ограничиваются ими, -СН2-, -СН2СН2-, -СН2СН2СН2-, -СН2СН2СН2СН2- и -СН2СН(СН3)СН2-.

Используемый в настоящем документе термин «алкинил» означает углеводородную группу с прямой или разветвленной цепью, содержащую от 2 до 10 атомов углерода и содержащую по меньшей мере одну углерод-углеродную тройную связь. Термин «Cx-Cy алкинил» означает углеводородную группу с прямой или разветвленной цепью, содержащую от x до y атомов углерода. Репрезентативные примеры алкинила включают, но не ограничиваются ими, ацетиленил, 1-пропинил, 2-пропинил, 3-бутинил, 2-пентинил и 1-бутинил.

Используемый в настоящем документе термин «алкинилен» означает двухвалентный радикал, полученный из углеводородной группы с прямой или разветвленной цепью, содержащей от 2 до 10 атомов углерода и содержащей по меньшей мере одну углерод-углеродную тройную связь.

Термин «арил» (самостоятельно или в комбинации с другим термином(ами)) означает ароматический карбоциклил, содержащий от 6 до 14 кольцевых атомов углерода. Арил может быть моноциклическим или полициклическим (т.е. может содержать более чем одно кольцо). В случае полициклических ароматических колец требуется только одно кольцо полициклической системы для того, чтобы оно было ненасыщенным, в то время как остальное кольцо(а) может быть насыщенным, частично насыщенным или ненасыщенным. Примеры арилов включают фенил, нафталенил, инденил, инданил и тетрагидронафтил.

Термин «карбоциклил» (самостоятельно или в комбинации с другим термином(ами)) означает насыщенный циклический (т.е. «циклоалкил»), частично насыщенный циклический (т.е. «циклоалкенил») или полностью ненасыщенный (т.е. «арил») гидрокарбильный заместитель, содержащий от 3 до 14 кольцевых атомов углерода («кольцевыми атомами» являются атомы, связанные вместе с образованием кольца или колец циклического заместителя). Карбоциклил может представлять собой однокольцевую (моноциклическую) или полициклическую кольцевую структуру.

Карбоциклил может представлять собой однокольцевую структуру, которая обычно содержит от 3 до 8 кольцевых атомов, более предпочтительно от 3 до 6 кольцевых атомов и еще более предпочтительно 5-6 кольцевых атомов. Примеры таких однокольцевых карбоциклилов включают циклопропил (циклопропанил), циклобутил (циклобутанил), циклопентил (циклопентанил), циклопентенил, циклопентадиенил, циклогексил (циклогексанил), циклогексенил, циклогексадиенил и фенил. Карбоциклил может альтернативно быть полициклическим (т.е. может содержать более чем одно кольцо). Примеры полициклических карбоциклилов включают содержащие мостиковую связь, конденсированные и спироциклические карбоциклилы. В спироциклическом карбоциклиле один атом является общим для двух разных колец. Примером спироциклического карбоциклильного заместителя является спироциклопропил. В спироциклическом карбоциклиле один атом является общим для двух разных колец. Примером спироциклического карбоциклила является спиропентанил. В карбоциклиле с мостиковой связью кольца разделяют по меньшей мере два общих несмежных атома. Примеры карбоциклилов с мостиковой связью включают бицикло[2.2.1]гептанил, бицикло[2.2.1]гепт-2-енил и адамантанил. В карбоциклической системе с конденсированными кольцами два или более колец могут быть конденсированы вместе таким образом, что два кольца делят одну общую связь. Примеры кольцевых карбоциклилов с двумя или тремя конденсированными кольцами включают нафталенил, тетрагидронафталенил (тетралинил), инденил, инданил (дигидроинденил), антраценил, фенантренил и декалинил.

Используемый в настоящем документе термин «циклическая группа» означает бензол, фенил, фенилен, циклоалкан, циклоалкил, циклоалкилен, циклоалкен, циклоалкенил, циклоалкенилен, циклоалкин, циклоалкинил, циклоалкинилен, гетероарен, гетероарил, гетероциклоалкан, гетероциклоалкил, гетероциклоалкен, гетероциклоалкенил и спироалкил.

Используемые в настоящем документе термины «циклоалкилен» или «циклоалкил», или «циклоалкан» означают моноциклическую или содержащую мостиковую связь углеводородную кольцевую систему. Моноциклический циклоалкил представляет собой карбоциклическую кольцевую систему, содержащую три-восемь атомов углерода, не содержащую гетероатомы и не содержащую двойные связи. Примеры моноциклических кольцевых систем включают циклопропил, циклобутил, циклопентил, циклогексил, циклогептил и циклооктил. Моноциклическое кольцо может содержать один или два алкиленовых мостика, каждый состоящий из одного, двух или трех атомов углерода, каждый соединяющий два несмежных атома углерода кольцевой системы. Неограничивающие примеры таких циклоалкильных кольцевых систем с мостиковой связью включают бицикло[3.1.1]гептан, бицикло[2.2.1]гептан, бицикло[2.2.2]октан, бицикло[3.2.2]нонан, бицикло[3.3.1]нонан, бицикло[4.2.1]нонан, трицикло[3.3.1.03,7]нонан (октагидро-2,5-метанопентален или норадамантан) и трицикло[3.3.1.13,7]декан (адамантан). Моноциклический циклоалкил и циклоалкил с мостиковой связью могут быть присоединены к исходной молекулярной группе через любой замещаемый атом, находящийся в кольцевой системе.

Используемые в настоящем документе термины «циклоалкенилен» или «циклоалкенил», или «циклоалкен» означают моноциклическую или содержащую мостиковую связь углеводородную кольцевую систему. Моноциклический циклоалкенил содержит четыре, пять, шесть, семь или восемь атомов углерода и не содержит гетероатомы. Четырехчленные кольцевые системы имеют одну двойную связь, пяти- или шестичленные кольцевые системы имеют одну или две двойные связи, и семи- или восьмичленные кольцевые системы имеют одну, две или три двойные связи. Репрезентативные примеры моноциклических циклоалкенильных групп включают, но не ограничиваются ими, циклобутенил, циклопентенил, циклогексенил, циклогептенил и циклооктенил. Моноциклическое циклоалкенильное кольцо может содержать один или два алкиленовых мостика, каждый состоящий из одного, двух или трех атомов углерода, каждый соединяющий два несмежных атома углерода кольцевой системы. Репрезентативные примеры бициклических циклоалкенильных групп включают, но не ограничиваются ими, 4,5,6,7-тетрагидро-3аН-инден, октагидронафталенил и 1,6-дигидропентален. Моноциклический и бициклический циклоалкенил может быть присоединен к исходной молекулярной группе через любой замещаемый атом, находящийся в кольцевых системах.

Используемые в настоящем документе термины «циклоалкин» или «циклоалкинил», или «циклоалкинилен» означают моноциклическую или содержащую мостиковую связь углеводородную кольцевую систему. Моноциклический циклоалкинил имеет восемь или более атомов углерода, ноль гетероатомов и одну или более тройных связей. Моноциклическое циклоалкинильное кольцо может содержать один или два алкиленовых мостика, каждый состоящий из одного, двух или трех атомов углерода, каждый соединяющий два несмежных атома углерода кольцевой системы. Моноциклический и содержащий мостиковую связь циклоалкинил может быть присоединен к исходной молекулярной группе через любой замещаемый атом, находящийся в кольцевых системах.

Используемые в настоящем документе термины «гетероарен» или «гетероарил», или «гетероарилен» означают пятичленное или шестичленное ароматическое кольцо, содержащее по меньшей мере один атом углерода и один или более чем один независимо выбранных атомов азота, кислорода или серы. Гетероарены по настоящему изобретению соединены через любые смежные атомы в кольце, при условии, что сохраняются присущие валентности. В частности, термин «гетероарил» (самостоятельно или в комбинации с другим термином(и)) означает ароматический гетероциклил, содержащий от 5 до 14 кольцевых атомов. Гетероарил может представлять собой одно кольцо или 2 или 3 конденсированных кольца. Примеры гетероарильных заместителей включают 6-членные кольцевые заместители, такие как пиридил, пиразил, пиримидинил, пиридазинил и 1,3,5-, 1,2,4- или 1,2,3-триазинил; 5-членные кольцевые заместители, такие как имидазил, фуранил, тиофенил, пиразолил, оксазолил, изоксазолил, тиазолил, 1,2,3-, 1,2,4-, 1,2,5- или 1,3,4-оксадиазолил и изотиазолил; 6/5-членные конденсированные кольцевые заместители, такие как бензотиофуранил, бензизоксазолил, бензоксазолил, имидазолил, индолил, бензоимидазолил, пирроло[2,3-b]пиридинил, пуринил и антранилил; и 6/6-членные конденсированные кольца, такие как бензопиранил, хинолинил, изохинолинил, циннолинил, хиназолинил и бензоксазинил.

Термин «гетероциклил» (самостоятельно или в комбинации с другим термином(ами)) означает насыщенную (т.е. гетероциклоалкил»), частично насыщенную (т.е. «гетероциклоалкенил») или полностью ненасыщенную (т.е. «гетероарил») кольцевую структуру, содержащую в целом 3-14 кольцевых атомов. По меньшей мере один из кольцевых атомов представляет собой гетероатом (т.е. атом кислорода, азота или серы), где остальные кольцевые атомы независимо выбраны из группы, состоящей из атомов углерода, кислорода, азота и серы. Гетероциклил может представлять собой однокольцевую (моноциклическую) или полициклическую кольцевую структуру. Гетероциклил может представлять собой одно кольцо, которое обычно содержит от 3 до 7 кольцевых атомов, более предпочтительно от 3 до 6 кольцевых атомов и еще более предпочтительно от 5 до 6 кольцевых атомов. Примеры однокольцевых гетероциклилов включают фуранил, дигидрофуранил, тетрагидрофуранил, тетрагидропиранил, тиофенил (тиофуранил), дигидротиофенил, тетрагидротиофенил, пирролил, пирролинил, пирролидинил, имидазолил, имидазолинил, имидазолидинил, пиразолил, пиразолинил, пиразолидинил, триазолил, тетразолил, оксазолил, оксазолидинил, изоксазолидинил, изоксазолил, тиазолил, изотиазолил, тиазолинил, изотиазолинил, тиазолидинил, изотиазолидинил, тиодиазолил, оксадиазолил (включая 1,2,3-оксадиазолил, 1,2,4-оксадиазолил, 1,2,5-оксадиазолил (фуразанил) или 1,3,4-оксадиазолил), оксатриазолил (включая 1,2,3,4-оксатриазолил или 1,2,3,5-оксатриазолил), оксетанил, диоксазолил (включая 1,2,3-диоксазолил, 1,2,4-диоксазолил, 1,3,2-диоксазолил или 1,3,4-диоксазолил), оксатиазолил, оксатиолил, оксатиоланил, пиранил, дигидропиранил, тиопиранил, тетрагидротиопиранил, пиридинил (азинил), пиперидинил, диазинил (включая пиридазинил (1,2-диазинил), пиримидинил (1,3-диазинил) или пиразинил (1,4-диазинил)), пиперазинил, триазинил (включая 1,3,5-триазинил, 1,2,4-триазинил и 1,2,3-триазинил)), оксазинил (включая 1,2-оксазинил, 1,3-оксазинил или 1,4-оксазинил)), оксатиазинил (включая 1,2,3-оксатиазинил, 1,2,4-оксатиазинил, 1,2,5-оксатиазинил или 1,2,6-оксатиазинил)), оксадиазинил (включая 1,2,3-оксадиазинил, 1,2,4-оксадиазинил, 1,4,2-оксадиазинил или 1,3,5-оксадиазинил)), морфолинил, азепинил, оксепинил, тиепинил и диазепинил.

Гетероциклил может альтернативно быть полициклическим (т.е. может содержать более чем одно кольцо). Примеры полициклических гетероциклилов включают содержащие мостиковую связь, конденсированные и спироциклические гетероциклилы. В спироциклическом гетероциклиле один атом является общим для двух разных колец. Примеры спироциклического гетероциклила включают 2-оксаспиро[3.5]нонанил. В гетероциклиле с мостиковой связью кольца разделяют по меньшей мере два общих несмежных атома. В гетероциклиле с конденсированными кольцами два или более колец могут быть конденсированы вместе таким образом, что два кольца делят одну общую связь. Примеры гетероциклилов с конденсированными кольцами, содержащих два или три кольца, включают индолизинил, пиранопирролил, 4Н-хинолизинил, пуринил, нафтиридинил, пирроло[2,3-b]пиридинил, пиридопиридинил (включая пиридо[3,4-b]пиридинил, пиридо[3,2-b]пиридинил или пиридо[4,3-b]пиридинил) и птеридинил. Другие примеры гетероциклилов с конденсированными кольцами включают бензоконденсированные гетероциклилы, такие как индолил, индазоил, изоиндолил (изобензазолил, псевдоизоиндолил), индоленинил (псевдоиндолил), изоиндазолил (бензпиразолил), бензоимидазолил, бензазинил (включая хинолинил (1-бензазинил) или изохинолинил (2-бензазинил)), фталазинил, хиноксалинил, хиназолинил, бензодиазинил (включая циннолинил (1,2-бензодиазинил) или хиназолинил (1,3-бензодиазинил)), бензопиранил (включая хроманил или изохроманил), бензоксазинил (включая 1,3,2-бензоксазинил, 1,4,2-бензоксазинил, 2,3,1-бензоксазинил или 3,1,4-бензоксазинил) и бензизоксазинил (включая 1,2-бензизоксазинил или 1,4-бензизоксазинил).

Термин «гетероциклоалкил» (самостоятельно или в комбинации с другим термином(ами)) означает насыщенный гетероциклил.

Используемые в настоящем документе термины «гетероциклоалкен» или гетероциклоалкенил», или «гетероциклоалкенилен» означают моноциклическое или содержащее мостиковую связь трех-, четырех-, пяти-, шести-, семи- или восьмичленное кольцо, содержащее по меньшей мере один гетероатом, независимо выбранный из группы, состоящей из O, N и S, и одну или более двойных связей. Моноциклический или содержащий мостиковую связь гетероциклоалкен присоединен к исходной молекулярной группе через любой замещаемый атом углерода или любой замещаемый атом азота, находящийся в кольцах. Гетероатомы азот и сера в гетероциклических кольцах могут быть необязательно окислены, а атомы азота могут быть необязательно кватернизованы. Репрезентативные примеры гетероциклоалкеновых групп включают, но не ограничиваются ими, тетрагидрооксоцинил, 1,4,5,6-тетрагидропиридазинил, 1,2,3,6-тетрагидропиридинил, дигидропиранил, имидазолинил, изотиазолинил, оксадиазолинил, изоксазолинил, оксазолинил, пиранил, пиразолинил, пирролинил, тиадиазолинил, тиазолинил и тиопиранил.

Используемый в настоящем документе термин «фенилен» означает двухвалентный радикал, образованный путем удаления атома водорода из фенила.

Используемый в настоящем документе термин «спироалкил» означает алкилен, оба конца которого присоединены к одному и тому же атому углерода, и в качестве его примера можно привести С2-спироалкил, С3-спироалкил, С4-спироалкил, С5-спироалкил, С6-спироалкил, С7-спироалкил, С8-спироалкил, С9-спироалкил и тому подобное.

Используемый в настоящем документе термин «спирогетероалкил» означает спироалкил, содержащий одну или две СН2-группы, замещенные независимо выбранными группами O, C(O), CNOH, CNOCH3, S, S(O), SO2 или NH, и одну или две СН-группы, незамещенные или замещенные N.

Используемый в настоящем документе термин «спирогетероалкенил» означает спироалкенил, содержащий одну или две СН2-группы, замещенные независимо выбранными группами О, C(O), CNOH, CNOCH3, S, S(O), SO2 или NH, и одну или две CH-группы, незамещенные или замещенные N, и также означает спироалкенил, имеющий одну или две СН2-группы, незамещенные или замещенные независимо выбранными группами O, C(O), CNOH, CNOCH3, S, S(O), SO2 или NH, и одну или две CH-группы, замещенные N.

Используемый в настоящем документе термин «спироцикло» означает два заместителя при одном и том же атоме углерода, которые вместе с атомом углерода, к которому они присоединены, образуют циклоалкановое, гетероциклоалкановое, циклоалкеновое или гетероциклоалкеновое кольцо.

Используемый в настоящем документе термин «С25-спироалкил» означает С2-спироалкил, С3-спироалкил, С4-спироалкил и С5-спироалкил.

Используемый в настоящем документе термин «С2-спироалкил» означает эт-1,2-илен, оба конца которого замещают атомы водорода одной и той же СН2-группы.

Используемый в настоящем документе термин «С3-спироалкил» означает проп-1,3-илен, оба конца которого замещают атомы водорода одной и той же СН2-группы.

Используемый в настоящем документе термин «С4-спироалкил» означает бут-1,4-илен, оба конца которого замещают атомы водорода одной и той же СН2-группы.

Используемый в настоящем документе термин «С5-спироалкил» означает пент-1,5-илен, оба конца которого замещают атомы водорода одной и той же СН2-группы.

Используемый в настоящем документе термин «С6-спироалкил» означает гекс-1,6-илен, оба конца которого замещают атомы водорода одной и той же СН2-группы.

Используемый в настоящем документе термин «NH-защитная группа» означает трихлорэтоксикарбонил, трибромэтоксикарбонил, бензилоксикарбонил, пара-нитробензилкарбонил, орто-бромбензилоксикарбонил, хлорацетил, дихлорацетил, трихлорацетил, трифторацетил, фенилацетил, формил, ацетил, бензоил, трет-амилоксикарбонил, трет-бутоксикарбонил, пара-метоксибензилоксикарбонил, 3,4-диметоксибензилоксикарбонил, 4-(фенилазо)бензилоксикарбонил, 2-фурфурилоксикарбонил, дифенилметоксикарбонил, 1,1-диметилпропоксикарбонил, изопропоксикарбонил, фталоил, сукцинил, аланил, лейцил, 1-адамантилоксикарбонил, 8-хинолилоксикарбонил, бензил, дифенилметил, трифенилметил, 2-нитрофенилтио, метансульфонил, пара-толуолсульфонил, N,N-диметиламинометилен, бензилиден, 2-гидроксибензилиден, 2-гидрокси-5-хлорбензилиден, 2-гидрокси-1-нафтилметилен, 3-гидрокси-4-пиридилметилен, циклогексилиден, 2-этоксикарбонилциклогексилиден, 2-этоксикарбонилциклопентилиден, 2-ацетилциклогексилиден, 3,3-диметил-5-оксициклогексилиден, дифенилфосфорил, дибензилфосфорил, 5-метил-2-оксо-2Н-1,3-диоксол-4-илметил, триметилсилил, триэтилсилил и трифенилсилил.

Используемый в настоящем документе термин «С(О)ОН-защитная группа» означает метил, этил н-пропил, изопропил, 1,1-диметилпропил, н-бутил, трет-бутил, фенил, нафтил, бензил, дифенилметил, трифенилметил, пара-нитробензил, пара-метоксибензил, бис(пара-метоксифенил)метил, ацетилметил, бензоилметил, пара-нитробензоилметил, пара-бромбензоилметил, пара-метансульфонилбензоилметил, 2-тетрагидропиранил, 2-тетрагидрофуранил, 2,2,2-трихлорэтил, 2-(триметилсилил)этил, ацетоксиметил, пропионилоксиметил, пивалоилоксиметил, фталимидометил, сукцинимидометил, циклопропил, циклобутил, циклопентил, циклогексил, метоксиметил, метоксиэтоксиметил, 2-(триметилсилил)этоксиметил, бензилоксиметил, метилтиометил, 2-метилтиоэтил, фенилтиометил, 1,1-диметил-2-пропенил, 3-метил-3-бутенил, аллил, триметилсилил, триэтилсилил, триизопропилсилил, диэтилизопропилсилил, трет-бутилдиметилсилил, трет-бутилдифенилсилил, дифенилметилсилил и трет-бутилметоксифенилсилил.

Используемый в настоящем документе термин «ОН- или SH-защитная группа» означает бензилоксикарбонил, 4-нитробензилоксикарбонил, 4-бромбензилоксикарбонил, 4-метоксибензилоксикарбонил, 3,4-диметоксибензилоксикарбонил, метоксикарбонил, этоксикарбонил, трет-бутоксикарбонил, 1,1-диметилпропоксикарбонил, изопропоксикарбонил, изобутилоксикарбонил, дифенилметоксикарбонил, 2,2,2-трихлорэтоксикарбонил, 2,2,2-трибромэтоксикарбонил, 2-(триметилсилил)этоксикарбонил, 2-(фенилсульфонил)этоксикарбонил, 2-(трифенилфосфино)этоксикарбонил, 2-фурфурилоксикарбонил, 1-адамантилоксикарбонил, винилоксикарбонил, аллилоксикарбонил, S-бензилтиокарбонил, 4-этокси-1-нафтилоксикарбонил, 8-хинолилоксикарбонил, ацетил, формил, хлорацетил, дихлорацетил, трихлорацетил, трифторацетил, метоксиацетил, феноксиацетил, пивалоил, бензоил, метил, трет-бутил, 2,2,2-трихлорэтил, 2-триметилсилилэтил, 1,1-диметил-2-пропенил, 3-метил-3-бутенил, аллил, бензил (фенилметил), пара-метоксибензил, 3,4-диметоксибензил, дифенилметил, трифенилметил, тетрагидрофурил, тетрагидропиранил, тетрагидротиопиранил, метоксиметил, метилтиометил, бензилоксиметил, 2-метоксиэтоксиметил, 2,2,2-трихлорэтоксиметил, 2-(триметилсилил)этоксиметил, 1-этоксиэтил, метансульфонил, пара-толуолсульфонил, триметилсилил, триэтилсилил, триизопропилсилил, диэтилизопропилсилил, трет-бутилдиметилсилил, трет-бутилдифенилсилил, дифенилметилсилил и трет-бутилметоксифенилсилил.

Если заместитель описывается как «замещенный», то радикал, отличный от водорода, находится на месте атома водорода при атоме углерода или азота заместителя. Таким образом, например, замещенный алкильный заместитель представляет собой алкильный заместитель, в котором по меньшей мере один радикал, отличный от водорода, находится на месте атома водорода в алкильном заместителе. Для иллюстрации, монофторалкил представляет собой алкил, замещенный атомом фтора, и дифторалкил представляет собой алкил, замещенный двумя атомами фтора. Следует признать, что если в заместителе имеется более чем одна замена, то каждый радикал, отличный от водорода, может быть одинаковым или различным (если не указано иное).

Если заместитель описывается как «необязательно замещенный», то заместитель может быть (1) или не замещенным, или (2) замещенным. Если заместитель описывается как «необязательно замещенный» конкретным числом радикалов, отличных от водорода, то заместитель может быть (1) или не замещенным, или (2) замещенным конкретным числом радикалов, отличных от водорода, или максимальным числом замещаемых позиций в заместителе, которое ниже. Таким образом, например, если заместитель описывается как гетероарил, необязательно замещенный отличными от водорода радикалами числом вплоть до 3, то тогда любой гетероарил с менее чем 3 замещаемыми положениями будет необязательно замещен столькими радикалами, отличными от водорода, сколько гетероарил имеет замещаемых положений. Для иллюстрации, тетразолил (который имеет только одно замещаемое положение) будет необязательно замещен не более чем одним радикалом, отличным от водорода. Для дополнительной иллюстрации, если азот аминогруппы описывается как необязательно замещенный отличными от водорода радикалами числом вплоть до 2, то азот первичной аминогруппы будет необязательно замещен не более чем 2 радикалами, отличными от водорода, в то время как азот вторичной аминогруппы будет замещен только 1 радикалом, отличным от водорода.

В настоящей патентной заявке термины «заместитель» и «радикал» используются взаимозаменяемо.

Как указывается, соединения, являющиеся селективными ингибиторами Bcl-2 по настоящему изобретению, включают все возможные комбинации заместителей для общего соединения формулы (I). Подходящие примеры соединений, которые попадают в объем настоящего изобретения, включают, но не ограничиваются ими, N-({5-хлор-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индазол-4-ил)окси]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-{[4-({[(2S)-4-циклопропилморфолин-2-ил]метил}амино)-3-нитрофенил]сульфонил}-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({5-хлор-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индол-5-ил)окси]-N-({4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]-3-нитрофенил}сульфонил)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4,4-дифторциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-(1Н-бензимидазол-4-илокси)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-фтор-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({3-хлор-4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]фенил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-(1Н-бензимидазол-4-илокси)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-цианоциклогексил)метил]амино}-3-нитрофенил)сульфонил)бензамид; N-({5-хлор-6-[(цис-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси)бензамид; N-[(3-хлор-4-{[4-фтор-1-(оксетан-3-ил)пиперидин-4-ил]метокси}фенил)сульфонил]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-циано-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-2-(1Н-индол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-фтортетрагидро-2Н-пиран-4-ил)метил]амино}-3-нитрофенил)сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({3-хлор-4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]фенил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-фтор-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-2-(1Н-индазол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-{[4-({[(2R)-4-циклопропилморфолин-2-ил]метил}амино)-3-нитрофенил]сульфонил}-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-цианоциклогексил]метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; транс-2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-морфолин-4-илциклогексил)амино]-3-нитрофенил}сульфонил)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-{[4-({(3R)-1-[2-фтор-1-(фторметил)этил]пирролидин-3-ил}амино)-3-нитрофенил]сульфонил}-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; транс-N-({5-хлор-6-[(4-гидроксициклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси)бензамид; N-({3-хлор-4-[(транс-4-гидроксициклогексил)метокси]фенил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({5-хлор-6-[(транс-4-гидроксициклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индазол-4-ил)окси]бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[транс-4-(морфолин-4-ил)циклогексил]амино}-3-нитрофенил)сульфонил]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(цис-4-гидрокси-4-метилциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-циано-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-2-(1Н-индазол-4-илокси)бензамид; N-[(5-хлор-6-{[4-фтор-1-(оксетан-3-ил)пиперидин-4-ил]метокси}пиридин-3-ил)сульфонил]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-метилпиперазин-1-ил)амино]-3-нитрофенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; транс-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-метоксициклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; транс-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-морфолин-4-илциклогексил)амино]-3-нитрофенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]-3-нитрофенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(3R)-1-(2,2-дифторэтил)пирролидин-3-ил]амино}-3-нитрофенил)сульфонил]бензамид; N-({5-хлор-6-[(транс-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси]бензамид; N-({5-хлор-6-[(цис-1-фтор-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси]бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-метоксициклогексил)метил]амино}-3-нитрофенил)сульфонил]бензамид; N-({5-хлор-6-[(транс-1-фтор-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-гидрокси-4-метилциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-[(3-амино-1Н-индазол-4-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-метоксициклогексил)метил]амино}-3-нитрофенил)сульфонил]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(2-оксаспиро[3.5]нон-7-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-циано-6-[(транс-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-2-(1Н-индазол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индол-5-ил)окси]-N-{[3-нитро-4-({[4-(оксетан-3-ил)морфолин-2-ил]метил}амино)фенил]сульфонил)бензамид; N-({5-хлор-6-[(транс-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индазол-4-ил)окси]бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(5-циано-6-{[4-фтор-1-(оксетан-3-ил)пиперидин-4-ил]метокси}пиридин-3-ил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-гидроксициклогексил)метил]амино}-3-нитрофенил)сульфонил]бензамид; N-({5-хлор-6-[(транс-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-2-[(3-хлор-1Н-индазол-4-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)бензамид; 4-[4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}(2Н8)пиперазин-1-ил]-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; N-({5-хлор-6-[(транс-1-фтор-4-гидрокси-4-метилциклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(6-{[(цис-4-гидрокси-4-метилциклогексил)метил]амино}-5-нитропиридин-3-ил)сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({5-нитро-6-[(тетрагидро-2Н-пиран-4-илметил)амино]пиридин-3-ил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({6-[(транс-4-гидрокси-4-метилциклогексил)метокси]-5-(трифторметил)пиридин-3-ил}сульфонил)-2-(1Н-индазол-4-илокси)бензамид; 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(цис-4-этил-4-гидроксициклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид; и 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индол-5-илокси)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)бензамид. Каждое из вышеуказанных соединений и способы получения данных соединений описаны в заявке на патент США 12/787682, поданной 26 мая 2010, в заявке на патент США 12/793418, поданной 3 июня 2010, которая является продолжением в части заявки на патент США 12/631404, поданной 4 декабря 2009 и заявке на патент США 12/793413, поданной 3 июня 2010, которая является продолжением в части заявки на патент США 12/631367, поданной 4 декабря 2009, содержание которых включено в настоящий документ посредством ссылки.

Соединения, представляющие собой селективные ингибиторы Bcl-2, используемые в способах по настоящему изобретению, также могут включать фармацевтически приемлемую соль соединения формулы (I). Используемое в настоящем документе выражение «фармацевтически приемлемая соль(и)» означает соли селективных ингибиторов Bcl-2 по изобретению, которые являются безопасными и эффективными для введения пациенту и которые не оказывают отрицательного влияния на терапевтически эффективные количества соединения. Фармацевтически приемлемые соли включают соли кислых и основных групп, присутствующих в соединениях по изобретению. Фармацевтически приемлемые кислотно-аддитивные соли включают, но не ограничиваются ими, гидрохлорид, гидробромид, гидройодид, нитрат, сульфат, бисульфат, фосфат, кислый фосфат, изоникотинат, ацетат, лактат, салицилат, цитрат, тартрат, пантотенат, битартрат, аскорбат, сукцинат, малеат, гентизинат, фумарат, глюконат, глюкуронат, сахарат, формиат, бензоат, глутамат, метансульфонат, этансульфонат, бензолсульфонат, п-толуолсульфонат и памоат (т.е. 1,1'-метилен-бис-(2-гидрокси-3-нафтоат). Некоторые соединения по изобретению могут образовывать фармацевтически приемлемые соли с различными аминокислотами. Подходящие соли основания включают, но не ограничиваются ими, соли алюминия, кальция, лития, магния, калия, натрия, цинка и диэтаноламина. Обзор по фармацевтически приемлемым солям см. в публикации Berge et al., 66 J. Pharm. Sci., 1-19 (1977), которая включена в настоящий документ посредством ссылки.

Соединения, используемые в способах по настоящему изобретению, могут также включать геометрические изомеры. Соединения по настоящему изобретению могут содержать углерод-углеродные двойные связи или углерод-азотные двойные связи в E- или Z-конфигурации, где префикс «Е» представляет заместители более высокого старшинства с противоположных сторон углерод-углеродных или углерод-азотных двойных связей, и префикс «Z» представляет заместители более высокого старшинства с одной и той же стороны углерод-углеродной или углерод-азотной двойной связи, что определяется по правилам приоритета Кана-Ингольда-Прелога. Соединения по настоящему изобретению также могут находиться в виде смеси «Е»- и «Z»-изомеров. Заместители вокруг циклоалкила или гетероциклоалкила обозначаются в виде цис- или транс-конфигурации. Кроме того, изобретение предполагает наличие различных изомеров и их смесей, образующихся за счет расположения заместителей вокруг адамантановой кольцевой системы. Два заместителя вокруг одного кольца в адамантановой кольцевой системе обозначаются как относительная Z- или Е-конфигурация. Примеры см. в публикациях C.D. Jones, M. Kaselj R.N., Salvatore, W.J. le Noble. J. Org. Chem., 1998, 63, 2758-2760 и E.L. Eliel and S.H. Wilen (1994), Stereochemistry of Organic Compounds, New York, NY: John Wiley & Sons, Inc.

Соединения, являющиеся селективными ингибиторами Bcl-2, также могут содержать асимметрично замещенные атомы углерода в R- или S-конфигурации, где термины «R» и «S» определяются согласно IUPAC, 1974, Recommendations for Section E, Fundamental Stereochemistry, Pure Appl. Chem. (1976), 45, 13-10. Соединения, содержащие асимметрично замещенные атомы углерода с равным вкладом R- или S-конфигураций, являются рацемическими по этим атомам углерода. Атомы с избытком одной конфигурации по сравнению с другой приписываются к конфигурации, присутствующей с большим вкладом, например избыток составляет примерно 85-90%, избыток примерно 95-99% или избыток составляет более чем примерно 99%. Соответственно, настоящее изобретение включает рацемические смеси, относительные и абсолютные стереоизомеры и смеси относительных и абсолютных стереоизомеров.

Соединения, представляющие собой селективные ингибиторы Bcl-2, используемые в способах по настоящему изобретению, содержащие группы NH, C(O)OH, OH или SH, могут иметь присоединенные к ним группы, образующие пролекарство. Группы, образующие пролекарство, удаляются в результате метаболических процессов и высвобождают соединения, содержащие свободный гидроксил, аминогруппу или карбоксильную группу в условиях in vivo. Пролекарства являются пригодными для корректировки таких фармакокинетических свойств соединений, как растворимость или гидрофобность, всасывание в желудочно-кишечном тракте, биодоступность, проникновение в ткани и скорость клиренса.

Соединения, используемые в различных вариантах осуществления, также могут находиться в меченной изотопом или обогащенной изотопом форме, содержащей один или более атомов, имеющих атомную массу или массовое число, отличающиеся от значений атомной массы или массового числа, наиболее часто обнаруживаемые в природе. Изотопы могут быть радиоактивными или нерадиоактивными изотопами. Изотопы атомов, таких как водород, углерод, фосфор, сера, фтор, хлор и йод, включают, но не ограничиваются ими, 2Н, 3H, 13C, 14C, 15N, 18O, 32P, 35S, 18F, 36Cl и 125I. Соединения, которые содержат другие изотопы данных и/или других атомов, входят в объем настоящего изобретения.

В еще одном варианте осуществления меченные изотопом соединения содержат изотопы дейтерий (2Н), тритий (3Н) или 14С. Меченные изотопом соединения по настоящему изобретению можно получить общими способами, хорошо известными специалистам в данной области. Такие меченные изотопом соединения можно легко получить осуществлением способов, раскрытых в приведенных в настоящем документе примерах и на схемах, заменой немеченого реагента легко доступным меченным изотопом реагентом. В некоторых случаях соединения можно обработать меченными изотопом реагентами для замены нормального атома на изотоп, например атом водорода можно заменить дейтерием путем воздействия дейтериевой кислоты, такой как D2SO4/D2O. В дополнение к изложенному выше, соответствующие способы и промежуточные соединения раскрыты, например, в публикациях Lizondo J. et al., Drugs Fut., 21(11), 1116 (1996); Brickner S.J. et al., J. Med. Chem., 39(3), 673 (1996); Mallesham B. et al., Org. Lett., 5(7), 963 (2003); РСТ публикациях WO1997010223, WO2005099353, WO19955007271, WO2006008754; патентах США №№ 7538189; 7534814; 7531685; 7528131; 7521421; 7514068; 7511013 и публикациях заявок на патент США №№ 20090137457; 20090131485; 20090131363; 20090118238; 20090111840; 20090105338; 20090105307; 20090105147; 20090093422; 20090088416; и 20090082471, которые включены в настоящий документ посредством ссылки.

Меченные изотопом соединения по изобретению можно использовать в качестве стандартов для определения эффективности ингибиторов Bcl-2 в тестах оценки связывания. Соединения, содержащие изотоп, использовались в фармацевтических исследованиях для изучения метаболического пути in vivo соединений путем оценки механизма действия и пути метаболизма не меченных изотопом исходных соединений (Blake et al., J. Pharm. Sci., 64, 3, 367-391 (1975)). Такие исследования по метаболизму являются важными при создании безопасных, эффективных лекарственных препаратов, поскольку активное соединение, введенное in vivo пациенту, или метаболиты, образовавшиеся из исходного соединения, могут быть токсичными или канцерогенными (Foster et al., Advances in Drug Research, Vol. 14, pp. 2-36; Academic press, London, 1985; Kato et al., J. Labelled Comp. Radiopharmaceut., 36(10):927-932 (1995); Kushner et al., Can. J. Physiol. Pharmacol., 77, 79-88 (1999).

Кроме того, лекарственные препараты, содержащие нерадиоактивные изотопы, такие как дейтерированные препараты, называемые «тяжелыми лекарственными препаратами», можно использовать для лечения заболеваний и расстройств, связанных с активностью Bcl-2. Увеличение количества изотопа, присутствующего в соединении, выше его содержания в природе называется обогащением. Примеры количеств для обогащения включают примерно от 0,5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 16, 21, 25, 29, 33, 37, 42, 46, 50, 54, 58, 63, 67, 71, 75, 79, 84, 88, 92, 96 до примерно 100 мол.%. При замене и поддержании в течение периода времени от суток до недель примерно до 15% нормального атома тяжелым изотопом у млекопитающих, включая грызунов и собак, наблюдали минимальные побочные эффекты (Czajka D.M. and Finkel A.J., Ann. N.Y. Acad. Sci., 1960, 84:770; Thomson J.F., Ann. N.Y. Acad. Sci., 1960, 84:736; Czajka D.M. et al., Am. J. Physiol., 1961, 201:357). Было установлено, что однократная замена вплоть до 15-23% на дейтерий в жидкостях человека не вызывает токсичности (Blagojevic N. et al., в «Dosimetry & Treatment Planning for Neutron Capture Therapy», Zamenhof R., Solares G. and Harling O., Eds., 1994. Advanced Medical Publishing, Madison Wis., pp. 125-134; Diabetes Metab., 23:251 (1997)).

Введение в молекулу лекарственного препарата стабильного изотопа может изменить его физико-химические свойства, такие как pKa и растворимость в липидах. Данные эффекты и изменения могут оказать влияние на фармакодинамический ответ организма на молекулу лекарственного препарата, если замена изотопа оказывает влияние на область, принимающую участие во взаимодействии лиганд-рецептор. Несмотря на то, что некоторые физические свойства молекулы, меченной стабильным изотопом, отличаются от свойств немеченой молекулы, химические и биологические свойства являются одинаковыми, с одним важным исключением: за счет повышенной массы тяжелого изотопа любая связь, содержащая тяжелый изотоп и другой атом, будет сильнее, чем та же связь между легким изотопом и этим атомом. Следовательно, включение изотопа в место метаболизма или ферментативной трансформации будет замедлять указанные реакции, потенциально изменяя фармакокинетический профиль или эффективность по сравнению с не меченным изотопом соединением.

Способы по настоящему изобретению могут также включать пролекарство соединения селективного ингибитора Bcl-2. Пролекарства представляют собой производные активного лекарственного препарата, созданные для ослабления некоторого определенного, нежелательного физического или биологического свойства. Как правило, физическими свойствами являются растворимость (очень высокая или недостаточная растворимость в липидах или в воде) или связанная стабильность, в то время как проблемные биологические свойства включают слишком быстрый метаболизм или низкую биодоступность, что само по себе может быть связано с физико-химическими свойствами соединения. Как правило, пролекарства получают: а) синтезом сложного эфира, гемиэфиров, карбонатных эфиров, нитратных эфиров, амидов, гидроксамовых кислот, карбаматов, иминов, оснований Манниха, фосфатов, фосфатных эфиров и енаминов активного лекарственного препарата, (b) функционализацией лекарственного препарата азогруппой, гликозидом, пептидом и функциональными группами простого эфира; с) использованием аминалов, гемиаминалов, полимеров, солей, комплексов, фосфорамидов, ацеталей, гемиацеталей и кеталей лекарственного препарата. Например, см. публикацию Andrejus Korolkovas's «Essentials of Medicinal Chemistry», John Wiley-Interscience Publications, John Wiley and Sons, New York (1988), pp. 97-118, которая включена в настоящий документ посредством ссылки.

Кроме того, способы по настоящему изобретению могут включать введение соединений формулы (I), например, по меньшей мере одним путем, выбранным из парентерального, подкожного, внутримышечного, внутривенного, внутриартикулярного, внутрибронхиального, внутриабдоминального, внутрикапсульного, внутрихрящевого, внутриполостного введения, внутриклеточного, внутримозжечкового, интрацеребровентрикулярного пути введения, введения в толстый кишечник, интрацервикального, внутрижелудочного пути введения, введения в печень, внутримиокардиального, внутрикостного, внутритазового, внутриперикардиального, внутрибрюшинного, внутриплеврального, интрапростатического, внутрилегочного, интраректального пути введения, введения в почку, интраретинального, интраспинального, внутрисуставного, интраторакального пути введения, введения в матку, внутрипузырного пути введения, болюсного введения, интравагинального, ректального, буккального, сублингвального, интраназального и трансдермального путей введения.

Как указывалось выше, «терапевтически эффективное количество» по настоящему изобретению относится к такому количеству соединения, которое будучи введенным является достаточным для предупреждения развития или ослабления до некоторой степени одного или более симптомов состояния или расстройства, которое подвергается лечению. Терапевтически эффективные количества соединений формулы (I) зависят от реципиента, подвергающегося лечению, расстройства, которое лечится, и его тяжести, композиции, содержащей соединение, времени введения, пути введения, продолжительности лечения, активности соединения, скорости его клиренса, и того, вводится или нет совместно другой лекарственный препарат. В общем, способы по настоящему изобретению включают введение дозы селективного ингибитора Bcl-2 в пределах примерно от 0,001 мг/кг до примерно 1000 мг/кг. В одном варианте осуществления способы включают введение дозы селективного ингибитора Bcl-2 в пределах примерно от 0,01 мг/кг до примерно 500 мг/кг. В дополнительном варианте осуществления способы включают введение дозы селективного ингибитора Bcl-2 в пределах примерно от 0,1 мг/кг до примерно 300 мг/кг.

Способы по настоящему изобретению могут проявить повышенную эффективность при лечении болезненных состояний, таких как SLE, волчаночный нефрит и синдром Шегрена, по сравнению со способами, известными в настоящее время в данной области, за счет того факта, что соединения, раскрытые в настоящем документе, могут избирательно ингибировать белок Bcl-2. Семейство белков Bcl-2 представляет собой группу белков, которые обладают регуляторными эффектами на многие функции в процессах развития и гомеостаза, такие как апоптоз (запрограммированная гибель клеток). Семейство Bcl-2 включает другие белки, в том числе, Bcl-xL и Bcl-w. Однако было показано, что ингибирование белка Bcl-xL оказывает побочное действие на число тромбоцитов, приводя в некоторых случаях к тромбоцитопении. Было показано, что соединения формулы (I), представляющие собой селективные ингибиторы Bcl-2, обладают более высокой аффинностью связывания (что подтверждается более низкими значениями Ki) для Bcl-2 по сравнению с другими белками семейства Bcl-2, такими как Bcl-xL и Bcl-w. По существу, способы по настоящему изобретению обеспечивают преимущества ингибирования белка Bcl-2 с пониженным риском проявления побочных эффектов, ассоциированных с ингибированием Bcl-xL и Bcl-w. Аффинность связывания для различных белков оценивают по значению Ki, которое представляет собой количество соединения, необходимое для ингибирования физиологического процесса или соединения (такого как белок) на 50%. Соединения, представляющие собой селективные ингибиторы Bcl-2, используемые в способах по настоящему изобретению, обычно имеют аффинность связывания (Ki) ниже чем примерно 1 мкМ, ниже чем примерно 500 нМ, ниже чем примерно 400 нМ, ниже чем примерно 300 нМ, ниже чем примерно 200 нМ, ниже чем примерно 100 нМ, ниже чем примерно 50 нМ, ниже чем примерно 25 нМ, ниже чем примерно 10 нМ, ниже чем примерно 5 нМ, ниже чем примерно 1 нМ, ниже чем примерно 900 пмоль, ниже чем примерно 800 пмоль, ниже чем примерно 700 пмоль, ниже чем примерно 600 пмоль, ниже чем примерно 500 пмоль, ниже чем примерно 400 пмоль, ниже чем примерно 300 пмоль, ниже чем примерно 200 пмоль и ниже чем примерно 100 пмоль для Bcl-2.

Селективные ингибиторы Bcl-2, используемые в способах по настоящему изобретению, избирательно связываются с белками Bcl-2 и индуцируют ответ на них при значительно более низких концентрациях, чем концентрации, необходимые для связывания с Bcl-xL и индукции ответа на него. По существу, когда селективный ингибитор Bcl-2 вводят пациенту, то ингибитор более склонен к ингибированию Bcl-2, чем Bcl-xL. Селективные ингибиторы, используемые в способах по настоящему изобретению, имеют тенденцию к наличию аффинности конкурентного связывания (Ki) для Bcl-2, которая по меньшей мере примерно в 500 раз, по меньшей мере примерно в 1000 раз, по меньшей мере примерно в 2000 раз, по меньшей мере примерно в 2500 раз, по меньшей мере примерно в 3000 раз, по меньшей мере примерно в 3500 раз и по меньшей мере примерно в 4000 раз ниже, чем аффинность связывания для Bcl-xL. По существу, даже при низких концентрациях (т.е. при пикомолярных концентрациях) селективный ингибитор Bcl-2 будет связываться с белком Bcl-2 и ингибировать его.

Кроме того, способы по настоящему изобретению включают введение соединений формулы (I) с эксципиентом или без него. Эксципиенты включают, например, инкапсулирующие вещества или добавки, такие как усилители всасывания, антиоксиданты, связующие вещества, буферы, покровные агенты, красители, разбавители, разрыхлители, эмульгаторы, сухие разбавители, наполнители, вкусовые вещества, увлажнители, лубриканты, ароматизаторы, консерванты, пропелленты, высвобождающие агенты, стерилизующие вещества, подсластители, солюбилизаторы, смачивающие вещества и их смеси.

Эксципиенты для приготовления композиций, содержащих соединение формулы (I), предназначенные для введения перорально, включают, например, агар, альгиновую кислоту, гидроксид алюминия, бензиловый спирт, бензилбензоат, 1,3-бутиленгликоль, карбомеры, касторовое масло, целлюлозу, ацетат целлюлозы, какао-масло, кукурузный крахмал, кукурузное масло, масло семян хлопчатника, кросповидон, диглицериды, этанол, этилцеллюлозу, этиллаурат, этилолеат, эфиры жирных кислот, желатин, масло зародышей пшеницы, глюкозу, глицерин, масло земляного ореха, гидроксипропилметилцеллюлозу, изопропанол, изотонический раствор соли, лактозу, гидроксид магния, стеарат магния, солод, маннит, моноглицериды, оливковое масло, арахисовое масло, фосфаты калия, картофельный крахмал, повидон, пропиленгликоль, раствор Рингера, сафлоровое масло, кунжутное масло, натриевую соль карбоксиметилцеллюлозы, фосфаты натрия, лаурилсульфат натрия, сорбит натрия, соевое масло, стеариновые кислоты, стеарилфумарат, сахарозу, поверхностно-активные вещества, тальк, трагакант, тетрагидрофурфуриловый спирт, триглицериды, воду и их смеси. Эксципиенты для приготовления композиций, содержащих соединение по настоящему изобретению формулы (I), предназначенные для введения офтальмически или перорально в жидких лекарственных формах, включают, например, 1,3-бутиленгликоль, касторовое масло, кукурузное масло, масло семян хлопчатника, этанол, сложные эфиры жирных кислот и сорбитана, масло зародышей пшеницы, масло земляного ореха, глицерин, изопропанол, оливковое масло, полиэтиленгликоли, пропиленгликоль, кунжутное масло, воду и их смеси. Эксципиенты для приготовления композиций, содержащих соединение по настоящему изобретению формулы (I), предназначенные для введения осмотически, включают, например, хлорфторуглеводороды, этанол, воду и их смеси. Эксципиенты для приготовления композиций, содержащих соединение по настоящему изобретению формулы (I), предназначенные для введения парентерально, включают, например, 1,3-бутандиол, касторовое масло, кукурузное масло, масло семян хлопчатника, декстрозу, масло зародышей пшеницы, масло земляного ореха, липосомы, олеиновую кислоту, оливковое масло, арахисовое масло, раствор Рингера, сафлоровое масло, кунжутное масло, соевое масло по Фармакопее США или изотонический раствор хлорида натрия, воду и их смеси. Эксципиенты для приготовления композиций, содержащих соединение по настоящему изобретению формулы (I), предназначенные для введения ректально или интравагинально, включают, например, какао-масло, полиэтиленгликоль, воск и их смеси.

Способы по настоящему изобретению включают способы введения селективного ингибитора Bcl-2 одного или в комбинации с другими терапевтическими продуктами. Многие белки принимают участие в общих аутоиммунных и воспалительных ответах. Следовательно, может быть возможным комбинировать селективные ингибиторы Bcl-2 с соединениями, способными изменять функцию других белков, участвующих в развитии аутоиммунных и воспалительных ответов. Примеры белков, ассоциированных с аутоиммунным и воспалительным ответом, включают C5, CCL1 (I-309), CCL11 (эотаксин), CCL13 (mcp-4), CCL15 (MIP-1d), CCL16 (HCC-4), CCL17 (TARC), CCL18 (PARC), CCL19, CCL2 (mcp-1), CCL20 (MIP-3a), CCL21 (MIP-2), CCL23 (MPIF-1), CCL24 (MPIF-2/эотаксин-2), CCL25 (TECK), CCL26, CCL3 (MIP-1a), CCL4 (MIP-1b), CCL5 (RANTES), CCL7 (mcp-3), CCL8 (mcp-2), CXCL1, CXCL10 (IP-10), CXCL11 (I-TAC/IP-9), CXCL12 (SDF1), CXCL13, CXCL14, CXCL2, CXCL3, CXCL5 (ENA-78/LIX), CXCL6 (GCP-2), CXCL9, IL13, IL8, CCL13 (mcp-4), CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CX3CR1, IL8RA, XCR1 (CCXCR1), IFNA2, IL10, IL13, IL17C, IL1A, IL1B, IL1F10, IL1F5, IL1F6, IL1F7, IL1F8, IL1F9, IL22, IL5, IL8, IL9, LTA, LTB, MIF, SCYE1 (эндотелиальный моноциты-активирующий цитокин), SPP1, TNF, TNFSF5, IFNA2, IL10-RA, IL10RB, IL13, IL13RA1, IL5RA, IL9, IL9R, ABCF1, BCL6, C3, C4A, CEBPB, CRP, ICEBERG, ILR1, IL1RN, IL8RB, LTB4R, TOLLIP, FADD, IRAK1, IRAK2, MYD88, NCK2, TNFAIP3, TRADD, TRAF1, TRAF2, TRAF3, TRAF4, TRAF5, TRAF6, ACVR1, ACVR1B, ACVR2, ACVR2B, ACVRL1, CD28, CD3E, CD3G, CD3Z, CD69, CD80, CD86, CNR1, CTLA4, CYSLTR1, FCER1A, FCER2, FCGR3A, GPR44, HAVCR2, OPRD1, P2RX7, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, BLR1, CCL1, CCL2, CCL3, CCL4, CCL5, CCL7, CCL8, CCL11, CCL13, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CX3CL1, CX3CR1, CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL10, CXCL11, CXCL12, CXCL13, CXCR4, GPR2, SCYE1, SDF2, XCL1, XCL2, XCR1, AMH, AMHR2, BMPR1A, BMPR1B, BMPR2, C19orf10 (IL27w), CER1, CSF2, CSF3, DKFZp451J0118, FGF2, GFI1, IFNA1, IFNB1, IFNG, IGF1, IL1A, IL1B, IL1R1, IL1R2, IL2, IL2RA, IL2RB, IL2RG, IL3, IL4, IL4R, IL5, IL5RA, IL6, IL6R, IL6ST, IL7, IL8, IL8RA, IL8RB, IL9, IL9R, IL10, IL10RA, IL10RB, IL11, IL11RA, IL12A, IL12B, IL12RB1, IL12RB2, IL13, IL13RA1, IL13RA2, IL15, IL15RA, IL16, IL17, IL17R, IL18, IL18R1, IL19, IL20, KITLG, LEP, LTA, LTB, LTB4R, LTB4R2, LTBR, MIF, NPPB, PDGFB, TBX21, TDGF1, TGFA, TGFB1, TGFB1I1, TGFB2, TGFB3, TGFBI, TGFBR1, TGFBR2, TGFBR3, TH1L, TNF, TNFRSF1A, TNFRSF1B, TNFRSF7, TNFRSF8, TNFRSF9, TNFRSF11A, TNFRSF21, TNFSF4, TNFSF5, TNFSF6, TNFSF11, VEGF, ZFPM2, RNF110(ZNF144), семейство FGF, PLGF, DLL4 и NPR-1.

Должно быть понятно, что изобретение можно использовать самостоятельно или в комбинации с дополнительным агентом, например терапевтическим агентом, где дополнительный агент может быть выбран специалистом в данной области для предназначенной цели. Например, дополнительный агент может представлять собой терапевтический агент, признанный в данной области как пригодный для лечения заболевания или расстройства, которое подвергается лечению по настоящему изобретению. Дополнительный агент также может представлять собой агент, который придает положительное качество терапевтической композиции, например агент, который влияет на вязкость композиции.

Также должно быть понятно, что комбинации, которые включены в настоящее изобретение, представляют собой такие комбинации, включающие лечение селективными ингибиторами Bcl-2, описанными в настоящем документе, и одним или более дополнительными терапевтическими агентами.

Комбинации для лечения аутоиммунных и воспалительных заболеваний представляют собой нестероидные противовоспалительные препараты, также называемые НПВП, которые включают лекарственные препараты, подобные ибупрофену. Другими комбинациями являются кортикостероиды, включающие преднизолон; хорошо известные побочные эффекты при использовании стероидов можно снизить или даже полностью устранить снижением необходимой дозы стероида при лечении пациентов в комбинации с настоящим изобретением. Неограничивающие примеры терапевтических агентов для лечения волчанки, которые можно комбинировать с настоящим изобретением, включают следующее: цитокин-подавляющий противовоспалительный препарат (CSAID); антитела или антагонисты других цитокинов человека или факторов роста, например TNF, LT, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-15, IL-16, IL-17A, IL-17F, IL-18, IL-21, IL-22, IL-23, IL-25, IL-33, интерфероны (например, альфа, бета, гамма и т.д.), Tweak, BAFF/BLyS, April, хемокины. Изобретение можно объединить с антителами к молекулам клеточной поверхности, таким как CD2, CD3, CD4, CD8, CD16, CD19, CD20, CD22, CD25, CD28, CD30, CD32, CD40, CD45, CD47, CD52, CD54, CD64, CD69, CD72, CD79, CD80 (B7.1), CD86 (B7.2), CD90, CD100, CD200, CTLA, ICOS-1, B7RP, BR3, TACI, BCMA или другие лиганды, включая CD154 (gp39 или CB40L).

Изобретение также можно комбинировать с такими агентами, как микофенолата мофетил (MMF), цитоксан, бортезомиб, метотрексат, 6-МР, азатиоприн, сульфасалазин, месалазин, олсалазин, хлорквинин/гидроксихлорохин, пеницилламин, ауротиомалат (для внутримышечного и перорального введения), азатиоприн, колхицин, кортикостероиды (для перорального, ингаляционного применения и местной инъекции), селективные модуляторы глюкокортикоидных рецепторов (SGRM), агонисты О-бета-2-адренорецепторов (салбутамол, тербуталин, салметерол), ксантины (теофиллин, аминофиллин), кромогликат, недокромил, кетотифен, ипратропий и окситропий, циклоспорин, FK506, рапамицин, микофенолата мофетил, лефлуномид, НПВП, например ибупрофен, кортикостероиды, такие как преднизолон, ингибиторы фосфодиэстеразы, агонисты аденозина, противотромбические средства, ингибиторы комплемента, адренергические агенты, агенты, которые интерферируют с сигнальным путем провоспалительных цитокинов, таких как TNF-α или IL-1 (например, IRAK, NIK, IKK, p38 или ингибиторы МАР-киназы), ингибиторы IL-1β-превращающего фермента, ингибиторы Jak, ингибиторы btk, ингибиторы syk, ингибиторы семейства РКС, ингибиторы TNF-превращающего фермента (ТАСЕ), ингибиторы Т-клеточного сигнального пути, такие как ингибиторы киназы, ингибиторы металлопротеиназы, сульфасалазин, азатиоприн, 6-меркаптопурины, ингибиторы ангиотензин-превращающего фермента, растворимые рецепторы цитокинов и их производные (например, растворимые рецепторы TNF р55 или р75 и производные p75TNFRIgG (Enbrel™ и p55TNFRIgG (Lenercept), sIL-1RI, sIL-1RII, sIL-6R), противовоспалительные цитокины (например, IL-4, IL-6, IL-10, IL-11, IL-12, IL-13, IL-17, IL-18, IL-33 и TGFβ), целекоксиб, фолиевая кислота, гидроксихлорохина сульфат, рофекоксиб, этанерцепт, инфликсимаб, напроксен, валдекоксиб, сульфасалазин, метилпреднизолон, мелоксикам, метилпреднизолона ацетат, тиомалат золота и натрия, аспирин, триамцинолона ацетонид, пропоксифена напзилат/апап, фолат, набуметон, диклофенак, пироксикам, этодолак, диклофенак натрия, оксапрозин, оксикодон HCl, гидрокодон битартрат/апап, диклофенак натрия/мизопростол, фентанил, анакинра, человеческий рекомбинант, трамадол HCl, салсалат, сулиндак, цианокобаламин/фа/пиридоксин, ацетаминофен, алендронат натрия, преднизолон, морфина сульфат, лидокаина гидрохлорид, индометацин, глюкозамин сульф/хондроитин, амитриптилин HCl, сульфадиазин, оксикодон HCl/ацетаминофен, олопатадин HCl, мизопростол, напроксен натрия, омепразол, циклофосфамид, ритуксимаб, IL-1, TRAP, MRA, CTLA4-IG, IL-18 BP, анти-IL-18-антитело, анти-IL-15-антитело, BIRB-796, SCIO-469, VX-702, AMG-548, VX-740, рофлумиласт, IC-485, CDC-801 и мезопрам. Комбинации включают метотрексат или лефлуномид, циклоспорин и агонисты S1P.

Примеры терапевтических агентов для лечения SLE (волчанки) и волчаночного нефрита, с которыми можно комбинировать изобретение, включают следующее: НПВП, например диклофенак, напроксен, ибупрофен, пироксикам, индометацин; ингибиторы СОХ2, например целекоксиб, рофекоксиб, валдекоксиб; препараты против малярии, например гидроксихлорохин; стероиды, например преднизон, преднизолон, буденозид, дексаметазон; цитостатики, например азатиоприн, циклофосфамид, микофенолата мофетил, метотрексат; ингибиторы PDE4 или ингибитор синтеза пуринов, например селлсепт. Связывающие белки, включенные в способы по изобретению, также можно комбинировать с таким агентами, как сульфасалазин, 5-аминосалициловая кислота, олсалазин, имуран, и агенты, которые нарушают синтез, продукцию или действие провоспалительных цитокинов, таких как IL-1, например ингибиторы каспазы, подобные ингибиторам IL-1β-превращающего фермента и IL-1ra. Изобретение также можно использовать с ингибиторами Т-клеточного сигнального пути, например ингибиторами тирозинкиназы, или молекулами, которые нацелены на молекулы активации Т-клеток, например CTLA-4-IgG или семейство анти-В7-антител, семейство анти-PD-1-антител. Изобретение можно объединить с IL-11 или антителами к цитокинам, например фонотолизумабом (анти-IFNg-антитело), антителами к интерферону альфа или антирецепторными антителами, например рецептор анти-IL-6 антирецепторным антителом и антителами к поверхностным молекулам В-клеток. Изобретение также можно использовать с ингибиторами HMGB1, HDGF. Изобретение также можно использовать с ингибиторами к toll-рецепторам 1, 2, 3, 4, 7 и 9. Изобретение также можно использовать с маркерами дендритных клеток BDCA-1, 2 и 3. Изобретение также можно использовать с агентами, которые способствуют регуляторной функции Т-клеток. Изобретение также можно использовать с LJP 394 (абетимусом), агентами, которые ингибируют комплемент, например анти-С5-антителом, анти-С5а-антителом, которые приводят к истощению или инактивации В-клеток, например ритуксимабом (анти-CD20-антитело), лимфостатом-В (анти-BlyS-антитело), анти-CD22-антителами, антагонистами TNF, например анти-TNF-антителами, адалимумабом (РСТ публикация WO 97/29131; HUMIRA), CA2 (REMICADE), CDP 571, конструкциями TNFR-Ig (p75TNFRIgG (ENBREL)) и p55TNFRIgG (LENERCEPT) и ингибиторами других членов семейства bcl-2, такими как Bcl-xL, Mcl-1, A-1 и т.д.

Примеры терапевтических агентов, используемых для лечения синдрома Шегрена, которые можно комбинировать с селективными ингибиторами Bcl-2, включают, но не ограничиваются ими, искусственные слезы, циклоспорин, цевимелин, пилокарпин, НПВП, кортикостероиды, иммуносупрессоры, модифицирующие заболевание противоревматические препараты (DMARD), такие как метотрексат и гидроксихлорохин.

Также можно комбинировать селективный ингибитор Bcl-2 со связующим белком для дополнительного повышения эффективности соединения в желаемом месте действия. В одном варианте осуществления связывающий белок, используемый в способах по изобретению, имеет константу скорости ассоциации (Kon) с одной или более мишеней, выбранную из группы, состоящей из: по меньшей мере примерно 102 М-1сек-1, по меньшей мере примерно 103 М-1сек-1, по меньшей мере примерно 104 М-1сек-1, по меньшей мере примерно 105 М-1сек-1 и по меньшей мере примерно 106 М-1сек-1, что определяли поверхностным плазмонным резонансом. В варианте осуществления связывающий белок по изобретению имеет константу скорости ассоциации (Kon) с одной или более мишеней от 102 М-1сек-1 до 103 М-1сек-1; от 103 М-1сек-1 до 104 М-1сек-1; от 104 М-1сек-1 до 105 М-1сек-1; или от 105 М-1сек-1 до 106 М-1сек-1, что определяли поверхностным плазмонным резонансом.

В еще одном варианте осуществления связывающий белок имеет константу скорости диссоциации (Koff) для одной или более мишеней, выбранную из группы, состоящей из: не более чем примерно 10-3 сек-1; не более чем примерно 10-4 сек-1; не более чем примерно 10-5 сек-1; и не более чем примерно 10-6 сек-1, что определяли поверхностным плазмонным резонансом. В варианте осуществления связывающий белок по изобретению имеет константу скорости диссоциации (Koff) для одной или более мишеней от 10-3 сек-1 до 10-4 сек-1; от 10-4 сек-1 до 10-5 сек-1; или от 10-5 сек-1до 10-6 сек-1, что определяли поверхностным плазмонным резонансом.

В варианте осуществления связывающий белок имеет константу диссоциации (KD) для одной или более мишеней, выбранную из группы, состоящей из: не более чем примерно 10-7 М; не более чем примерно 10-8 М; не более чем примерно 10-9 М; не более чем примерно 10-10 М; не более чем примерно 10-11 М; не более чем примерно 10-12 М; и не более чем примерно 10-13 М. В варианте осуществления связывающий белок по изобретению имеет константу диссоциации (KD) для его мишеней от 10-7 М до 10-8 М; от 10-8 М до 10-9 М; от 10-9 М до 10-10 М; от 10-10 М до 10-11 М; от 10-11 М до 10-12 М; или от 10-12 М до 10-13 М.

В еще одном аспекте связывающий белок представляет собой конъюгат, содержащий связывающий белок и агент, выбранный из группы, состоящей из молекулы иммуноадгезии, визуализирующего агента, терапевтического агента и цитотоксического агента. Примеры визуализирующих агентов включают радиоактивную метку, фермент, флуоресцентную метку, люминесцентную метку, биолюминесцентную метку, магнитную метку и биотин. Примеры радиоактивных меток включают 3Н, 14С, 35S, 90Y, 99Tc, 111In, 125I, 131I, 177Lu, 166Ho и 153Sm. В еще одном варианте осуществления терапевтический или цитотоксический агент выбран из группы, состоящей из антиметаболита, алкилирующего агента, антибиотика, фактора роста, цитокина, антиангиогенного агента, антимитотического агента, антрациклина, токсина и агента, способствующего апоптозу клеток.

В еще одном аспекте связывающий белок представляет собой кристаллизованный связывающий белок, например не содержащий носителя фармацевтический кристалл с контролируемым высвобождением. В еще одном варианте осуществления кристаллизованный связывающий белок имеет более высокий период полураспада в условиях in vivo, чем растворимый аналог связывающего белка. В еще одном варианте осуществления кристаллизованный связывающий белок сохраняет биологическую активность.

В еще одном варианте осуществления связывающий белок, описанный в настоящем документе, является гликозилированным. Например, гликозилирование представляет собой образец гликозилирования белков человека.

Еще один аспект изобретения относится к выделенной нуклеиновой кислоте, кодирующей один из связывающих белков, описанных в настоящем документе. Еще один вариант осуществления относится к вектору, содержащему выделенную нуклеиновую кислоту, раскрытую в настоящем документе, где вектор выбран из группы, состоящей из pcDNA; pTT (Durocher et al., Nucleic Acids Research, 2002, vol. 30, № 2); pTT3 (pTT с дополнительным множественным сайтом клонирования; pEFBOS (Mizushima S. and Nagata S., 1990, Nucleic Acids Research, Vol. 18, № 17); pBV; pJV; pcDNA3.1 TOPO, pEF6 TOPO и pBJ. В варианте осуществления вектор представляет собой вектор, раскрытый в заявке на патент США 61/021282.

В еще одном аспекте клетка-хозяин трансформирована вектором, раскрытым в настоящем документе. В варианте осуществления клетка-хозяин является прокариотической клеткой. В еще одном варианте осуществления клетка-хозяин представляет собой E.coli. В близком варианте осуществления клетка-хозяин является эукариотической клеткой. В еще одном варианте осуществления эукариотическая клетка выбрана из группы, состоящей из одноклеточного организма, животной клетки, птичьей клетки, растительной клетки и грибковой клетки. В еще одном варианте осуществления клетка-хозяин представляет собой клетку млекопитающего, включая, но не ограничиваясь ими, CHO, COS, NS0, SP2, PER.C6, или грибковую клетку, такую как Saccharomyces cerevisiae; или клетку насекомого, такую как Sf9.

Еще один аспект изобретения относится к способу получения связывающего белка, раскрытого в настоящем документе, включающему культивирование любой из клеток-хозяев, также раскрытых в настоящем документе, в культуральной среде в условиях, достаточных для получения связывающего белка. В варианте осуществления 50-75% связывающего белка, полученного данным способом, представляет собой двойной специфический четырехвалентный связывающий белок. В конкретном варианте осуществления 75-90% связывающего белка, полученного данным способом, представляет собой двойной специфический четырехвалентный связывающий белок. В конкретном варианте осуществления 90-95% связывающего полученного белка представляет собой двойной специфический четырехвалентный связывающий белок.

Один вариант осуществления относится к композиции для высвобождения связывающего белка, где композиция включает композицию, которая, в свою очередь, содержит кристаллизованный связывающий белок, раскрытый в настоящем документе, и ингредиент и по меньшей мере один полимерный носитель. Например, полимерный носитель представляет собой полимер, выбранный из одного или более полимеров из группы, состоящей из: поли(акриловой кислоты), поли(цианоакрилатов), поли(аминокислот), поли(ангидридов), поли(депсипептида), сложных поли(эфиров), поли(молочной кислоты), поли(молочной-со-гликолевой кислоты) или PLGA, поли(b-гидроксибутирата), поли(капролактона), поли(диоксанона), поли(этиленгликоля), поли(гидроксипропил)метакрилата), поли[(органо)фосфазена], поли(ортоэфиров), поли(винилового спирта), поли(винилпирролидона), сополимеров малеинового ангидрида-алкилвинилового эфира, плюрониковых полиолов, альгината, целлюлозы и производных целлюлозы, коллагена, фибрина, желатина, гиалуроновой кислоты, олигосахаридов, гликаминогликанов, сульфатированных полисахаридов, их смесей и сополимеров. Например, ингредиент выбран из группы, состоящей из альбумина, сахарозы, трегалозы, лактитола, желатина, гидроксипропил-β-циклодекстрина, метоксиполиэтиленгликоля и полиэтиленгликоля. Еще один вариант осуществления относится к способу лечения млекопитающего, включающему стадию введения млекопитающему эффективного количества композиции, раскрытой в настоящем документе.

Изобретение также относится к фармацевтической композиции, содержащей связывающей белок, раскрытый в настоящем документе, и фармацевтически приемлемый носитель. В еще одном варианте осуществления фармацевтическая композиция содержит по меньшей мере один дополнительный терапевтический агент для лечения расстройства. Например, дополнительный агент выбран из группы, состоящей из: терапевтического агента, визуализирующего агента, цитотоксического агента, ингибитора ангиогенеза (включая, но не ограничиваясь этим, анти-VEGF-антитело или VEGF-ловушку), ингибитора киназы (включая, но не ограничиваясь этим, ингибитор KDR и TIE-2), блокатора молекулы костимуляции (включая, но не ограничиваясь этим, анти-В7.1-антитело, анти-В7.2-антитело, CTLA4-Ig, анти-CD20-антитело), блокатора молекулы адгезии (включая, но не ограничиваясь этим, анти-LFA-1-антитело, анти-E/L-селектин-антитело, низкомолекулярный ингибитор), антитела к цитокину или его функционального фрагмента (включая, но не ограничиваясь этим, анти-IL-18-антитело, анти-TNF-антитело и анти-IL-6-антитело/антитело к рецептору цитокина), метотрексата, циклоспорина, рапамицина, FK506, детектируемой метки или репортера, антагониста TNF, противоревматического препарата, мышечного релаксанта, наркотического препарата, нестероидного противовоспалительного препарата (НПВП), анальгетика, анестетика, седативного средства, местного анестетика, нейромышечного блокатора, антимикробного препарата, антипсориатического препарата, кортикостероида, анаболического стероида, эритропоэтина, иммунизации, иммуноглобулина, иммуносупрессора, гормона роста, препарата заместительной гормональной терапии, радиоактивного фармацевтического препарата, антидепрессанта, антипсихотического препарата, стимулятора, препарата для лечения астмы, бета-агониста, ингаляционного стероида, эпинефрина или аналога, цитокина и антагониста цитокина.

В еще одном аспекте изобретение относится к способу лечения пациента, страдающего расстройством, включающему стадию введения любого из связывающих белков, раскрытых в настоящем документе, до, совместно или после введения второго агента, раскрытого в настоящем документе. В конкретном варианте осуществления второй агент выбран из группы, состоящей из буденозида, эпидермального фактора роста, кортикостероидов, циклоспорина, сульфасалазина, аминосалицилатов, 6-меркаптопурина, азатиоприна, метронидазола, ингибиторов липоксигеназы, месаламина, олсалазина, балсалазида, антиоксидантов, ингибиторов тромбоксана, антагонистов рецептора IL-1, анти-IL-1β mAb, mAb к IL-6 или рецептору IL-6, факторов роста, ингибиторов эластазы, производных пиридинилимидазола, антител или агонистов TNF, LT, IL-1, IL-2, IL-6, IL-7, IL-8, IL-12, IL-13, IL-15, IL-16, IL-18, IL-23, EMAP-II, GM-CSF, FGF и PDGF, антител к CD2, CD3, CD4, CD8, CD19, CD25, CD28, CD30, CD40, CD45, CD69, CD90 или их лигандов, метотрексата, циклоспорина, FK506, рапамицина, микофенолата мофетила, лефлуномида, НПВП, ибупрофена, кортикостероидов, преднизолона, ингибиторов фосфодиэстеразы, агонистов аденозина, противотромбических агентов, ингибиторов комплемента, адренергических агентов, IRAK, NIK, IKK, p38, ингибиторов МАР-киназы, ингибиторов IL-1β-превращающего фермента, ингибиторов TNFα-превращающего фермента, ингибиторов Т-клеточного сигнального пути, ингибиторов металлопротеиназы, сульфасалазина, азатиоприна, 6-меркаптопуринов, ингибиторов ангиотензин-превращающего фермента, растворимых рецепторов цитокинов, растворимого рецептора TNF р55, растворимого рецептора р75 TNF, sIL-1RI, sIL-1RII, sIL-6R, противовоспалительных цитокинов, IL-4, IL-10, IL-11, IL-13 и TGFβ.

Один аспект изобретения относится по меньшей мере к одному антиидиотипическому антителу, по меньшей мере к одному связывающему белку по настоящему изобретению. Антиидиотипическое антитело включает любой белок или пептид, содержащий молекулу, которая содержит по меньшей мере фрагмент молекулы иммуноглобулина, такой как, но не ограничиваясь этим, по меньшей мере один определяющий комплементарность участок (CDR) тяжелой или легкой цепи или его связывающийся с лигандом участок, вариабельная область тяжелой цепи или легкой цепи, константная область тяжелой цепи или легкой цепи, каркасная область, или любой их участок, который может быть включен в связывающий белок по настоящему изобретению.

Связывающий белок по настоящему изобретению можно использовать самостоятельно или в комбинации для лечения таких заболеваний. Должно быть понятно, что связывающие белки могут быть использованы самостоятельно или в комбинации с дополнительным агентом, например терапевтическим агентом, где дополнительный агент выбран специалистом в данной области для предназначенной цели. Например, дополнительный агент может представлять собой терапевтический агент, признанный в данной области как полезный для лечения заболевания или расстройства, которое лечится антителом по настоящему изобретению. Дополнительный агент также может представлять собой агент, который придает положительное качество терапевтической композиции, например агент, который оказывает влияние на вязкость композиции.

Также должно быть понятно, что комбинации, которые включены в настоящее изобретение, представляют собой комбинации, пригодные для предназначенной им цели. Агенты, представленные ниже, приводятся в целях иллюстрации и не предназначены для ограничения. Комбинации, которые являются частью настоящего изобретения, могут представлять собой антитела по настоящему изобретению и по меньшей мере один дополнительный агент, выбранный из перечня, приведенного ниже. Комбинация также может включать более одного дополнительного агента, например два или три дополнительных агента, если комбинация является такой, что полученная композиция может осуществлять ее предназначенную функцию.

Комбинации для лечения аутоиммунных и воспалительных заболеваний представляют собой нестероидные противовоспалительные препараты, также называемые НПВП, которые включают лекарственные препараты, подобные ибупрофену. Другими комбинациями являются кортикостероиды, включающие преднизолон; хорошо известные побочные эффекты при использовании стероидов можно снизить или даже полностью устранить снижением необходимой дозы стероида при лечении пациентов в комбинации с DVD Igs по настоящему изобретению. Неограничивающие примеры терапевтических агентов для лечения ревматоидного артрита, с которыми можно комбинировать антитело или участок антитела по изобретению, включают следующее: цитокин-подавляющий противовоспалительный препарат (CSAID); антитела к другим цитокинам человека или антагонисты других цитокинов человека или факторов роста, например TNF, LT, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-15, IL-16, IL-18, IL-21, IL-23, интерфероны, EMAP-II, GM-CSF, FGF и PDGF. Связывающие белки, включенные в способы по изобретению или их антигенсвязывающие участки, могут быть объединены с антителами к молекулам клеточной поверхности, таким как CD2, CD3, CD4, CD8, CD25, CD28, CD30, CD40, CD45, CD69, CD80 (B7.1), CD86 (B7.2), CD90, CTLA, или их лигандам, включая CD154 (gp39 или CD40L).

Комбинации терапевтических агентов могут интерферировать в различных точках в аутоиммунном и последующем воспалительном каскаде; примеры включают антагонисты TNF, такие как химерные, гуманизированные или человеческие антитела к TNF, адалимумаб (WO 97/29131), СА2 (Remicade™), CDP 571 и растворимые рецепторы TNF р55 или р75, их производные (p75TNFR1gG (Enbrel™) или p55TNFR1gG (Lenercept), а также ингибиторы TNFα-превращающего фермента; аналогично, ингибиторы IL-1 (ингибиторы интерлейкин-1-юпревращающего фермента, IL-1RA и т.д.) могут быть эффективными по той же причине. Другие комбинации включают интерлейкин 11. Еще одна комбинация включает ключевых участников аутоиммунного ответа, которые могут функционировать параллельно, в зависимости от функции IL-12 или во взаимодействии с ней; в частности, антагонисты IL-18, включая антитела к IL-18 или растворимые рецепторы IL-18, или связывающие IL-18 белки. Было показано, что IL-12 и IL-18 обладают перекрывающимися, но различными функциями, и комбинация антагонистов к обоим может быть наиболее эффективной. Еще одной комбинацией являются не приводящие к истощению ингибиторы анти-CD4. Еще другие комбинации включают антагонисты костимулирующего пути CD80 (B7.1) или CD86 (B7.2), включающие антитела, растворимые рецепторы и антагонистические лиганды.

Связывающие белки, включенные в способы по настоящему изобретению, также можно комбинировать с такими агентами, как метотрексат, 6-МР, азатиоприн, сульфасалазин, месалазин, олсалазин хлорквинин/гидроксихлорохин, пеницилламин, ауротиомалат (для внутримышечного и перорального введения), азатиоприн, колхицин, кортикостероиды (для перорального, ингаляционного применения и местной инъекции), агонисты бета-2-адренорецепторов (сальбутамол, тербуталин, салметерал), ксантины (теофиллин, аминофиллин), кромогликат, недокромил, кетотифен, ипратропий и окситропий, циклоспорин, FK506, рапамицин, микофенолата мофетил, лефлуномид, НПВП, например ибупрофен, кортикостероиды, такие как преднизолон, ингибиторы фосфодиэстеразы, агонисты аденозина, противотромбические агенты, ингибиторы комплемента, адренергические агенты, агенты, которые интерферируют с сигнальным путем провоспалительных цитокинов, таких как TNF-α или IL-1 (например, IRAK, NIK, IKK, p38 или ингибиторы МАР-киназы), ингибиторы IL-1β-превращающего фермента, ингибиторы TNFα-превращающего фермента (ТАСЕ), ингибиторы Т-клеточного сигнального пути, такие как ингибиторы киназы, ингибиторы металлопротеиназы, сульфасалазин, азатиоприн, 6-меркаптопурины, ингибиторы ангиотензин-превращающего фермента, растворимые рецепторы цитокинов и их производные (например, растворимые рецепторы TNF р55 или р75 и производные p75TNFRIgG (Enbrel™ и p55TNFRIgG (Lenercept)), sIL-1RI, sIL-1RII, sIL-6R), противовоспалительные цитокины (например, IL-4, IL-10, IL-11, IL-13 и TGFβ), целекоксиб, фолиевая кислота, гидроксихлорохина сульфат, рофекоксиб, этанерцепт, инфликсимаб, напроксен, валдекоксиб, сульфасалазин, метилпреднизолон, мелоксикам, метилпреднизолона ацетат, тиомалат золота и натрия, аспирин, триамцинолона ацетонид, пропоксифен напзилат/апап, фолат, набуметон, диклофенак, пироксикам, этодолак, диклофенак натрия, оксапрозин, оксикодон HCl, гидрокодона битартрат/апап, диклофенак натрия/мизопростол, фентанил, анакинра, человеческий рекомбинант, трамадол HCl, салсалат, сулиндак, цианокобаламин/фа/пиридоксин, ацетаминофен, алендронат натрия, преднизолон, морфина сульфат, лидокаина гидрохлорид, индометацин, глюкозамина сульф/хондроитин, амитриптилин HCl, сульфадиазин, оксикодон HCl/ацетаминофен, олопатадин HCl, мизопростол, напроксен натрия, омепразол, циклофосфамид, ритуксимаб, IL-1, TRAP, MRA, CTLA4-IG, IL-18 BP, анти-IL-18-антитело, анти-IL-15-антитело, BIRB-796, SCIO-469, VX-702, AMG-548, VX-740, рофлумиласт, IC-485, CDC-801 и мезопрам. Комбинации включают метотрексат или лефлуномид и в умеренных или тяжелых случаях ревматоидного артрита циклоспорин.

Примеры терапевтических агентов для лечения SLE (волчанки) и волчаночного нефрита, при которых связывающие белки, включенные в способы по изобретению, можно комбинировать, включают следующее: НПВП, например диклофенак, напроксен, ибупрофен, пироксикам, индометацин; ингибиторы СОХ2, например целекоксиб, рофекоксиб, валдекоксиб; препараты против малярии, например гидроксихлорохин; стероиды, например преднизон, преднизолон, буденозид, дексаметазон; цитостатики, например азатиоприн, циклофосфамид, микофенолата мофетил, метотрексат; ингибиторы PDE4 или ингибитор синтеза пуринов, например селлсепт. Связывающие белки, включенные в способы по изобретению, также можно комбинировать с такими агентами, как сульфасалазин, 5-аминосалициловая кислота, олсалазин, имуран, и агентами, которые нарушают синтез, продукцию или действием провоспалительных цитокинов, таких как IL-1, например ингибиторы каспазы, подобные ингибиторам IL-1β-превращающего фермента и IL-1ra. Связывающие белки, включенные в способы по изобретению, также можно использовать с ингибиторами Т-клеточного сигнального пути, например ингибиторами тирозинкиназы, или молекулами, которые нацелены на молекулы активации Т-клеток, например CTLA-4-IgG или семейство анти-В7-антител, семейство анти-PD-1-антител. Связывающие белки, включенные в способы по изобретению, можно объединить с IL-11 или антителами к цитокинам, например фонотолизумабом (анти-IFNg-антителом), антирецепторными антителами, например анти-IL-6 антирецепторным антителом и антителами к поверхностным молекулам В-клеток. Антитела по изобретению или их антигенсвязывающие фрагменты также можно использовать с LJP 394 (абетимусом), агентами, которые приводят к истощению или инактивации В-клеток, например ритуксимабом (анти-CD20-антителом), лимфостатом-В (анти-BlyS-антителом), антагонистами TNF, например анти-TNF-антителами, адалимумабом (РСТ публикация WO 97/29131; HUMIRA), CA2 (REMICADE), CDP 571, конструкции TNFR-Ig, (p75TNFRIgG (ENBREL)) и p55TNFRIgG (LENERCEPT)) и ингибиторами bcl-2, поскольку было показано, что сверхэкспрессия bcl-2 у трансгенных мышей вызывает подобный волчанке фенотип (см. Marquina, Regina et al., Journal of Immunology (2004), 172(11), 7177-7185), то следовательно, полагается, что ингибирование будет оказывать терапевтический эффект.

Фармацевтические композиции по изобретению могут содержать «терапевтически эффективное количество» или «профилактически эффективное количество» связывающего белка по изобретению. «Терапевтически эффективное количество» относится к количеству, эффективному в дозах и периодах времени, необходимых для достижения требуемого терапевтического результата. Терапевтически эффективное количество связывающего белка может определить специалист в данной области, и оно может варьировать в зависимости от таких факторов, как болезненное состояние, возраст, пол и масса индивидуума, и от способности связывающего белка вызывать требуемый ответ у индивидуума. Терапевтически эффективное количество также представляет собой количество, при котором любые токсические или отрицательные эффекты антитела или фрагмента антитела перевешиваются терапевтически полезными эффектами. «Профилактически эффективное количество» относится к количеству, эффективному в дозах и периодах времени, необходимых для достижения требуемого профилактического результата. Как правило, поскольку профилактическая доза используется у субъектов до или на ранней стадии заболевания, то профилактически эффективное количество будет ниже, чем терапевтически эффективное количество.

Схемы дозирования можно корректировать для обеспечения оптимального требуемого ответа (например, терапевтического или профилактического ответа). Например, препарат можно вводить в виде одного болюса, можно вводить в виде нескольких разделенных доз в течение времени, или дозу можно пропорционально снизить или увеличить, как это показано неотложностью терапевтической ситуации. Особенно преимущественно составлять композиции для парентерального введения в разовой лекарственной форме для простоты введения или однородности дозирования. Используемый в настоящем документе термин «разовая лекарственная форма» относится к физически дискретным единицам, подходящим для использования в качестве разовых доз для субъекта, подвергаемого лечению; каждую единицу, содержащую заранее определенное количество активного соединения, рассчитывают для обеспечения желаемого терапевтического эффекта в сочетании с необходимым фармацевтическим носителем. Подробное определение разовых лекарственных форм по изобретению диктуется и непосредственно зависит от (а) уникальных характеристик активного соединения и конкретного терапевтического эффекта, которого желательно достичь, и (b) ограничений, известных в области формуляции такого активного соединения для лечения чувствительности у индивидуумов.

Примерные неограничивающие пределы терапевтически или профилактически эффективного количества связывающего белка по изобретению составляют 0,1-20 мг/кг, например 1-10 мг/кг. Следует отметить, что значения доз могут варьировать в зависимости от типа и тяжести состояния, которое лечится. Также должно быть понятно, что для любого конкретного субъекта конкретные схемы введения следует корректировать в течение времени, исходя из потребности индивидуума и с учетом профессионального мнения лица, проводящего введение или наблюдение за введением композиций, и что пределы доз, приведенные в настоящем документе, являются только примерными и не предназначены для ограничения объема или практики заявленной композиции.

Специалистам в данной области будет легко понять, что возможны другие подходящие модификации и адаптации способов по изобретению, описанных в настоящем документе и которые могут быть сделаны с использованием подходящих эквивалентов, не отступая от объема изобретения или вариантов осуществления, описанных в настоящем документе. Описав подробно настоящее изобретение, оно будет понятнее при обращении к последующим примерам, которые приведены только в целях иллюстрации и не предназначены для ограничения изобретения.

Пример 1: тесты оценки аффинности конкурентного связывания для селективных ингибиторов Bcl-2

В целях исследования аффинности селективного связывания для рецепторов Bcl-2 проводили тестирование in vitro некоторых селективных ингибиторов Bcl-2 и сравнивали с неселективным ингибитором Bcl-2. В частности, два соединения: 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид (далее «соединение 1», селективный ингибитор Bcl-2) и N-(4-(4-((2-(4-хлорфенил)-5,5-диметил-1-циклогекс-1-ен-1-ил)метил)пиперазин-1-ил)бензоил)-4-(((1R)-3-(морфолин-4-ил)-1-((фенилсульфанил)метил)пропил)амино)-3-((трифторметил)сульфонил)бензолсульфонамид (далее «соединение 2», неселективный ингибитор Bcl-2) вводили в мышиные клетки (FL5.12), полученные как зависимые для выживания от Bcl-2 (FL5.12-Bcl-2) или Bcl-xL (FL5.12-Bcl-xL). Данные соединения, а также дополнительные соединения приведены в таблице 1А. Данные соединения и дополнительные соединения, приведенные в таблице 1А, также вводили в человеческие опухолевые клеточные линии, которые ранее показали себя как преимущественно зависимые для выживания от Bcl-2 (RS4; 11) или Bcl-xL (Н146), и оценивали эффект соединений. Проводили сравнение аффинности связывания для каждого из соединений для оценки аффинности к мишени, что определяли методом резонансного переноса энергии флуоресценции с временным разрешением (TR FRET). Также проводили исследования по определению эффективной концентрации, необходимой для ингибирования по меньшей мере 50% белка-мишени, что определяли по значению EC50, для всех соединений (WO 2010/138588 А2). Результаты тестирования in vitro соединений, приведенных в таблице 1А, представлены в таблице 1В ниже:

Таблица 1A
Перечень номеров соединений и связанных названий соединений
Номер соединения Название
1 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид
2 N-(4-(4-((2-(4-хлорфенил)-5,5-диметил-1-циклогекс-1-ен-1-ил)метил)пиперазин-1-ил)бензоил)-4-(((1R)-3-(морфолин-4-ил)-1-((фенилсульфанил)метил)пропил)амино)-3-((трифторметил)сульфонил)бензолсульфонамид
3 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индол-5-илокси)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)бензамид
4 транс-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-морфолин-4-илциклогексил)амино]-3-нитрофенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид
5 транс-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(4-метоксициклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид
6 транс-N-({5-хлор-6-[(4-гидроксициклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси)бензамид
7 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-{[4-({[(2S)-4-циклопропилморфолин-2-ил]метил}амино)-3-нитрофенил]сульфонил}-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид
8 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(цис-4-гидрокси-4-метилциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид
9 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-гидрокси-4-метилциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид
10 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-метилпиперазин-1-ил)амино]-3-нитрофенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид
11 N-[(3-хлор-4-{[4-фтор-1-(оксетан-3-ил)пиперидин-4-ил]метокси}фенил)сульфонил]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид
12 N-({5-хлор-6-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индазол-4-илокси]бензамид
13 N-[(5-хлор-6-{[(4-фтор-1-(оксетан-3-ил)пиперидин-4-ил]метокси}пиридин-3-ил)сульфонил]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид
14 N-({5-хлор-6-[(транс-4-гидроксициклогексил)метокси]пиридин-3-ил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-[(6-фтор-1Н-индазол-4-ил)окси]бензамид
15 N-({3-хлор-4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]фенил}сульфонил)-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид
16 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-фтортетрагидро-2Н-пиран-4-ил)метокси]-3-нитрофенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамид
17 транс-2-[(6-амино-5-хлорпиридин-3-ил)окси]-4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({4-[(4-морфолин-4-илциклогексил)амино]-3-нитрофенил}сульфонил)бензамид

Как показано в таблице 1В, соединение 1 имеет аффинность на уровне пикомолярных концентраций для Bcl-2, но обладает в >4000 раз более низкой аффинностью для Bcl-xL в тестах конкурентного связывания. На основании достоверно более высокой аффинности к Bcl-2 по сравнению с Bcl-xL можно предположить о наличии аффинности селективного связывания. Кроме того, соединение 1 приводило к высокой гибели клеток FL5.12-Bcl-2 (EC50=4 нМ), но проявляло значительно более слабую активность в отношении клеток FL5.12-Bcl-xL (EC50=261 нМ), что дополнительно указывает на функциональную избирательность соединения для Bcl-2. Кроме того, соединение 1 приводило к высокой гибели клеток RS4;11 (EC50=12 нМ), но проявляло существенно более слабую активность против клеток Н146 (EC50=3600 нМ), что также указывает на наличие функциональной избирательности соединения для Bcl-2. Так же, как показано в таблице 1В, дополнительные соединения демонстрировали аффинность селективного связывания для Bcl-2 по сравнению с Bcl-xL и другими белками семейства Bcl-2. Дополнительные соединения также ингибируют Bcl-2-зависимые клеточные линии по сравнению с Bcl-xL-зависимыми линиями. Ингибирование и гибель клеток под действием соединения 1 демонстрируют характерные признаки апоптической гибели клеток, которые включают быстрое высвобождение цитохрома с, активацию каспазы-3 и каспазы-7, экстернализацию мембранного фосфатидилсерина (PS). Гибель клеток под воздействием соединения 1 является зависимой от каспазы и может «отменяться» под действием пан-каспазного ингибитора z-VAD-fmk. Гибель клеток полностью подавляется, когда генетически удаляются Bax и Bak, основные нижележащие эффекторы. Эти данные указывают на то, что соединение 1 эффективно и избирательно разрывает Bcl-2 белок-белковые взаимодействия и индуцирует основанный на гибели клеток механизм в клетках, зависимых от Bcl-2, для выживаемости.

Пример 2: фармакодинамический ответ на селективный ингибитор Bcl-2, соединение 1

В данной области известно, что ингибирование некоторых членов семейства белков Bcl-2 может индуцировать ограничивающую дозу тромбоцитопению. Полагают, что ограничивающая дозу тромбоцитопения, которая существенно ограничивает терапевтическое применение некоторых неселективных ингибиторов Bcl-2 для аутоиммунных показаний, возникает за счет ингибирования Bcl-xL (см. Mason K.D. et al., Programmed anuclear cell death delimits platelet life span. Cell, 2007, 128(6), p. 1173-86). Исходя из вышеизложенного, оценивали влияние селективного для Bcl-2/недостаточно селективного для Bcl-xL соединения 1 на иммунные клетки периферической крови и тромбоциты у мышей (NZB×NZW)F1. Мышей обрабатывали в течение четырех суток соединением 1 (в дозе 1-100 мг/кг, перорально ежедневно) и определяли число клеток на гематологическом анализаторе Cell Dyn. Как показано на фигуре 1В, соединение 1 приводило к дозозависимому снижению лимфоцитов, одновременно сохраняя нормальное число тромбоцитов по сравнению с контролем. Как показано на фигуре 1А, соединение 2 также приводило к снижению числа лимфоцитов, но вызывало статистически значимое снижение уровня тромбоцитов. Эти данные согласуются с установленным профилем селективности в опытах in vitro и подчеркивают важное влияние Bcl-2 на выживаемость лимфоцитов и Bcl-xL на выживаемость тромбоцитов соответственно. Данные также дают основу для использования лимфопении в качестве удобного механистического биомаркера для соединения 1.

Также оценивали влияние селективных для Bcl-2/недостаточно селективных для Bcl-xL соединений на иммунные клетки периферической крови у мышей C57BL/6. Мышей обрабатывали в течение четырех суток отдельными соединениями (в дозе 100 мг/кг, перорально ежедневно) и определяли число клеток на гематологическом анализаторе Cell Dyn. Как показано в таблице 2, обработка всеми соединениями приводила к снижению уровня лимфоцитов после однократной пероральной дозы 100 мг/кг и после 4 пероральных доз 100 мг/кг.

Пример 3: фармакодинамический ответ на селективный ингибитор Bcl-2, соединение 3

Проводили эксперимент по оценке влияния дополнительного селективного ингибитора Bcl-2, соединения 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-2-(1Н-индол-5-илокси)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)бензамида, далее «соединение 3», на иммунные клетки и тромбоциты у мышей (NZB×NZW)F1. Мышей обрабатывали в течение четырех суток соединением 3 (дозы 30 мг/кг и 100 мг/кг, введенные путем ежедневной внутрибрюшинной инъекции) и определяли число клеток на гематологическом анализаторе Cell Dyn. Экспозицию соединения оценивали через 24 ч после введения последней дозы. Результаты данного эксперимента приведены на фигурах 2 и 3. Как показано на фигуре 2, соединение 3 приводило к дозозависимому снижению лимфоцитов, в то же время сохраняя нормальное число тромбоцитов по сравнению с контрольным носителем phosal. В частности, соединение 3 в дозах 30 мг/кг и 100 мг/кг приводило к снижению числа лимфоцитов соответственно на 47% и 66% без существенного влияния на число тромбоцитов. Кроме того, на фигуре 3 показано статистически значимое снижение CD+4 Т-клеток, CD+8 Т-клеток и CD+19 B-клеток для доз соединения 3 100 мг/кг и 300 мг/кг. По существу, результаты данных фармакодинамических исследований показали способность соединения 3, селективного ингибитора Bcl-2, эффективно снижать количество лимфоцитов без проявления побочных эффектов, ассоциированных с неселективными ингибиторами Bcl-2.

Пример 4: обработка селективными ингибиторами Bcl-2 на спонтанной мышиной модели волчанки

Для демонстрации того, что соединение 1 и соединение 17 являются перспективными лекарственными препаратами для лечения SLE или волчаночного нефрита у человека, проводили эксперименты на спонтанной мышиной модели (NZB×NZW)F1 волчанки (см. Liu K. and C. Mohan, What do mouse models teach us about human SLE? Clin. Immunol., 2006, 119(2), p. 123-130). Данная модель хорошо охарактеризована в отношении патофизиологических изменений, которые аналогичны для SLE человека. Модель предпочтительно воспроизводится на самках в отношении проявления заболевания и высоких титров анти-дц ДНК IgG антител в сыворотке крови, которые являются характерными признаками SLE у человека, с сопровождающимся отложением IgG в почках. Гистопатологические изменения в почках включают тяжелый гломерулонефрит, мезангиальные и периферические пролиферативные изменения, утолщение мембран капилляров, атрофию клубочков и инфильтрацию лимфоцитами и моноцитами/макрофагами, что имеет место у большинства пациентов с SLE. Данные изменения приводят к нарушению функции почек, о чем свидетельствует тяжелая протеинурия (PU) с показателями выше 300 мг/дл, которую определяли с использованием тест-полосок на альбумин, с последующей гибелью животных, что оценивали по выживаемости. Было показано, что два из клинических показателей для волчаночного нефрита, MMF и циклофосфамид, снижали титр аутоантител, подавляли патологию почек, замедляли начало развития тяжелой протеинурии и продлевали выживаемость у этих животных (см. Gelfand M.C. and A.D. Steinberg, Therapeutic studies in NZB-W mice. II. Relative efficacy of azathioprine, cyclophosphamide and methylprednisolone. Arthritis Rheum., 1972, 15(3), p. 247-252 и Ramos M.A. et al., Modulation of autoantibody production by mycophenolate mofetil: effects on the development of SLE in (NZBxNZW)F1 mice. Nephrol. Dial Transplant, 2003, 18(5), p. 878-83).

Самок (NZB×NZW)F1 получали из питомника The Jackson Laboratory (Bar Harbor, Maine, USA) и содержали в обычном помещении для животных во время эксперимента. Анти-дц ДНК-антитела определяли у мышей (NZB×NZW)F1 в 25-недельном возрасте и животных распределяли по различным опытным группам (N=14-18/группу) в возрасте 26 недель и вводили соединение 1 или соединение 17 перорально в суточных дозах в диапазоне от 1 до 100 мг/кг или микофенолата мофетил (MMF) в дозе 100 мг/кг. Протеинурию (PU) и выживаемость оценивали еженедельно с последующим определением числа лимфоцитов и тромбоцитов два раза в неделю и продукции анти-дц ДНК-антител. В течение исследования также определяли фармакокинетические параметры. Влияние на отложение IgG и патологию почек оценивали в конце исследования. Тяжелую PU определяли измерением в течение двух недель подряд показателя PU 300 мг/дл с использованием тест-полосок Albustix (VWR). Когда мыши входили в состояние агонии, их умерщвляли согласно протоколам Институционального комитета по уходу за животными и их использованию. Данные по PU и выживаемости представляли в виде кривых выживаемости Каплана-Мейера, используя программное обеспечение Graphpad Prism, и различия по группам считали статистически значимыми при уровне значимости р<0,05. Баллы по гистологической оценке анализировали с использованием анализа ANOVA. Анти-дц ДНК-антитела анализировали с использованием одностороннего анализа ANOVA и пост-теста Tukey.

Как показано на фигуре 4А, обработка соединением 1 приводила к замедленному началу развития тяжелой PU с дозозависимым характером, достигая статистической значимости при дозах 10, 30 и 100 мг/кг. Кроме того, обработка соединением 1 в дозах 3, 10, 30 и 100 мг/кг статистически достоверно продлевала выживаемость, как показано на фигуре 4В и в таблице 3А. Эти данные коррелировали с дозозависимым и стойким снижением числа лимфоцитов в периферической крови, приводя к 70% лимфопении при введении соединения 1 в дозах 30 и 100 мг/кг. Эффективность соединения 1 в дозе 30 мг/кг в конечных точках заболевания была сравнима с обработкой MMF в дозе 100 мг/кг. Экспозиция соединения на данной модели при введении в дозе 30 мг/кг составляла 40 мкг·ч/мл. Аналогичные результаты по эффективности были также получены для соединения 17, как показано на фигуре 4C, 4D и в таблице 3В.

Таблица 3A
Эффективность соединения 1 по PU и выживаемости на 47 неделе
Опытные группы % мышей с PU <300 мг/дл % выживаемости
Соединение 1
Контрольный носитель 7 19
1 мг/кг 51 60
3 мг/кг 50 70*
10 мг/кг 66* 83*
30 мг/кг 94* 100*
100 мг/кг 100* 100*
MMF
Контрольный носитель 13 13
100 мг/кг 94* 100*
*: P<0,05
Таблица 3b
Эффективность соединения 17 по PU и выживаемости на 39 неделе
Опытные группы % мышей с PU <300 мг/дл % выживаемости
Соединение 17
Контрольный носитель 71 93
1 мг/кг 58 67
3 мг/кг 67 92
10 мг/кг 71 93
30 мг/кг 86 100
100 мг/кг 100* 100
*: P<0,05

Пример 5: эффект селективных ингибиторов Bcl-2 на титр анти-дц ДНК-антител на спонтанной мышиной модели

Считается, что соединение 1 «запускает» апоптоз лимфоцитов, которые ответственны за продукцию антител, которые, в свою очередь, играют роль в прогрессировании системной красной волчанки, а также синдрома Шегрена. По существу, была выдвинута гипотеза, что обработка соединением 1 должна снижать титр анти-дц ДНК-антител. В частности, уровни анти-дц ДНК-антител определяли анализом ELISA и произвольные единицы концентрации устанавливали на мл относительно стандартного пула плазмы крови, полученной от 9-10-месячных мышей NZB/W. Анализ ELISA проводили в планшетах, покрытых поли-L-лизином, с последующим покрытием ДНК из тимуса теленка. Разведенные пробы плазмы крови мышей инкубировали и развивали с использованием анти-IgG HPR-конъюгированных антител и средние значения OD в двух параллельных лунках сравнивали с титрованной калибровочной кривой объединенной плазмы с высоким титром анти-дц ДНК-антител. Неразведенный пул стандартной плазмы произвольно устанавливали на значении 1000 единиц анти-дц ДНК-антител/мл. Затем использовали линейный регрессионный анализ для расчета относительных единиц данной пробы, умноженных на данный фактор разведения.

Результаты этого эксперимента приведены на фигуре 5. У контрольных животных уровни анти-дц ДНК IgG повышались от среднего значения <100 единиц/мл в исходном периоде (25 недель) до среднего значения ~600 единиц/мл на 32 неделе, с последующим повышением до ~1800 единиц/мл на 40 неделе. Очевидное повышение титра анти-дц ДНК-антител имело место с сопутствующим повышением тяжести и частоты заболевания по данным PU и выживаемости. Отсутствовало существенное снижение титра анти-дц ДНК-антител в группах мышей, обработанных соединением 1 в дозах 1, 3 и 10 мг/кг. Однако на 40 неделе обработка соединением 1 в дозах 30 и 100 мг/кг статистически значимо подавляла повышение титра анти-дц ДНК-антител по сравнению с контрольным носителем, что было сравнимо с эффектом, наблюдаемым для MMF.

Пример 6: инфильтрация ткани почек селективными ингибиторами Bcl-2

Проводили эксперимент по определению степени, с которой селективные ингибиторы Bcl-2 инфильтрировали ткань почек. В частности, проводили гистологическую оценку проникновения селективных ингибиторов Bcl-2 в ткань почек на спонтанной мышиной модели волчанки. Спонтанную мышиную модель волчанки, описанную в примере 3, использовали для гистологической оценки, описанной в настоящем документе. Почки разрезали пополам и затем фиксировали в 10% нейтральном забуференном формалине или подвергали криоконсервации (мгновенному замораживанию). После окрашивания гематоксилином-эозином срезов толщиной 5 мкм из залитой в парафин ткани квалифицированный патоморфолог оценивал их в баллах полуколичественно (0-4) в отношении наличия гломерулонефрита и изменений канальцев (расширение и цилиндров). Для иммуногистохимии IgG криосрезы толщиной 5 мкм фиксировали в ацетоне, промывали и блокировали 10% нормальной козьей сывороткой. Затем срезы инкубировали с FITC-конъюгированным козьим антимышиным IgG (Cappel/ICN Pharmaceuticals) или HPR-козьим IgG, используемым в качестве отрицательного контроля (Jackson ImmunoResearch Laboratories), и накрывали покровным стеклом с использованием 4',6-диамидино-2-фенилиндола Vectashield (Vector Laboratories). Срезы оценивали на степень отложения IgG с использованием полуколичественной оценочной системы (от 0 до 4). Для идентификации В- и Т-клеток проводили иммуногистохимический анализ на CD45R (В-клетки) и CD3 (Т-клетки) на парафиновых срезах. На фигурах 6 и 7 приведены результаты гистохимической оценки, и на фигуре 8 показан эффект обработки селективными ингибиторами Bcl-2 на отложение IgG, В-клеток и Т-клеток в почках.

Как показано на фигуре 6, у мышей со спонтанным волчаночным нефритом, которым вводили носитель phosal, как правило, имели место инфильтраты в почках, о чем судили по цилиндрам в канальцах, расширенным канальцам, наличию гломерулосклероза и клеточных инфильтратов. Инфильтраты в ткани почек у мышей со спонтанным волчаночным нефритом, которым вводили соединение 1 в дозах 30 и 100 мг/кг, были небольшими, дискретными и менее частыми. Кроме того, на фигуре 7 приведен график в столбцах, показывающий различие в баллах гистологической оценки ткани почек мышей, которых не обрабатывали, обрабатывали соединением 1 в дозах 30 и 100 мг/кг, и мышей, обработанных MMF в дозе 100 мг/кг. Как показано на фигуре 7, ткань, обработанная соединением 1 в дозах 30 мг/кг и 100 мг/кг, показывала статистически значимое улучшение (снижение тяжести) баллов гистологии в отношении гломерулонефрита, изменений канальцев и периваскулярных инфильтратов.

Далее, на фигуре 8 показано снижение отложения IgG в ткани почек, обработанной соединением 1 в дозе 30 мг/кг, а также снижение числа В-клеток и Т-клеток в почечной ткани, обработанной соединением 1 в дозе 100 мг/кг. Следовательно, селективный ингибитор Bcl-2, соединение 1, демонстрировал снижение отложения IgG, инфильтрации и наличия В-клеток и Т-клеток в почечной ткани, а также приводил к статистически значимому улучшению баллов гистологической оценки по сравнению с обработкой носителем phosal.

Пример 7: обработка селективным ингибитором Bcl-2 на модели волчанки, индуцированной интерфероном-α

В результате того, что для завершения опытов на спонтанной модели (NZB×NZW)F1 требуется 6-8 месяцев за счет медленного развития проявлений заболевания, проводили дополнительное тестирование селективных ингибиторов Bcl-2 на альтернативных моделях. Для обеспечения более быстрой оценки воспроизводили IFNα-индуцированную модель волчанки и использовали для определения терапевтической эффективности соединения 1. Сообщалось о повышенном уровне IFNα в сыворотке крови и сопутствующем повышенном «ответном профиле гена IFNα» в подгруппе пациентов с SLE (см. Kwok S.K., et al., Dysfunctional interferon-alpha production by peripheral plasmacytoid dendritic cells upon Toll-like receptor-9 stimulation in patients with systemic lupus erythematosus. Arthritis Res. Ther., 2008, 10(2), p. R29 и Rong Z. et al., Effect of Interferon-alpha in systemic lupus erythematosus (SLE) serum on differentiation and maturation of dendritic cells derived from CD34+ hematopoietic precursor cells. Journal of Nanjing Medical University, 2009, 23(6), p. 380-385). Также сообщалось об индуцированном лекарственным препаратом SLE-подобном заболевании у пациентов с ВИЧ-инфекцией, получавших лечение IFNα (см. Wilson L.E. et al., Autoimmune disease complicating antiviral therapy for hepatitis C virus infection. Semin Arthritis Rheum., 2002, 32(3), p. 163-173). Данные наблюдения подчеркивают важную роль сигнального пути с участием IFNα в патогенезе SLE.

Для подтверждения эффекта IFNα на грызунах заявители и другие исследователи в данной области (см. Bardwell P.D., et al., The Bcl-2 family antagonist ABT-737 significantly inhibits multiple animal models of autoimmunity. J. Immunol., 2009, 182(12), p. 7482-7490; и Mathian A. et al., IFN-alpha induces early lethal lupus in preautoimmune (New Zealand Black × New Zealand White)F1 but not in BALB/c mice. J. Immunol, 2005, 174(5), p. 2499-2506) воспроизводили опосредованную аденовирусом индуцированную IFNα (NZB×NZW)F1 модель волчанки, которая напоминает быстрое и тяжелое заболевание с многочисленными признаками, аналогичными при спонтанной волчанке на мышах (NZB×NZW)F1, включая гибель в результате тяжелого гломерулонефрита. Однако также имеются различия между двумя моделями: (1) для тяжелого волчаночного нефрита требуется более высокая, чем физиологическая, продукция IFNα в крови (см. Mathian A., et al., IFN-alpha induces early lethal lupus in preautoimmune (New Zealand Black × New Zealand White)F1 but not in BALB/c mice. J. Immunol., 2005, 174(5), p. 2499-2506); (2) наблюдается стойкая, >50% лимфопения в периферической крови при обработке IFNα в течение 2 недель; (3) усиление течения заболевания не ассоциировано с резким повышением гуморального аутоиммунитета, показателем которого является титр анти-дц ДНК-антител, как это наблюдается на спонтанных мышах (NZB×NZW)F1. Данные, полученные в этом эксперименте, согласовывались с недавно полученными результатами на мышах, обработанных IFNα аденовирусом, B6.Sle123 (см. Fairhurst A.M., et al.,Systemic IFN-alpha drives kidney nephritis in B6.Sle123 mice. Eur. J. Immunol., 2008, 38(7), p. 1948-1960) и поддерживали идею о том, что основным эффектом обработки IFNα на патогенез заболевания на данной модели является регуляция конечного органного заболевания, возможно, посредством активации многих типов иммунных клеток и продукции провоспалительных цитокинов.

Соединение 1, MMF и BAFFR3-Ig (заменитель белимумаба) оценивали на IFNα-индуцированной модели волчанки на мышах (NZB×NZW)F1. BAFFR3-Ig специфически блокирует связывание BAFF/BLyS с его рецептором BAFFR3, приводя к системному снижению числа В-клеток в лимфоидных органах (см. Kayagaki, N., et al., BAFF/BLyS receptor 3 binds the B cell survival factor BAFF ligand through a discrete surface loop and promotes processing of NF-kappaB2. Immunity, 2002, 17(4), p. 515-524). Обработку начинали в позднем-профилактическом режиме (через 7 суток после обработки IFNα аденовирусом). В частности, мышам (NZB×NZW)F1 (The Jackson Laboratory) в возрасте 13-15 недель вводили однократную внутривенную дозу IFNα аденовируса (Abbott) в концентрации 5×109 вирусных частиц/мышь. Опытным группам мышей вводили соединение 1 в пределах доз 1-100 мг/кг/сутки перорально; микофенолата мофетил (MMF) в дозе 100 мг/кг/сутки перорально и BAFFR3-Ig (блокатор BAFF/BLys) в дозе 15 мг/кг 3 раза в неделю внутрибрюшинной инъекцией. Животным всех опытных групп обработку начинали через 7 суток после инъекции аденовируса. После введения аденовируса у мышей еженедельно оценивали протеинурию (PU) с использованием тест-полосок Albustix (VWR). Тяжелую PU определяли измерением в течение последовательных недель показателя PU ≥300 мг/дл. Когда мыши входили в стадию агонии, их умерщвляли согласно протоколам Институционального комитета по уходу за животными и их использованию.

Результаты данного эксперимента приведены на фигуре 9 и в таблице 4 ниже. Согласуясь с результатами, полученными на мышах со спонтанной волчанкой, обработка соединением 1 в дозах 30 и 100 мг/кг существенно замедляла начало проявления тяжелой PU и продлевала выживаемость животных. Эффективность была сравнима, если даже не выше, с MMF и BAFFR3-Ig и коррелировала со стойкой лимфопенией. Экспозиция составила примерно 40 мкг·ч/мл.

Таблица 4
Эффективность по PU и выживаемости у животных, обработанных соединением 1, MMF и BAFF-R3-Ig
Опытные группы % мышей с PU <300 мг/дл % выживаемости
Соединение 1
Контрольный носитель 0 16
30 мг/кг 77* 82*
MMF
Контрольный носитель 0 42
100 мг/кг 40* 72*
BAFFR3-Ig
PBS 10 60
15 мг/кг 70* 958
*: P<0,05

Пример 8: эффект селективных ингибиторов Bcl-2 на титр анти-дц ДНК-антител на модели волчанки, индуцированной интерфероном-α

Проводили дополнительный эксперимент по оценке эффектов обработки селективным ингибитором Bcl-2 на титр анти-дц ДНК-антител на модели волчанки, индуцированной интерфероном-альфа. Уровни анти-дц ДНК-антител определяли анализом ELISA и произвольные единицы концентрации устанавливали на мл относительно стандартного пула в плазме крови, полученного от 9-10-месячных мышей NZB/W. Анализ ELISA проводили в планшетах, покрытых поли-L-лизином, с последующим покрытием ДНК из тимуса теленка. Разведенные пробы плазмы крови мышей инкубировали и развивали с использованием анти-IgG HPR-конъюгированных антител и средние значения OD в двух параллельных лунках сравнивали с титрованной калибровочной кривой объединенной плазмы с высоким титром анти-дц ДНК-антител. Неразведенный пул стандартной плазмы произвольно устанавливали на значении 1000 единиц анти-дц ДНК-антител /мл. Затем использовали линейный регрессионный анализ для расчета относительных единиц данной пробы, умноженных на данный фактор разведения. Результаты данного опыта приведены на фигуре 10.

В противоположность результатам, полученным на спонтанной мышиной модели (NZB×NZW)F1, приведенным на фигуре 5, соединение 1 не снижало статистически значимо титр анти-дц ДНК-антител на индуцированной интерфероном модели, как показано на фигуре 10. Имела место 2-кратная, но не статистически значимая индукция титра анти-дц ДНК-антител в период между 42 и 55 сутками, которая не зависела от дозы. Следует отметить, что обработка соединением 1 в дозе 30 мг/кг данных животных сохраняла >70% лимфопению в крови во время обработки и защищала животных от волчаночного нефрита.

Пример 9: инфильтрация селективных ингибиторов Bcl-2 в слюнные железы

В данной области известно, что синдром Шегрена является хроническим заболеванием, которое поражает продуцирующие жидкость железы организма, включая слюнные железы в ротовой полости. По существу, была выдвинута теория, что проникновение селективных ингибиторов Bcl-2 в слюнные железы пациентов с синдромом Шегрена может обеспечить эффективное лечение для снижения лимфоцитов, ассоциированных с синдромом Шегрена, без ограничивающей дозу тромбоцитопении, ассоциированной с неселективным ингибированием Bcl-2. Проводили гистологическую оценку проникновения селективных ингибиторов Bcl-2 в слюнные железы на спонтанной мышиной модели волчанки для проверки данной теории. Для гистологической оценки, описанной в настоящем документе, использовали спонтанную мышиную модель волчанки, как описано в примере 3. В частности, подъязычные и подчелюстные слюнные железы фиксировали в 10% нейтральном забуференном формалине и заливали в парафин. Срезы толщиной 5 мкм окрашивали гематоксилин-эозином, и квалифицированный патоморфолог оценивал срезы полуколичественно (0-4) на наличие воспалительных клеточных инфильтратов в железах. Категории оценки инфильтратов слюнных желез были следующими: (1) 3 или меньше небольших перидуктулярных очага; (2) 3 или более очагов средних размеров; (3) несколько больших очагов и (4) слитые инфильтраты с диффузией. Гистологическая оценка срезов ткани подчелюстной железы показана на фигуре 11.

Как показано на фигуре 11, у мышей со спонтанным нефритом, которым вводили носитель phosal, как правило, имели место обширные перидуктулярные инфильтраты со слиянием. Инфильтраты слюнных желез у мышей со спонтанным волчаночным нефритом, которым вводили соединение 1 в дозах 30 или 100 мг/кг, были небольшими, дискретными и менее частыми. Кроме того, на фигуре 12 приведен график в столбцах, показывающий различие в баллах гистологической оценки ткани подчелюстной слюнной железы, которую не обрабатывали, ткани, обработанной соединением 1 в дозе 10 мг/кг, и ткани, обработанной соединением 1 в дозах 30 и 100 мг/кг. Как показано на фигуре 11, для ткани, обработанной соединением 1 в дозах 30 мг/кг и 100 мг/кг, имело место статистически значимое улучшение баллов гистологической оценки, что подтверждается тем фактом, что баллы гистологии для обработки дозами 30 и 100 мг/кг были ниже.

Следовательно, синдром Шегрена является воспалительным заболеванием, которое поражает продуцирующие жидкость железы организма, включая слюнные железы. Проводили гистологическую оценку слюнных желез на спонтанных мышиных моделях для определения того, насколько обработка селективным ингибитором Bcl-2 может снижать воспалительные процессы в слюнной железе и, в конечном итоге, обеспечивать возможность лечения синдрома Шегрена. Результаты гистологической оценки показывали, что соединение 1 в дозах 30 мг/кг и 100 мг/кг приводило к пониженному воспалению в слюнных железах, что подтверждалось снижением баллов гистологической оценки с 3-4 у мышей, которых не обрабатывали, до 1-2 баллов у мышей, которые подвергались обработке. Таким образом, было установлено, что селективные ингибиторы Bcl-2 могут обеспечить эффективное лечение пациентов с синдромом Шегрена.

1. Применение 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамида или его фармацевтически приемлемой соли для получения лекарственного средства для лечения системной красной волчанки, волчаночного нефрита или синдрома Шегрена у пациента, указанное применение включает введение пациенту лекарственного средства, включающего терапевтически эффективное количество 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамида или его фармацевтически приемлемой соли.

2. Применение по п. 1, для применения в терапевтически эффективном количестве в пределах от 0,001 мг/кг до 1000 мг/кг.

3. Применение по п. 2, для применения в терапевтически эффективном количестве в пределах от 0,01 мг/кг до 500 мг/кг.

4. Применение по п. 3, для применения в терапевтически эффективном количестве в пределах от 0,1 мг/кг до 300 мг/кг.

5. Применение по п. 4, для применения в терапевтически эффективном количестве в пределах от 1 мг/кг до 100 мг/кг.

6. Применение по п. 1, для применения в комбинации со связующим белком для дополнительного повышения эффективности соединения в желаемом месте действия.

7. Применение 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-гидрокси-4-метилциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло [2,3-b]пиридин-5-илокси)бензамида или его фармацевтически приемлемой соли для получения лекарственного средства для лечения системной красной волчанки, волчаночного нефрита или синдрома Шегрена у пациента, указанное применение включает введение пациенту терапевтически эффективного количества 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-гидрокси-4-метилциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамида или его фармацевтически приемлемой соли.

8. Применение по п. 7, для применения в терапевтически эффективном количестве в пределах от 0,001 мг/кг до 1000 мг/кг.

9. Применение по п. 8, для применения в терапевтически эффективном количестве в пределах от 0,01 мг/кг до 500 мг/кг.

10. Применение по п. 9, для применения в терапевтически эффективном количестве в пределах от 0,1 мг/кг до 300 мг/кг.

11. Применение по п. 10, для применения в терапевтически эффективном количестве в пределах от 1 мг/кг до 100 мг/кг.

12. Применение по п. 7, для применения в комбинации со связующим белком для дополнительного повышения эффективности соединения в желаемом месте действия.



 

Похожие патенты:

Изобретение относится к области медицины, в частности к способу иммунотерапии солидных опухолей. Способ иммунотерапии солидных опухолей, заключающийся в вакцинации пациента комбинацией препарата экзосом и олигодезоксинуклеотида Р-типа, при этом препарат включает экзосомы, выделенные культурой клеток K562/i-S9, и содержит белок, антигены CEA, 5Т4, лиганды FasL и TRAIL, а олигодезоксинуклеотид Р-типа представляет собой последовательность нуклеотидов GGGGCGCCGTGATGGCGAGCGCGCC, указанную комбинацию вводят подкожно в течение не менее 2 месяцев и не реже 1 раза в неделю в эффективном количестве, предпочтительно в дозах 0,01-0,04 мг/кг каждый.

Изобретение относится к медицине, а именно к иммунологии, и может быть использовано для применения производного олигохитозана в качестве адъюванта для вакцин. Производное олигохитозана состоит из звеньев глюкозамина 91-98% и (N-ацил)глюкозамина 2-9% с молекулярной массой от 5 до 15 кДа.

Группа изобретений относится к медицине, фармакологии и касается способов снижения продолжительности или тяжести воспалительного иммунного ответа у субъекта, а также фармацевтической композиции, содержащей как таковые карбоксилированные частицы.

Изобретение относится к биохимии. Описано применение антител или их фрагментов, которые специфично связывают hDH4 и блокируют взаимодействие между Dll4 и Notch-рецептором для предупреждения, лечения или ослабления сахарного диабета 1-го типа у субъекта.

Данное изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5 человека, охарактеризованное последовательностями гипервариабельных участков (HVR), и его антигенсвязывающий фрагмент.

Изобретение относится к области иммунологии и медицины. Предложено применение антитела или его антиген-связывающего фрагмента, которые специфически связываются с дельта-подобным лигандом 4 (Dll4) человека, в предупреждении рецидивирования рассеянного склероза или снижении развития данного заболевания при его рецидивировании у субъекта.

Изобретение относится к новым соединениям общей формулы (I), где каждый из m и n независимо представляет собой 0 или 1; R1 и R2, вместе с атомом углерода, к которому они присоединены, образуют гетероциклическое кольцо, содержащее один или два гетероатома, выбранных из кислорода, серы, -S(O)- и -S(O)2-; R3 представляет собой -CHF2, -CF3, -OCHF2, -OCF3, -SCHF2 или -SCF3; или их фармацевтически приемлемым солям, гидратам или сольватам, а также к фармацевтическим композициям на их основе, а также к способу лечения воспалительных заболеваний, так как эти соединения проявляют активность ингибирования PDE4 и могут быть полезными при лечении воспалительных заболеваний и расстройств.

Изобретение относится к соединению формулы (1), где R1 выбирают из группы, состоящей из гидроксигруппы и ее физиологически гидролизуемых сложных эфиров и -NR8R9, где R8 и R9 независимо выбирают из группы, состоящей из водорода и незамещенного (С1-С3)алкила; R2 и R3 независимо выбирают из группы, состоящей из водорода или незамещенного (С1-С3)алкила; каждый из R4 независимо выбирают из группы, состоящей из галогена и незамещенного (С1-С3)алкила, а n представляет собой целое число от 0 до 4; каждый из R5 независимо выбирают из группы, состоящей из галогена и незамещенного (С1-С3)алкила, a m представляет собой целое число от 0 до 3; R6 представляет собой незамещенный циклогексил или циклогексил, замещенный (С1-С6)алкилом, галогеном или трифторметилом; и его фармацевтически приемлемые соли.

Настоящее изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5, охарактеризованное последовательностями HVR.

Изобретение относится к соединениям формулы (I), где Y означает 6-членный гетероарил, содержащий 1-2 атома азота; R2 выбирают из OR14 и NR6R7; каждый из R6 и R7 независимо выбирают из H, C1-C12 алкила, C3-C12 циклоалкила, 6-членного гетероцикла, содержащего 1 атом азота, или бензила, где указанные алкил, циклоалкил или бензил необязательно замещены одной или более группами, независимо выбираемыми из -F, -OR8, -NR12SO2R13, -C(=O)NR12R13, или R6 и R7, вместе с атомом азота, к которому присоединены, образуют 5-6 членное гетероциклическое кольцо, содержащее 1 атом азота, и указанное 5-6 членное гетероциклическое кольцо необязательно замещено одним или более -ОН; R8 выбирают из водорода и C1-C12 алкила, и каждый из R12, R13 и R14 независимо выбирают из H и C1-C12 алкила, где указанный алкил необязательно замещен -OH; или их таутомерам, энантиомерам или фармацевтически приемлемым солям.

Изобретение относится к способу получения соединения или его соли, представленного формулой (I), который включает реакцию соединения или его соли, представленного формулой (II), и производного анилина, представленного формулой (III), в воде или смешанном растворителе из воды и органического растворителя в присутствии 1-этил-3-(3-диметиламинопропил)карбодиимида и, главным образом, при отсутствии основания: . Технический результат: разработан новый улучшенный способ получения соединения или его соли, представленного формулой (I).

Изобретение относится к медицине. Описана композиция жидкого или гелеобразного состава, содержащая арипипразол в форме пластыря для трансдермальной доставки.

Изобретение относится к способам получения хиральных соединений, в частности к способу получения хирального соединения формулы (II). Способ включает реакцию хирального соединения формулы (I) с H2N-NH-CHO в растворителе с получением соединения формулы (II).

Изобретение относится к способу получения соединения формулы (IVb), включающему (1.1) использование соединения формулы (Ia) или его соли (1.2) использование производного фосгена формулы (IIb) в которой Y1N- и Y2N- обозначают одинаковые или разные необязательно замещенные азотсодержащие гетероциклические фрагменты, предпочтительно выбранные из группы, включающей имидазолил и бензимидазолил; (1.3) использование соединения формулы (III) или его соли в которой R1 обозначает этил, и в которой -R обозначает -Н; (2) смешивание и введение в реакцию соединений формул (Ia), (IIb) и (III) в растворителе в любом порядке с получением реакционной смеси, содержащей хиральное соединение формулы (IVb) Изобретение также относится к хиральному соединению формулы (IVb), к необязательно кристаллическому хиральному соединению формулы (IVb) и к соединению формулы (IIc) для получения соединения формулы (IVb) или формулы (IVd).

Изобретение относится к соединениям общей формулы (I), которая приведена ниже, или к их фармацевтически приемлемым солям, обладающим фармакологической активностью в отношении сигма рецептора, к способам получения таких соединений, к содержащим их фармацевтическим композициям и к их применению для лечения и/или профилактики заболевания, в которое вовлечен сигма рецептор.

Изобретение относится к соединению, которое имеет изображенную ниже формулу (I), или к его фармакологически приемлемой соли. Данное соединение может ингибировать киназы семейства рецептора фактора роста фибробластов (FGFR) в раковых тканях.

Изобретение относится к твердой дисперсии для индукции апоптоза. Дисперсия включает соединение Формулы I где: R0 обозначает хлор; R1 и R2 обозначают Н; R3 и R4 обозначают метил; А1 обозначает N, и А2 обозначает СН; R5 обозначает нитро; X обозначает -NH-; Y обозначает -(СН2)n-, где n=1; и R6 выбран из группы, состоящей из тетрагидропиранила и 4-гидрокси-4-метилциклогексила; или его фармацевтически приемлемую соль.

Изобретение относится к амидному производному формулы (I), обладающему свойством ингибирования продукции proMMP-9, а также к фармацевтической композиции и лекарственному средству на их основе и средству для ингибирования продукции ММР-9.

Изобретение относится к 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-гидрокси-4-метилциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1H-пирроло[2,3-b]пиридин-5-илокси)бензамиду и фармацевтической композиции, содержащей терапевтически эффективное количество указанного соединения.

Изобретение относится к соединениям, представленным общей формулой (I) и их фармацевтически приемлемым солям. Соединения изобретения обладают активностью агониста рецептора D2.

Изобретение относится к соединению формулы [I] и его фармацевтически приемлемым солям. Соединение формулы [I] обладает ренин-ингибирующей активностью. В формуле [I] R1 представляет собой С3-6-циклоалкильную группу; R представляет собой низшую алкильную группу или образует 5-6-членное кольцо путем связывания с R22 на каждом конце; Т представляет собой карбонильную группу; Z представляет собой -О-, -NH- или одинарную связь; и R3, R4, R5 и R6 представляют собой атом водорода. Изобретение относится также к фармацевтической композиции, содержащей соединение изобретения, и к соединению формулы [II]. Технический результат: получены новые соединения формулы [I], обладающие ренин-ингибирующей активностью. 3 н. и 8 з.п. ф-лы, 93 табл., 422 пр.
Наверх