Способ комбинированного лечения немелкоклеточного рака легкого 1в-111 стадии с персонификацией адъювантной химиотерапии


 


Владельцы патента RU 2593342:

Федеральное государственное бюджетное научное учреждение "Томский научно-исследовательский институт онкологии" (Томский НИИ онкологии) (RU)

Изобретение относится к медицине, а именно, к онкологии, и может быть использованго для комбинированного лечения немелкоклеточного рака легкого (НМРЛ) IB - III стадии. Способ включает проведение неоадъювантной химиотерапии, до ее начала проводят забор биопсийного материала опухоли, из которого выделяют тотальную РНК и определяют уровень экспрессии генов монорезистентности RRM1, TYMS, АВСС5, ERCC1, TOP1, ТОР2а, TUBB3 в ткани опухоли. На втором этапе проводят курсы неоадъювантной химиотерапии, на третьем этапе комбинированного лечения выполняют радикальную операцию в объеме пневмонэктемии или лобэктомии, во время которой производят забор образцов опухолевой ткани и визуально неизмененной ткани легкого/бронха, в которых проводят повторное определение уровней экспрессии генов монорезистентности, далее, в послеоперационном периоде на 15 сутки проводят адъювантную химиотерапию карбоплатином в дозе по AUC6 во 2-й день цикла, при уровне экспрессии гена монорезистентности ERCC1 менее 0,5, в комбинации с одним из цитостатиков, выбор которого зависит от уровня экспрессии исследуемых генов монорезистентности. Использование изобретения позволяет повысить эффективность лечения

НМРЛ IB - III стадии. 1 ил., 4 пр.

 

Изобретение относится к медицине, конкретно к онкологии, и может быть использовано для комбинированного лечения немелкоклеточного рака легкого IB - III стадии с персонификацией адъювантной химиотерапии.

Несмотря на успехи в лечении, рак легких продолжает оставаться ведущей причиной смерти от рака в большинстве стран мира. По данным GLOBOCAN за 2012 год, заболеваемость раком легкого составила 16,7% (более 1,2 млн человек) от общего числа случаев и 23,6% (1,1 млн) смертей [1]. Хирургическое лечение резектабельных форм немелкоклеточного рака легких является наиболее эффективным методом, дающим реальные перспективы для излечения [2]. Однако показатели 5-летней выживаемости прогрессивно снижаются в зависимости от местной распространенности онкологического процесса и от состояния лимфатического аппарата. Так, у больных с I стадией заболевания она находится в диапазоне между 50% и 70%, от 30 до 50% при II стадии и от 10% до 30% у пациентов с IIIA стадией заболевания [3]. К моменту установления диагноза более 75% больных раком легкого имеют местно распространенный или метастатический процесс, поэтому важнейшей задачей повышения эффективности лечения остается разработка новых способов комбинированного лечения.

Системная лекарственная противоопухолевая терапия призвана дополнить хирургическое лечение. В плане комбинированного лечения химиотерапия может применяться как до операции, так и после нее [2, 4].

Основная задача неоадъювантной химиотерапии (НАХТ) состоит в повреждении опухолевых клеток, снижении степени их злокачественности, санации лимфатических путей корня легкого и средостения для предупреждения лимфо- и гематогенного метастазирования и, следовательно, рецидива болезни [4]. При использовании химиотерапии в неоадъювантном режиме наблюдается лучшая переносимость, чем в послеоперационном периоде, повышается ее эффективность при неизмененном кровоснабжении опухоли до операции, а также повышается возможность проведения всех запланированных курсов химиотерапии. Эффективность предоперационной химиотерапии определяется уменьшением размеров опухоли; повышением операбельности и резектабельности опухоли; ликвидации или профилактики микрометастазов [5].

Целью адъювантной химиотерапии является эрадикация или длительное подавление микрометастазов рака легкого после удаления первичной опухоли. Послеоперационная химиотерапия может быть применима уже пациентам с IB стадией НМРЛ (размер опухоли более 4 см) [6].

С помощью сочетания неоадъювантной и адъювантной химиотерапии повышается эффективность лечения и, соответственно, увеличивается общая и безрецидивная выживаемость больных раком легкого [2, 4].

Одним из перспективных подходов к лечению является поиск молекулярно-генетических маркеров чувствительности к отдельным цитостатикам [7, 8, 9]. К таковым, например, относится ген ERCC1, повышенная экспрессия которого означает резистентность к препаратам платины в силу высокой активности процессов репарации ДНК [10]. Избыток мишени для 5-фторурацила - тимидилатсинтетазы (TYMS) приводит к тому, что переносимые дозы гемцитабина не могут «насытить» этот фермент и оказываются заведомо неэффективными. Для винорельбина важна экспрессия в опухоли в3-тубулина (TUBB3), основного строительного материала микротрубочек, гиперэкспрессия которого разрушает этот химиопрепарат. Высокая экспрессия топоизомеразы 2а (ТОР2а - мишень для антрациклинов) и внутриядерного фермента топоизомеразы I (ТОР1 - мишень для иринотекана) сопряжена с чувствительностью к данным препаратам [11, 12].

Показано, что совместное обнаружение различных генов монорезистентности может повысить их предсказательную значимость [12, 13, 14].

Наиболее близким к предлагаемому является способ, выбранный в качестве прототипа, включающий в себя неоадьювантную химиотерапию с последующей радикальной операцией. Далее, в послеоперационном периоде дополнительно проводят адъювантную химиотерапию в том же режиме [16]. По предложенному ранее способу неоадъювантная химиотерапия проводилась по схеме винорелбин в дозе 25 мг/м 2 на 1 и 8 дни цикла, на второй день, через 20 часов после введения винорелбина внутривенно капельно вводился карбоплатин в дозе по AUC 6, при этом интервал между курсами химиотерапии составлял 20 дней. После проведения курсов химиотерапии выполнялась радикальная операция.

В известном способе применялся общий подход к проведению химиотерапии, не учитывалась динамика изменения экспрессии генов монорезистентности в процессе лечения, продолжение химиотерапии в послеоперационном периоде осуществляли по прежней схеме без определения маркеров чувствительности к используемым в клинической практике цитостатикам. В результате существенным недостатком способа явилась значительное число осложнений и низкая выживаемость больных.

Новый технический результат - повышение эффективности лечения рака легкого за счет индивидуализации адъювантной химиотерапии и увеличения выживаемости больных.

Для достижения нового технического результата в способе комбинированного лечения немелкоклеточного рака легкого IB-III стадий с персонификацией адъювантной химиотерапии, включающем на первом этапе проведение неоадъювантной химиотерапии с последующим радикальным хирургическим вмешательством и проведением адъювантной химиотерапии в послеоперационном периоде, на первом этапе, до начала неоадъювантной химиотерапии проводят забор биопсийного материала опухоли, из которого выделяют тотальную РНК и определяют уровень экспрессии генов монорезистентности RRM1, TYMS, АВСС5, ERCC1, TOP1, ТОР2а, TUBB3 в ткани опухоли при помощи количественной ПЦР в режиме реального времени, на втором этапе проводят курсы неоадъювантной химиотерапии путем внутривенного введения в течение 2 часов винорельбина в дозе 25 мг/м2 на 1 и 8 дни цикла, во 2 день через 20 часов после введения винорельбина, внутривенно капельно вводят карбоплатин в дозе по AUC 6, причем, интервал между курсами химиотерапии составляет 21 день, оценивают объективный эффект лечения после двух курсов при помощи спиральной компьютерной томографии органов грудной клетки и видеобронхоскопии, далее, на третьем этапе комбинированного лечения выполняют радикальную операцию в объеме пневмонэктомии или лобэктомии, во время которой производят забор образцов опухолевой ткани и визуально неизмененной ткани легкого/бронха, в которых проводят повторное определение уровней экспрессии генов монорезистентности, далее, в послеоперационном периоде на 15 сутки проводят адъювантную химиотерапию карбоплатином в дозе по AUC6 во 2-й день цикла, при уровне экспрессии гена монорезистентности ERCC1 менее 0,5, в комбинации с одним из цитостатиков, выбор которого зависит от уровня экспрессии исследуемых генов монорезитстентности: при уровне экспрессии гена монорезистентности RRM1 или TYMS, менее 1,0, АВСС5 менее 0,5, назначают гемцитабин в дозе 1250 мг/м2 в 1 и 8 дни цикла, при уровне ТОР1 более 2, назначают иринотекан в дозе 100 мг мг/м2 на 1 и 8 дни цикла, при уровне TUBB3 0,6-1,5 назначают винорельбин в дозе 25 мг/м2 на 1 и 8 дни цикла, при уровне ТОР2а более 4 назначают доксорубицин в дозе 50 мг/м2 в 1-й день в количестве 3 курсов.

Изобретение соответствует критерию «новизна», т.к. при лечении рака легкого не использовалась персонифицированная адъювантная химиотерапия дублетами в соответствии с изменением уровней экспрессии генов монорезистентности опухолевой ткани после проведения неоадъювантного лечения в сочетании с радикальной операцией.

Изобретение соответствует критерию «промышленно применимо», т.к. оно использовано в клинической практике для лечения больных немелкоклеточным раком легкого IB-III стадии.

Способ осуществляют следующим образом: на первом этапе проводят забор биопсийного материала опухоли до начала неоадъювантной химиотерапии с помощью видеобронхоскопии при центральном раке легкого и трансторакальной биопсии при периферической локализации опухоли легкого. Биопсийные образцы помещают в консервирующий раствор RNALater (Ambion, USA), выдерживают сутки при температуре 4°С и далее сохраняют при температуре - 80°С. Выделение тотальной РНК из полученных образцов производят с помощью набора Plus RNeasy mini kit (Qiagen, Germany) с определением уровней экспрессии генов монорезистентности RRM1, TYMS, АВСС5, ERCC1, TOP1, ТОР2а, TUBB3 в ткани опухоли при помощи количественной ПЦР в режиме реального времени (qPCR) по технологии TaqMan.

На втором этапе проводят курсы неоадъювантной химиотерапии: внутривенное введение в течение 2 ч винорельбина в дозе 25 мг/м2 на 1 и 8 дни цикла, во 2 день через 20 часов после введения винорельбина внутривенно капельно вводят карбоплатин в дозе по AUC 6, интервал между курсами химиотерапии составляет 21 день, с последующей оценкой объективного эффекта лечения после двух курсов при помощи спиральной компьютерной томографии органов грудной клетки и видеобронхоскопии.

На третьем этапе комбинированного лечения выполняют радикальную операцию в объеме пневмонэктомии или лобэктомии. Далее производится забор образцов опухолевой ткани и визуально неизмененной ткани легкого (бронха) для повторного определения уровней экспрессии генов монорезистентности по вышеописанной методике, согласно которым установлено:

1. RRM1, наиболее важный ген для назначения гемцитабина: уровень экспрессии менее 1 - низкий (показан гемцитабин); 1-2 - средний уровень (назначение гемцитабина не определено); более 2 - высокий уровень (гемцитабин не показан).

2. TYMS, второй по значимости ген для гемцитабина: уровень экспрессии менее 1 - низкий (показан гемцитабин), 1-1,5 - средний уровень (назначение гемцитабина не определено), более 1,5 - высокий уровень (гемцитабин не показан).

3. АВСС5, третий по значимости ген для назначения гемцитабина: уровень экспрессии менее 0,5 - низкий (показан гемцитабин), 0,5-1 - средний уровень (назначение гемцитабина не определено), более 1 - высокий уровень (гемцитабин не показан).

4. ERCC1, маркер для назначения карбоплатина: уровень экспрессии менее 0,5 - низкий (показан карбоплатин), 0,5-1 - средний уровень (назначение карбоплатина не определено), более 1 - высокий уровень (карбоплатин не показан).

5. ТОР1, маркер для назначения иринотекана: уровень экспрессии менее 1 - низкий, (иринотекан не показан), 1-2 - средний уровень (назначение иринотекана не определено), более 2 - высокий уровень (иринотекан показан).

6. TUBB3, маркер для назначения винорельбина: уровень экспрессии ниже 0,6 - низкий (винорельбин не показан), уровень 0,6-1,5 - средний (показано назначение винорельбина), уровень более 1,5 - высокий (винорельбин не показан).

7. ТОР2а, маркер для назначения доксорубицина: уровень экспрессии менее 2 - низкий (не показан доксорубицин), 2-4 - средний уровень (назначение доксорубицина не определено), более 4 - высокий уровень (доксорубицин показан).

Четвертым этапом в послеоперационном периоде на 15 сутки проводят адъювантную химиотерапию карбоплатином в дозе по AUC6 во 2-й день цикла, при уровне экспрессии гена монорезистентности ERCC1 менее 0,5, в комбинации с одним из цитостатиков, выбор которого зависит от уровня экспрессии исследуемых генов монорезитстентности: при уровне экспрессии гена монорезистентности RRM1 или TYMS, менее 1,0, АВСС5 менее 0,5, назначают гемцитабин в дозе 1250 мг/м2 в 1 и 8 дни цикла, при уровне ТОР1 более 2, назначают иринотекан в дозе 100 мг мг/м2 на 1 и 8 дни цикла, при уровне TUBB3 0,6-1,5 назначают винорельбин в дозе 25 мг/м2 на 1 и 8 дни цикла, при уровне ТОР2а более 4 назначают доксорубицин в дозе 50 мг/м2 в 1-й день в количестве 3 курсов.

Обоснование способа: на протяжении последних десятилетий рак легкого остается лидером онкологической заболеваемости и смертности. Результаты хирургического лечения при II и III стадии остаются неудовлетворительными, а используемая химиотерапия применяется «в слепую», что не дает существенного прироста общей и безрецидивной выживаемости больных [17, 18].

Винорельбин (навельбин - регистрационный номер - Р №003822/01 - 27.12.2004) обладает противоопухолевым действием, нарушая полимеризацию тубулина в процессе клеточного митоза, блокирует митоз в фазе G2 и вызывает разрушение клеток в интерфазе или при последующем митозе, что позволяет использовать его в качестве цитостатика [4].

Гемцитабин (Гемзар - регистрационный номер Π N013405/01 от 19.01.12) - представляет собой 2,2-дифтордезоксицитидин. В процессе метаболизма он подвергается трехэтапному фосфорилированию. Основной метаболит, трифосфат, включается в концевые участки ДНК, нарушая репликацию и восстановление, подавляя активность ДНК-полимераз. Другие метаболиты гемцитабина на разных этапах также вызывают цитотоксический эффект (феномен самопотенцирования) [4].

Иринотекан (ирнокам - регистрационный номер - ЛС №00869) является специфическим ингибитором клеточного фермента топоизомеразы I. В тканях препарат метаболизируется с образованием активного метаболита SN-38. Иринотекан и данный метаболит стабилизируют комплекс топоизомеразы I с ДНК, что препятствует ее репликации. Все это позволяет использовать его в качестве цитостатика [4].

Доксорубицин (доксорубицин-Тева - регистрационный номер - ЛС № Π N015001/01-2003 от 20.05.2009) - противоопухолевый антибиотик антрациклинового ряда. Подавляет синтез ДНК и РНК: интеркалирует в двойную спираль ДНК между парами азотистых оснований (нарушается матрица и изменяется пространственная структура) и вызывает расщепление ДНК вследствие образования свободных радикалов. Помимо этого противоопухолевое действие возможно обусловлено изменением клеточных функций в результате связывания с липидами клеточных мембран и взаимодействием с топоизомеразой II [4].

Карбоплатин (Карбоплатин-ТЕВА - регистрационный номер Π N012288/02 от 25.09.08) - неорганическое комплексное соединение, содержащее платину. Основной механизм действия препарата обусловлен нарушением синтеза ДНК путем внутри- и межнитевых сшивок ДНК, а также связывания с клеточными мембранами [4].

Необходимо отметить, что существует много потенциальных генов-мишеней для фармакогеномной химиотерапии рака легкого [19]. Нами была изучена экспрессия генов монорезистентности RRM1, TYMS, АВСС5, ERCC1, ТОР1, ТОР2а и TUBB3 в нормальной ткани бронхов и опухолевой ткани немелкоклеточного рака легкого (НМРЛ) после неоадъювантной химиотерапии (НАХТ) по схеме винорельбин/карбоплатин. Показан различный уровень экспрессии некоторых генов монорезистентности в бронхах по сравнению с опухолевой тканью, у больных, имеющих различный гистотип и размер (символ Т) опухоли. Установлена тенденция к снижению уровня экспрессии генов монорезистентности в опухоли больных с частичной регрессией, по сравнению с опухолью больных со стабилизацией процесса [15]. Полученные результаты свидетельствуют о целесообразности оценки экспрессии генов монорезистентности до и после проведения НАХТ и имеют важное значение с точки зрения формирования подхода к персонифицированному назначению схемы адъювантной химиотерапии, так как позволяют преодолеть один из механизмов резистентности рака легкого к проводимому системному лечению, в отличие от предлагаемого в прототипе способа комбинированного лечения НМРЛ с продолжением курсов ПХТ по схеме винорельбин/карбоплатин и в адъювантном режиме.

Взаимодействие вышеперечисленных противоопухолевых препаратов и карбоплатина в персонифицированном адъювантном режиме оказывает противоопухолевую активность, не увеличивая при этом побочные эффекты препаратов, Предлагаемые способы введения химиопрепаратов в адъювантном режиме не увеличивает побочные эффекты и не ухудшает эффективность противоопухолевого лечения. Все это делает возможным использование данного способа лечения у больных немелкоклеточным раком легкого IB - III стадии, с применением в послеоперационном периоде 3 курсов индивидуализированной схемы полихимиотерапии, не снижая эффективность лечения и не увеличивая послеоперационные осложнения. В большинстве предложенных схем химиотерапии немелкоклеточного рака легкого IB - III стадии используется цисплатин, который оказывает выраженное нефротоксическое действие. Этот факт ставит под вопрос проведение курсов химиотерапии в пред- и послеоперационном периодах, а также и увеличения количества курсов до достижения достаточного противоопухолевого эффекта. Поэтому в способе предложена замена цисплатина на карбоплатина, так как нефротоксичность карбоплатина минимальна, что позволяет использовать его в периоперационном режиме с хорошей непосредственной эффективностью и переносимостью.

Применение данной схемы лечения пациентов с IB - III стадией НМРЛ позволяет провести полноценное лечение и увеличить общую и безрецидивную выживаемость.

Пример 1

Больной С, 55 лет, поступил в отделение 21.01.2014 г. с диагнозом: Центральный рак верхнедолевого бронха слева с прорастанием перикарда и метастатическим поражением лимфоузлов средостения Ст. IIIA, Т3 N2 М0 (Гистология №1363-70/14 + ИГХ от 20.01.14: плоскоклеточный с-r низкой степени дифференцировки без ороговения). По результатам обследования: видеобронхоскопия (13.01.2014) - межсегментарная шпора S1-3 и нижняя стенка в/долевого бронха представлена бугристой опухолевой тканью, S3-4 визуализируется до субсегментов, S1-2 сужены до ½. По данным компьютерной томографии (14.01.2014) - объем легких слева уменьшен за счет ателектаза язычковых сегментов; структура ателектаза неравномерная с расширением просвета бронхов и вероятно распадом легочной ткани; опухоль расположена в развилке верхне- и нижнедолевого бронхов, опухолевая инфильтрация распространяется на нижнедолевой бронх, вероятно на главный, обтурирует язычковые бронхи, инфильтрирует нижнюю легочную вену, вероятно перикард, правую ветвь легочной артерии и все долевые.

Проведено лечение согласно предлагаемому способу.

Первым этапом взята биопсия опухоли и определены уровни экспрессии генов монорезистентности (до лечения): RRM1=1,039, TYMS=0,762, АВСС5=0,57, ERCC1=0,000, ТОР1=0,714, TUBB3=2,012, ТОР2а=0,502. Далее пациенту проведен 1 курс неоадъювантной химиотерапии путем внутривенного введения винорельбина в дозе 50 мг на 1 и 8 дни цикла (27.01.14 и 03.02.14) в 13.00, во 2 день, через 20 часов после введения винорельбина внутривенно капельно в 09.00 вводили карбоплатин в дозе 650 мг (28.01.2014). Интервал между курсами химиотерапии составил 20 дней. Второй курс химиотерапии проведен в прежних дозах в аналогичном временном периоде (с 25.02.2014 по 04.03.2014). При комплексном исследовании по данным видеобронхоскопии и спиральной компьютерной томографии - эффект химиотерапии расценен как стабилизация процесса. Осложнений при проведении химиотерапии не наблюдалось, что позволило вторым этапом после 2-х курсов химиотерапии выполнить 01.04.2014 радикальную операцию в объеме пневмонэктомии слева с резекцией перикарда и медиастинальной лимфодиссекцией. Ближайший послеоперационный период протекал без особенностей, швы сняты на 12 сутки после операции. Осложнений не наблюдалось. По результатам гистологического исследования после проведения 2-х курсов неоадъювантной химиотерапии по гистологическому исследованию - установлена II степень лекарственного патоморфоза.

По данным молекулярно-генетического анализа операционного материала зафиксирована высокая экспрессия уровня генов TUBB3 (1,875), а также низкий уровень экспрессии ТОР2а (0,673), что говорило о химиорезистентности к винорельбину и доксорубицину соответственно. Уровень генов RRM1 составил 0,758 (низкий), TYMS -1,400 (средний), АВСС5 - 1,065 (высокий), что свидетельствовало об отсутствии чувствительности к гемцитабину. При этом обращало внимание полное отсутствие экспрессии гена ERCC1 (0,000) и средний уровень экспрессии гена ТОР1 (0,916), что определяло чувствительность к препаратам платины и иринотекану соответственно. После проведения НАХТ отмечена тенденция к увеличению уровней экспрессии генов TYMS и АВСС1, что определяло усиление химиорезистентности к гемцитабину, несмотря на снижение уровня RRM1. Однако выявлена тенденция к повышению уровня экспрессии гена ТОР1 и, следовательно, преодоление химиорезистентности к иринотекану. По результатам полученного анализа изменения экспрессии генов монорезистентности согласно предлагаемому способу в процессе лечения третьим этапом (23.04.2014) проведен 1 курс адъювантной химиотерапии путем внутривенного капельного введения иринотекана в дозе 180 мг на 1 и 8 дни цикла (23.04.2014, 30.04.2014) в 13.00. Во 2 день, через 20 часов после введения иринотекана в 09.00 часов, внутривенно капельно вводили карбоплатин в дозе 700 мг (24.04.2014). Интервал между курсами химиотерапии составил 21 день. С 21.05.2014 по 28.05.2014 проведен 2 курс адъювантной химиотерапии по схеме иринотекан/карбоплатин в прежних дозах и временных интервалах. С 19.06.2014 по 26.06.2014 проведен 3 курс адъювантной химиотерапии по схеме иринотекан/карбоплатин в прежнем режиме и дозах. Таким образом, комбинированное лечение с включением неоадъювантной химиотерапии, радикальной операции и персонифицированной адъювантной химиотерапии было закончено 26.06.2014 г. Курсы неоадъювантной и адъювантной химиотерапии пациент перенес удовлетворительно, осложнений не наблюдалось, что позволило провести полный комплекс лечебных мероприятий в запланированные сроки. Хирургический этап комбинированного лечения проведен также в запланированные сроки.

Больной выписан из клиник в удовлетворительном состоянии. В последующем больной наблюдался в контрольные сроки через 1 месяц, 3 месяца, 6 и 9 месяцев. Данные за прогрессирование заболевания, рецидив опухоли, отдаленное метастазирование не получены.

Пример 2

Больной Б., 56 лет, поступил в отделение 23.01.14 г. с диагнозом: Центральный рак верхнедолевого бронха справа ст. ИВ T3N0M0 (Гистология №1567 - 71/14: плоскоклеточный умереннодифференцированный рак). По результатам обследования: видеобронхоскопия (03.02.2014) - в третьем сегментарном бронхе справа определяется бугристая опухоль, полностью обтурирующая просвет бронха. По данным компьютерной томографии (30.01.2014) - ателектаз верхней доли, опухолевый конгломерат расположен в корне, размеры 36×35×50 мм, перекрывает верхнедолевой бронх, инфильтрирует главный до уровня бифуркации, сдавливает верхнюю полую вену.

Проведено лечение согласно предлагаемому способу.

Первым этапом взята биопсия опухоли и определены уровни экспрессии генов монорезистентности (до лечения): RRM1=0,578, TYMS=1,264, АВСС5=4,765, ERCC1=0,778, ТОР1=1,442, TUBB3=3,952, ТОР2а=0,484. Далее больному проведен один курс неоадъювантной химиотерапии путем внутривенного введения винорельбина в дозе 50 мг на 1 и 8 дни цикла (11.02.2014 и 18.02.2014), в 14.00 часов. Во 2 день, через 20 часов, после введения винорельбина в 10.00 утра внутривенно капельно вводили карбоплатин в дозе 650 мг (12.02.2014). Интервал между курсами химиотерапии составил 21 день. Второй курс неоадъювантной химиотерапии проведен в прежних дозах (с 12.03.14 по 19.03.14). При комплексном исследовании по данным бронхоскопии и спиральной компьютерной томографии - эффект после 2-х курсов химиотерапии расценен как частичная регрессия процесса - 40%. Осложнений при проведении химиотерапии не наблюдалось, что позволило вторым этапом после 2 курсов химиотерапии выполнить 21.04.14 радикальную операцию в объеме верхней лобэктомии справа. Ближайший послеоперационный период протекал без особенностей, швы сняты на 11 сутки после операции. Осложнений не наблюдалось. По результатам гистологического исследования после проведения 2-х курсов предоперационной химиотерапии - установлена II степень лекарственного патоморфоза.

По данным молекулярно-генетического анализа экспрессии генов монорезистентности зафиксирован высокий уровень экспрессии гена АВСС5 (2,407), средний уровень экспрессии генов RRM1 (1,131) и TYMS (1,105), что говорит о химиорезистентности к гемцитабину; низкий уровень ТОР1 (0,366) - химиорезистентность к иринотекану; чувствительность к доксорубицину не определена (средний уровень экспрессии ТОР2а (3,848)). Отмечен низкий уровень экспрессии генов ERCC1 (0,451) и TUBB3 (0,709), что определяло чувствительность опухоли к препаратам платины и винорельбину соответственно. При анализе изменения уровней экспрессии генов монорезистентности в динамике выявлено снижение уровней экспрессии генов ТиВВЗи ERCC1, что говорило о повышении чувствительности опухоли после проведения НАПХТ к винорельбину и карбоплатину соответственно.

После операции на 14 сутки третьим этапом (05.05.2014) проведен один курс персонифицированной адъювантной химиотерапии путем внутривенного капельного введения винорельбина в дозе 50 мг на 1 и 8 дни цикла (05.05.2014, 12.05.2014) в 14.00. Во 2 день, через 20 часов после введения винорельбина внутривенно капельно в 10.00 вводили карбоплатин в дозе 670 мг (06.05.2014). Интервал между курсами химиотерапии составил 20 дней. С 02.06.2014 по 09.06.2014 проведен второй курс адъювантной химиотерапии по схеме винорельбин/карбоплатин в прежних дозах и временных интервалах. С 30.06.2009 по 07.07.2014 проведен третий курс адъювантной химиотерапии по схеме винорельбин/карбоплатин в прежнем режиме и дозах. Таким образом, комбинированное лечение с включением неоадъювантной химиотерапии, радикальной операции и адъювантной химиотерапией было закончено 07.07.2014 г. Курсы неоадъювантной и адъювантной химиотерапии пациент перенес удовлетворительно, осложнений не наблюдалось, что позволило провести полный комплекс лечения в запланированные сроки.

Больной выписан из клиник в удовлетворительном состоянии. В последующем больной наблюдался в контрольные сроки через 1 месяц, 3 месяца, 6 и 9 месяцев. Данные за прогрессирование заболевания, рецидив не получены.

Пример 3

Больной Ж., 48 лет, поступил в отделение 21.11.13 г. с диагнозом: Центральный рак верхнедолевого бронха слева ст. IIB T3N0M0 (Гистология №1567 - 71/14: плоскоклеточный умеренно дифференцированный рак). По результатам обследования: видеобронхоскопия (13.11.13) - в верхнедолевом бронхе слева определяется бугристая опухоль, полностью обтурирующая просвет бронха. По данным компьютерной томографии (26.11.13) - ателектаз верхней доли, опухолевый конгломерат расположен в корне левого легкого, до 40 мм, проксимально инфильтрация распространяется на ½ главного бронха, стенку нижнедолевого бронха; основание левой легочной артерии и стенка на протяжении инфильтрированы, равно как и перикард, верхняя легочная вена.

Проведено лечение согласно предлагаемому способу.

Первым этапом взята биопсия опухоли и определены уровни экспрессии генов монорезистентности (до лечения): RRM1=0,363, TYMS=0,794, АВСС5=0,107, ERCC1=0,257, ТОР1=0,000, TUBB3=1,201, ТОР2а=0,000. Далее больному проведен один курс неоадъювантной химиотерапии путем внутривенного введения винорельбина в дозе 50 мг на 1 и 8 дни цикла (05.12.13 и 12.12.2013), в 14.00 часов. Во 2 день, через 20 часов, после введения винорельбина в 10.00 утра внутривенно капельно вводили карбоплатин в дозе 670 мг (06.12.2013). Интервал между курсами химиотерапии составил 28 дней. Второй курс неоадъювантной химиотерапии проведен в прежних дозах (с 09.01.14 по 16.01.14). При комплексном исследовании по данным бронхоскопии и спиральной компьютерной томографии эффект после 2-х курсов химиотерапии расценен как стабилизация процесса. Осложнений при проведении химиотерапии не наблюдалось, что позволило вторым этапом после 2 курсов химиотерапии выполнить 05.02.14 радикальную операцию в объеме пневмонэктомии слева. Ближайший послеоперационный период протекал без особенностей, швы сняты на 11 сутки после операции. Осложнений не наблюдалось. По результатам гистологического исследования после проведения 2-х курсов предоперационной химиотерапии - установлена II степень лекарственного патоморфоза.

По данным молекулярно-генетического анализа экспрессии генов монорезистентности зафиксирован низкий уровень экспрессии генов RRM1 (0,463), TYMS (0,080) и АВСС5 (0,107), а в динамике после проведения НАХТ отмечена незначительная тенденция к снижению экспрессии уровней этих генов, что свидетельствовало о чувствительности опухоли к гемцитабину. Уровень ERCC1 остался по-прежнему на низком уровне (0,351) с незначительной тенденцией к повышению. Также определены низкие уровни экспрессии генов ТОР1 (0,119) и ТОР2а (0,513) без значительных изменений в процессе лечения, что определяло химиорезистентность к иринотекану и доксорубицину соответственно. Отмечен низкий уровень экспрессии генов ERCC1 (0,451) и TUBB3 (0,709), что определяло чувствительность опухоли к препаратам платины и винорельбину, соответственно. Особый интерес представляло изменение уровня экспрессии гена TUBB3 после проведения предоперационной НАХТ с 1,201 (показан винорельбин) до 2,108 (винорельбин не показан). Данное наблюдение говорит о развитии химиорезистентности к винорельбину в процессе лечения у данного пациента.

Третьим этапом, по результатам полученного анализа экспрессии генов, после операции на 15 сутки (20.02.2014) проведен один курс персонифицированной адъювантной химиотерапии путем внутривенного капельного введения гемцитабина в дозе 2000 мг на 1 и 8 дни цикла (20.02.2014, 27.02.2014) в 14.00. Во 2 день, через 20 часов после введения гемцитабина внутривенно капельно в 10.00 вводили карбоплатин в дозе 670 мг (21.02.2014). Интервал между курсами химиотерапии составил 23 дня. С 17.03.2014 по 24.03.2014 проведен второй курс адъювантной химиотерапии по схеме гемцитабин/карбоплатин в прежних дозах и временных интервалах. С 15.04.2014 по 22.04.2014 проведен третий курс адъювантной химиотерапии по схеме гемцитабин/карбоплатин в прежнем режиме и дозах. Комбинированное лечение с включением неоадъювантной химиотерапии, радикальной операции и персонифицированной адъювантной химиотерапией было закончено 24.04.2014 г. Курсы неоадъювантной и адъювантной химиотерапии пациент перенес удовлетворительно, осложнений не наблюдалось, что позволило провести полный комплекс лечения в запланированные сроки.

Пример 4

Больной Ш., 58 лет, поступил в отделение 09.04.14 г. с диагнозом: Периферический рак верхней доли правого легкого с метастатическим поражением лимфоузлов средостения ст. IIIΑ T1bN2M0 (гистология №14082-93U4: низкодифференцированная аденокарцинома). По данным компьютерной томографии (15.04.14) справа в аксиллярном субсегменте имеется участок уплотнения неправильной формы до 22 мм в диаметр с инфильтрацией мягких тканей; в средостении парааортально, паратрахеально в области бифуркации и в правом корне имеются лимфатические узлы до 30-35 мм в диаметре с выраженной перинодулярной инфильтрацией.

Проведено лечение согласно предлагаемому способу.

На первом этапе взята биопсия опухоли (при трансторакальной пункции) и определены уровни экспрессии генов монорезистентности (до лечения): RRM1=1,577, TYMS=3,980, АВСС5=1,000, ERCC1=0,502, ТОР1=0,000, TUBB3=2,304, ТОР2а=4,670. Далее больному проведен один курс неоадъювантной химиотерапии путем внутривенного введения винорельбина в дозе 50 мг на 1 и 8 дни цикла (23.04.14 и 30.04.2013), в 14.00 часов. Во 2 день, через 20 часов, после введения винорельбина в 10.00 утра внутривенно капельно вводился карбоплатин в дозе 700 мг (24.04.2014). Интервал между курсами химиотерапии составил 21 день. Второй курс неоадъювантной химиотерапии проведен в прежних дозах (с 21.05.2014 по 28.05.2014). При комплексном исследовании по спиральной компьютерной томографии эффект после 2-х курсов химиотерапии расценен как стабилизация процесса. Осложнений при проведении химиотерапии не наблюдалось, что позволило вторым этапом после 2 курсов химиотерапии выполнить 18.06.14 радикальную операцию в объеме верхней лобэктомии справа. По результатам гистологического исследования после проведения 2-х курсов предоперационной химиотерапии - установлена II степень лекарственного патоморфоза.

По данным молекулярно-генетического анализа экспрессии генов монорезистентности зафиксирован средний уровень экспрессии гена RRM1 (1,694) и высокие уровни TYMS (4,138) и АВСС5 (1,040), а в динамике после проведения НАХТ отмечена незначительная тенденция к повышению экспрессии уровней этих генов, что свидетельствует о химиорезистентности опухоли к гемцитабину. Уровень ERCC1 после НАХТ снизился до 0,339, в результате чего повысилась чувствительность опухоли к карбоплатину. Уровень ТОР1 остался по-прежнему на низком уровне (0,300) с незначительной тенденцией к повышению (химиорезистентность к иринотекану). Изменение уровня экспрессии гена TUBB3 после проведения предоперационной НАХТ с 2,304 до 5,041 свидетельствует об усилении химиорезистентности к винорельбину в процессе лечения и бесперспективность его дальнейшего применения у данного пациента. Особое внимание привлек очень высокий уровень экспрессии ТОР2а (24,241), который свидетельствует об амплификации гена и высокой чувствительности к доксорубицину.

Послеоперационный период осложнился паренхиматозной недостаточностью шва легкого, на фоне консервативной терапии данное осложнение купировано. В связи с этим адъювантная химиотерапия начата на 25 сутки после операции. По результатам полученного анализа экспрессии генов монорезистентности, 15.07.2014 проведен первый курс персонифицированной послеоперационной химиотерапии путем внутривенного капельного введения доксорубицина в дозе 100 мг и карбоплатина в дозе 750 мг внутривенно капельно в 1 день. Интервал между курсами химиотерапии составил 21 день. 05.08.14 проведен второй курс адъювантной химиотерапии по схеме доксорубицин/карбоплатин в прежних дозах. 27.08.15 проведен третий курс адъювантной химиотерапии по прежней схеме. Таким образом, комбинированное лечение с включением неоадъювантной химиотерапии, радикальной операции и персонифицированной адъювантной химиотерапией было закончено 27.08.14 г. Курсы неоадъювантной и адъювантной химиотерапии пациент перенес удовлетворительно, осложнений во время проведения курсов химиотерапии не наблюдалось, что позволило провести полный комплекс лечения в запланированные сроки.

Больной выписан из клиник в удовлетворительном состоянии. В последующем больной наблюдался в контрольные сроки через 1 месяц, 3 и 6 месяцев. Данные за прогрессирование заболевания, рецидив не получены.

Предлагаемым способом пролечено 11 больных раком легкого IB - III стадии, из которых все пациенты - мужчины. На первом этапе проведено 2 курса неоадъювантной химиотерапии. Объективный эффект от предоперационной химиотерапии составил: полная регрессия - 0 больных, частичная регрессия - 5 больных, стабилизация процесса - 6, прогрессирование выявлено не было. Из осложнений отмечена лишь лейкопения I степени у 1 пациента, которая не потребовала медикаментозной коррекции и увеличения интервала перед операцией.

На втором этапе была выполнена радикальная операция (3 больным пульмонэктомии и 8 больным лобэктомии). Существенных послеоперационных осложнений выявлено не было. На третьем этапе всем пациентам проведено 3 курса адъювантной химиотерапии в соответствии с уровнями экспрессии генов монорезистентности: по схеме винорельбин/карбоплатин - 4 пациента, гемцитабин / карбоплатин - 4 пациента, иринотекан / карбоплатин - 1 пациент, доксорубицин / карбоплатин - 2 пациента.

На Фиг. 1 приведены расчетные показатели годичной безрецидивной выживаемости больных, пролеченных по предлагаемому способу, которые по сравнению с контрольной группой возросли приблизительно на 18%, что говорит об эффективности предложенного метода комбинированного лечения.

Предлагаемый способ лечения основан на анализе результатов экспериментальных и клинических результатов. Как показали клинические исследования, использование предлагаемого способа лечения позволяет достичь нового технического результата, а именно повысить эффективность лечения немелкоклеточного рака легкого - IB - III стадии без существенных осложнений проводимого лечения, а также увеличить выживаемость больных за счет использования персонифицированного подхода к назначению адъювантной химиотерапии.

Источники информации

1. GLOBOCAN 2012 (IARC). http://elobocan.iarc.fr/Pages/fact_sheets_cancer.aspx. Last accessed 22/12/2014.

2. Трахтенберг А.Х., Колбанов К.И. Рак легкого / Под ред. акад. РАМН, проф. В.И. Чиссова. - М.: ГЭОТАР-Медиа, 2012. - 160 с.

3. Scagliotti, GV, Pastorino, U, Vansteenkiste, JF et al. Randomized phase III study of surgery alone or surgery plus preoperative cisplatin and gemcitabine in stages IB to IIIA non-small-cell lung cancer. J Clin Oncol. 2012; 30: 172-178.

4. Переводчикова Н.И. Руководство по химиотерапии опухолевых заболеваний. - 3-е изд., доп. и пер. - М.: Практическая медицина, 2011. - 512 с.

5. NSCLC Meta-analysis Collaborative Group.Preoperative chemotherapy for non-small-cell lung cancer: a systematic review and meta-analysis of individual participant data. Lancet 2014; 383: 1561-71.

6. Vansteenkiste J., De Ruysscher D., Eberhardt W.E.E., Lim E., Senan S., Felip E., Peters S. Early-Stage and Locally Advanced (non-metastatic) Non-Small-Cell Lung Cancer: ESMO Clinical Practice Guidelines. - Ann. Oncol. 2013; 24 (Suppl. 6): vi89-vi98.

7. Bartolucci R, Wei J, Sanchez JJ, et al (2009). XPG mRNA expression levels modulate prognosis in resected non-small-cell lung cancer in conjunction with BRCA1 and ERCC1 expression. Clin Lung Cancer, 10, 47-52.

8. Santos ES, Blaya M, Raez LE (2009). Gene expression profiling and non-small-cell lung cancer: where are we now? Clin Lung Cancer, 10, 168-73.

9. Vilmar A, S0rensen JB (2009). Excision repair cross-complementation group 1 (ERCC1) in platinum-based treatment of non-small cell lung cancer with special emphasis on carboplatin: a review of current literature. Lung Cancer, 64,131-9.

10. Soria J. et al. Immunohistochemical staining of the Excision Repair Cross-Complementing 1 (ERCC1) protein as predictor for benefit of adjuvant chemotherapy (CT) in the International Lung Cancer Trial (IALT) // ASCO. - 2006. - Abstr. 7010.

11. Chang A. Chemotherapy, chemoresistance and the changing treatment landscape for NSCLC. Lung Cancer 71 (2011). p. 3-10.

12. Yi Han et al. mRNA Expression and Clinical Significance of ERCC1, BRCA1, RRM1, TYMS and TUBB3 in NSCLCs. Asian Pacific J Cancer Prev, 14 (5), 2987-2990.

13. Leng XF, Chen MW, ssXian L, et al (2012). Combined analysis of mRNA expression of ERCC1, BAG-1, BRCA1, RRM1 and TUBB3 to predict prognosis in patients with non-small cell lung cancer who received adjuvant chemotherapy. J Exp Clin Cancer Res, 31, 25.

14. Pesta M, Kulda V, Fiala O, et al (2012). Prognostic significance of ERCC1, RRM1 and BRCA1 in surgically-treated patients with non-small cell lung cancer. Anticancer Res, 32, 5003-10.

15. Юмов Е.Л., Цыганов M.M., Литвяков H.B. и др. Экспрессия генов множественной лекарственной устойчивости и монорезистентности при немелкоклеточном раке легкого. // Сибирский онкологический журнал. - 2014. - №1 (61). - С. 16-22.

16. Полищук Т.В., Миллер C.B., Тузиков С.А, Гольдберг В.Е., Юмов Е.Л. «Способ комбинированного лечения немелкоклеточного рака легкого II и III стадии», патент на изобретение №2455986, зарегистрирован 16.02.2011.

17. Давыдов М.И., Полоцкий Б.Е. «Современные принципы выбора лечебной тактики и возможности хирургического лечения немелкоклеточного рака легкого» сборник - Новое в терапии рака легкого, Москва, 2003 г.

18. Горбунова В.Α., Маренич А.Ф., Михина З.П., Извекова О.В. Консервативное лечение рака легкого // Издательство «Литтерра», Москва 2005, с. 127.

19. Р. Россел, А. О′Брэйт, М. Монзо, X.М. Санчес, М. Гийо, Χ.X. Санчес, К. Арасил. Фармакогеномика и современные тенденции в лечении немелкоклеточного рака легкого. http://medi.ru/doc/0446312.htm

Способ комбинированного лечения немелкоклеточного рака легкого IB-III стадий с персонификацией адъювантной химиотерапии, включающий на первом этапе проведение неоадъювантной химиотерапии с последующим радикальным хирургическим вмешательством и проведением адъювантной химиотерапии в послеоперационном периоде, отличающийся тем, что на первом этапе, до начала неоадъювантной химиотерапии проводят забор биопсийного материала опухоли, из которого выделяют тотальную РНК и определяют уровень экспрессии генов монорезистентности RRM1, TYMS, АВСС5, ERCC1, TOP1, ТОР2а, TUBB3 в ткани опухоли при помощи количественной ПЦР в режиме реального времени, на втором этапе проводят курсы неоадъювантной химиотерапии путем внутривенного введения в течение 2 часов винорельбина в дозе 25 мг/м2 на 1 и 8 дни цикла, во 2 день через 20 часов после введения винорельбина, внутривенно капельно вводят карбоплатин в дозе по AUC 6, причем, интервал между курсами химиотерапии составляет 21 день, оценивают объективный эффект лечения после двух курсов при помощи спиральной компьютерной томографии органов грудной клетки и видеобронхоскопии, далее, на третьем этапе комбинированного лечения выполняют радикальную операцию в объеме пневмонэктомии или лобэктомии, во время которой производят забор образцов опухолевой ткани и визуально неизмененной ткани легкого/бронха, в которых проводят повторное определение уровней экспрессии генов монорезистентности, далее, в послеоперационном периоде на 15 сутки проводят адъювантную химиотерапию карбоплатином в дозе по AUC6 во 2-й день цикла, при уровне экспрессии гена монорезистентности ERCC1 менее 0,5, в комбинации с одним из цитостатиков, выбор которого зависит от уровня экспрессии исследуемых генов монорезистентности: при уровне экспрессии гена монорезистентности RRM1 или TYMS менее 1,0, АВСС5 менее 0,5 назначают гемцитабин в дозе 1250 мг/м2 в 1 и 8 дни цикла, при уровне ТОР1 более 2 назначают иринотекан в дозе 100 мг мг/м2 на 1 и 8 дни цикла, при уровне TUBB3 0,6-1,5 назначают винорельбин в дозе 25 мг/м2 на 1 и 8 дни цикла, при уровне ТОР2а более 4 назначают доксорубицин в дозе 50 мг/м2 в 1-й день в количестве 3 курсов.



 

Похожие патенты:

Изобретение относится к медицине и представляет собой способ оценки литогенности желчи, включающий определение в желчи у обследуемого (i) показателей холестерина (ХС, ммоль/л) в сравнении со средними значениями, принятыми за норму (k), отличающийся тем, что в желчи определяют комплекс общих липидов (ОЛ, г/л), суммарную антиокислительную активность (АОА) электрохимическим методом (в нА·с), максимум вспышки хемилюминесценции (МВХЛ, в усл.
Изобретение относится к области судебной и криминалистической медицины и может быть использовано для выявления следов, имеющих органическое происхождение, а именно следов пальцев и ладоней.

Изобретение относится к области медицины, а именно к способу дифференциальной диагностики заболеваний онкологического и не онкологического генеза. Сущность способа состоит в том, что исследуют электрофоретическую подвижность эритроцитов и при снижении электрофоретической подвижности эритроцитов менее чем на 49% от физиологической нормы диагностируют заболевание не онкологического генеза.

Изобретение относится к медицине, а именно к лабораторной диагностике, и может быть использовано для оценки индуцирующего действия цитомегаловирусной инфекции на активность липоевой кислоты в синцитиотрофобласте плаценты на третьем триместре гестации.

Изобретение относится к медицине, а именно к лабораторной диагностике, и может быть использовано для оценки содержания андростендиона в синцитиотрофобласте плаценты беременных при обострении цитомегаловирусной инфекции на третьем триместре гестации.

Изобретение относится к области медицины, а именно лабораторной диагностике, и может быть использовано для оценки развития угрозы гемической анемии беременных. Для этого определяют количество ненасыщенных жирных кислот в эритроцитах периферической крови с последующей оценкой их функционального состояния.
Изобретение относится к медицине, а именно гинекологии и эндокринологии, и может быть использовано для дифференциальной диагностики овариальной и адреналовой гиперандрогении у девочек пубертатного возраста.

Изобретение относится к областям ветеринарии и может быть использовано для оценки степени аккумуляции кадмия в печени крупного рогатого скота. Для этого определяют концентрацию Μn в биосубстрате методом атомно-эмиссионной спектрометрии с индуктивно связанной плазмой.

Изобретение относится к медицине и может быть использовано для оценки эффективности и безопасности терапии при проведении клинических исследований. Проводят анализ клинических или клинико-лабораторных показателей для каждого пациента из исследуемой группы.
Изобретение относится к области экологической аналитической химии. Способ включает отбор проб массой 2-4 г, их сушку, измельчение и двухкратную экстракцию целевых компонентов дихлорметаном при воздействии на пробу ультразвуковых колебаний, фильтрование объединенного экстракта и упаривание досуха при давлении не выше 0,1 мм рт.ст.

Изобретение относится к фармацевтической промышленности, а именно к применению цепочек бактериальных магнитосом для лечения опухоли. Применение цепочек бактериальных магнитосом для лечения опухоли при помощи термотерапии, где указанные цепочки бактериальных магнитосом имеют следующие свойства: содержат по меньшей мере 2 магнитосомы с размерами, лежащими в диапазоне от 10 до 120 нм; кристаллографические направления большей части магнитосом, принадлежащих указанным цепочкам, ориентированы в направлении удлинения цепочки, изолированы из магнетотактических бактерий, которые культивировались в питательной среде, содержащей железо и/или другой переходный металл, такой как кобальт, никель, медь, цинк, марганец, хром, или содержащей хелатирующий агент.

Изобретение относится к соединению формулы I или его таутомеру, энантиомеру или фармацевтически приемлемой соли, где в указанной формуле Y представляет собой -(О)х(СН2)yR11; х выбирают из 0 и 1; у выбирают из 0, 1, 2 и 3; R11 выбирают из фенила, пиридила, морфолинила, 1-оксо-1,3-дигидроизобензофуранила и 2-оксо-тетрагидрофуранила, при этом когда х равен 0, указанный фенил или пиридинил замещен -C(O)NR1R2 или Т; R1 и R2 выбирают независимо из водорода и С1-6алкила, при этом указанный алкил необязательно замещен -С(О)О(СН2)tR12, или R1 и R2 вместе с атомом азота, к которому они присоединены, образуют насыщенный 5-членный гетероцикл, содержащий 1-4 гетероатомов, выбранных из азота, кислорода и серы; t выбирают из 0, 1, 2 и 3; R12 выбирают из С3-6циклоалкила и фенила; Т выбирают из 2-оксо-1,3-диоксолана, 2-оксотетрагидрофурана, -(CHR7)zOR9, -(О)u(СН2)sC(О)R8, -OSO2R13 и -СН(ОН)СН2ОН; R7 представляет собой Н; R8 представляет собой -OR10; R9 представляет собой Н; R10 выбирают из С1-6алкила, -(CH2)R12 и водорода, при этом указанный алкил необязательно замещен галогеном или диС1-6алкиламином; R13 представляет собой CF3; u выбирают из 0 и 1; z выбирают из 1, 2 и 3; s выбирают из 1 и 2; R5 выбирают из -NR3R4 и -OR10; R3 и R4 выбирают независимо из Н, С1-12алкила, -(О)q(СН2)rP; при этом указанный алкил необязательно замещен -ОН; q выбирают из 0 и 1; r выбирают из 0, 1, 2 и 3; Р выбирают из фенила, -SO2R6, пиперидинила и пирролидинила; и R6 представляет собой -NH2, при условии, что когда R11 представляет собой фенил или пиридил, тогда a) х+у≥1; или b) R11 замещен Т; или c) R5 представляет собой NR3R4, и по меньшей мере один из R3 или R4 представляет собой -(О)q(СН2)rP-, и q+r≥1; или d) по меньшей мере один из R1 или R2 представляет собой алкил, замещенный -С(О)О(СН2)R12.

Изобретение относится к соединению формулы I, где Ph представляет собой фенил; R1 представляет собой C3-7циклоалкил; каждый R2, R3, R4, R5 и R6 независимо в каждом случае представляет собой H или C1-6алкил; или его фармацевтически приемлемой соли.

Настоящее изобретение относится к области преобразования химических элементов и источникам радиоактивности, предназначенным для медицинских целей, в частности к способу получения радиофармацевтического препарата «Астат-211» из облученной мишени, включающему возгонку радионуклида при температуре 700÷850°C в течение 4÷6 минут, с его осаждением в слабощелочном буферном физиологическом растворе с pH от 7.5 до 9, где в качестве мишени используют Bi естественного изотопного состава, который облучается α-частицами с энергией 29÷31 МэВ.

Изобретение относится к области медицины, в частности к способу иммунотерапии солидных опухолей. Способ иммунотерапии солидных опухолей, заключающийся в вакцинации пациента комбинацией препарата экзосом и олигодезоксинуклеотида Р-типа, при этом препарат включает экзосомы, выделенные культурой клеток K562/i-S9, и содержит белок, антигены CEA, 5Т4, лиганды FasL и TRAIL, а олигодезоксинуклеотид Р-типа представляет собой последовательность нуклеотидов GGGGCGCCGTGATGGCGAGCGCGCC, указанную комбинацию вводят подкожно в течение не менее 2 месяцев и не реже 1 раза в неделю в эффективном количестве, предпочтительно в дозах 0,01-0,04 мг/кг каждый.

Группа изобретений относится к комбинированной терапии солидной опухоли или рака. Предложены: фармацевтический продукт в виде комбинированного препарата указанного назначения, содержащий в качестве активного агента {3-[5-(4-хлор-фенил)-1H-пирроло[2,3-b]пиридин-3-карбонил-2,4-дифтор-фенил]-амид}пропан-1-сульфоновой кислоты или его фармацевтически приемлемую соль и пег-интерферон альфа-2а; набор того же назначения, включающий вышеперечисленные активные агенты; применение {3-[5-(4-хлор-фенил)-1H-пирроло[2,3-b]пиридин-3-карбонил-2,4-дифтор-фенил]-амид}пропан-1-сульфоновой кислоты или его соли и пег-интерферона альфа-2а в лечении солидной опухоли или рака; применение {3-[5-(4-хлор-фенил)-1H-пирроло[2,3-b]пиридин-3-карбонил-2,4-дифтор-фенил]-амид}пропан-1-сульфоновой кислоты или его соли и пег-интерферона альфа-2а для производства лекарственного средства для лечения солидной опухоли или рака.

Изобретение относится к новым соединениям формулы 10 и способу их получения. Соединения обладают свойствами ингибиторов рецепторной тирозинкиназы типа I и могут быть использованы при лечении гиперпролиферативных нарушений.

Данное изобретение относится к соединениям или их фармацевтически приемлемым солям общей формулы I, где R1 представляет собой ;R2 выбирают из группы, состоящей из замещенного или незамещенного фенила и , и ; и R3, R4, R5 и R6 все представляют собой Н, также к соединениям II и III.

Изобретение относится к химиотерапии. Предложен способ лечения рака, отличающегося от меланомы, заключающийся в апоптозе раковых клеток.

Изобретение относится к медицине, а именно к онкологии, и касается лечения рака у человека. Для этого вводят соединение формулы в интервале суточных доз от 20 мг до 1500 мг.

Изобретение относится к медицине, а именно к онкологии, и может быть использовано для лечения рака мочевого пузыря. Для этого на первые сутки после проведения трансуретральной резекции мочевого пузыря осуществляют внутрипузырное введение 2000 мг растворенного в 50 мл физиологического раствора гемцитабина концентрацией 40 мг/мл.
Наверх