Способы введения антагонистов интегрина бета7



Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7
Способы введения антагонистов интегрина бета7

 


Владельцы патента RU 2595836:

ДЖЕНЕНТЕК, ИНК. (US)

Группа изобретений относится к медицине и предназначена для лечения желудочно-кишечных воспалительных заболеваний, включая язвенный колит и болезнь Крона. Также изобретение относится к способам введения антагонистов интегрина бета7, таких как анти-бета7 антитела. Кроме того, изобретение относится к конкретным режимам дозирования, включая режимы дозирования, включающие подкожное введение. Группа изобретений позволяет повысить эффективность лечения и снизить степень тяжести заболевания. 4 н. и 63 з.п. ф-лы, 8 ил., 6 табл., 2 пр.

 

Перекрестная ссылка на родственные заявки

По настоящей заявке испрашивается приоритет по предварительной заявке США № 61/470360, поданной 31 марта 2011, и по предварительной заявке США № 61/550216 поданной 21 октября 2011 года, полное содержание которых включено в настоящее описание посредством ссылки.

Список последовательностей

Настоящая заявка включает список последовательностей, который был подан в формате ASCII через EFS-Web и, таким образом, полностью включен в данное описание посредством ссылки. Указанная ASCII-копия, созданная 15 марта 2012 года, названа P4622R1WO_SequenceListing.txt и имеет размер 17964 байт.

Области техники

Изобретение относится к способам лечения желудочно-кишечных воспалительных заболеваний, таких как воспалительные заболевания кишечника, включая неспецифический язвенный колит и болезнь Крона. Также изобретение относится к способам введения антагонистов интегрина бета7, таких как антитела к интегрину бета7. В дополнение, изобретение относится к особым режимам дозирования, в том числе, режимам дозирования, включающим подкожное введение и введение с помощью устройств для самоинъекций.

Предпосылки создания изобретения

Воспалительное заболевание кишечника (IBD) представляет собой хроническое воспалительное аутоиммунное заболевание желудочно-кишечного тракта (ЖКТ), которое клинически представлено либо как язвенный колит (UC), либо как болезнь Крона (CD). CD является хроническим трансмуральным воспалительным заболеванием, потенциально способным поражать любую часть всего желудочно-кишечного тракта, и UC представляет собой воспаление слизистой оболочки толстой кишки. Оба состояния клинически характеризуются частым стулом, истощением и обезвоживанием с нарушением функций жизнедеятельности. CD часто осложняется развитием мальабсорбции, стриктур и свищей, и может требовать многократных операций. UC может осложняться (не так часто) тяжелым кровавым поносом и токсическим мегаколоном, также требующими хирургического вмешательства. Оба IBD-состояния связаны с повышенным риском развития злокачественных заболеваний ЖКТ. Этиология IBD является сложной, и многие аспекты патогенеза остаются неясными.

Лечение умеренных и тяжелых форм IBD создает значительные трудности для лечащих врачей, так как обычная терапия кортикостероидами и иммуномодуляторами (например, азатиоприном, 6-меркаптопурином и метотрексатом) связана с побочными эффектами и непереносимостью, и не было показано достоверного эффекта поддерживающей терапии (стероидами). Для лечения CD в настоящее время используются моноклональные антитела к фактору некроза опухоли альфа (TNF-α), такие как инфликсимаб (химерные антитела) и адалимумаб (полностью человеческое антитело). Было показано, что инфликсимаб также является эффективным, и он был одобрен для использования при UC. Однако приблизительно 10%-20% пациентов с CD сразу не отвечают на терапию антителами к TNF-α, и еще ~20%-30% пациентов с CD теряют ответ со временем (Schnitzler et al., Gut 58:492-500 (2009)). Другие побочные эффекты, ассоциированные с анти-TNF-α антителами, включают повышенный уровень бактериальной инфекции, включая туберкулез и, реже, лимфому и демиелинизацию (Chang et al., Nat. Clin. Pract. Gastroenterol. Hepatology 3:220 (2006); Hoentjen et al., World J. Gastroenterol. 15(17):2067 (2009)). Ни один из доступных на сегодняшний день методов терапии не вызывает стойкую ремиссию более чем у 20%-30% пациентов с IBD, имеющим хроническое течение (Hanauer et al., Lancet 359:1541-49 (2002); Sandborn et al., N Engl. J Med. 353:1912-25 (2005)). Кроме того, у большинства пациентов не достигается без стероидов устойчивой ремиссии и заживления слизистой оболочки, клинических показателей, которые соответствуют действительному излечению от болезни. Таким образом, необходима разработка более целенаправленной терапии IBD, оптимизированной для постоянного применения: имеющей улучшенный профиль безопасности и дающей устойчивую ремиссию, особенно, ремиссию в отсутствие стероидов и предупреждение осложнений в долгосрочной перспективе у большей части пациентов, включая пациентов, которые либо никогда не отвечали на анти-TNF-α терапевтическое средство, либо теряли ответ со временем.

Интегрины представляют собой альфа/бета гетеродимерные гликопротеиновые рецепторы на клеточной поверхности, которые участвуют во многих клеточных процессах, включая адгезию лейкоцитов, передачу сигнала, пролиферацию и миграцию, а также в регуляции генов (Hynes, R. O., Cell, 1992, 69:11-25; и Hemler, M. E., Annu. Rev. Immunol, 1990, 8:365-368). Они состоят из двух гетеродимерных, нековалентно взаимодействующих трансмембранных субъединиц, α и β, которые специфично связываются с различными молекулами клеточной адгезии (CAM) на эндотелии, эпителии, и белками внеклеточного матрикса. Таким образом, интегрины могут функционировать как тканеспецифичные рецепторы клеточной адгезии, способствующие привлечению лейкоцитов из крови почти во все участки ткани строго регулируемым образом, участвующие в транслокации лейкоцитов в здоровую ткань и в участки воспаления (von Andrian et al., N Engl J Med 343:1020-34 (2000)). В иммунной системе, интегрины вовлечены в перемещение, адгезию и инфильтрацию лейкоцитов при воспалительных процессах (Nakajima, H. et al., J. Exp. Med., 1994, 179:1145-1154). Дифференциальная экспрессия интегринов регулирует адгезивные свойства клеток, и различные интегрины вовлечены в различных воспалительные реакции. (Butcher, E. C. et al., Science, 1996, 272:60-66). Бета7-содержащие интегрины (т.е. альфа4бета7 и альфаEбета7) экспрессируются в основном в моноцитах, лимфоцитах, эозинофилах, базофилах и макрофагах, но не в нейтрофилах (Elices, M. J. et al., Cell, 1990, 60:577-584).

Интегрин α4β7 представляет собой рецептор транслокации (homing receptor) лейкоцитов, который играет важную роль в миграции клеток к слизистой оболочке кишечника и ассоциированной лимфоидной ткани, такой как Пейеровы бляшки в тонком кишечнике, лимфоидные фолликулы в толстой кишке и брыжеечные лимфатические узлы. В кишечнике, первичное прикрепление и плотное прикрепление лейкоцитов к слизистому эндотелию инициируются сигналами от хемокинов и опосредовано сиалилом Льюиса X, связанным с молекулой белка клеточной адгезии слизистых, адресином-1 (MAdCAM). Сигнал от хемокинов вызывает изменение аффинности связывания интегрина α4β7 с MAdCAM-1 от низкой до высокой. Затем лейкоцит плотно прикрепляется и начинается процесс экстравазации через сосудистый эндотелий в окружающую ткань. Полагают, что данный процесс экстравазации происходит как при нормальной рециркуляции иммунных клеток, так и при воспалении (von Andrian et al., выше). Число α4β7+ клеток в инфильтратах и экспрессия лиганда MAdCAM-1 выше в участках хронического воспаления, например, в желудочно-кишечном тракте больных с UC или CD (Briskin et al., Am J Pathol. 151:97-110 (1997); Souza et al., Gut 45:856-63 (1999)). α4β7 связывается преимущественно с высоким эндотелием венул, экспрессирующим MAdCAM-1 и молекулу адгезии сосудистых клеток (VCAM-1), а также с фрагментом CS-1 молекулы внеклеточного матрикса, фибронектина (Chan et al., J Biol. Chem. 267:8366-70 (1992); Ruegg et al., J Cell Biol. 17:179-89 (1992); Berlin et al., Cell 74:185-95 (1993)). Вместе с конститутивно экспрессирующимся MAdCAM-1 в сосудах слизистой оболочки кишечника, интегрин α4β7 играет роль в избирательном тропизме лейкоцитов к ткани кишечника, но, по-видимому, не способствует транслокации лейкоцитов в периферические лимфоидные ткани или ЦНС. Наоборот, перемещение лимфоцитов в периферические лимфоидные органы ассоциировано с взаимодействием α4β1 и VCAM-1 (Yednock et al., Nature 356:63-6 (1992); Rice et al., Neurology 64:1336-42 (2005)).

Еще одним членом семейства интегринов β7, экспрессирующихся исключительно на Т-лимфоцитах и связанных с тканями слизистых оболочек, является интегрин αΕβ7, иначе известный как CD103. Интегрин αΕβ7 селективно связывается с Е-кадгерином на эпителиальных клетках и, как полагают, участвует в удержании Т-клеток в интраэпителиальном компартменте в ткани слизистой оболочки (Cepek et al., J Immunol. 150:3459-70 (1993); Karecla et al., Eur J Immunol. 25:852-6 (1995)). Опубликовано, что клетки αΕβ7+ в lamina propria (собственной пластинке слизистой оболочки), проявляют цитотоксичность в отношении эпителиальных клеток в состоянии стресса или инфицированных (Hadley et al., J Immunol. 159:3748-56 (1997); Buri et al., J Pathol. 206:178-85 (2005)). Экспрессия αΕβ7 увеличивается при CD (Elewaut et al., Acta Gastroenterol Belg 61:288-94 (1998); Oshitani et al., Int J Mol. Med. 12:715-9 (2003)), и было опубликовано, что лечение анти-αΕβ7 антителом ослабляет экспериментальный колит у мышей, указывая на роль αΕβ7+ лимфоцитов на экспериментальных моделях IBD (Ludviksson et al., J Immunol. 162:4975-82 (1999)).

Опубликовано, что введение моноклональных антител к альфаEбета7 предупреждает и ослабляет индуцированный иммунизацией колит у мышей IL-2-/-, позволяя предположить, что начало и развитие воспалительного заболевания кишечника зависит от локализации CD4+ лимфоцитов lamina propria, экспрессирующих альфаEбета7, в толстом кишечнике (Ludviksson et al., J Immunol. 1999, 162(8):4975-82). Опубликовано, что анти-α4 антитела (натализумаб) эффективны для лечения больных с CD (Sandborn et al., N Engl J Med. 2005; 353:1912-25), и анти-α4β7 антитела ((MLN-02, MLN0002, ведолизумаб) эффективны для лечения пациентов с UC (Feagan et al., N Engl J Med. 2005; 352:2499-507). Эти результаты валидируют α4β7 в качестве терапевтической мишени и подтверждает идею о том, что взаимодействие между α4β7 и MAdCAM-1 опосредует патогенез IBD. Таким образом, антагонисты интегрина бета7 обладают большим потенциалом в качестве терапевтического средства для лечения IBD.

Ранее были описаны гуманизированные моноклональные антитела к β7-субъединице интегрина. См., например, международную патентную публикацию № WO 2006/026759. Одно из таких антител, rhuMAb Beta7 (этролизумаб), получено из крысиного моноклонального антитела FIB504 к β7 мыши/человека (Andrew et al. 1994). Оно было модифицировано включением каркасных областей тяжелой цепи IgG1 и легкой цепи κ1 человека. Международная патентная публикация № WO 2006/026759.

RhuMAb Beta7 связывается с α4β7 (Holzmann et al., Cell 56:37-46 (1989); Hu et al., Proc. Natl. Acad Sci USA 89:8254-8 (1992)) и αΕβ7 (Cepek et al., J Immunol. 150:3459-70 (1993)), которые соответственно регулируют транслокацию и сохранение субпопуляции лимфоцитов в слизистой оболочке кишечника. Клинические исследования показали эффективность антител к α4 (натализумаба) для лечения CD (Sandborn et al., N Engl J Med. 353:1912-25 (2005)), а также обнадеживающие результаты были опубликованы для антитела к α4β7 (LDP02/MLN02/MLN0002/ведолизумаба) при лечении UC (Feagan et al., N Engl J Med. 352:2499-507 (2005)). Эти данные способствуют валидации α4β7 в качестве потенциальной терапевтической мишени и подтверждают гипотезу о том, что взаимодействие между α4β7 и молекулой белка клеточной адгезии слизистых, адресином-1 (MadCAM 1), вносит свой вклад в патогенез воспалительных заболеваний кишечника (IBD).

В отличие от натализумаба, который связывается с α4 и, таким образом, связывается как с α4β1, так и с α4β7, rhuMAb Beta7 специфично связывается с β7-субъединицей α4β7 и αΕβ7 и не связывается с отдельными субъединицами интегринов, α4 или β1. Это было продемонстрировано неспособностью антитела ингибировать адгезию α4β1+α4β7- клеток Ramos на молекулы адгезии сосудистых клеток 1 (VCAM 1) в концентрации вплоть до 100 нМ. Важно отметить, что это свойство rhuMAb Beta7 указывает на его селективность: rhuMAb Beta7 не должно непосредственно влиять на субпопуляции T-клеток, экспрессирующие α4β1, но не β7.

Несколько доклинических исследований in vivo подтверждают кишечно-специфичные эффекты rhuMAb Beta7 на транслокацию лейкоцитов. У мышей с тяжелым комбинированным иммунодефицитом (SCID) с введенными CD45RBвысок.CD4+ Т-клетками (животная модель колита) антитело rhuMAb Beta7 блокировало привлечение радиоактивно-меченных лимфоцитов к воспаленной толстой кишке, но не блокировало привлечение к селезенке, периферическому лимфоидному органу. См., например, международную патентную публикацию № WO 2006/026759. Кроме того, химерное (мышь/крыса) антитело к мышиной β7-субъединице (анти-β7, muFIB504) не уменьшало гистологическую степень воспаления центральной нервной системы (ЦНС) или не улучшало выживаемость у мышей с экспериментальным аутоиммунным энцефалитом (ЭАЭ), трансгенных по Т-клеточному рецептору к основному белку миелина (TCR-МВР), животной модели рассеянного склероза. Id. Кроме того, в двух исследованиях по безопасности на яванских макаках, rhuMAb Beta7 вызывало умеренное увеличение числа лимфоцитов периферической крови, что в основном являлось следствием значительного (примерно в три-шесть раз) увеличения CD45RA-β7высок. Т-клеток периферической крови, субпопуляции, фенотипически похожей на транслоцирующиеся в кишечник Т-клетки памяти или эффекторные Т-клетки в организме человека. См., например, международную патентную публикацию № WO 2009/140684; Stefanich et al., Br. J. Pharmacol, принята к публикации, doi: 10.1111/j.1476-5381.2011.01205.x). Напротив, rhuMAb Beta7 обладало минимальным или совсем не обладало эффектом на число CD45RA+β7средн. Т-клеток периферической крови, субпопуляции, фенотипически похожей на наивные Т-клетки в организме человека, и не оказывало какого-либо эффекта на число CD45RA-β7низк. Т-клеток периферической крови, субпопуляции, фенотипически похожей на транслоцирующиеся в периферические лимфатические органы Т-клетки памяти или эффекторные Т-клетки в организме человека, что подтверждает специфичность rhuMAb Beta7 к субпопуляции лимфоцитов, транслоцирующейся в кишечник. Международная патентная публикация № WO 2009/140684; Stefanich et al., Br. J. Pharmacol, принята к публикации, doi: 10.1111/j.1476-5381.2011.01205.x).

Несмотря на то, что клинические исследования показали эффективность анти-α4 антитела (натализумаба) для лечения CD (Sandborn et al., N Engl J Med. 353:1912-25 (2005)), а также обнадеживающие результаты были получены для анти-α4β7 антитела (LDP02/MLN02/MLN0002/ведолизумаба) при лечении UC, все еще необходимы дополнительные методы лечения этих заболеваний. Например, лечение натализумабом было ассоциировано с подтвержденными случаями прогрессивной мультифокальной лейкоэнцефалопатии (PML) (и отдельно, со случаями рассеянного склероза) у пациентов с болезнью Крона, которые получали лечение натализумабом и иммуносупрессорами. PML представляет собой потенциально смертельное неврологическое заболевание, связанное с реактивацией полиомавируса (JC-вируса) и активной репликацией вируса в мозге. Не существует надежной профилактики или адекватного лечения PML при ее возникновении. Одним из ограничений лечения ведолизумабом является его внутривенное введение, что может быть неудобным для пациента, а также может быть связано с нежелательными или побочными эффектами, например, побочными реакциями инфузии. Соответственно, необходимы улучшенные терапевтические подходы к лечению желудочно-кишечных воспалительных заболеваний, таких как IBD, например, неспецифический язвенный колит и болезнь Крона, а также более предпочтительные режимы дозирования.

Изобретение, описанное в настоящем описании, соответствует некоторым из описанных выше потребностей и обеспечивает другие преимущества.

Все приведенные в настоящем описании ссылки, включая патентные заявки и публикации, полностью включены посредством ссылки для любых целей.

Краткое изложение сущности изобретения

Способы по настоящему изобретению основаны по меньшей мере, частично, на открытии того, что терапевтически эффективное количество антагонистов интегрина бета7, таких как анти-бета7 антитела, включая rhuMAb Beta7 (этролизумаб), можно вводить подкожно, также как и внутривенно.

Соответственно, в одном аспекте изобретение относится к способам лечения желудочно-кишечных воспалительных заболеваний у млекопитающего субъекта, включающим введение субъекту терапевтически эффективного количества антагониста интегрина бета7. В некоторых вариантах осуществления изобретения млекопитающим субъектом является пациент. В некоторых вариантах осуществления изобретения пациентом является человек. В некоторых вариантах осуществления изобретения антагонист интегрина бета7 вводят внутривенно. В некоторых вариантах осуществления изобретения антагонист интегрина бета7 вводят подкожно. В одном аспекте желудочно-кишечное воспалительное заболевание представляет собой воспалительное заболевание кишечника. В некоторых вариантах осуществления изобретения воспалительным заболеванием кишечника является язвенный колит (UC) или болезнь Крона (CD). В некоторых вариантах осуществления изобретения антагонист интегрина бета7 представляет собой моноклональное анти-бета7 антитело. В некоторых таких вариантах осуществления изобретения анти-бета7 антитело выбрано из химерного антитела, антитела человека и гуманизированного антитела. В некоторых вариантах осуществления изобретения анти-бета7 антитело представляет собой фрагмент антитела. В некоторых вариантах осуществления анти-бета7 антитело содержит шесть гипервариабельных участков (HVR), в которых:

(i) HVR-L1 содержит аминокислотную последовательность A1-A11, где A1-A11 представляет собой RASESVDTYLH (SEQ ID NO:1); RASESVDSLLH (SEQ ID NO:7), RASESVDTLLH (SEQ ID NO:8) или RASESVDDLLH (SEQ ID NO:9), или вариант SEQ ID NO:1, 7, 8 или 9 (SEQ ID NO:26), где аминокислота A2 выбрана из группы, состоящей из A, G, S, T и V, и/или аминокислота A3 выбрана из группы, состоящей из S, G, I, K, N, P, Q, R и Т, и/или аминокислота А4 выбрана из группы, состоящей из Е, V, Q, А, D, G, H, I, K, L, N и R, и/или аминокислота A5 выбрана из группы, состоящей из S, Y, A, D, G, H, I, K, N, P, R, Т и V, и/или аминокислота A6 выбрана из группы, состоящей из V, R, I, A, G, K, L, M и Q, и/или аминокислота A7 выбрана из группы, состоящей из D, V, S, A, E, G, H, I, K, L, N, P, S и Т, и/или аминокислота A8 выбрана из группы, состоящей из D, G, N, E, T, P и S, и/или аминокислота A9 выбрана из группы, состоящей из L, Y, I и М, и/или аминокислота А10 выбрана из группы, состоящей из L, A, I, M и V, и/или аминокислота A11 выбрана из группы, состоящей из H, Y, F и S;

(ii) HVR-L2 содержит аминокислотную последовательность В1-В8, где В1-В8 представляет собой KYASQSIS (SEQ ID NO:2), RYASQSIS (SEQ ID NO:20) или XaaYASQSIS (SEQ ID NO:21, где Xaa представляет собой любую аминокислоту), или вариант SEQ ID NO:2, 20 или 21 (SEQ ID NO:27), где аминокислота B1 выбрана из группы, состоящей из K, R, N, V, A, F, Q, H, P, I, L, Y и Xaa (где Xaa представляет собой любую аминокислоту), и/или аминокислота B4 выбрана из группы, состоящей из S и D, и/или аминокислота B5 выбрана из группы, состоящей из Q и S, и/или аминокислота B6 выбрана из группы, состоящей из S, D, L и R, и/или аминокислота B7 выбрана из группы, состоящей из I, V, Е и К;

(iii) HVR-L3 содержит аминокислотную последовательность С1-С9, где С1-С9 представляет собой QQGNSLPNT (SEQ ID NO:3) или вариант SEQ ID NO:3 (SEQ ID NO:28), где аминокислота C8 выбрана из группы, состоящей из N, V, W, Y, R, S, T, A, F, H, I, L и M;

(iv) HVR-H1 содержит аминокислотную последовательность D1-D10, где D1-D10 представляет собой GFFITNNYWG (SEQ ID NO:4);

(v) HVR-H2 содержит аминокислотную последовательность Е1-Е17, где Е1-Е17 представляет собой GYISYSGSTSYNPSLKS (SEQ ID NO:5) или вариант SEQ ID NO:5 (SEQ ID NO:29), где аминокислота Е2 выбрана из группы, состоящей из Y, F, V и D, и/или аминокислота E6 выбрана из группы, состоящей из S и G, и/или аминокислота E10 выбрана из группы, состоящей из S и Y, и/или аминокислота E12 выбрана из группы, состоящей из N, Т, А и D, и/или аминокислота 13 выбрана из группы, состоящей из P, H, D и A, и/или аминокислота Е15 выбрана из группы, состоящей из L и V, и/или аминокислота E17 выбрана из группы, состоящей из S и G; и

(vi) HVR-H3 содержит аминокислотную последовательность F2-F11, где F2-F11 представляет собой MTGSSGYFDF (SEQ ID NO:6) или RTGSSGYFDF (SEQ ID NO:19); или содержит аминокислотную последовательность F1-F11, где F1-F11 представляет собой AMTGSSGYFDF (SEQ ID NO:16), ARTGSSGYFDF (SEQ ID NO:17) или AQTGSSGYFDF (SEQ ID NO:18), или вариант SEQ ID NO:6, 16, 17, 18 или 19 (SEQ ID NO:30), где аминокислотой F2 является R, M, A, E, G, Q, S, и/или аминокислота F11 выбрана из группы, состоящей из F и Y. В некоторых таких вариантах осуществления изобретения анти-бета7 антитело содержит три последовательности гипервариабельных областей тяжелой цепи (HVR-H1-H3) и три последовательности гипервариабельных областей легкой цепи (HVR-L1-L3), где:

(i) HVR-L1 содержит SEQ ID NO:7, SEQ ID NO:8 или SEQ ID NO:9;

(ii) HVR-L2 содержит SEQ ID NO:2;

(iii) HVR-L3 содержит SEQ ID NO:3;

(iv) HVR-H1 содержит SEQ ID NO:4;

(v) HVR-H2 содержит SEQ ID NO:5; и

(vi) HVR-H3 содержит SEQ ID NO:6 или SEQ ID NO:16, или SEQ ID NO:17, или SEQ ID NO:19.

В другом аспекте изобретение относится к способам подкожного введения терапевтически эффективного количества анти-бета7 антител в расчете на массу. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в дозировке 0,5 мг/кг. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в дозировке 1,5 мг/кг. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в дозировке 3,0 мг/кг. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в дозировке 4,0 мг/кг. В одном аспекте анти-бета7 антитело вводят через равные интервалы времени. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят один раз в неделю. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят каждые две недели. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят каждые четыре недели. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят каждые шесть недель. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят каждые восемь недель. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение двух месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение трех месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение шести месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение 12 месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение 18 месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение 24 месяцев. В некоторых вариантах изобретения анти-бета7 антитело вводят в течение всей жизни субъекта. В некоторых вариантах осуществления изобретения анти-бета7 антителом является rhuMAb Beta7 (этролизумаб).

В еще одном аспекте изобретение относится к способам подкожного введения терапевтически эффективного количества анти-бета7 антител в фиксированной дозе. В некоторых вариантах анти-бета7 антитело вводят в фиксированной дозе от 50 мг до 450 мг. В некоторых вариантах осуществления фиксированная доза составляет 50 мг. В некоторых таких вариантах осуществления фиксированная доза составляет 100 мг. В некоторых таких вариантах осуществления фиксированная доза составляет 150 мг. В некоторых таких вариантах осуществления фиксированная доза составляет 200 мг. В некоторых таких вариантах осуществления фиксированная доза составляет 300 мг. В некоторых вариантах осуществления фиксированная доза составляет 350 мг. В некоторых таких вариантах осуществления фиксированная доза составляет 400 мг. В некоторых таких вариантах осуществления фиксированная доза составляет 420 мг. В некоторых таких вариантах осуществления фиксированная доза составляет 450 мг. В одном аспекте анти-бета7 антитело вводят через равные интервалы времени. В некоторых таких вариантах осуществления изобретения анти-бета7 антитело вводят один раз в неделю. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят каждые две недели. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят каждые четыре недели. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят каждые шесть недель. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят каждые восемь недель. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение двух месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение трех месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение шести месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение 12 месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение 18 месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение 24 месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение всей жизни субъекта. В некоторых вариантах осуществления анти-бета7 антителом является rhuMAb Beta7 (этролизумаб).

В еще одном аспекте изобретение относится к способам введения терапевтически эффективного количества анти-бета7 антитела в фиксированной дозе, где введение включает введение первой ударной дозы и введение по меньшей мере одной последующей поддерживающей дозы, причем каждую из ударной дозы и по меньшей мере одной поддерживающей дозы вводят в фиксированной дозе. В некоторых вариантах осуществления изобретения ударную дозу анти-бета7 антитела вводят внутривенно. В некоторых вариантах осуществления изобретения ударную дозу анти-бета7 антитела вводят подкожно. В некоторых вариантах осуществления изобретения по меньшей мере одну последующую поддерживающую дозу анти-бета7 антитела вводят внутривенно. В некоторых вариантах осуществления изобретения по меньшей мере одну последующую поддерживающую дозу анти-бета7 антитела вводят подкожно. В некоторых вариантах осуществления изобретения каждую из ударной дозы и по меньшей мере одной последующей поддерживающей дозы вводят внутривенно. В некоторых вариантах осуществления изобретения каждую из ударной дозы и по меньшей мере одной последующей поддерживающей дозы вводят подкожно. В некоторых вариантах осуществления изобретения ударную дозу вводят внутривенно, и каждую из по меньшей мере одной последующей поддерживающей дозы вводят подкожно. В некоторых вариантах осуществления изобретения ударная доза составляет от 400 мг до 450 мг и поддерживающая доза составляет от 50 мг до 350 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 420 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 430 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 450 мг. В некоторых вариантах осуществления изобретения поддерживающая доза составляет 50 мг. В некоторых вариантах осуществления изобретения поддерживающая доза составляет 100 мг. В некоторых вариантах осуществления изобретения поддерживающая доза составляет 150 мг. В некоторых вариантах осуществления изобретения поддерживающая доза составляет 200 мг. В некоторых вариантах осуществления изобретения поддерживающая доза составляет 300 мг. В некоторых вариантах осуществления изобретения поддерживающая доза составляет 350 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг и поддерживающая доза составляет 50 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг и поддерживающая доза составляет 100 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг и поддерживающая доза составляет 150 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг и поддерживающая доза составляет 200 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг и поддерживающая доза составляет 300 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг и поддерживающая доза составляет 350 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 420 мг и поддерживающая доза составляет 50 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 420 мг и поддерживающая доза составляет 100 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 420 мг и поддерживающая доза составляет 150 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 420 мг и поддерживающая доза составляет 200 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 420 мг и поддерживающая доза составляет 300 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 420 мг и поддерживающая доза составляет 350 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 430 мг и поддерживающая доза составляет 50 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 430 мг и поддерживающая доза составляет 100 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 430 мг и поддерживающая доза составляет 150 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 430 мг и поддерживающая доза составляет 200 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 430 мг и поддерживающая доза составляет 300 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 430 мг и поддерживающая доза составляет 350 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 450 мг и поддерживающая доза составляет 50 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 450 мг и поддерживающая доза составляет 100 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 450 мг и поддерживающая доза составляет 150 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 450 мг и поддерживающая доза составляет 200 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 450 мг и поддерживающая доза составляет 300 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 450 мг и поддерживающая доза составляет 350 мг. В некоторых вариантах осуществления анти-бета7 антителом является rhuMAb Beta7 (этролизумаб).

В другом аспекте изобретение относится к способам подкожного введения терапевтически эффективного количества анти-бета7 антител в ударной дозе с последующей одной или несколькими поддерживающими дозами. В некоторых вариантах осуществления изобретения первую поддерживающую дозу вводят в тот же день, что и ударную дозу. В некоторых вариантах осуществления изобретения первую поддерживающую дозу вводят через один день после ударной дозы. В некоторых вариантах осуществления изобретения первую поддерживающую дозу вводят через одну неделю после ударной дозы. В некоторых вариантах осуществления изобретения первую поддерживающую дозу вводят через две недели после ударной дозы. В некоторых вариантах осуществления изобретения первую поддерживающую дозу вводят через четыре недели после ударной дозы. В некоторых вариантах осуществления изобретения вторую и каждую последующую поддерживающую дозу вводят каждые две недели. В некоторых вариантах осуществления изобретения вторую и каждую последующую поддерживающую дозу вводят каждые четыре недели. В некоторых вариантах осуществления изобретения вторую и каждую последующую поддерживающую дозу вводят каждые восемь недель. В некоторых вариантах осуществления изобретения первую поддерживающую дозу вводят через две недели после ударной дозы, вторую поддерживающую дозу вводят через две недели после первой поддерживающей дозы, и каждую последующую поддерживающую дозу вводят каждые четыре недели. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение двух месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение трех месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение шести месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение 12 месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение 18 месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение 24 месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение всей жизни субъекта. В некоторых вариантах осуществления анти-бета7 антителом является rhuMAb Beta7 (этролизумаб).

В еще одном аспекте изобретение относится к изделию, содержащему антагонист интегрина бета7. В некоторых вариантах осуществления изобретения изделие включает предварительно заполненный шприц или устройство для автоматических инъекций, содержащее 2 мл (150 мг) антагониста интегрина бета7. В некоторых вариантах осуществления изделие включает предварительно заполненный шприц или устройство для автоматических инъекций, содержащее 1 мл (180 мг) антагониста интегрина бета7. В некоторых вариантах осуществления антагонистом интегрина бета7 является анти-бета7 антитело или rhuMAb Beta7 (этролизумаб).

В еще одном аспекте изобретение относится к способам подкожного введения терапевтически эффективного количества антагониста интегрина бета7 по меньшей мере с одним дополнительным соединением. В некоторых вариантах осуществления изобретения по меньшей мере одно дополнительное соединение выбрано из 5-аминосалициловой кислоты (5-ASA), азатиоприна (AZA), 6-меркаптопурина (6-МР) и метотрексата.

В другом аспекте изобретение относится к способам подкожного введения терапевтически эффективного количества антагониста интегрина бета7, когда субъект или пациент ранее не отвечал по меньшей мере на один биологический агент. В некоторых вариантах осуществления изобретения биологический агент выбран из адалимумаба, этанерцепта, инфликсимаба, голимумаба, цертолизумаба пегола, натализумаба и ведолизумаба. В некоторых вариантах осуществления изобретения антагонистом интегрина бета7 является анти-бета7 антитело или rhuMAb Beta7 (этролизумаб).

В еще одном аспекте изобретение относится к способам подкожного введения терапевтически эффективного количества антагониста интегрина бета7 с помощью устройства для самоинъекций. В некоторых вариантах осуществления изобретения устройство для самоинъекций выбрано из предварительно заполненного шприца, устройства с микроиглой, устройства для автоматических инъекций и безыгольного устройства для инъекций. В некоторых вариантах осуществления изобретения антагонистом интегрина бета7 является анти-бета7 антитело или rhuMAb Beta7 (этролизумаб).

В еще одном аспекте изобретение относится к способам, вызывающим ремиссию у пациента с язвенным колитом. Такие способы включают введение анти-бета7 антитела в любой дозировке или в соответствии с любым режимом дозирования, указанными выше. В некоторых вариантах осуществления изобретения анти-бета7 антителом является rhuMAb Beta7 (этролизумаб). В некоторых вариантах осуществления изобретения ремиссия у пациента наступает, когда абсолютный индекс клинических проявлений по шкале Мейо (индекс Мейо) ≤2, и ни один индивидуальный показатель не превышает 1, что также называют клинической ремиссией. В некоторых вариантах осуществления изобретения ремиссия у пациента возникает по меньшей мере на 10-й неделе после начала лечения анти-бета7 антителом. В некоторых вариантах осуществления изобретения пациенты, которым вводили анти-бета7 антитело, как описано выше, сохраняют клиническую ремиссии после ее начала и продолжают оставаться в ремиссии в течение некоторого периода времени, что также известно как устойчивая ремиссия. В некоторых таких вариантах осуществления изобретения устойчивая ремиссия составляет 8 недель после начала ремиссии, или составляет 30 недель после начала ремиссии, или составляет 50 недель после начала ремиссии, или составляет 54 недели или более длительный период времени после начала ремиссии. В некоторых вариантах осуществления изобретения пациенты, которым вводили анти-бета7 антитело в любой дозировке или в соответствии с любым режимом дозирования, указанными выше, находятся в устойчивой ремиссии без использования стероидов. В некоторых вариантах осуществления изобретения пациенты, находящиеся в устойчивой ремиссии без использования стероидов, прекращают применение кортикостероидов на 30-й неделе после начала ремиссии и находятся в ремиссии через 50 недель или 54 недели, или в течение большего периода времени после начала ремиссии. В некоторых вариантах осуществления изобретения у пациентов, которым вводили анти-бета7 антитело, как описано выше, наблюдается сокращение времени обострений или снижение частоты обострений в течение определенного периода времени. В некоторых вариантах осуществления изобретения у пациентов, которым вводили анти-бета7 антитело, как описано выше, наблюдается заживление слизистой оболочки кишечника. В некоторых вариантах осуществления изобретения определено, что пациенты, у которых наблюдается заживление слизистой оболочки, имеют значения 0 или 1 эндоскопического показателя по оценке гибкой сигмоидоскопии. В некоторых вариантах осуществления анти-бета7 антителом является rhuMAb Beta7 (этролизумаб).

Краткое описание фигур

На фиг.1 показаны профили зависимости среднегрупповых концентраций rhuMAb Beta7 в сыворотке от времени в исследовании фазы I, описанном в примере 1. (А) Концентрация rhuMAb Beta7 в сыворотке пациентов, которые получали исследуемое лекарственное средство внутривенно, на стадии исследовании действия однократных нарастающих доз (SAD); (В) концентрация rhuMAb Beta7 в сыворотке пациентов, которые получали исследуемое лекарственное средство в количестве 3,0 мг/мг внутривенно по сравнению с пациентами, которые получали такую же дозировку исследуемого лекарственного средства подкожно, на стадии исследовании действия однократных нарастающих доз; (С) концентрация rhuMAb Beta7 в сыворотке пациентов на стадии исследовании действия многократных нарастающих доз (MAD). На каждом графике концентрация rhuMAb Beta7 в сыворотке (мкг/мл) отложена по оси ординат, и время (дни) - по оси абсцисс.

На фиг.2 показана степень занятости (связывания) интегрина бета7, описанная в примере 1. (А) Степень занятости в образцах от пациентов в когорте G; четыре пациента (V, W, X, Y) получали по 0,5 мг/кг rhuMAb beta7 подкожно, и один получал плацебо (P6); (B) степень занятости в образцах от каждого пациента в когорте Н; три пациента (AA, BA, DA) получали по 1,5 мг/кг rhuMAb beta7 подкожно, и один получал плацебо (P8); (C) степень занятости в образцах от каждого пациента в когорте I; четыре пациента (EA, FA, GA, HA) получали по 3,0 мг/кг rhuMAb beta7 подкожно, и один получал плацебо (P9); (D) степень занятости в образцах от каждого пациента в когорте J; пять пациентов (IA, JA, KA, LA, MA) получали по 4,0 мг/кг rhuMAb beta7 внутривенно, и один получал плацебо (P10). На каждом графике степень занятости отложена по оси ординат, и день исследования - по оси абсцисс. Некоторые пациенты имели обострения в течение исследования, и это указано в круглых скобках для каждого пациента, а также указан день обострения.

На фиг.3 показаны индивидуальные изменения индекса Мейо, описанные в примере 1. (A) Когорта G (0,5 мг/кг подкожно); (B) когорта H (1,5 мг/кг подкожно); (C) когорта I (3 мг/кг подкожно); (D) когорта J (4 мг/кг внутривенно); (E) плацебо. На каждом графике индекс Мейо отложен по оси ординат, и время (дни) отложены по оси абсцисс. Стрелки указывают дни, в которые вводили исследуемое лекарственное средство (A-D) или плацебо (E).

На фиг.4 показан профиль (медианный уровень) зависимости концентрации rhuMAb Beta7 в сыворотке от времени, смоделированный с использованием фармакокинетической модели, полученной на основе предварительных фармакокинетических данных фазы I, описанных в примере 2. Смоделированная концентрация rhuMAb Beta7 в сыворотке (мкг/мл) отложена по оси ординат; время (дни) отложено по оси абсцисс.

На фиг.5 показано сравнение смоделированных постоянного воздействия (Cmax и AUC0-84) и вариабельности в случае дозирования по массе относительно фиксированной дозы, как описано в примере 2.

На фиг.6А и 6В показано выравнивание вариабельных областей легкой и тяжелой цепей для следующих последовательностей: консенсусной последовательности подгруппы каппа I легких цепей человека (фиг.6A, SEQ ID NO:12), консенсусной последовательности подгруппы III тяжелых цепей человека (фиг.6B, SEQ ID NO:13), вариабельной области легкой цепи крысиного антитела к мышиному интегрину бета 7 (Fib504) (фиг.6A, SEQ ID NO:10), вариабельной области тяжелой цепи крысиного антитела к мышиному интегрину бета 7 (Fib504) (фиг.6B, SEQ ID NO:11) и гуманизированных вариантов антител: вариабельной области легкой цепи гуманизированного антитела hu504Kgraft (фиг.6A, SEQ ID NO:14), вариабельной области тяжелой цепи гуманизированного антитела hu504Kgraft (фиг.6B, SEQ ID NO:15), вариантов hu504-5, hu504-16 и hu504-32 (аминокислотные отличия от гуманизированного hu504Kgraft указаны на фиг.6A (легкая цепь) (SEQ ID NOS:22-24, соответственно, по порядку) и на фиг.6B (тяжелая цепь) для вариантов hu504-5, hu504-16 и hu504-32 (SEQ ID NO:25)).

На фиг.7 показана схема исследований для исследования фазы II, описанного в примере 2.

На фиг.8 показан частичный индекс Мейо (pMCS) для пациентов с умеренным и тяжелым язвенным колитом, которые участвовали в открытом расширенном исследовании, описанном в примере 2.

Подробное описание изобретения

Если не указано иное, то технические и научные термины, используемые в настоящем описании, имеют такие же значения, которые понятны специалисту в области техники, к которой относится данное изобретение. Для специалистов в данной области техники, в Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994) и March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992) приведено общее описание ко многим терминам, используемым в настоящем описании.

Некоторые определения

Для целей интерпретации данного описания применимы следующие определения и, если это уместно, термины, используемые в единственном числе, будут также включать множественное число и наоборот. В случае если какое-либо определение, изложенное ниже, противоречит любому документу, включенному в настоящее описание посредством ссылки, изложенное ниже определение будет превалировать.

Используемые в данном описании и прилагаемой формуле изобретения формы единственного числа включают и множественное число, если из контекста явно не следует иное. Таким образом, например, ссылка на «белок» включает множество белков; ссылка на «клетку» включает смеси клеток и т.д.

Диапазоны, приведенные в данном описании и прилагаемой формуле изобретения, включают как конечные точки, так и все точки между конечными точками. Так, например, диапазон от 2,0 до 3,0 включает 2,0, 3,0 и все точки между 2,0 и 3,0.

«Лечение» и его грамматические варианты относятся к клиническому вмешательству в попытке изменить естественную судьбу человека или клетки, подлежащих лечению, и могут осуществляться либо для профилактики, либо при клинической патологии. Желаемые эффекты лечения включают предупреждение возникновения или рецидива заболевания, облегчение симптомов, уменьшение любых прямых или косвенных патологических последствий заболевания, снижение скорости развития заболевания, улучшение или временное облегчение болезненного состояния, а также ремиссию или улучшение прогноза.

«Схема лечения» относится к комбинации дозировки, частоты введения или продолжительности лечения, с добавлением или без добавления второго лекарственного средства.

«Эффективная схема лечения» относится к схеме лечения, которая будет давать предпочтительный ответ у пациента, получающего лечение.

«Модификация лечения» относится к изменению схемы лечения, включая изменение дозировки, частоты введения или длительности лечения, и/или добавление второго лекарственного средства.

«Ответ пациента» или «ответную реакцию пациента» можно оценить, используя любую конечную точку, в которой наблюдается эффект у пациента, включая, но без ограничения, (1) ингибирование, в некоторой степени, развития заболевания, включая замедление и полную остановку развития заболевания; (2) снижение количества эпизодов заболевания и/или симптомов; (3) уменьшение размера повреждений; (4) ингибирование (т.е. уменьшение, замедление или полное прекращение) инфильтрации больных клеток в соседние периферические органы и/или ткани; (5) ингибирование (т.е. уменьшение, замедление или полное прекращение) распространения заболевания; (6) снижение аутоиммунного ответа, что может, но необязательно, приводить к регрессии или устранению болезненных поражений; (7) снижение выраженности, до некоторой степени, одного или нескольких симптомов, связанных с заболеванием; (8) увеличение продолжительности безрецидивного периода после лечения; и/или (9) снижение смертности в данной точке времени после лечения. Термин «ответная реакция» относится к измеримому ответу, включая полный ответ (CR) и частичный ответ (PR).

В контексте настоящего описания «полный ответ» или «CR» означает исчезновение всех признаков воспаления или ремиссию в ответ на лечение. Это необязательно означает, что болезнь была вылечена.

«Частичный ответ» или «PR» относится к снижению тяжести воспаления в ответ на лечение по меньшей мере на 50%.

«Предпочтительный ответ» пациента на лечение антагонистом интегрина бета7 и аналогичные словосочетания относятся к клиническому или терапевтическому эффекту у пациента, имеющего риск развития или страдающего желудочно-кишечным воспалительным расстройством, от или в результате лечения антагонистом, таким как антитело к интегрину бета7. Такой эффект включает клеточные или биологические реакции, полный ответ, частичный ответ, стабилизацию заболевания (без развития или рецидива) или ответ с более поздним рецидивом у пациента от или в результате лечения антагонистом.

«Пациент сохраняет ответную реакцию на лечение», когда ответная реакция пациента не снижается с течением времени в ходе лечения.

Термин «образец» в контексте настоящего описания относится к композиции, которая получена от представляющего интерес субъекта, который содержит клеточные и/или другие молекулярные объекты, которые необходимо описать и/или идентифицировать, например, на основе физических, биохимических, химических и/или физиологических характеристик. Например, фраза «образец заболевания» и ее вариации относится к любому образцу, полученному от представляющего интерес субъекта, который как ожидается, или как известно, содержит клеточный и/или молекулярный объект, который необходимо охарактеризовать. Образец может быть получен из ткани представляющего интерес субъекта или из периферической крови субъекта.

«Антагонист интегрина бета7» или «антагонист бета7» означает любую молекулу, которая ингибирует одну или более биологических активностей или блокирует связывание интегрина бета7 с одной или более ассоциированными с ним молекулами. Антагонисты по настоящему изобретению можно использовать для модуляции одного или более аспектов бета7-ассоциированных эффектов, включая, но, не ограничиваясь ими, ассоциации с субъединицей альфа4 интегрина, ассоциации с субъединицей альфаЕ интегрина, связывание интегрина альфа4бета7 с MAdCAM, VCAM-1 или фибронектином и связывание интегрина альфаEбета7 с Е-кадгерином. Эти эффекты могут осуществляться по любому соответствующему биологическому механизму, включая нарушение связывания лиганда с субъединицей бета7 или с димерными интегринами, альфа4бета7 или альфаEбета7, и/или путем разрушения связи между альфа- и бета-субъединицами интегрина, так что ингибируется образование димерного интегрина. В одном варианте осуществления изобретения антагонист бета7 представляет собой антитело к интегрину бета7 (или анти-бета7 антитело). В одном варианте осуществления изобретения антитело к интегрину бета7 является гуманизированным антителом к интегрину бета7 и, более конкретно, рекомбинантным гуманизированным моноклональным анти-бета7 антителом (или rhuMAb beta7). В некоторых вариантах осуществления изобретения анти-бета7 антитела по настоящему изобретению являются антагонистическими антителами к интегрину бета7, которые ингибируют или блокируют связывание субъединицы бета7 интегрина с субъединицей альфа4 интегрина, связывание с субъединицей альфаЕ интегрина, связывание альфа4бета7 интегрина с MAdCAM, VCAM-1 или фибронектином и связывание интегрина альфаEбета7 с E-кадгерином.

Под термином «субъединица бета7» или «β7-субъединица» подразумевается β7-субъединица интегрина человека (Erle et al., (1991) J. Biol. Chem. 266:11009-11016). Субъединица бета7 связывается с субъединицей альфа4 интегрина, такой как α4-субъединица человека (Kilger and Holzmann (1995) J. Mol. Biol. 73:347-354). Интегрин альфа4бета7 экспрессируется на большинстве зрелых лимфоцитов, а также на небольшой популяции тимоцитов, на клетках костного мозга и на тучных клетках. (Kilshaw and Murant (1991) Eur. J. Immunol. 21:2591-2597; Gurish et al., (1992) 149:1964-1972; и Shaw, S.K. and Brenner, M.B. (1995) Semin. Immunol. 7:335). Субъединица бета7 также связывается с субъединицей альфаЕ, такой как субъединица альфаЕ интегрина человека (Cepek, K.L, et al. (1993) J. Immunol. 150:3459). Интегрин альфаЕбета7 экспрессируется на лимфоцитах эпителия кишечника (iIEL) (Cepek, K.L. (1993), выше).

Под «субъединицей альфаЕ» или «субъединицей альфаЕ интегрина», или «αЕ-субъединицей», или «αЕ-субъединицей интегрина», или «CD103» подразумевается субъединица интегрина, связанная с интегрином бета7, экспрессирующимся на внутриэпителиальных лимфоцитах, причем данный интегрин альфаЕбета7 опосредует связывание iIEL с клетками кишечного эпителия, экспрессирующими E-кадгерин (Cepek, K.L. et al. (1993) J. Immunol. 150:3459; Shaw, S.K. and Brenner, M.B. (1995) Semin. Immunol. 7:335).

«MAdCAM» или «MAdCAM-1» используются взаимозаменяемо в контексте настоящего изобретения для обозначения молекулы белка клеточной адгезии слизистых, адресина-1, который представляет собой одноцепочечный полипептид, содержащий короткий цитоплазматический хвост, трансмембранный участок и внеклеточную последовательность, состоящую из трех иммуноглобулин-подобных доменов. Были клонированы кДНК мышиного MAdCAM-1, MAdCAM-1 человека и MAdCAM-1 макаки (Briskin, et al., (1993) Nature, 363:461-464; Shyjan et al., (1996) J. Immunol. 156:2851-2857).

«VCAM-1» или «молекула адгезии сосудистых клеток-1», или «CD106» относится к лиганду альфа4бета7 и альфа4бета1, который экспрессируется на активированных эндотелиальных клетках и играет важную роль во взаимодействиях эндотелиальных клеток с лейкоцитами, таких как связывание и перемещение лейкоцитов в процессе воспаления.

«CD45» относится к белку из семейства белковых тирозинфосфатаз (PTP). РТР, как известно, представляют собой сигнальные молекулы, которые регулируют различные клеточные процессы, включая клеточный рост, дифференцировку, митотический цикл и опухолевую трансформацию. Эта PTP содержит внеклеточный домен, один трансмембранный сегмент и два тандемных внутрицитоплазматических каталитических домена, и, следовательно, относится к рецепторному типу PTP. Этот ген специфично экспрессируется в гемопоэтических клетках. Было показано, что данная PTP является необходимым регулятором передачи сигнала от Т- и В-клеточного антигенного рецептора. Она функционирует либо через непосредственное взаимодействие с компонентами комплекса антигенного рецептора, либо путем активации различных киназ Src-семейства, необходимых для передачи сигнала от антигенного рецептора. Эта PTP также подавляет JAK-киназы, и таким образом, действует в качестве регулятора передачи сигнала от цитокиновых рецепторов. Опубликовано четыре альтернативно сплайсированых транскрипционных вариантов этого гена, которые кодируют различные изоформы. (T Chilian EZ, Beverley PC (2002). "CD45 in memory and disease." Arch. Immunol. Ther. Exp. (Warsz.) 50 (2):85-93. Ishikawa H, Tsuyama N, Abroun S, et al. (2004). "Interleukin-6, CD45 and the src-kinases in myeloma cell proliferation." Leuk. Lymphoma 44 (9):1477-81.

Существуют различные изоформы CD45: CD45RA, CD45RB, CD45RC, CD45RAB, CD45RAC, CD45RBC, CD45RO, CD45R (ABC). CD45 также сильно гликозилирована. CD45R является наиболее длинным белком и мигрирует на уровне 200 кДа при выделении из Т-клеток. В-клетки также экспрессируют CD45R, но более сильно гликозилированную, что повышает молекулярную массу до 220 кДа, давая название белку - В220; В-клеточная изоформа 220 кДа. Экспрессия В220 не ограничена В-клетками, и этот белок также может экспрессироваться на активированных Т-клетках, на субпопуляции дендритных клеток и других антиген-представляющих клетках. Stanton T, Boxall S, Bennett A, et al. (2004). "CD45 variant alleles: possibly increased frequency of a novel exon 4 CD45 polymorphism in HIV seropositive Ugandans." Immunogenetics 56 (2):107-10.

«Транслоцирующиеся в кишечник лимфоциты» относятся к подгруппе лимфоцитов, отличающихся избирательной транслокацией в кишечные лимфатические узлы и ткани, но не транслоцирующиеся в периферические лимфатические узлы и ткани. Эта подгруппа лимфоцитов отличается уникальным профилем экспрессии комбинации множества молекул клеточной поверхности, включая, но, не ограничиваясь ими, комбинацию CD4, CD45RA и бета7. Как правило, по меньшей мере две субпопуляции CD4+ лимфоцитов периферической крови можно подразделить на основе маркеров CD45RA и бета7, CD45RA-β7высок. и CD45RA-β7низк. CD4+ клетки. CD45RA-β7высок. CD4+ клетки транслоцируются предпочтительно в кишечные лимфатические узлы и ткани, тогда как CD45RA-β7низк. CD4+ клетки транслоцируются предпочтительно в периферические лимфатические узлы и ткани (Rott et al. 1996; Rott et al. 1997; Williams et al. 1998; Rosé et al. 1998; Williams and Butcher 1997; Butcher et al. 1999). Транслоцирующиеся в кишечник лимфоциты, таким образом, представляют собой особую подгруппу лимфоцитов, идентифицируемую как CD45RA-β7высок. CD4+ в анализе методом проточной цитометрии. Способы идентификации этой группы лимфоцитов хорошо известны в данной области, а также подробно раскрыты в примерах настоящего описания.

Используемый в настоящем описании в отношении маркера клеточной поверхности символ «+» указывает на положительную экспрессию маркера клеточной поверхности. Например, CD4+ лимфоциты являются группой лимфоцитов, имеющих CD4, экспрессированный на их клеточной поверхности.

Используемый в настоящем описании в отношении маркера клеточной поверхности символ «-» указывает на отсутствие экспрессии маркера клеточной поверхности. Например, CD45RA- лимфоциты являются группой лимфоцитов, не имеющих CD45RA, экспрессированного на их клеточной поверхности.

Используемый в отношении экспрессии маркера клеточной поверхности, символ «низкая (низк.)» указывает на относительно низкий уровень экспрессии маркера клеточной поверхности на лимфоцитах, в то время как «высокая (высок.)» указывает на относительно высокий уровень экспрессии маркера клеточной поверхности на лимфоцитах. В проточной цитометрии, интенсивностьβ7высок. по меньшей мере в 10-100 раз выше интенсивности β7низк.. Поэтому, как показано в настоящем описании в примерах осуществления изобретения, CD45RA-β7высок. и CD45RA-β7низк. CD4+ лимфоциты находятся в разных участках точечной диаграммы или гистограммы, полученной с помощью проточной цитометрии, на которой на оси Х представлена интенсивность экспрессии CD45RA, на оси Y представлена интенсивность экспрессии бета7.

«Транслоцирующиеся в периферические лимфатические органы лимфоциты» относятся к подгруппе лимфоцитов, отличающихся избирательной транслокацией в периферические лимфатические узлы и ткани, но не транслоцирующиеся в кишечные лимфатические узлы и ткани. В примере варианта осуществления изобретения описанные выше транслоцирующиеся в периферические лимфатические органы лимфоциты представляют собой отдельную группу лимфоцитов, идентифицированных как CD45RA-β7низк. CD4+ клетки методом проточной цитометрии. Способы идентификации этой группы лимфоцитов известны в данной области.

«Желудочно-кишечные воспалительные заболевания» представляют собой группу хронических заболеваний, которые вызывают воспаление и/или образование язв в слизистой оболочке. Эти заболевания включают, например, воспалительное заболевание кишечника (например, болезнь Крона, язвенный колит, неопределяемый колит и инфекционный колит), мукозит (например, мукозит ротовой полости, желудочно-кишечный мукозит, назальный мукозит и проктит), некротический энтероколит и эзофагит.

Термин «воспалительное заболевание кишечника» или «IBD» используется взаимозаменяемо в настоящем описании в отношении заболеваний кишечника, которые вызывают воспаление и/или образование язв, и включает, но без ограничения, болезнь Крона и язвенный колит.

«Болезнь Крона (CD)» или «язвенный колит (UC) представляют собой хронические воспалительные заболевания кишечника неизвестной этиологии. Болезнь Крона, в отличие от язвенного колита, может поражать любые части кишечника. Наиболее заметным признаком болезни Крона является гранулярное, красно-фиолетовое отечное утолщение стенки кишечника. С развитием воспаления данные гранулемы зачастую утрачивают четко обозначенные границы и сливаются с окружающей тканью. Преобладающими клиническими признаками данного заболевания являются диарея и непроходимость кишечника. Как и язвенный колит, болезнь Крона может быть непрерывной или рецидивирующей, легкой или тяжелой, но в отличие от язвенного колита, болезнь Крона не лечится резекцией пораженного участка кишечника. Для большинства пациентов с болезнью Крона в какой-то момент требуется хирургическое вмешательство, но после этого обычно наблюдается рецидив и необходимо постоянное лечение.

Болезнь Крона может поражать любые участки пищеварительного тракта ото рта до ануса, хотя обычно она встречается в подвздошно-ободочном, тонком или толстом-аноректальном кишечнике. Гистологически заболевание проявляется в виде непрерывных гранулем, криптогенных абсцессов, трещин и афтозных язв. Воспалительный инфильтрат представляет собой смесь лимфоцитов (как T-, так и B-клеток), плазматических клеток, макрофагов и нейтрофилов. Наблюдается непропорциональное увеличение IgM- и IgG-секретирующих плазматических клеток, макрофагов и нейтрофилов.

Для лечения умеренно активной болезни Крона толстой кишки используют противовоспалительные лекарственные средства сульфасалазин и 5-аминосалициловую кислоту (5-ASA), которые также назначают для поддержания ремиссии данного заболевания. Метронидазол и ципрофлоксацин имеют аналогичное сульфасалазину действие, и их, в частности, назначают для лечения перианальной формы заболевания. В более тяжелых случаях назначают кортикостероиды для лечения активных обострений, и которые даже способны поддерживать ремиссию. У пациентов, которым необходимо постоянное введение кортикостероидов, также применяют азатиоприн и 6-меркаптопурин. Было высказано предположение, что данные лекарственные средства могут способствовать длительной профилактике. К сожалению, у некоторых пациентов действие наступает с очень большой отсрочкой (до шести месяцев). Для облегчения симптомов у некоторых пациентов также можно использовать противодиарейные средства. Диетотерапия или элементная диета могут улучшать пищевой статус пациентов и вызывать симптоматическое улучшение острого заболевания, однако они не приводят к длительной клинической ремиссии. Для лечения вторичного чрезмерного роста микрофлоры в тонком кишечнике и пиогенных осложнений используют антибиотики.

"Язвенный колит (UC)" поражает толстый кишечник. Течение болезни может быть непрерывным или рецидивирующим, легким или тяжелым. Ранним патологическим изменением является воспалительная инфильтрация с образованием абсцесса в основании либеркюновой крипты. Слияние данных растянутых и разрыхленных криптов способствует отделению вышележащей слизистой оболочки от кровоснабжения, приводя к образованию язвы. Симптомы данного заболевания включают спазмы, боли в нижней части живота, ректальное кровотечение и частые, рыхлые испражнения, состоящие в основном из крови, гноя и слизи с небольшим количеством фекальных частиц. В случае острого, тяжелого или хронического непрерывного язвенного колита может потребоваться тотальная колэктомия.

Клинические признаки UC сильно варьируют, и они могут появляться постепенно или резко и могут включать диарею, тенезм и рецидивирующее ректальное кровотечение. При скоротечном включении всей толстой кишки может развиться токсический мегаколон, угрожающей состоянию жизни. Не связанные с кишечником проявления включают артрит, гнойную гангрену, увеит и нодозную эритему.

Лечение легких случаев UC включает сульфасалазин и родственные салицилат-содержащие лекарственные средства, и тяжелых случаев - кортикостероидные лекарственные средства. Иногда эффективно местное введение салицилатов или кортикостероидов, особенно, если заболевание ограничено дистальным кишечником, что сопровождается более низкими побочными эффектами, чем системное введение. Иногда показана поддерживающая терапия, такая как введение железа и противодиарейных средств. В случаях отсутствия ответа на кортикостероиды или зависимости лечения от кортикостероидов иногда также назначают азатиоприн, 6-меркаптопурин и метотрексат.

«Эффективная дозировка» относится к количеству, эффективному при таких дозировках и в течение таких периодов времени, которые необходимы для достижения желаемого терапевтического или профилактического результата.

В контексте настоящего описания термин «пациент» относится к любому субъекту, лечение которого желательно. В некоторых вариантах осуществления изобретения пациентом в настоящем изобретении является человек.

«Субъектом» в настоящем изобретении, как правило, является человек. В некоторых вариантах осуществления изобретения субъектом является млекопитающее, кроме человека. Примеры млекопитающих, кроме человека, включают лабораторных животных, домашних животных, животных-компаньонов, спортивных животных и сельскохозяйственных животных, например, мышей, кошек, собак и коров. Как правило, субъект подходит для лечения, например, лечения желудочно-кишечного воспалительного заболевания.

В контексте настоящего описания «продолжительность жизни» субъекта относится к остатку жизни субъекта после начала лечения.

Термины «антитело» и «иммуноглобулин» используются взаимозаменяемо в широком смысле и включают моноклональные антитела (например, полноразмерные или интактные моноклональные антитела), поликлональные антитела, поливалентные антитела, полиспецифичные антитела (например, биспецифичные антитела, при условии, что они обладают желаемой биологической активностью) и могут также включать некоторые фрагменты антител (описанные более подробно в настоящем описании). Антитела могут быть антителами человека, гуманизированными антителами или аффиннозрелыми антителами.

«Фрагменты антитела» включают только участок интактного антитела, причем данный участок сохраняет по меньшей мере одну или, как правило, большинство или все функции, ассоциированные с данным участком, если он присутствует в интактном антителе. В одном варианте осуществления изобретения фрагмент антитела содержит антигенсвязывающий участок интактного антитела и, таким образом, сохраняет способность связываться с антигеном. В другом варианте осуществления изобретения фрагмент антитела, например фрагмент, который содержит Fc-область, сохраняет по меньшей мере одну из биологических функций, которые в норме ассоциированы с Fc-областью, если она присутствует в интактном антителе, таких как связывание с FcRn, регуляция времени полужизни антитела, ADCC-функция и/или связывание с комплементом. В одном варианте осуществления изобретения фрагментом антитела является моновалентное антитело, которые имеет время полужизни in vivo, по существу аналогичное интактному антителу. Например, такой фрагмент антитела может содержать антигенсвязывающее плечо, соединенное с последовательностью Fc, способной придавать фрагменту стабильность in vivo.

Термин «моноклональное антитело» в контексте настоящего описания относится к антителу, полученному из популяции по существу гомогенных антител, то есть индивидуальные антитела, содержащиеся в популяции, являются идентичными, за исключением возможных встречающихся в природе мутаций, которые могут присутствовать в незначительных количествах. Моноклональные антитела представляют собой высокоспецифичные антитела, направленные против одного антигенного сайта. Кроме того, в отличие от обычных препаратов поликлональных антител, которые, как правило, содержат разные антитела, направленные против разных детерминант (эпитопов), причем каждое моноклональное антитело направлено против одной детерминанты на антигене.

Моноклональные антитела в контексте настоящего описания специально включают «химерные» антитела, в которых участок тяжелой и/или легкой цепей идентичен или гомологичен соответствующим последовательностям в антителах, полученных из конкретных видов или принадлежащих к конкретному классу или подклассу антител, тогда как остаток цепи(ей) идентичен или гомологичен соответствующим последовательностям в антителах, полученных из другого вида или принадлежащих к другому классу или подклассу антител, а также фрагменты таких антител, при условии, что они демонстрируют желаемую биологическую активность (патент США 4816567; and Morrison et al., 1984, Proc. Natl. Acad. Sci. USA 81:6851-6855).

«Гуманизированные» формы антител животных, кроме человека (например, мышей), представляют собой химерные антитела, которые содержат минимальную последовательность иммуноглобулина животного, кроме человека. Большей частью гуманизированные антитела представляют собой иммуноглобулины человека (реципиентные антитела), в которых остатки гипервариабельной области реципиента замещены остатками гипервариабельной области антитела животного, кроме человека (донорного антитела), такого как мышь, крыса, кролик или примат, которые имеют желаемую специфичность, аффинность и антигенсвязывающую способность. В некоторых случаях остатки каркасной области (FR) иммуноглобулина человека замещены соответствующими остатками антитела животного, кроме человека. Кроме того, гуманизированные антитела могут содержать остатки, не присутствующие в реципиентном антителе или в донорном антителе. Такие модификации осуществляют для дополнительного улучшения свойств антитела. Как правило, гуманизированное антитело будет содержать по существу все из по меньшей мере одного и, как правило, двух вариабельных доменов, в которых все или по существу все гипервариабельные петли соответствуют участкам иммуноглобулина животного, и все или по существу все FR имеют последовательность иммуноглобулина человека. Гуманизированное антитело необязательно также будет содержать по меньшей мере участок константной области (Fc) иммуноглобулина, как правило, иммуноглобулина человека. Дополнительные подробности см. в Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-329 (1988); и Presta, Curr. Op. Struct. Biol. 2:593-596 (1992). См. также следующие обзорные статьи и приведенные в них ссылки: Vaswani and Hamilton, Ann. Allergy, Asthma & Immunol. 1:105-115 (1998); Harris, Biochem. Soc. Transactions 23:1035-1038 (1995); Hurle and Gross, Curr. Op. Biotech. 5:428-433 (1994).

«Антитело человека» представляет собой антитело, содержащее аминокислотную последовательность, соответствующую последовательности антитела, продуцируемого человеком, и/или антитела, полученного по любой из описанных в настоящем описании методик получения антител человека. Такие методики включают скрининг комбинаторных библиотек созданных на основе иммуноглобулинов человека, таких как библиотеки фагового дисплея (см., например, Marks et al., J. Mol. Biol., 222:581-597 (1991) и Hoogenboom et al., Nucl. Acids Res., 19:4133-4137 (1991)); использование клеточных линий миеломы человека и гетеромиеломы (мышь/человек) для продукции моноклональных антител человека (см., например, Kozbor J. Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp.55-93 (Marcel Dekker, Inc., New York, 1987); и Boerner et al., J. Immunol., 147:86 (1991)); и получение моноклональных антител в трансгенных животных (например, мышах), которые способны синтезировать полный репертуар антител человека при отсутствии продукции эндогенных иммуноглобулинов (см., например, Jakobovits et al., Proc. Natl. Acad. Sci USA, 90:2551 (1993); Jakobovits et al., Nature, 362:255 (1993); Bruggermann et al., Year in Immunol., 7:33 (1993)). Это определение антитела человека специально исключает гуманизированное антитело, содержащее антигенсвязывающие остатки из антитела животного, кроме человека.

«Выделенное» антитело представляет собой антитело, которое было идентифицировано и отделено, и/или выделено от/из компонентов его природного окружения. Примесными компонентами его природного окружения являются вещества, которые мешают диагностическому или терапевтическому применению антитела, и могут включать ферменты, гормоны и другие белковые и небелковые растворимые вещества. В некоторых вариантах осуществления изобретения антитело будет очищено (1) до получения чистоты более 95% по массе антитела, которую определяют методом Лоури, часто, до чистоты более 99% по массе, (2) до степени, достаточной для получения по меньшей мере 15 остатков N-концевой или внутренней аминокислотной последовательности с помощью секвенатора с вращающейся чашкой, или (3) до гомогенности по разделению в ДСН-ПААГ в восстанавливающих или невосстанавливающих условиях с окрашиванием Кумасси синим или серебром. Выделенное антитело включает антитело in situ в рекомбинантных клетках, если по меньшей мере один компонент природного окружения антитела не присутствует. Однако обычно выделенное антитело получают путем по меньшей мере одной стадии очистки.

Термин «гипервариабельная область», «HVR» или «HV» в контексте настоящего описания относится к областям вариабельных доменов антитела, последовательности которых являются гипервариабельными и/или образуют определяемые структурой петли. Обычно антитела содержат шесть гипервариабельных участков; три в VH (H1, H2, H3) и три в VL (L1, L2, L3). Используют несколько вариантов определения границ гипервариабельных областей, и они входят в настоящее изобретение. Определяющие комплементарность области (CDR) по Кабату (Kabat) основаны на вариабельности последовательностей и наиболее широко используются (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)). Напротив, в системе Чотии ориентируются по положению структурных петель (Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987)). Гипервариабельные области AbM представляют собой компромисс между CDR по Кабату и структурными петлями по Чотии и используются в компьютерной программе для моделирования антител AbM Oxford Molecular. «Контактные» гипервариабельные области основаны на анализе имеющихся кристаллических структур комплексов. Остатки для каждой из этих HVR указаны ниже.

Гипервариабельные области могут содержать следующие «расширенные гипервариабельные области»: 24-36 или 24-34 (L1), 46-56 или 50-56 (L2) и 89-97 (L3) в VL и 26-35 (H1), 50-65 или 49-65 (H2) и 93-102, 94-102 или 95-102 (H3) в VH. Остатки вариабельных доменов пронумерованы по Kabat et al., выше для каждого из приведенных определений.

Остатки «каркасной области» или «FR» представляют собой другие остатки вариабельного домена, отличные от остатков гипервариабельной области, определенной в настоящем описании.

«Консенсусной каркасной областью антитела человека» является каркасная область, которая имеет наиболее широко встречающийся аминокислотный остаток при отборе каркасных последовательностей VL или VH иммуноглобулина человека. В основном отбор последовательностей VL или VH иммуноглобулина человека осуществляется из подгруппы последовательностей вариабельных доменов. Обычно подгруппа последовательностей представляет собой подгруппу по Kabat et al. В одном варианте осуществления изобретения для VL подгруппой является подгруппа каппа I по Kabat et al. В одном варианте осуществления изобретения для VH подгруппой является подгруппа III по Kabat et al.

«Аффиннозрелое» антитело представляет собой антитело с одним или несколькими изменениями в одной или более его CDR, которые приводят к повышению аффинности антитела к антигену по сравнению с исходным антителом, которое не имеет такого изменения(ий). В некоторых вариантах осуществления изобретения аффинозрелые антитела будут иметь наномолярную или даже пикомолярную аффинность по отношению к антигену-мишени. Аффиннозрелые антитела получают способами, известными в данной области. В статье Marks et al. Bio/Technology 10:779-783 (1992) описано созревание аффинности в результате перетасовки доменов VH и VL. Случайный мутагенез остатков CDR и/или каркасной области описан в: Barbas et al. Proc Nat. Acad. Sci. USA 91:3809-3813 (1994); Schier et al. Gene 169:147-155 (1995); Yelton et al. J. Immunol. 155:1994-2004 (1995); Jackson et al., J. Immunol. 154(7): 3310-9 (1995); and Hawkins et al. J. Mol. Biol. 226:889-896 (1992).

Фраза «по существу аналогичный» или «по существу такой же» в контексте настоящего описания означает достаточно высокую степень сходства между двумя числовыми значениями (обычно одно ассоциировано с антителом по изобретению, и другое ассоциировано с эталонным/сравнительным антителом), так что специалист в данной области может считать различие между двумя значениями небольшим или биологически и/или статистически незначимым в контексте биологического признака, измеряемого указанными значениями (например, значениями Kd). Различие между двумя указанными значениями составляет менее чем примерно 50%, менее чем примерно 40%, менее чем примерно 30%, менее чем примерно 20%, менее чем примерно 10% от значения для эталонного/сравнительного антитела.

«Аффинность связывания» обычно относится к силе суммарных нековалентных взаимодействий между одним сайтом связывания в молекуле (например, антителе) и его партнером по связыванию (например, антигеном). Если указано иное, то в контексте настоящего описания «аффинность связывания» относится к присущей молекулам аффинности связывания, которая отражает взаимодействие в соотношении 1:1 между членами связывающейся пары (например, антителом и антигеном). Аффинность молекулы X к ее партнеру Y, как правило, может быть представлена константой диссоциации (Kd). Аффинность может быть измерена обычными способами, известными в данной области, включая способы, описанные в настоящем описании. Низкоаффинные антитела обычно связывают антиген медленно и имеют тенденцию легко диссоциировать, тогда как высокоаффинные антитела обычно связывают антиген быстрее и имеют тенденцию дольше оставаться связанными. В данной области известны различные способы измерения аффинности связывания, любой из которых можно применять в целях настоящего изобретения. Конкретные иллюстративные варианты описаны ниже.

Термин «вариабельный» относится к тому факту, что некоторые участки вариабельных доменов в значительной степени отличаются по последовательности среди антител и используются в связывании и обеспечении специфичности каждого конкретного антитела по отношению к его конкретному антигену. Однако вариабельность неравномерно распределена на протяжении вариабельных доменов антител. Она сконцентрирована в трех сегментах, называемых гипервариабельными областями, в вариабельных доменах как легкой цепи, так и тяжелой цепи. Более высококонсервативные участки вариабельных доменов называют каркасными областями (FR). Каждый из вариабельных доменов нативных тяжелой и легкой цепей содержит четыре области FR, в основном принимающих β-складчатую конфигурацию, соединенные тремя гипервариабельными областями, которые образуют петли, связывающие и в некоторых случаях составляющие часть β-складчатой структуры. Гипервариабельные области в каждой цепи удерживаются вместе в непосредственной близости с помощью FR и совместно с гипервариабельными областями из другой цепи вносят вклад в образование антигенсвязывающего участка антитела (см. Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)). Константные домены непосредственно не вовлечены в связывание антитела с антигеном, но проявляют различные эффекторные функции, такие как участие антитела в антителозависимой клеточной цитотоксичности (ADCC).

Расщепление антител папаином дает два идентичных антигенсвязывающих фрагмента, называемых «Fab»-фрагментами, каждый из которых имеет один антигенсвязывающий участок, и остаточный «Fc»-фрагмент, название которого отражает его способность легко кристаллизоваться. Обработка пепсином дает F(ab')2-фрагмент, который имеет два антигенсвязывающих участка и еще способен к перекрестному связыванию антигена.

«Fv» представляет собой минимальный фрагмент антитела, который содержит полный сайт узнавания и связывания антигена. Данный участок представляет собой димер, состоящий из одного вариабельного домена тяжелой цепи и одного вариабельного домена легкой цепи, которые плотно прилегают друг к другу, удерживаясь с помощью нековалентных связей. В данной конфигурации три гипервариабельные области каждого вариабельного домена взаимодействуют, определяя антигенсвязывающий участок на поверхности димера VH-VL. Шесть гипервариабельных областей совместно придают антителу антигенсвязывающую специфичность. Однако даже один вариабельный домен (или половина Fv, содержащая только три гипервариабельных области, специфичных к антигену) обладает способностью распознавать и связывать антиген, хотя и с меньшей аффинностью, чем полноразмерный участок связывания.

Fab-фрагмент также содержит константный домен легкой цепи и первый константный домен (CH1) тяжелой цепи. Fab'-фрагменты отличаются от Fab-фрагментов добавлением нескольких остатков на карбоксильном конце CH1-домена тяжелой цепи, включая один или более цистеинов из шарнирной области антитела. Fab'-SH в настоящем описании означает Fab', в котором остаток(ки) цистеина константных доменов несут по меньшей мере одну свободную тиольную группу. F(ab')2-фрагменты антител исходно получали в виде пар Fab'-фрагментов, между которыми находятся цистеины шарнирной области. Также известны другие типы химического связывания фрагментов антител.

«Легкие цепи» антител (иммуноглобулинов) любого вида позвоночных можно отнести к одной из двух четко отличающихся типов, называемых каппа (κ) и лямбда (λ), на основе аминокислотных последовательностей их константных доменов.

В зависимости от аминокислотной последовательности константного домена своих тяжелых цепей антитела (иммуноглобулины) могут быть отнесены к разным «классам». Существует пять основных классов иммуноглобулинов: IgA, IgD, IgE, IgG и IgM, и некоторые из них могут быть дополнительно разделены на подклассы (изотипы), например IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2. Константные домены тяжелой цепи, которые соответствуют разным классам иммуноглобулинов, названы α, δ, ε, γ и µ соответственно. Структуры субъединиц и трехмерные конфигурации разных классов иммуноглобулинов хорошо известны и описаны, в общем, например, в Abbas et al. Cellular and Mol. Immunology, 4th ed. (W. B. Saunders, Co., 2000). Антитело может представлять собой часть более крупной слитой молекулы, образованной ковалентным или нековалентным связыванием антитела с одним или несколькими другими белками или пептидами.

Термины «полноразмерное антитело», «интактное антитело» и «все антитело» используются в настоящем описании взаимозаменяемо и относятся к антителу в его по существу интактной форме, но не к фрагментам антител, описанным ниже. Эти термины, в частности, относятся к антителу с тяжелыми цепями, которые содержат Fc-область.

«Свободное (голое) антитело» для целей настоящего описания представляет собой антитело, неконъюгированное с гетерологичной молекулой, такой как цитотоксическая группа или радиоактивная метка.

Термин Fc-область в настоящем описании используется для описания С-концевой области тяжелой цепи иммуноглобулина, включая нативную последовательность Fc-области и ее варианты. Хотя границы Fc-области тяжелой цепи иммуноглобулина могут варьировать, однако Fc-область тяжелой цепи IgG человека обычно определена отрезком от аминокислотного остатка в положении Cys226 или от Pro230 и до ее карбоксиконца. C-концевой лизин (остаток 447 в соответствии с системой нумерации ЕС) Fc-области может быть удален, например, во время получения или очистки полипептида, или посредством рекомбинантной модификации нуклеиновой кислоты, кодирующей тяжелую цепь антитела. Соответственно, композиция интактных антител может содержать популяции антител, в которых все остатки К447 удалены, популяции антител, в которых не удалены остатки К447, и популяции антител, содержащих смесь антител с удаленным или не удаленным остатком К447.

Если не указано иное, то в настоящем описании нумерация остатков в тяжелой цепи иммуноглобулина соответствует Европейской системе нумерации, описанной в Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (1991), включенной в настоящее описание посредством ссылки. «EU-нумерация по Кабату» относится к нумерации остатков антитела IgG1 человека.

«Функциональная Fc-область» обладает «эффекторной функцией» нативной последовательности Fc-области. Конкретные «эффекторные функции» включают: связывание с C1q; комплементзависимую цитотоксичность (CDC); связывание с Fc-рецепторами; антителозависимую клеточно-опосредуемую цитотоксичность (ADCC); фагоцитоз; отрицательную регуляцию рецепторов клеточной поверхности (например, В-клеточного рецептора; BCR) и т.п. Для обеспечения таких эффекторных функций обычно требуется, чтобы Fc-область была объединена со связывающим доменом (например, с вариабельным доменом антитела), и их можно оценивать, например, с использованием различных методов анализа, раскрытых в настоящем описании.

«Нативная последовательность Fc-области» содержит аминокислотную последовательность, идентичную природной аминокислотной последовательности Fc-области. Нативные последовательности Fc-областей человека включают нативную последовательность Fc-области IgG1 (не А и А-аллотипы) человека; нативную последовательность Fc-области IgG2 человека; нативную последовательность Fc-области IgG3 человека; и нативную последовательность Fc-области IgG4 человека, а также их природные варианты.

«Вариант Fc-области» включает аминокислотную последовательность, которая отличается от нативной последовательности Fc-области вследствие по меньшей мере одной аминокислотной модификации. В некоторых вариантах осуществления изобретения вариант Fc-области может содержать по меньшей мере одну аминокислотную замену по сравнению с нативной последовательностью Fc-области или с Fc-областью исходного антитела, и может содержать, например, примерно от одной до примерно десяти аминокислотных замен, или примерно от одной до примерно пяти аминокислотных замен в нативной последовательности Fc-области или в Fc-области исходного антитела. В некоторых вариантах осуществления изобретения вариант Fc-области будет иметь по меньшей мере примерно 80%-ю гомологию с нативной последовательностью Fc-области и/или с Fc-областью исходного антитела, или по меньшей мере примерно 90%-ю гомологию с ними, или по меньшей мере примерно 95%-ю гомологию с ними.

В зависимости от аминокислотной последовательности константного домена их тяжелых цепей, интактные антитела можно отнести к различным «классам». Существуют пять главных классов интактных антител: IgA, IgD, IgE, IgG и IgM, и несколько из них можно дополнительно разделить на подклассы (изотипы), например, IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2. Константные домены тяжелых цепей, которые соответствуют различным классам иммуноглобулинов, называются α, δ, ε, γ и µ соответственно. Структуры субъединиц и трехмерные конфигурации различных классов иммуноглобулинов хорошо известны.

Термины «антителозависимая клеточно-опосредованная цитотоксичность» и «ADCC» относятся к клеточной реакции, при которой неспецифические цитотоксические клетки, которые экспрессируют Fc-рецепторы (FcR) (например, природные клетки-киллеры (NK), нейтрофилы и макрофаги), распознают связанное на клетке-мишени антитело и впоследствии вызывают лизис клетки-мишени. Основные клетки, опосредующие ADCC, NK-клетки, экспрессируют только FcyRIII, тогда как моноциты экспрессируют FcyRI, FcyRII и FcyRIII. Экспрессия FcR на гематопоэтических клетках описана в таблице 3 на стр. 464 Ravetch and Kinet, в Annu. Rev. Immunol 9:457-92 (1991). Для оценки ADCC-активности исследуемой молекулы можно провести тест на ADCC in vitro, такой как тест, описанный в патентах США 5500362 или 5821337. Эффекторные клетки, которые могут использоваться в таких анализах, включают мононуклеарные клетки периферической крови (PBMC) и природные клетки-киллеры (NK). В альтернативном или дополнительном варианте осуществления ADCC-активность исследуемой молекулы можно оценить in vivo, например, на животной модели, как описано в статье Clynes et al., PNAS (USA) 95:652-656 (1998).

«Эффекторными клетками человека» являются лейкоциты, которые экспрессируют один или более FcR и осуществляют эффекторные функции. В некоторых вариантах осуществления изобретения клетки экспрессируют по меньшей мере FcyRIII и осуществляют ADCC-эффекторную функцию. Примеры лейкоцитов человека, которые опосредуют ADCC, включают мононуклеарные клетки периферической крови (PBMC), природные клетки-киллеры (NK), моноциты, цитотоксические T-клетки и нейтрофилы. Эффекторные клетки можно выделить из их природного источника, например из крови или PBMC, как описано в настоящем описании.

Термины «Fc-рецептор» или «FcR» используют для описания рецептора, который связывается с Fc-областью антитела. В некоторых вариантах осуществления изобретения FcR является FcR человека с нативной последовательностью. Кроме того, FcR является FcR, который связывается с IgG-антителом (гамма-рецептор) и включает рецепторы подклассов FcyRI, FcyRII и FcyRIII, включая аллельные варианты и альтернативно сплайсируемые формы указанных рецепторов. Рецепторы FcyRII включают FcyRIIA («активирующий рецептор») и FcyRIIB («ингибирующий рецептор»), которые имеют сходные аминокислотные последовательности, отличающиеся главным образом своими цитоплазматическими доменами. Активирующий рецептор FcyRIIA содержит в своем цитоплазматическом домене тирозиновый мотив активации иммунорецептора (ITAM). Ингибирующий рецептор FcyRIIB содержит в своем цитоплазматическом домене тирозиновый мотив ингибирования иммунорецептора (ITIM) (обзор см. в Daëron, Annu. Rev. Immunol. 15:203-234 (1997)). Обзор, посвященный FcR, представлен Ravetch and Kinet, в Annu. Rev. Immunol. 9:457-92 (1991); Capel et al., Immunomethods 4:25-34 (1994); и de Haas et al., J. Lab. Clin. Med. 126:330-41 (1995). Другие FcR, включая FcR, идентифицируемые в будущем, включены в настоящем описании в термин «FcR». Термин также включает неонатальный рецептор, FcRn, который отвечает за перенос материнских IgG в плод (Guyer et al., J. Immunol. 117:587 (1976) и Kim et al., J. Immunol. 24:249 (1994)) и регулирует гомеостаз иммуноглобулинов. Антитела с улучшенным связыванием с неонатальным Fc-рецепторм (FcRn) и увеличенным временем полужизни описаны в WO 00/42072 (Presta, L.) и US 2005/0014934A1 (Hinton et al.). Эти антитела содержат Fc-область с одной или несколькими заменами в ней, которые улучшают связывание Fc-области с FcRn. Например, Fc-область может иметь замены по одному или нескольким положениям из 238, 250, 256, 265, 272, 286, 303, 305, 307, 311, 312, 314, 317, 340, 356, 360, 362, 376, 378, 380, 382, 413, 424, 428 или 434 (Eu-нумерация остатков). В некоторых вариантах осуществления изобретения содержащий Fc-область вариант антитела с улучшенным связыванием с FcRn содержит аминокислотные замены одного, двух или трех положений 307, 380 и 434 в своей Fc-области (Eu-нумерация остатков).

«Одноцепочечные Fv» или «scFv» фрагменты антител содержат VH- и VL-домены антитела, причем эти домены присутствуют в одной полипептидной цепи. В некоторых вариантах осуществления изобретения Fv-полипептид дополнительно содержит полипептидный линкер между VH- и VL-доменами, который обеспечивает возможность образования требуемой структуры scFv для связывания антигена. Обзор scFv см. Plückthun, в The Pharmacology of Monoclonal Antibodies, vol.113, Rosenburg and Moore eds., Springer-Verlag, New York, pp.269-315 (1994). scFv-фрагменты антител к HER2 описаны в WO 93/16185; патенте США 5571894; и патенте США 5587458.

Термин «диантитела» относится к небольшим фрагментам антител с двумя антигенсвязывающими участками, причем такие фрагменты содержат вариабельный домен тяжелой цепи (VH), связанный с вариабельным доменом легкой цепи (VL) в одной полипептидной цепи (VH-VL). В случае использования линкера, который является слишком коротким, чтобы обеспечить возможность образования пар между двумя доменами в одной цепи, домены вынуждены образовывать пары с комплементарными доменами другой цепи и образовывать два антигенсвязывающих участка. Диантитела более полно описаны, например, в EP 404097, WO 93/11161 и в Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993).

«Аффиннозрелое» антитело представляет собой антитело с одним или более изменениями в одной или нескольких его CDR, которые приводят к повышению аффинности антитела к антигену по сравнению с исходным антителом, которое не имеет такого изменения(ий). В некоторых вариантах осуществления изобретения аффиннозрелые антитела будут иметь наномолярную или даже пикомолярную аффинность по отношению к антигену-мишени. Аффиннозрелые антитела получают способами, известными в данной области. В статье Marks et al. Bio/Technology 10:779-783 (1992) описано созревание аффинности в результате перетасовки VH- и VL-доменов. Случайный мутагенез остатков CDR и/или каркасной области описан в: Barbas et al. Proc Nat. Acad. Sci. USA 91:3809-3813 (1994); Schier et al. Gene 169:147-155 (1995); Yelton et al. J. Immunol. 155:1994-2004 (1995); Jackson et al., J. Immunol. 154(7):3310-9 (1995); and Hawkins et al., J. Mol. Biol. 226:889-896 (1992).

В контексте настоящего описания «вариант аминокислотной последовательности» антитела представляет собой антитело с аминокислотной последовательностью, которая отличается от антитела основного типа. В некоторых вариантах осуществления изобретения варианты аминокислотных последовательностей будут обладать по меньшей мере примерно 70%-й гомологией с антителом основного типа, или они будут по меньшей мере примерно на 80%, или по меньшей мере примерно на 90% гомологичны антителу основного типа. Варианты аминокислотных последовательностей включают замены, делеции и/или вставки в определенных положениях аминокислотной последовательности антитела основного типа или рядом с ней. В контексте настоящего описания примеры вариантов аминокислотных последовательностей включают кислый вариант (например, дезамидированный вариант антитела), основный вариант, антитело с аминоконцевым удлинением лидера (например, VHS-) на одной или двух его легких цепях, антитело с C-концевым остатком лизина на одной или двух его тяжелых цепях и т.д., и включают сочетания вариантов аминокислотных последовательностей тяжелых и/или легких цепей. Представляющий особый интерес в контексте настоящего описания вариант антитела является антителом, содержащим аминоконцевое удлинение лидера на одной или двух его легких цепях, необязательно дополнительно содержащим другую аминокислотную последовательность и/или обладающим отличиями в гликозилировании относительно антитела основного типа.

В настоящем описании «вариант по гликозилированию» антитела представляет собой антитело с одной или несколькими присоединенными к нему группами углеводов, которые отличаются от одной или нескольких групп углеводов, присоединенных к антителу основного типа. В контексте настоящего описания примеры вариантов по гликозилированию включают антитело с олигосахаридной структурой G1 или G2 вместо олигосахаридной структуры G0, присоединенной к его Fc-области, антитело с одной или несколькими углеводными группами, присоединенными к одной или двум его легким цепям, антитело, не содержащее углевода, присоединенного к одной или двум его тяжелым цепям, и т.д., и комбинации вариантов гликозилирования. Если антитело содержит Fc-область, то олигосахаридная структура может быть присоединена к одной или двум тяжелым цепям антитела, например, остатку 299 (298, по Eu-нумерации остатков).

Термин «цитотоксический агент», используемый в настоящем описании, относится к веществу, которое ингибирует функционирование или препятствует функционированию клеток и/или приводит к разрушению клеток. Предполагается, что термин включает радиоактивные изотопы (например, At211, I131, I125, Y90, Re186, Re188, Sm153, Bi212, P32 и радиоактивные изотопы Lu), химиотерапевтические средства и токсины, такие как низкомолекулярные токсины или ферментативно-активные токсины бактериального, грибкового, растительного или животного происхождения, включая их фрагменты и/или варианты.

Термин «цитокин» является общим термином, относящимся к белкам, которые высвобождаются одной клеточной популяцией, и которые действуют на другие клетки в качестве межклеточных медиаторов. Примерами таких цитокинов являются лимфокины, монокины и стандартные полипептидные гормоны. Термин «цитокины» также включает гормоны роста, такие как гормон роста человека, N-метионильный гормон роста человека и бычий гормон роста; паратиреоидный гормон; тироксин; инсулин; проинсулин; релаксин; прорелаксин; гликопротеиновые гормоны, такие как фолликулостимулирующий гормон (FSH), тиреоидстимулирующий гормон (TSH) и лютеинизирующий гормон (LH); фактор роста гепатоцитов, фактор роста фибробластов; пролактин; плацентарный лактоген; фактор некроза опухоли-α и -β; мюллеровский ингибирующий фактор; пептид, ассоциированный с мышиным гонадотропином; ингибин; активин; васкулярный эндотелиальный фактор роста; интегрин; тромбопоэтин (ТРО); факторы роста нервных тканей, такие как NGF-β; тромбоцитарный фактор роста; трансформирующие факторы роста (TGF), такие как TGF-α и TGF-β; инсулиноподобный фактор роста-I и -II; эритропоэтин (EPO); факторы, индуцирующие остеогенез; интерфероны, такие как интерферон-α, -β и -γ; колониестимулирующие факторы (CSF), такие как макрофагальный CSF (M-CSF); гранулоцитарный-макрофагальный CSF (GM-CSF) и гранулоцитарный CSF (G-CSF); интерлейкины (IL), такие как IL-1, IL-1α, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12; фактор некроза опухоли, такой как TNF-α или TNF-β; и другие полипептидные факторы, включая LIF и лиганд kit (KL). В контексте настоящего описания термин цитокин включает белки из природных источников или из рекомбинантной клеточной культуры, и биологически активные эквиваленты цитокинов с нативной последовательностью.

Термин «иммуносупрессор», используемый в настоящем описании, относится к веществам, которые подавляют или блокируют иммунную систему субъекта, получающего лечение по настоящему изобретению. Этот термин будет включать вещества, которые подавляют продукцию цитокинов, снижают или подавляют экспрессию аутоантигенов или блокируют антигены MHC. Примеры таких средств включают 2-амино-6-арил-5-замещенные пиримидины (см. патент США 4665077); нестероидные противовоспалительные лекарственные средства (NSAID); ганцикловир, такролимус, глюкокортикоиды, такие как кортизол или альдостерон, противовоспалительные средства, такие как ингибиторы циклооксигеназы, ингибиторы 5-липоксигеназы или антагонист рецептора лейкотриенов; антагонисты пуринов, такие как азатиоприн или микофенолят мофетил (MMF); алкилирующие средства, такие как циклофосфамид; бромокриптин; даназол; дапсон; глутаральдегид (который блокирует MHC антигены, как описано в патенте США 4120649); антиидиотипические антитела для MHC антигенов и MHC фрагментов; циклоспорин; 6-меркаптопурин; стероиды, такие как кортикостероиды или глюкокортикостероиды или аналоги глюкокортикоидов, например, преднизон, метилпреднизолон, включая SOLU-MEDROL™, метилпреднизолон-натрия сукцинат и дексаметазон; ингибиторы дигидрофолатредуктазы, такие как метотрексат (перорально или подкожно); противомалярийные средства, такие как хлорохин и гидроксихлорохин; сульфасалазин; лефлуномид; антитела к цитокинами или рецепторам цитокинов, включая антитела к интерферону альфа, бета или гамма, антитела к фактору некроза опухоли(TNF)-альфа (инфликсимаб (REMICADE™) или адалимумаб), иммуноадгезин к TNF-альфа (этанерсепт), антитела к TNF-бета, антитела к интерлейкину-2 (IL-2) и антитела к рецептору IL-2, и антитела и антагонисты к рецептору IL-6; антитела к LFA-1, включая антитела к CD11a и к CD18; антитела к L3T4; гетерологичный антилимфоцитарный иммуноглобулин; антитела к общим маркерам Т-клеток, антитела к CD3 или к CD4/CD4a; растворимый пептид, содержащий домен связывания с LFA-3 (WO 1990/08187, опубликовано 26 июля 1990); стрептокиназу; трансформирующий фактор роста-бета (TGF-бета); стрептодомазу; РНК или ДНК хозяйского организма; FK506; RS-61443; хлорамбуцил; дезоксиспергуалин; рапамицин; T-клеточный рецептор (Cohen et al., патент США 5114721); фрагменты T-клеточного рецептора (Offner et al., Science, 251:430-432 (1991); WO 1990/11294; Ianeway, Nature, 341:482 (1989); и WO 1991/01 133); антагонисты BAFF, такие как антитела или иммуноадгезины к BAFF или BR3 и антагонисты zTNF4 (обзор см. в Mackay and Mackay, Trends Immunol, 23:113-5 (2002) и см. также определение ниже); биологические агенты, которые препятствуют прохождению сигналов от Т-хелперов, такие как антитела к рецептору CD40 или CD40-лиганду (CD 154), включая антитела, блокирующие взаимодействие CD40-CD40 (например, Durie et al., Science, 261:1328-30 (1993); Mohan et al., J. Immunol, 154:1470-80 (1995)) и CTLA4-Ig (Finck et al., Science, 265:1225-7 (1994)); и антитела к T-клеточному рецептору (EP 340109), такие как T10B9.

Термин «улучшает» или «улучшение» в контексте настоящего изобретения относится к снижению, уменьшению или исчезновению состояния, заболевания или фенотипа, включая отклонение от нормы или симптом.

«Симптомом» заболевания или расстройства (например, воспалительного заболевания кишечника, язвенного колита или болезни Крона) является любой симптом заболевания или отклонение от нормы в структуре, функции или ощущениях, испытываемых субъектом, и указывающих на заболевание.

Выражение «терапевтически эффективное количество» относится к количество, эффективному для предупреждения, улучшения или лечения заболевания или расстройства (например, воспалительного заболевания кишечника, например, язвенного колита или болезни Крона). Например, «терапевтически эффективное количество» антитела относится к количеству антитела, эффективному для предупреждения, улучшения или лечения указанного заболевания или расстройства. Аналогичным образом, «терапевтически эффективное количество» комбинации антитела и второго соединения относится к такому количеству антитела и количеству второго соединения, которые совместно эффективны для предупреждения, улучшения или лечения указанного заболевания или расстройства.

Следует понимать, что терминология «комбинация» двух соединений не означает, что два соединения необходимо вводить смешанными друг с другом. Таким образом, лечение такой комбинацией или ее применение охватывает смесь соединений или отдельное введение соединений, и включает введение в один день или в разные дни. Таким образом, термин «комбинация» означает, что для лечения используются два или более соединений, либо индивидуально или в смеси друг с другом. Если антитело и второе соединение, например, вводятся в комбинации субъекту, то антитело присутствует в организме субъекта тогда, когда второе соединение также присутствует в организме субъекта, вне зависимости от того, вводятся ли субъекту антитело и второе соединение индивидуально или в смеси. В некоторых вариантах осуществления изобретения другое соединение вводят до введения антитела. В некоторых вариантах осуществления изобретения другое соединение вводят после антитела.

Для целей настоящего изобретения «фактор некроза опухолей альфа (TNF-альфа)» относится к молекуле TNF-альфа, включающей аминокислотную последовательность, описанную Pennica et al., в Nature, 312:721 (1984) или Aggarwal et al., JBC, 260:2345 (1985).

«Ингибитор TNF-альфа» в контексте настоящего изобретения представляет собой агент, который ингибирует, до некоторой степени, биологическую функцию TNF-альфа, как правило, благодаря связыванию TNF-альфа и нейтрализации его активности. Примерами ингибиторов TNF, специально предусмотренных в настоящем изобретении, являются этанерцепт (ENBREL®), инфликсимаб (REMICADE®) и адалимумаб (HUMIRA®), голимумаб (SIMPONITM) и цертолизумаб пегол (CIMZIA®).

«Кортикостероид» относится к любому одному из нескольких синтетических или природных веществ с общей химической структурой стероидов, которые имитируют или увеличивают эффекты природных кортикостероидов. Примеры синтетических кортикостероидов включают преднизон, преднизолон (включая метилпреднизолон), дексаметазон триамцинолон и бетаметазон.

«Антагонист» относится к молекуле, которая способна нейтрализовать, блокировать, ингибировать, аннулировать, снижать или препятствовать активности конкретного или указанного белка, включая его связывание с одним или более рецепторами в случае лиганда или связывание с одним или более лигандами в случае рецептора. Антагонисты включают антитела и их антигенсвязывающие фрагменты, белки, пептиды, гликопротеины, гликопептиды, гликолипиды, полисахариды, олигосахариды, нуклеиновые кислоты, биоорганические молекулы, пептидомиметики, фармакологические средства и их метаболиты, последовательности транскрипционного и трансляционного контроля и т.п. Антагонисты также включают низкомолекулярные ингибиторы белка и слитые белки, рецепторные молекулы и производные, которые избирательно связываются с белком, таким образом, препятствуя его связыванию с мишенью, варианты антагониста белка, антисмысловые молекулы к данному белку, РНК-аптамеры и рибозимы, направленные к белку.

«Устройство для самоинъекций» относится к медицинскому устройству для самостоятельного введения лекарственного средства, например, пациентом или домашним персоналом. Устройства для самоинъекций включает устройства для автоматических инъекций и другие устройства, разработанные для самостоятельного введения лекарственных средств.

В настоящем описании описан или охарактеризован ряд дополнительных терминов.

КОМПОЗИЦИИ И СПОСОБЫ

A. Антагонисты интегрина бета7

Изобретение относится к способам лечения воспалительного заболевания кишечника у субъекта, например, человека, путем введения антагонистов интегрина-бета7. Примеры потенциальных антагонистов включают олигонуклеотид, который связывается с гибридами иммуноглобулина и интегрина бета7, и, в особенности, антитела, включая, но без ограничения, поли- и моноклональные антитела и фрагменты антител, одноцепочечные антитела, антиидиотипические антитела, химерные или гуманизированные версии таких антител или их фрагменты, а также антитела человека и их фрагменты. Альтернативно, потенциальный антагонист может представлять собой близкородственный белок, например мутантную форму интегрина бета7, которая распознает лиганд, но не дает какого-либо эффекта, следовательно, конкурентно ингибирует действие интегрина бета7.

Другим потенциальным антагонистом интегрина бета7 является антисмысловая конструкция РНК или ДНК, изготовленная с применением антисмысловой технологии, когда, например, антисмысловая молекула РНК или ДНК действует, напрямую блокируя трансляцию мРНК за счет гибридизации с целевой мРНК, то есть, предупреждая трансляцию в белок. Антисмысловую технологию можно использовать для управления экспрессией генов через образование тройной спирали с антисмысловой ДНК или РНК, причем оба указанных способа основаны на связывании полинуклеотида с ДНК или РНК. Например, 5'-кодирующий участок полинуклеотидной последовательности, который кодирует указанный интегрин бета7 по настоящему изобретению, используют для конструирования антисмыслового РНК-олигонуклеотида длиной приблизительно от 10 до 40 пар оснований. ДНК-олигонуклеотид конструируют таким образом, чтобы он был комплементарен участку гена, вовлеченному в транскрипцию (тройная спираль - см. Lee et al., Nucl. Acids Res., 6:3073 (1979), Cooney et al., Science, 241:456 (1988), Dervan et al., Science, 251:1360 (1991)), таким образом, предупреждая транскрипцию и экспрессию интегрина бета7. Антисмысловой РНК-олигонуклеотид гибридизуется с мРНК in vivo и блокирует трансляцию молекулы мРНК в интегрин бета7 (антисмысловая РНК - Okano, Neurochem., 56:560 (1991), Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton, FL, 1988). Описанные выше олигонуклеотиды можно также доставлять в клетки таким образом, чтобы антисмысловая РНК или ДНК могла экспрессироваться in vivo, подавляя выработку интегрина бета7. При использовании антисмысловой ДНК, как правило, используют олигодезоксирибонуклеотиды из сайта инициации трансляции, например, находящиеся примерно между положениями -10 и +10 в нуклеотидной последовательности целевого гена.

Другие потенциальные антагонисты включают низкомолекулярные соединения, которые связываются с активным сайтом, лигандом или сайтом связывания связывающей молекулы, посредством чего они блокируют нормальную биологическую активность интегрина бета7. Примеры низкомолекулярных соединений включают, но, не ограничиваясь ими, низкомолекулярные пептиды или пептидоподобные молекулы, как правило, растворимые пептиды, а также синтетические органические и неорганические непептидные соединения.

Рибозимы представляют собой обладающие ферментативной активностью молекулы РНК, способные катализировать специфическое расщепление РНК. Рибозимы действуют через специфичную по последовательности гибридизацию с комплементарной целевой РНК, сопровождающуюся эндонуклеолитическим расщеплением. Специфичные сайты рибозимного расщепления в потенциально целевой РНК можно идентифицировать при помощи известных методик. Более подробное описание см., например, в Rossi, Current Biology, 4:469-471 (1994) и в публикации PCT № WO 97/33551 (опубликованной 18 сентября 1997 г.).

Молекулы нуклеиновых кислот в форме тройной спирали, используемые для подавления транскрипции, должны быть одноцепочечными и состоять из дезоксинуклеотидов. Состав оснований в этих олигонуклеотидах подбирают таким образом, чтобы он способствовал формированию тройной спирали по правилам спаривания оснований Хугстина, которые в общем смысле требуют продолжительных последовательностей из пуринов или пиримидинов на одной из цепей дуплекса. Для получения дополнительных сведений, см., например, публикацию PCT WO № 97/33551. Эти низкомолекулярные соединения можно идентифицировать с помощью одного или более скрининговых методов анализа, обсуждавшихся в настоящем описании выше, и/или любых других скрининговых методик, хорошо известных опытному специалисту в данной области.

Скрининговые методы анализа для антагонистов разработаны для идентификации соединений, которые связываются или образуют комплексы с интегрином бета7, кодируемым генами, указанными в настоящем описании, или иным образом препятствуют взаимодействию кодируемых полипептидов с другими клеточными белками. Такие скрининговые методы анализа включают методы анализа, подходящие для высокопроизводительного скрининга химических библиотек, делая их особенно подходящими для идентификации потенциальных низкомолекулярных лекарственных соединений.

Анализы могут проводиться в различных форматах, включая методы анализа белок-бекового связывания, биохимические скрининговые методы анализа, иммунологические методы анализа и клеточные методы анализа, хорошо описанные в данной области.

В. Антитела к интегрину бета7

В одном варианте осуществления изобретения антагонистами интегрина бета7 являются антитела к интегрину бета7. Примеры антител включают поликлональные, моноклональные, гуманизированные, антитела человека, биспецифичные и гетероконьюгатные антитела и т.д., описанные ниже.

1. Поликлональные антитела

Поликлональные антитела получают в животных в результате множественных подкожных (SC) или внутрибрюшинных (IP) инъекций соответствующего антигена и адъюванта. Может оказаться полезным конъюгировать нужный антиген с белком, обладающим иммуногенными свойствами в иммунизируемом биологическом виде, например, с гемоцианином морского блюдечка, сывороточным альбумином, бычьим тиреоглобулином или соевым ингибитором трипсина, с помощью бифункционального или дериватизирующего агента, например малеимидобензоил-сульфосукцинимидного эфира (конъюгация через цистеиновые остатки), N-гидроксисукцинимида (через лизиновые остатки), глутарового альдегида, янтарного ангидрида, SOCl2 или R1N=C=NR, где R и R1 представляют собой разные алкильные группы.

Животных иммунизируют антигеном, иммуногенными конъюгатами или их производными, комбинируя, например, 100 мкг или 5 мкг белка или конъюгата (для кроликов или мышей соответственно) с 3 объемами полного адъюванта Фрейнда и вводя раствор внутрикожной инъекцией в нескольких местах. Месяц спустя животным проводят бустерные подкожные инъекции в нескольких местах, вводя им от 1/5 до 1/10 первоначального количества пептида или конъюгата в полном адъюванте Фрейнда. Через 7-14 дней у животных отбирают кровь для проведения анализа сыворотки на титр антител. Бустерные инъекции проводят до достижения титром антител плато. В некоторых вариантах осуществления изобретения животным проводят бустерные инъекции конъюгатом того же антигена, но конъюгированным с другим белком или через другой сшивающий агент. Конъюгаты также можно получить в рекомбинантной клеточной культуре в виде слитых белков. Кроме того, для усиления иммунного ответа можно использовать агрегирующие агенты, такие как квасцы.

2. Моноклональные антитела

Моноклональные антитела можно получить, используя гибридомный способ, впервые описанный Kohler et al., Nature, 256:495 (1975), или их можно получить способами рекомбинантных ДНК (см., например, патент США 4816567).

В гибридомном способе мышь или другое подходящее животное-хозяина, например хомяка, иммунизируют, как описано выше, для извлечения лимфоцитов, которые вырабатывают или способны вырабатывать антитела, специфично связывающиеся с тем белком, который применяют для иммунизации. Альтернативно, возможна иммунизация лимфоцитов in vitro. После иммунизации лимфоциты выделяют и затем сливают с клетками миеломной линии, используя подходящий сливающий агент, например, полиэтиленгликоль, для образования гибридомных клеток (Goding, Monoclonal Antibodies: Principles and Practice, pp.59-103 (Academic Press, 1986)).

Полученные таким способом клетки гибридомы высевают на подходящую культуральную среду и выращивают, причем такая среда в предпочтительном варианте содержит одно или более веществ, которые подавляют рост или выживание неслитых родительских клеток миеломы (также называемых партнером слияния). Например, если в родительских клетках миеломы отсутствует фермент гипоксантингуанинфосфорибозилтрансфераза (HGPRT или HPRT), селективная культуральная среда для гибридомы, как правило, будет включать гипоксантин, аминоптерин и тимидин (среда HAT), то есть вещества, предотвращающие рост HGPRT-дефицитных клеток.

В некоторых вариантах осуществления изобретения миеломными клетками - партнерами слияния - являются такие клетки, которые эффективно сливаются, поддерживают на высоком уровне стабильную выработку антитела выбранными клетками-продуцентами антитела и чувствительны к селективной среде, которая направляет действие отбора против неслившихся родительских клеток. В некоторых вариантах осуществления изобретения линиями клеток миеломы являются линии мышиной миеломы, например, полученные из мышиных опухолей MOPC-21 и MPC-11, доступные из Центра распределения клеток Института Солка, Сан-Диего, штат Калифорния, США, а также клетки опухолевой линии SP-2 и их производные, например, клетки X63-Ag8-653, доступные из Американской коллекции типовых культур, Манассас, штат Вирджиния, США. Клеточные линии миеломы человека и гетеромиеломы мышь/человек также были описаны для получения моноклональных антител человека (Kozbor, J. Immunol., 133:3001 (1984); и Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp.51-63 (Marcel Dekker, Inc., New York, 1987)).

Культуральную среду, в которой выращивают клетки миеломы, анализируют на выработку моноклональных антител к антигену. В некоторых вариантах осуществления изобретения специфичность связывания моноклональных антител, вырабатываемых клетками гибридомы, определяли иммунопреципитацией или анализом связывания in vitro, таким как, радиоиммуноанализ (RIA) или твердофазный иммуноферментный анализ (ELISA).

Аффинность связывания для моноклонального антитела можно определить, например, анализом Скэтчарда, описанным в Munson et al., Anal. Biochem., 107:220 (1980). После того как клетки гибридомы, продуцирующие антитела с желаемой специфичностью, аффинностью и/или активностью, будут идентифицированы, клоны можно субклонировать, применяя методику серийных разведений и выращивание стандартными способами (Goding, Monoclonal Antibodies: Principles and Practice, pp.59-103 (Academic Press, 1986)). Подходящие культуральные среды для этой цели включают, например, среды DMEM или RPMI-1640. В дополнение, клетки гибридомы можно выращивать in vivo как асцитные опухоли у животных, например путем внутрибрюшинной инъекции клеток в мышь. Моноклональные антитела, секретируемые субклонами, соответствующим образом отделяют от культуральной среды, асцитной жидкости или сыворотки, применяя традиционные методики очистки антител, такие как аффинная хроматография (например, с использованием белка A- или белка G-сефарозы), ионообменная хроматография, гидроксиапатитная хроматография, электрофорез в геле, диализ и т.д.

ДНК, кодирующую моноклональные антитела, достаточно просто можно выделить и секвенировать, используя традиционные методики (например, используя олигонуклеотидные зонды, которые способны специфично связываться с генами, кодирующими тяжелые и легкие цепи мышиных антител). Источником такой ДНК служат клетки гибридомы. После выделения ДНК ее можно поместить в экспрессионные векторы, которыми затем трансфицируют клетки-хозяева, например клетки E. coli, клетки COS обезьяны, клетки яичника китайского хомяка (CHO) или клетки миеломы, которые иным образом неспособны продуцировать антитело, чтобы инициировать синтез моноклональных антител в рекомбинантных клетках-хозяевах. Обзорные статьи по рекомбинантной экспрессии ДНК, кодирующей антитело, в бактериях включают Skerra et al., Curr. Opinion in Immunol., 5:256-262 (1993) и Plückthun, Immunol. Revs. 130:151-188 (1992).

В дополнительном варианте осуществления изобретения моноклональные антитела или фрагменты антител можно выделять из фаговых библиотек антител, созданных с использованием методик, описанных McCafferty et al., в Nature, 348:552-554 (1990). Clackson et al., Nature, 352:624-628 (1991) и Marks et al., J. Mol. Biol., 222:581-597 (1991) описывают выделение мышиных антител и антител человека соответственно, с использованием фаговых библиотек. Более поздние публикации описывают получение высокоаффинных (в наномолярном диапазоне) антител человека перетасовкой цепей (Marks et al., Bio/Technology, 10:779-783 (1992)), а также комбинаторную инфекцию и рекомбинацию in vivo, как стратегии конструирования очень крупных фаговых библиотек (Waterhouse et al., Nuc. Acids. Res. 21:2265-2266 (1993)). Таким образом, эти методики являются реальными альтернативами традиционным гибридомным методикам получения и выделения моноклональных антител.

ДНК, кодирующую антитело, можно модифицировать для получения химерных или гибридных полипептидов антител, например, замещая последовательности константных доменов тяжелой цепи и легкой цепи антител человека (CH и CL) гомологичными мышиными последовательностями (патент США 4816567 и Morrison et al., Proc. Natl Acad. Sci. USA, 81:6851 (1984)), или сливая кодирующую последовательность иммуноглобулина со всей кодирующей последовательностью или с частью кодирующей последовательности неиммуноглобулинового полипептида (гетерологичного полипептида). Неиммуноглобулиновыми полипептидными последовательностями можно заменять константные домены антитела или вариабельные домены антигенсвязывающего сайта антитела для того, чтобы создать химерное бивалентное антитело, в котором первый антигенсвязывающий сайт будет специфичен к одному антигену, и второй антигенсвязывающий сайт будет специфичен к другому антигену.

Примерами антител к интегрину бета7 являются Fib504, Fib 21, 22, 27, 30 (Tidswell, M. J Immunol. 1997 Aug 1; 159(3):1497-505) или их гуманизированные производные. Гуманизированные антитела Fib504 подробно описаны в публикации патентной заявки США № 20060093601 (опубликована, как патент США 7528236), полное содержание которой включено в настоящее описание посредством ссылки (также см. описание ниже).

3. Антитела человека и гуманизированные антитела

Анти-интегрин бета7 антитела по изобретению могут дополнительно включать гуманизированные антитела или антитела человека. Гуманизированные формы антител животных, например мышиных антител, представляют собой химерные иммуноглобулины, цепи иммуноглобулинов или их фрагменты (такие как Fv, Fab, Fab', F(ab')2 или другие антигенсвязывающие последовательности антител), которые содержат минимальное количество последовательностей из иммуноглобулина животного. Гуманизированные антитела включают иммуноглобулины человека (антитело-реципиент), в которых аминокислотные остатки определяющей комплементарность области (CDR) реципиента замещены аминокислотными остатками CDR другого биологического вида, кроме человека (антитело-донор), например мыши, крысы или кролика, придающими последовательности желаемую специфичность, аффинность и емкость. В некоторых случаях, аминокислотные остатки каркасной области Fv иммуноглобулина человека замещены соответствующими остатками из антитела другого биологического вида. Гуманизированные антитела могут также содержать остатки, которых нет ни в реципиентном антителе, ни в импортированных последовательностях CDR или каркасной области. Как правило, гуманизированное антитело содержит по существу все или по меньшей мере один и, как правило, два вариабельных домена, в которых все или по существу все соответствуют CDR в иммуноглобулине животного, кроме человека, и все или по существу все FR соответствуют консенсусной последовательности иммуноглобулина человека. Гуманизированное антитело оптимально также содержит по меньшей мере участок константной области (Fc) иммуноглобулина, как правило, иммуноглобулина человека [Jones et al., Nature, 321:522-525 (1986), Riechmann et al., Nature, 332:323-329 (1988), и Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].

Способы получения гуманизированных антител животных, кроме человека, хорошо известны в данной области. Обычно гуманизированное антитело имеет один или более аминокислотных остатков, которые были введены в него из иммуноглобулина животного, кроме человека. Эти аминокислотные остатки из иммуноглобулина животного часто называют «импортными» остатками, которые, как правило, взяты из «импортного» вариабельного домена. Гуманизацию по существу можно провести по способу, описанному Winter с сотрудниками [Jones et al., Nature, 321:522-525 (1986), Riechmann et al., Nature, 332:323-327 (1988), Verhoeyen et al., Science, 239:1534-1536 (1988)], путем замены последовательностями CDR грызунов соответствующих последовательностей антитела человека. Соответственно, такие «гуманизированные» антитела представляют собой химерные антитела (патент США 4816567), в которых по существу менее чем полноразмерный вариабельный домен антитела человека замещен соответствующей последовательностью антитела животного (кроме человека). На практике, гуманизированные антитела, как правило, представляют собой антитела человека, в которых некоторые остатки в CDR и, возможно, некоторые остатки в FR замещены остатками из аналогичных положений в антителах грызунов. Выбор вариабельных доменов человека как из легких, так и из тяжелых цепей, которые можно использовать для создания гуманизированных антител, очень важен для того, чтобы, по возможности, ограничить их иммуногенность и HAMA-реакцию (иммунный ответ человека на мышиные антитела) в тех случаях, когда антитело предназначено для медицинского применения. В соответствии с так называемым методом «оптимального соответствия» проводят скрининг последовательности вариабельного домена антитела грызуна против всей библиотеки известных последовательностей вариабельных доменов антител человека. Идентифицируют максимально приближенную к антителу грызуна последовательность вариабельного домена человека, и каркасную область (FR) в границах этой последовательности человека принимают за основу для гуманизированного антитела (Sims et al., J. Immunol. 151:2296 (1993), Chothia et al., J. Mol. Biol., 196:901 (1987)). В другом способе используют определенную каркасную область, полученную на основе консенсусной последовательности для всех антител человека конкретной подгруппы легких и тяжелых цепей. Одну и ту же каркасную область можно использовать для нескольких разных гуманизированных антител (Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al., J. Immunol. 151:2623 (1993)). Дополнительно важно, чтобы антитела были гуманизированы с сохранением высокой аффинности связывания с антигеном и других предпочтительных биологических свойств. Для достижения этой цели, в некоторых вариантах осуществления изобретения гуманизированные антитела получают путем анализа родительских последовательностей и различных концептуальных гуманизированных продуктов, используя трехмерные модели родительских и гуманизированных последовательностей. Трехмерные модели иммуноглобулинов широкодоступны и хорошо известны опытным специалистам в данной области. Доступны также компьютерные программы, которые иллюстрируют и наглядно воспроизводят возможные трехмерные конформационные структуры последовательностей иммуноглобулинов, отобранных в качестве кандидатов. Проверка этих изображений дает возможность анализа потенциальной роли остатков в функционировании последовательности иммуноглобулина-кандидата, то есть анализа остатков, которые влияют на способность иммуноглобулина-кандидата связываться с соответствующим ему антигеном. Таким образом, можно выбрать остатки FR и так скомбинировать их из реципиентной и импортной последовательности, чтобы получить желаемые характеристики антитела, в частности повышенную аффинность к целевому антигену (антигенам). Обычно, на связывание с антигеном напрямую и наиболее значительно влияют аминокислотные остатки гипервариабельной области.

Предусмотрены различные формы гуманизированного анти-интегрин бета7 антитела. Например, гуманизированное антитело может представлять собой фрагмент антитела, такой как Fab, который необязательно конъюгирован с одним или более цитотоксическими агентами для создания иммуноконъюгата. Альтернативно, гуманизированное антитело может представлять собой интактное антитело, такое как интактное антитело IgG1.

Примеры гуманизированных анти-бета7 антител включают, но без ограничения, rhuMAb Beta7, которое представляет собой моноклональное антитело к субъединице β7 интегрина, полученное из крысиного моноклонального антитела FIB504 к интегрину бета7 человека/мыши (Andrew et al., 1994 J Immunol. 1994; 153:3847-61). Оно было модифицировано, чтобы включить каркасные области тяжелой цепи IgG1 и легкой цепи κ1 иммуноглобулина человека, и продуцируется в клетках яичников китайского хомячка. Это антитело связывается с двумя интегринами, α4β7 (Holzmann et al. 1989 Cell, 1989; 56:37-46; Hu et al., 1992, Proc. Natl. Acad. Sci USA 1992; 89:8254-8) и αΕβ7 (Cepek et al., 1993 J Immunol. 1993; 150:3459-70), которые регулируют перемещение и удержание субпопуляций лимфоцитов в желудочно-кишечном тракте, и которые играют роль в воспалительном заболевании кишечника (IBD), таком как язвенный колит (UC) и болезнь Крона (CD). rhuMAb Beta7 является сильным in vitro ингибитором клеточного взаимодействия между α4β7 и его лигандами (молекулой белка клеточной адгезии слизистых, адресином-1 [MAdCAM]-1, молекулой адгезии сосудистых клеток [VCAM]-1 и фибронектином), а также взаимодействия между αΕβ7 и его лигандом (E-кадгерином). rhuMAb Beta7 связывается обратимым образом с примерно одинаковой высокой аффинностью с β7 на лимфоцитах кролика, яванского макака и человека. Оно также связывается с мышиной β7 с высокой аффинностью. Аминокислотная последовательность, а также создание и применение rhuMAb Beta7 и его вариантов подробно раскрыты, например, в публикации патентной заявки США № 20060093601 (опубликована как патент США 7528236), полное содержание которой включено в настоящее описание посредством ссылки.

На фиг.6A и 6B изображено выравнивание последовательностей вариабельных доменов легкой и тяжелой цепей для следующих последовательностей: консенсусной последовательности подгруппы каппа I легких цепей человека (фиг.6A, SEQ ID NO:12), консенсусной последовательности подгруппы III тяжелых цепей человека (фиг.6B, SEQ ID NO:13), вариабельной области легкой цепи крысиного антитела к мышиному интегрину бета 7 (Fib504) (фиг.6A, SEQ ID NO:10), вариабельной области тяжелой цепи крысиного антитела к мышиному интегрину бета 7 (Fib504) (фиг.6B, SEQ ID NO:11), и гуманизированных вариантов антител: вариабельной области легкой цепи гуманизированного антитела hu504Kgraft (фиг.6A, SEQ ID NO:14), вариабельной области тяжелой цепи гуманизированного антитела hu504Kgraft (фиг.6B, SEQ ID NO:15), варианты hu504-5, hu504-16 и hu504-32 (аминокислотные отличия от гуманизированного hu504Kgraft, указанные на фиг.6A (легкая цепь) (SEQ ID NOS:22-24, соответственно, по порядку) и на фиг.6B (тяжелая цепь) для вариантов hu504-5, hu504-16 и hu504-32 (SEQ ID NO:25)).

4. Антитела человека

В качестве альтернативы методике получения гуманизированных антител можно получить антитела человека. Например, в настоящее время можно получить трансгенных животных (например, мышей), которые способны в результате иммунизации продуцировать полный репертуар антител человека при отсутствии продукции эндогенных иммуноглобулинов. Например, было описано, что гомозиготная делеция гена соединяющей области (JH) тяжелой цепи антител у химерных мышей и мышей, несущих мутацию в зародышевой линии клеток, приводит к полному подавлению эндогенной выработки антител. Перенос набора генов иммуноглобулинов зародышевой линии человека в таких мутантных по зародышевой линии мышей будет приводить к продукции антител человека при антигенной стимуляции. См., например, Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551 (1993); Jakobovits et al., Nature, 362:255-258 (1993); Bruggermann et al., Year in Immunol., 7:33 (1993), патенты США 5545806, 5569825, 5591669 (все принадлежат GenPharm), 5545807 и WO 97/17852.

Альтернативно, можно использовать технологию фагового дисплея (McCafferty et al., Nature 348:552-553 [1990]) для получения антител человека и фрагментов антител in vitro из репертуаров генов вариабельных (V) доменов антител от иммунизированных доноров. Согласно этой методике гены V-доменов антител клонируют с сохранением рамки считывания в ген либо основного, либо минорного белка оболочки нитчатого бактериофага, такого как M13 или fd, и экспонируются в виде фрагментов функционального антитела на поверхности фаговой частицы. Поскольку нитевидная частица содержит однонитевую копию ДНК фагового генома, выбор, основанный на функциональных свойствах антитела, также приводит к отбору гена, кодирующего антитело, которое проявляет такие свойства. Таким образом, фаг имитирует некоторые из свойств B-клетки. Фаговый дисплей можно осуществить в разных форматах, обзор которых представлен, например, Johnson, Kevin S. and Chiswell, David J., в Current Opinion in Structural Biology 3:564-571 (1993). Для фагового дисплея можно использовать несколько источников сегментов V-генов. Clackson et al., Nature, 352:624-628 (1991) выделили многообразный набор антител к оксазолону из небольшой случайной комбинаторной библиотеки V-генов, полученных из селезенок иммунизированных мышей. Можно создать репертуар V-генов от неиммунизированных доноров (людей), и можно выделить разнообразный набор антигенов (включая аутоантигены), по существу следуя методикам, описанным в Marks et al., J. Mol. Biol. 222:581-597 (1991), или Griffith et al., EMBO J. 12:725-734 (1993). См. также патенты США 5565332 и 5573905.

Как обсуждалось выше, антитела человека также можно генерировать с использованием активированных in vitro B-клеток (см. патенты США 5567610 и 5229275).

5. Фрагменты антител

В некоторых обстоятельствах более предпочтительно использовать не целые антитела, а фрагменты антител. Меньший размер фрагментов позволяет быстрое выведение и может привести к лучшему доступу в солидные опухоли.

Для получения фрагментов антител были разработаны различные методики. Традиционно эти фрагменты получали посредством протеолитического расщепления интактных антител (см., например, Morimoto et al., Journal of Biochemical and Biophysical Methods 24:107-117 (1992) и Brennan et al., Science, 229:81 (1985)). Однако в настоящее время эти фрагменты можно получать непосредственно с использованием рекомбинантных клеток-хозяев. Например, фрагменты антител можно выделять из фаговых библиотек антител, обсуждавшихся выше. Альтернативно, фрагменты Fab'-SH можно напрямую выделять из E. coli и соединять химически для получения F(ab')2-фрагментов (Carter et al., Bio/Technology 10:163-167 (1992)). В соответствии с другим подходом F(ab')2-фрагменты можно непосредственно выделять из культуры рекомбинантных клеток-хозяев. Специалисту-практику будут очевидны другие методики получения фрагментов антител. В других вариантах осуществления изобретения антитело представляет собой одноцепочечный Fv-фрагмент (scFv). См. WO 93/16185; патент США 5571894 и патент США 5587458. Фрагмент антитела также может представлять собой «линейное антитело», например, описанное в патенте США 5641870. Такие линейные фрагменты антител могут быть моноспецифичными или биспецифичными.

6. Биспецифичные антитела

Биспецифичные антитела представляют собой антитела, имеющие специфичность связывания по меньшей мере с двумя разными антигенными эпитопами. Конкретные биспецифические антитела могут связываться с двумя разными эпитопами интегрина бета7, описанного в настоящем описании. Другие антитела подобного типа могут сочетать сайт связывания ТАТ с сайтом связывания для другого белка. Альтернативно, плечо анти-интегрин бета7 антитела может быть объединено с плечом, которое связывается со стимулирующей молекулой на лейкоците, такой как молекула T-клеточного рецептора (например, CD3) или Fc-рецепторы для IgG (FcγR), такие как FcγRI (CD64), FcγRII (CD32) и FcγRIII (CD16), для направления и локализации механизмов клеточной защиты на клетку, экспрессирующей ТАТ. Биспецифичные антитела можно также применять для локализации цитотоксических агентов на клетках, которые экспрессируют ТАТ. Такие антитела имеют ТАТ-связывающее плечо и плечо, связывающее цитотоксический агент (например, сапорин, анти-интерферон-альфа, алкалоиды барвинка, цепь A рицина, метотрексат или гаптен с радиоактивным изотопом). Биспецифичные антитела можно получать в виде полноразмерных антител или в виде фрагментов антител (например, биспецифичные антитела F(ab')2).

Способы получения биспецифичных антител известны в данной области. Традиционное получение полноразмерных биспецифичных антител основано на одновременной экспрессии двух пар тяжелых и легких цепей иммуноглобулина, причем две цепи имеют разную специфичность (Millstein et al., Nature 305:537-539 (1983)). Вследствие случайного образования пар между тяжелой и легкой цепями иммуноглобулина такие гибридомы (квадромы) продуцируют потенциальную смесь из 10 разных молекул антител, в которой только одна молекула имеет правильную биспецифичную структуру. Очистка правильно собранной молекулы, которая обычно требует нескольких этапов аффинной хроматографии, довольно обременительна, и выход продукта невелик. Похожие процедуры раскрыты в WO 93/08829 и в Traunecker et al., EMBO J. 10:3655-3659 (1991).

Согласно другому подходу вариабельные домены антитела с желаемой специфичностью связывания (сайты связывания антитело-антиген) сливают с последовательностями константных доменов иммуноглобулина. В некоторых вариантах осуществления изобретения слияние проводят с константным доменом тяжелой цепи Ig, содержащим по меньшей мере часть шарнирной, CH2- и CH3-областей. В некоторых вариантах осуществления изобретения первая константная область тяжелой цепи (CH1) содержащая сайт, необходимый для связывания легкой цепи, присутствует по меньшей мере в одном из слитых белков. Молекулы ДНК, кодирующие белки, слитые с тяжелой цепью иммуноглобулина и, если это желательно, легкой цепью иммуноглобулина, встраиваются в отдельные векторы экспрессии, которыми одновременно трансфицируют подходящую клетку-хозяина. Это обеспечивает большую гибкость при подборе взаимных соотношений трех полипептидных фрагментов в тех вариантах осуществления, когда неравное соотношение трех полипептидных цепей, используемых в конструкции, дает оптимальный выход целевого биспецифичного антитела. Однако можно вставлять кодирующие последовательности для двух или всех трех полипептидных цепей в один и тот же экспрессионный вектор, если экспрессия по меньшей мере двух полипептидных цепей в равном соотношении приводит к высокому выходу продукта, или если это соотношение существенно не влияет на выход целевой комбинации цепей.

В некоторых вариантах осуществления изобретения биспецифичные антитела состоят из тяжелой цепи гибридного иммуноглобулина с первой специфичностью связывания в одном плече и пары тяжелой и легкой цепи гибридного иммуноглобулина (создающей вторую специфичность связывания) в другом плече. Было обнаружено, что такая асимметричная структура облегчает отделение целевого биспецифичного соединения от нежелательной комбинации иммуноглобулиновых цепей, поскольку присутствие легкой цепи иммуноглобулина только в одной половине биспецифичной молекулы создает возможность легкого разделения. Этот подход раскрыт в WO 94/04690. Для получения дополнительных сведений по генерированию биспецифических антител см., например, Suresh et al., Methods in Enzymology 121:210 (1986).

В соответствии с другим подходом, описанным в патенте США 5731168, можно модифицировать границу раздела между парой молекул антитела, чтобы максимизировать процентную долю гетеродимеров, которые выделяют из рекомбинантной клеточной культуры. В некоторых вариантах осуществления изобретения граница раздела содержит по меньшей мере часть CH3-домена. В этом способе одну или более аминокислот с небольшими боковыми группами на границе раздела первой молекулы антитела замещают аминокислотами с более крупными боковыми группами (например, тирозином или триптофаном). На границе раздела второй молекулы антитела создают компенсаторные «полости» идентичного или сходного размера, замещая аминокислоты с крупными боковыми группами аминокислотами с боковыми группами меньшего размера (например, аланином или треонином). Это создает механизм для увеличения выхода гетеродимера по сравнению с другими нежелательными конечными продуктами, например, гомодимерами.

Биспецифичные антитела включают сшитые или «гетероконъюгатные» антитела. Например, одно из антител в гетероконъюгате может быть соединено с авидином, и другое - с биотином. Например, было предположено, что такие антитела направляют клетки иммунной системы на нежелательные клетки (патент США 4676980) и могут быть использованы при лечении ВИЧ-инфекции (WO 91/00360, WO 92/200373 и EP 03089). Гетероконъюгатные антитела можно получить, применяя любые традиционные способы сшивания. Подходящие сшивающие агенты хорошо известны в данной области и раскрыты в патенте США 4676980 наряду с множеством методик сшивания молекул.

В литературе также были описаны методики создания биспецифичных антител из фрагментов антител. Например, биспецифичные антитела можно получить с использованием химической связи. Brennan et al., в Science 229:81 (1985) описана процедура, в которой интактные антитела подвергают протеолитическому расщеплению для получения F(ab')2-фрагментов. Эти фрагменты восстанавливают в присутствии дитиол-комплексообразующего агента, арсенита натрия, чтобы стабилизировать соседние дитиолы и предотвратить образование межмолекулярных дисульфидных связей. Затем полученные Fab'-фрагменты преобразовывают в производные тионитробензоата (TNB): после чего одно из производных Fab'-TNB реконвертируют в Fab'-тиол восстановлением меркаптоэтаноламином и смешивают с эквимолярным количеством другого производного Fab'-TNB, с получением биспецифичного антитела. Полученные таким способом биспецифичные антитела можно использовать в качестве агентов для селективной иммобилизации ферментов.

Новейшие достижения облегчили прямое выделение из E. coli Fab'-SH-фрагментов, которые можно соединять химически для получения биспецифичных антител. В Shalaby et al., J. Exp. Med. 175:217-225 (1992) описано получение F(ab')2-молекулы полностью гуманизированного биспецифичного антитела. Каждый Fab'-фрагмент был по отдельности секретирован из E. coli и подвергнут прямому химическому соединению in vitro для получения биспецифичного антитела. Полученное таким способом антитело было способно связываться с клетками, избыточно экспрессирующими рецептор ErbB2, и с нормальными T-клетками, а также запускать литическую активность цитотоксических лимфоцитов человека против клеток-мишеней опухоли молочной железы человека. Были также описаны различные методики получения и выделения фрагментов биспецифичных антител непосредственно из культуры рекомбинантных клеток. Например, биспецифичные антитела были получены с применением лейциновых молний. Kostelny et al., J. Immunol. 148(5):1547-1553 (1992). Пептиды с лейциновыми молниями из белков Fos и Jun были соединены с Fab'-участками двух разных антител с помощью слияния кодирующих их генов. Гомодимеры антитела были восстановлены в шарнирной области с получением мономеров и подвергнуты повторному окислению с получением гетеродимеров антитела. Этот способ можно также использовать для получения гомодимеров антитела. Альтернативный механизм для получения фрагментов биспецифичных антител обеспечивает технология «диантител», описанная Hollinger et al., в Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993). Фрагменты содержат VH, соединенный с VL линкером, слишком коротким для того, чтобы позволить образование пар между двумя доменами одной и той же цепи. Соответственно, VH- и VL-домены одного фрагмента принудительно образуют пары с комплементарными VH- и VL-доменами другого фрагмента, формируя, таким образом, два антигенсвязывающих сайта. Кроме того, была опубликована еще одна стратегия получения фрагментов биспецифичных антител, основанная на использовании димеров одноцепочечных Fv (sFv). См. Gruber et al., J. Immunol., 152:5368 (1994).

Изобретение предусматривает антитела, имеющие более двух валентностей. Например, можно получить триспецифичные антитела. Tutt et al., J. Immunol. 147:60 (1991).

7. Гетероконъюгатные антитела

Гетероконъюгатные антитела также входят в объем настоящего изобретения. Гетероконъюгатные антитела состоят из двух ковалентно связанных антител. Такие антитела были предложены, например, для нацеливания клеток иммунной системы на нежелательные клетки (патент США 4676980) и могут использоваться при лечении ВИЧ-инфекции (WO 91/00360, WO 92/200373 и EP 03089). Предусмотрено, что антитела можно получить in vitro с использованием известных способов химического синтеза белка, включая способы с использованием сшивающих агентов. Например, иммунотоксины можно сконструировать с использованием реакции обмена дисульфидных связей или с образованием тиоэфирной связи. Примеры подходящих реактивов для этой цели включают иминотиолат, метил-4-меркаптобутиримидат и соединения, раскрытые, например, в патенте США 4676980.

8. Поливалентные антитела

Поливалентное антитело может интернализоваться (и/или катаболизироваться) быстрее, чем бивалентное антитело, клеткой, экспрессирующей антиген, с которым связывается указанное антитело. Антитела по настоящему изобретению могут представлять собой поливалентные антитела (отличающиеся от антител класса IgM) с тремя или более антигенсвязывающими сайтами (например, тетравалентные антитела), которые можно легко получить посредством рекомбинантной экспрессии нуклеиновой кислоты, кодирующей полипептидные цепи антитела. Поливалентное антитело может содержать димеризующийся домен, а также три или более антигенсвязывающих сайтов. В некоторых вариантах осуществления изобретения димеризующийся домен содержит Fc-область или шарнирную область (либо состоит из них). Согласно этому сценарию, антитело будет содержать Fc-область, а также три или более антигенсвязывающих сайтов на ее аминоконце. В некоторых вариантах осуществления изобретения поливалентное антитело в контексте настоящего изобретения содержит приблизительно от трех до восьми, но, как правило, четыре антигенсвязывающих сайта (или состоит из них). Поливалентное антитело содержит по меньшей мере одну полипептидную цепь (как правило, две полипептидные цепи), причем указанная полипептидная цепь (цепи) содержит два или более вариабельных доменов. Например, полипептидная цепь (цепи) может содержать VD1-(X1)n-VD2-(X2)n-Fc, где VD1 обозначает первый вариабельный домен, VD2 - второй вариабельный домен, Fc - одну полипептидную цепь Fc-области, X1 и X2 представляют собой аминокислоту или полипептид, и n равно 0 или 1. Например, полипептидная цепь (цепи) может содержать: цепь VH-CH1-гибкий линкер-VH-CH1-Fc-область или цепь VH-CH1-VH-CH1-Fc-область. Поливалентное антитело в контексте настоящего изобретения может дополнительно включать по меньшей мере два (и, как правило, четыре) полипептида вариабельных доменов легкой цепи. Поливалентное антитело в контексте настоящего изобретения может содержать, например, приблизительно от двух до восьми полипептидов вариабельных доменов легкой цепи. Предусмотренные в настоящем изобретении полипептиды вариабельных доменов легкой цепи содержат вариабельный домен легкой цепи и необязательно могут дополнительно содержать CL-домен.

9. Модификация эффекторной функции

Может оказаться желательным модифицировать антитело по изобретению, чтобы изменить его эффекторную функцию, например, усилить антигензависимую клеточно-опосредованную цитотоксичность (ADCC) и/или комплементзависимую цитотоксичность (CDC) антитела. Этого можно достичь, вводя одну или более аминокислотных замен в Fc-область антитела. Альтернативно или дополнительно, в Fc-область можно ввести цистеиновый остаток (остатки), что позволяет образовываться межцепочечным дисульфидным связям в данной области. Полученное таким способом гомодимерное антитело может обладать улучшенной способностью к интернализации и/или повышенными комплемент-опосредованным уничтожением клеток и антителозависимой клеточной цитотоксичностью (ADCC). См. Caron et al., J. Exp Med. 176:1191-1195 (1992) и Shopes, B. J. Immunol. 148:2918-2922 (1992). Гомодимерные антитела также можно получить с использованием гетеробифункциональных сшивающих агентов, как описано Wolff et al., в Cancer Research 53:2560-2565 (1993). Альтернативно, можно сконструировать антитело, имеющее сдвоенные Fc-области и поэтому, возможно, имеющее увеличенную способность к комплемент-зависимому лизису и ADCC. См. Stevenson et al., Anti-Cancer Drug Design 3:219-230 (1989). Для увеличения времени полужизни антитела в кровотоке, можно ввести в антитело (особенно, во фрагмент антитела) эпитоп, связывающийся с рецептором «спасения», как, например, описано в патенте США 5739277. В контексте настоящего описания термин «эпитоп, связывающийся с рецептором «спасения» относится к эпитопу Fc-области молекулы IgG (например, IgG1, IgG2, IgG3 или IgG4), который отвечает за увеличение времени полужизни молекулы IgG в кровотоке in vivo.

10. Иммуноконъюгаты

Антагонист или антитело, используемые в способах по настоящему изобретению, необязательно конъюгированы с другим агентом, таким как цитотоксический агент или цитокин.

Конъюгацию обычно осуществляют через ковалентную связь, конкретную природу которой будет определять молекула, которую необходимо присоединить, и участок связывания на антагонисте интегрина бета7 или антителе к интегрину бета7. Как правило, непептидный агент модифицируют добавлением линкера, который позволяет конъюгацию с антителом к интегрину бета7 через боковые группы аминокислот, углеводные цепи или реакционноспособные группы, введенные в антитело химической модификацией. Например, лекарственное соединение можно присоединить через ε-аминогруппу остатка лизина, через свободную α-аминогруппу, путем дисульфидного обмена с остатком цистеина или путем окисления 1,2-диолов в углеводной цепи перйодистой кислотой, что позволяет присоединять лекарственные соединения, содержащие различные нуклеофильные группы, через образование Шиффовых оснований. См., например, патент США 4256833. Агенты для модификации белков включают взаимодействующие с аминогруппами реагенты (например, реакционноспособные сложные эфиры, изотиоцианаты, альдегиды и сульфонилгалиды), взаимодействующие с тиольными группами реагенты (например, галоацетильные производные и малеимиды) и взаимодействующие с карбоновыми кислотами и альдегидами реагенты. Антагонист интегрина бета7 или антитело к интегрину бета7 можно ковалентно сочетать с пептидными агентами с помощью бифункциональных сшивающих агентов. Гетеробифункциональные реагенты наиболее широко используются и позволяют управлять присоединением двух различных белков с помощью двух различных реакционноспособных групп (например, взаимодействующих с аминами плюс тиол, йодацетамид или малеимид). Применение таких сшивающих агентов хорошо известно в данной области. См., например, Brinkley, выше, и патент США 4671958. Также можно использовать пептидные линкеры. Альтернативно, антитело к интегрину бета7 можно соединить с пептидной молекулой путем получения слитого полипептида.

Примеры дополнительных бифункциональных агентов для сочетания белков включают N-сукцинимидил-3-(2-пиридилдитио)пропионат (SPDP), сукцинимидил-4-(N-малеимидометил)циклогексан-1-карбоксилат, иминотиолан (IT), бифункциональные производные сложных имидоэфиров (такие как диметиладипимидат·HCl), активные сложные эфиры (такие как дисукцинимидилсуберат), альдегиды (такие как глутаровый альдегид), бис-азидосоединения (такие как бис(п-азидобензоил)гександиамин), бис-диазониевые производные (такие как бис(п-диазонийбензоил)этилендиамин), диизоцианаты (такие как толуол-2,6-диизоцианат) и активные бис-фторсоединения (такие как 1,5-дифтор-2,4-динитробензол).

10. Иммунолипосомы

Раскрытые в настоящем описании анти-интегрин бета7 антитела можно также ввести в состав иммунолипосом. «Липосома» представляет собой малый пузырек, состоящий из различных типов липидов, фосфолипидов и/или поверхностно-активного вещества, который пригоден для доставки лекарственного средства в организм млекопитающего. Компоненты липосомы обычно организованы в виде бислоя, аналогично организации липидов в биологических мембранах. Липосомы, содержащие антитело, можно получить способами, известными в данной области, например, как описано в Epstein et al., Proc. Natl. Acad. Sci. USA 82:3688 (1985); Hwang et al., Proc. Natl Acad. Sci. USA 77:4030 (1980); в патентах США 4485045 и 4544545; и в WO 97/38731, опубликованной 23 октября 1997 г. Липосомы с увеличенным периодом полужизни в кровотоке раскрыты в патенте США 5013556.

Особенно подходящие липосомы можно получить выпариванием из обращенной фазы с использованием композиции липидов, содержащей фосфатидилхолин, холестерин и PEG-производные фосфатидилэтаноламина (PEG-PE). Липосомы получают продавливанием через фильтры с определенным размером пор, с образованием липосом желаемого диаметра.

Fab'-фрагменты антитела по настоящему изобретению можно конъюгировать с липосомами посредством реакции тиол-дисульфидного обмена, как описано в Martin et al., J. Biol. Chem. 257:286-288 (1982). Необязательно, в липосому может быть включен химиотерапевтический агент. См. Gabizon et al., J. National Cancer Inst. 81(19):1484 (1989).

12. Векторы, клетки-хозяева и рекомбинантные способы получения антител

Также изобретение относится к выделенным нуклеиновым кислотам, кодирующим анти-бета7 антитела или полипептидные агенты, описанные в настоящем описании, к векторам и клеткам-хозяевам, содержащим нуклеиновые кислоты, и к рекомбинантным методикам получения антител.

Для рекомбинантного получения антитела нуклеиновую кислоту, кодирующую его, можно выделить и встроить в реплицирующийся вектор для последующего клонирования (амплификации ДНК) или для экспрессии. В другом варианте осуществления изобретения антитело можно получать посредством гомологичной рекомбинации, например, как описано в патенте США 5204244, специально включенном в настоящее описание посредством ссылки. ДНК, кодирующую моноклональное антитело, легко выделить и секвенировать с использованием стандартных методик (например, используя олигонуклеотидные зонды, которые способны специфично связываться с генами, кодирующими тяжелую и легкую цепи антитела). Доступно множество векторов. Компоненты векторов, как правило, включают, но, не ограничиваясь ими, одну или более из следующих последовательностей: сигнальной последовательности, точки инициации репликации, одного или более генов селективных маркеров, энхансерного элемента, промотора и последовательности терминации транскрипции, описанных, например, в патенте США 5534615, выданном 9 июля 1996 г. и специально включенном в настоящее описание посредством ссылки.

Клетки-хозяева, подходящие для клонирования или экспрессии ДНК в векторах в контексте настоящего описания, представляют собой клетки прокариот, дрожжей или высших эукариот, описанных выше. Подходящие для этой цели прокариоты включают эубактерии, такие как грамотрицательные или грамположительные организмы, например, Enterobacteriaceae, такие как Escherichia, например Е. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, например Salmonella typhimurium, Serratia, например, Serratia marcescans, и Shigella, а также Bacilli, такие как В.subtilis и В.licheniformis (например, В. licheniformis 41P, раскрытый в DD 266710, опубликованном 12 апреля 1989 г.), Pseudomonas, такие как P. aeruginosa и Streptomyces. Одним из штаммов Е. coli для клонирования является Е. coli 294 (АТСС 31,446), хотя также подходят и другие штаммы, такие как Е. coli В, Е. coli X1776 (АТСС 31,537) и Е. coli W3110 (АТСС 27325). Эти примеры являются иллюстративными, но не ограничивающими.

В дополнение к прокариотам подходящими хозяевами для клонирования или экспрессии кодирующих антитело к интегрину бета7 векторов являются эукариотические микроорганизмы, такие как нитевидные грибы или дрожжи. Saccharomyces cerevisiae, или обычные пекарские дрожжи, наиболее часто используются из низших эукариотических микроорганизмов-хозяев. Однако широкодоступны и подходят для использования в настоящем изобретении ряд других родов, видов и штаммов, таких как Schizosaccharomyces pombe; Kluyveromyces, такие как, например, K. lactis, K. fragilis (ATCC 12424), K. bulgaricus (ATCC 16045), К. wickeramii (ATCC 24178), K. waltii (ATCC 56500), К. drosophilarum (ATCC 36906), K. thermotolerans и K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070); Candida; Trichoderma reesia (EP 244,234); Neurospora crassa; Schwanniomyces, такие как Schwanniomyces occidentalis; и нитевидные грибы, например, такие как Neurospora, Penicillium, Tolypocladium и Aspergillus, такие как A. nidulans и A. niger.

Подходящие клетки-хозяева для экспрессии гликозилированного анти-бета7 антитела получают из многоклеточных организмов. Примеры клеток беспозвоночных включают клетки растений и насекомых. Выявлен ряд штаммов и вариантов бакуловирусов и соответствующих пермиссивных клеток-хозяев из хозяев, таких как Spodoptera frugiperda (совка травяная), Aedes aegypti (москит), Aedes albopictus (москит), Drosophila melanogaster (плодовая мушка) и Bombyx mori. Множество штаммов вирусов для трансфекции являются широкодоступными, например, вариант L-1 Autographa californica NPV и штамм Bm-5 Bombyx mori NPV, и такие вирусы можно использовать в качестве вирусов по настоящему изобретению, в частности, для трансфекции клеток Spodoptera frugiperda. Также в качестве хозяев можно использовать культуры клеток растений хлопчатника, кукурузы, картофеля, сои, петунии, томата и табака.

Однако наибольший интерес представляют клетки позвоночных, и размножение клеток позвоночных в культуре (культуре тканей) стало рутинной процедурой. Примерами пригодных клеточных линий-хозяев млекопитающих являются линия клеток почки обезьяны CV1, трансформированная SV40 (COS-7, АТСС CRL 1651); линия клеток почки эмбриона человека (клетки 293 или клетки 293, субклонированные для выращивания в суспензионной культуре, Graham et al., J. Gen Virol. 36:59 (1977); клетки почки детеныша хомячка (ВНК, АТСС CCL 10); клетки яичника китайского хомячка/-DHFR (СНО, Urlaub, et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980)); клетки Сертоли мыши (ТМ4, Mather, Biol. Reprod. 23:243-251 (1980)); клетки почки обезьяны (CV1 АТСС CCL 70); клетки почки африканской зеленой мартышки (VERO-76, АТСС CRL-1587); клетки карциномы шейки матки человека (HELA, АТСС CCL 2); клетки почки собаки (MDCK, АТСС CCL 34); клетки печени серой крысы (BRL 3А, АТСС CRL 1442); клетки легкого человека (W138, АТСС CCL 75); клетки печени человека (Hep G2, НВ 8065); клетки опухоли молочной железы мыши (ММТ 060562, АТСС CCL51); клетки TRI (Mather et al., Annals N.Y. Acad. Sci 383:44-68 (1982)); клетки MRC 5; клетки FS4; и линия гепатомы человека (Hep G2).

Для получения антитела к интегрину бета7 клетки-хозяева трансформируют описанными выше векторами для экспрессии и клонирования и культивируют в стандартной питательной среде, модифицированной соответствующим образом для индукции промоторов, отбора трансформантов или амплификации генов, кодирующих целевые последовательности.

Клетки-хозяева, используемые для получения антитела к интегрину бета7 по настоящему изобретению, можно культивировать в различных средах. Для культивирования клеток-хозяев пригодными являются коммерчески доступные среды, такие как среда Хэма F10 (Sigma), минимальная необходимая среда ((MEM) (Sigma)), RPMI-1640 (Sigma) и среда Игла, модифицированная Дульбекко ((DMEM), Sigma). Кроме того, для клеток-хозяев в качестве культуральной среды можно использовать любую из сред, описанных в Ham et al., Meth. Enz. 58:44 (1979), Barnes et al., Anal Biochem. 102:255 (1980), патентах США 4767704; 4657866; 4927762; 4560655 или 5122469; WO 9003430; WO 87/00195; или патенте США Re. 30985. Любые их этих сред можно дополнять, при необходимости, гормонами и/или другими факторами роста (такими как инсулин, трансферрин или эпидермальный фактор роста), солями (такими как хлорид натрия, кальция, магния и фосфат), буферами (такими как HEPES), нуклеотидами (такими как аденозин и тимидин), антибиотиками (такими как антибиотик GENTAMYCIN™), микроэлементами (определяемыми как неорганические соединения, обычно присутствующие в конечных концентрациях в микромолярном диапазоне) и глюкозой или эквивалентным источником энергии. Любые другие необходимые добавки также могут быть включены в соответствующих концентрациях, которые известны специалистам в данной области. Условия культивирования, такие как температура, рН и т.п., представляют собой условия, которые ранее использовали для клеток-хозяев, выбранных для экспрессии, и они будут очевидны специалисту в данной области.

При использовании рекомбинантных методик антитело может продуцироваться внутриклеточно, в периплазматическом пространстве, или оно может непосредственно секретироваться в среду. При внутриклеточной продукции антитела в качестве первой стадии удаляют частицы дебриса, либо клетки-хозяева, либо лизированные фрагменты, например, посредством центрифугирования или ультрафильтрации. В Carter, et al., Bio/Technology 10:163-167 (1992) описана методика выделения антител, которые секретируются в периплазматическое пространство Е. coli. Кратко, клеточную массу размораживают в присутствии ацетата натрия (рН 3,5), ЭДТА и фенилметилсульфонилфторида (PMSF) в течение приблизительно 30 мин. Клеточный дебрис можно удалить центрифугированием. Если антитело секретируется в среду, то супернатанты таких систем экспрессии, как правило, сначала концентрируют с использованием коммерчески доступного фильтра для концентрирования белка, например устройства для ультрафильтрации Amicon или Millipore Pellicon. На любой из вышеуказанных стадий для ингибирования протеолиза можно включить ингибитор протеаз, такой как PMSF, и для предупреждения роста загрязняющих микроорганизмов можно включить антибиотики.

Полученную из клеток композицию антитела можно очищать с использованием, например, хроматографии на гидроксилапатитах, электрофореза в геле, диализа и аффинной хроматографии, причем аффинная хроматография является наиболее распространенным способом очистки. Пригодность белка А в качестве аффинного лиганда зависит от вида и изотипа любого Fc-домена иммуноглобулина, который присутствует в антителе. Белок А можно использовать для очистки антител, в которых присутствуют тяжелые цепи γ1, γ2 или γ4 человека (Lindmark et al., J. Immunol. Meth. 62:1-13 (1983)). Белок G рекомендован для всех изотипов антител мыши и для тяжелой цепи γ3 человека (Guss et al., EMBO J. 5:1567-1575 (1986)). Матрикс, к которому присоединен аффинный лиганд, наиболее часто представляет собой агарозу, однако доступны и другие матриксы. Механически стабильные матриксы, такие как стекло с контролируемым размером пор или поли(стиролдивинил)бензол, обеспечивают более высокие скорости потока и более короткое время обработки, чем можно достигнуть с использованием агарозы. Если антитело содержит СН3-домен, то для очистки подходит смола Bakerbond ABX (J.Т. Baker, Phillipsburg, N.J.). Другие методики очистки белка, такие как фракционирование на ионообменной колонке, осаждение этанолом, ВЭЖХ с обращенной фазой, хроматография на силикагеле, хроматография на гепарин-SEPHAROSE™, хроматография на анионной или катионной обменной смоле (такая как колонка с полиаспарагиновой кислотой), хроматофокусирование, электрофорез в ДСН-ПААГ и осаждение сульфатом аммония также доступны в зависимости от антитела, подлежащего выделению. После предварительной стадии(й) очистки смесь, содержащую представляющее интерес антитело и примеси, можно разделять с помощью хроматографии гидрофобных взаимодействий в низком рН, используя элюирующий буфер с рН примерно 2,5-4,5, как правило, проводимой при низких концентрациях соли (например, примерно в 0-0,25 М соли).

С. Фармацевтические составы

Терапевтические составы, содержащие терапевтические агенты, антагонисты и антитела по изобретению, получают для хранения путем смешивания антитела, обладающего требуемой степенью чистоты, с необязательными физиологически приемлемыми носителями, эксципиентами или стабилизаторами (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), в форме водных растворов, лиофилизированных или других сухих составов. Приемлемые носители, эксципиенты или стабилизаторы являются нетоксичными для реципиентов в используемых дозировках и концентрациях и включают буферы, такие как фосфат, цитрат, гистидин и другие органические кислоты; антиоксиданты, включая аскорбиновую кислоту и метионин; консерванты (такие как октадецилдиметилбензиламмонийхлорид; гексаметонийхлорид; бензалконийхлорид, бензетонийхлорид; фенол, бутиловый или бензиловый спирт; алкилпарабены, такие как метил или пропилпарабен; катехол; резорцинол; циклогексанол; 3-пентанол и м-крезол); низкомолекулярные (менее примерно 10 остатков) полипептиды; белки, такие как сывороточный альбумин, желатин или иммуноглобулины; гидрофильные полимеры, такие как поливинилпирролидон; аминокислоты, такие как глицин, глутамин, аспарагин, гистидин, аргинин или лизин; моносахариды, дисахариды и другие углеводы, включая глюкозу, маннозу или декстрины; хелатирующие агенты, такие как ЭДТА; сахара, такие как сахароза, маннит, трегалоза или сорбит; солеобразующие противоионы, такие как натрий; комплексы металлов (например, Zn-белковые комплексы); и/или неионные поверхностно-активные вещества, такие как TWEEN™, PLURONICS™ или полиэтиленгликоль (PEG).

Для конкретного показания к лечению, при необходимости, состав в контексте настоящего описания также может содержать более одного действующего соединения, как правило, соединения с дополняющим действием, которые не оказывают неблагоприятного эффекта друг на друга. Такие молекулы соответственно присутствуют в комбинации в количествах, которые эффективны для предполагаемой цели.

Действующие ингредиенты также могут быть заключены в микрокапсулу, полученную, например методами коацервации или межфазной полимеризации, например, в гидроксиметилцеллюлозную или желатиновую микрокапсулу и полиметилметацилатную микрокапсулу соответственно в коллоидные системы доставки лекарственных средств (например, липосомы, альбуминовые микросферы, микроэмульсии, наночастицы и нанокапсулы) или в макроэмульсии. Такие методики описаны в Remington's Pharmaceutical Sciences, 16th edition, Osol, A., Ed., (1980).

Составы для введения in vivo должны быть стерильными. Это легко достигается фильтрацией через стерильные фильтрационные мембраны.

Можно получать лекарственные средства с замедленным высвобождением. Примеры подходящих лекарственных средств с замедленным высвобождением включают полупроницаемые матриксы из твердых гидрофобных полимеров, содержащие иммуноглобулин по изобретению, причем матриксы представляют собой изделия определенной формы, например, пленки или микрокапсулы. Примеры матриксов с замедленным высвобождением включают полиэфиры, гидрогели (например, поли(2-гидроксиэтилметакрилат) или поливиниловый спирт, полилактиды (патент США 3773919), сополимеры L-глутаминовой кислоты и γ-этил-L-глутамата, недеградируемый этиленвинилацетат, деградируемые сополимеры молочной кислоты и гликолевой кислоты, такие как LUPRON DEPOT™ (микросферы для инъекций, состоящие из сополимеров молочной кислоты и гликолевой кислоты и ацетата лейпролида), и поли-D-(-)-3-гидроксимасляную кислоту. В то время как полимеры, такие как этиленвинилацетат и сополимер молочной кислоты и гликолевой кислоты, обеспечивают высвобождение молекулы в течение более 100 суток, некоторые гидрогели высвобождают белки за более короткие промежутки времени. Если инкапсулированные иммуноглобулины остаются в организме в течение длительного времени, они могут денатурировать или агрегировать в результате воздействия влажности при 37°С, что приводит к потере биологической активности и возможным изменениям в иммуногенности. В зависимости от участвующего механизма можно разработать рациональные стратегии стабилизации. Например, если установлено, что механизмом агрегации является межмолекулярное образование S-S связей путем тиол-дисульфидного обмена, то стабилизацию можно достигнуть модификацией сульфгидрильных остатков, лиофилизацией из кислых растворов, контролем содержания влаги, использованием соответствующих добавок и разработкой определенных композиций полимерных матриксов.

D. Введение

Терапевт, назначающий лечение, будет способен определить соответствующую дозу для конкретного субъекта для введения по массе, или, в случае фиксированной дозировки, будет следовать инструкциям на этикетке. Лекарственные средства и режимы дозирования для коммерчески доступных вторых терапевтических и других соединений, вводимых в комбинации с антагонистами интегрина бета7, можно использовать по инструкциям изготовителя, или опытный специалист может их определить эмпирическим путем.

Для профилактики или лечения заболевания соответствующая дозировка антагониста интегрина бета7 и любого второго терапевтического или другого соединения, вводимого в комбинации с неистощающим антителом, будет зависеть от типа воспалительного заболевания кишечника, подлежащего лечению, например, IBD, UC, CD, тяжести и течения заболевания, вводят антагонист интегрина бета7 или комбинацию для профилактических или терапевтических целей, предшествующей терапии, клинической истории пациента и ответа на антагонист интегрина бета7 или комбинацию, и решения лечащего врача. Антагонист интегрина бета7 или комбинацию соответственно вводят пациенту единовременно или, чаще, несколькими дозами. В некоторых вариантах осуществления изобретения антагонист интегрина бета7 вводят один раз в неделю, или каждые две недели, или каждые четыре недели, или каждые шесть недель, или каждые восемь недель в течение одного месяца (4 недель), или двух месяцев, трех месяцев, или шести месяцев, или 12 месяцев, или 18 месяцев или 24 месяцев, или на протяжении всей жизни субъекта. В некоторых вариантах осуществления изобретения пациент осуществляет лечение самостоятельно.

В зависимости от типа и тяжести заболевания исходной потенциальной дозировкой для введения пациенту является примерно от 0,5 мг/кг до 4,0 мг/кг анти-бета7 антитела, водимой либо, например, введением одной или нескольких отдельных доз, либо непрерывной инфузией. Для повторного дозирования в течение нескольких дней или более длительного периода (в зависимости от состояния) лечение продолжают до достижения целевого подавления симптомов заболевания. Однако также подходят и другие режимы дозирования.

Например, в некоторых вариантах осуществления изобретения пациенту вводят фиксированную дозу анти-бета7 антитела. Фиксированная доза представляет собой определенное количество анти-бета7 антитела, которое вводится каждому пациенту вне зависимости от массы. В зависимости от типа и тяжести заболевания фиксированную дозу примерно 50-450 мг анти-бета7 антитела вводят пациенту одной или несколькими отдельными инъекциями или инфузиями, либо с помощью другого типа введения. Такую фиксированную дозу можно вводить внутривенно или подкожно, либо другими путями, описанными в настоящем описании. В некоторых вариантах осуществления изобретения фиксированная доза составляет 50 мг или 100 мг, или 150 мг, или 200 мг, или 300 мг, или 400 мг, или 420 мг, или 450 мг.

В некоторых вариантах осуществления изобретения за первой фиксированной ударной дозой анти-бета7 антитела следует одна или несколько фиксированных поддерживающих доз анти-бета7 антитела. Ударная доза содержит большее количество анти-бета7 антитела, чем поддерживающая доза. В некоторых вариантах осуществления изобретения ударная доза составляет примерно 400-450 мг и поддерживающая доза составляет примерно 50-350 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг или 420 мг, или 430 мг, или 450 мг. В некоторых вариантах осуществления изобретения поддерживающая доза составляет 50 мг или 100 мг, или 150 мг, или 200 мг, или 300 мг, или 350 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг и поддерживающая доза составляет 50 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг и поддерживающая доза составляет 100 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг и поддерживающая доза составляет 150 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг и поддерживающая доза составляет 200 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг и поддерживающая доза составляет 300 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 400 мг и поддерживающая доза составляет 350 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 420 мг и поддерживающая доза составляет 50 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 420 мг и поддерживающая доза составляет 100 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 420 мг и поддерживающая доза составляет 150 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 420 мг и поддерживающая доза составляет 200 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 420 мг и поддерживающая доза составляет 300 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 420 мг и поддерживающая доза составляет 350 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 430 мг и поддерживающая доза составляет 50 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 430 мг и поддерживающая доза составляет 100 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 430 мг и поддерживающая доза составляет 150 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 430 мг и поддерживающая доза составляет 200 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 430 мг и поддерживающая доза составляет 300 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 430 мг и поддерживающая доза составляет 350 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 450 мг и поддерживающая доза составляет 50 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 450 мг и поддерживающая доза составляет 100 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 450 мг и поддерживающая доза составляет 150 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 450 мг и поддерживающая доза составляет 200 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 450 мг и поддерживающая доза составляет 300 мг. В некоторых вариантах осуществления изобретения ударная доза составляет 450 мг и поддерживающая доза составляет 350 мг.

В некоторых вариантах осуществления изобретения первую поддерживающую дозу вводят в тот же день, что и ударную дозу. В некоторых вариантах осуществления изобретения первую поддерживающую дозу вводят через один день после ударной дозы. В некоторых вариантах осуществления изобретения первую поддерживающую дозу вводят через одну неделю после ударной дозы. В некоторых вариантах осуществления изобретения первую поддерживающую дозу вводят через две недели после ударной дозы. В некоторых вариантах осуществления изобретения первую поддерживающую дозу вводят через четыре недели после ударной дозы. В некоторых вариантах осуществления изобретения вторую и каждую последующую поддерживающую дозу вводят каждые две недели. В некоторых вариантах осуществления изобретения вторую и каждую последующую поддерживающую дозу вводят каждые четыре недели. В некоторых вариантах осуществления изобретения вторую и каждую последующую поддерживающую дозу вводят каждые восемь недель. В некоторых вариантах осуществления изобретения первую поддерживающую дозу вводят через две недели после ударной дозы, вторую поддерживающую дозу вводят через две недели после первой поддерживающей дозы, и каждую последующую поддерживающую дозу вводят каждые четыре недели. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение двух месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение трех месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение шести месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение 12 месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение 18 месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение 24 месяцев. В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят в течение всей жизни субъекта.

Как правило, лечащий врач будет вводить антитело (индивидуально или в комбинации со вторым соединением) по изобретению до достижения дозировки(ок), которые обеспечивают требуемый биологический эффект. Успех терапии по изобретению легко контролировать с использованием стандартных методик и методов анализа.

Антагонист интегрина бета7 можно вводить любым подходящим способом, включая парентеральное, местное, подкожное, внутрибрюшинное, внутрилегочное, интраназальное и/или внутриочаговое введение. Парентеральные инфузии включают внутримышечное, внутривенное, внутриартериальное, интраперитонеальное или подкожное введение. Также предусмотрено интратекальное введение (см., например, патентную заявку США № 2002/0009444 на имя Grillo-Lopez). В дополнение, антитело или антагонист можно соответственно ввести с помощью импульсной инфузии, например, с использованием уменьшающихся доз антитела. В некоторых вариантах осуществления изобретения дозы вводят внутривенно или подкожно. Каждое введение можно осуществлять одинаковыми или разными путями. В одном варианте осуществления изобретения каждое введение анти-бета7 антитела осуществляют подкожно. В одном варианте осуществления изобретения первое введение анти-бета7 антитела, например, ударной дозы, осуществляют внутривенно, и каждое последующее введение проводят подкожно.

В некоторых вариантах осуществления изобретения анти-бета7 антитело вводят с использованием, например, устройства для самоинъекций, устройства для автоматических инъекций или другого устройства, разработанного для самостоятельного введения лекарственных средств. Различные устройства для самоинъекций, включая устройства для автоматических инъекций, известны в данной области и коммерчески доступны. Примеры устройств включают, но, не ограничиваясь ими, заполненные шприцы (такие как BD HYPAK SCF®, READYFILL™ и STERIFILL SCF™ от Becton Dickinson; сополимерные заполненные шприцы CLEARSHOT™ от Baxter; и заполненные шприцы Daikyo Seiko CRYSTAL ZENITH®, доступные от West Pharmaceutical Services); одноразовые шприцы-ручки, такие как BD Pen от Becton Dickinson; ультраострые устройства и устройства с микроиглой (такие как INJECT-EASE™ и устройства для микроинфузий от Becton Dickinson; и H-PATCH™ от Valeritas), а также безыгольные устройства для инъекций (такие как BIOJECTOR® и IJECT®, доступные от Bioject; и SOF-SERTER® и пластыри, доступные от Medtronic). В некоторых вариантах осуществления изобретения rhuMAb Beta7 представляет собой изделие, включающее заполненный шприц, содержащий 2 мл (150 мг) rhuMAb Beta7. В некоторых вариантах осуществления изобретения rhuMAb Beta7 представляет собой промышленное изделие, включающее заполненный шприц, содержащий 1 мл (180 мг) rhuMAb Beta7.

Как отмечено, антагонист интегрина бета7 можно вводить индивидуально или в комбинации по меньшей мере со вторым терапевтическим соединением. Эти вторые терапевтические соединения обычно используют в таких же дозировках, используя такие же пути введения, как использовалось ранее, или в количестве примерно от 1 до 99% от используемых ранее дозировок. При использовании таких вторых соединений, их используют в некоторых вариантах осуществления изобретения в количестве, которое меньше количества, вводимого без антагониста интегрина бета7, для того чтобы избежать или снизить вызванные этим побочные эффекты.

Как указано дополнительно (например, см. ниже), в данной области известно множество подходящих вторых терапевтических соединений для лечения IBD, например, язвенного колита и болезни Крона, и аналогично описаны дозировки и способы введения для таких вторых терапевтических соединений.

Введение антагониста интегрина бета7 и любого второго терапевтического соединения можно осуществлять одновременно, например, в одной композиции, или в двух или нескольких разных композициях, используя один или разные пути введения. Альтернативно или дополнительно, введение можно осуществлять последовательно в любом порядке. В некоторых вариантах осуществления изобретения введение двух или более композиций можно осуществлять с интервалами от минут до дней (или недель, или месяцев). Например, антагонист бета7 можно вводить первым с последующим введением второго терапевтического соединения. Однако также предусмотрено одновременное введение или введение второго терапевтического соединения до введения антагониста интегрина бета7.

Стандарт лечения для субъектов с активной формой умеренно-тяжелого язвенного колита включает терапию стандартными дозировками: аминосалицилата, перорального кортикостероида, 6-меркаптопурина (6-МР) и/или азатиоприна. Терапия антагонистом интегрина бета7, таким как антитело к интегрину бета7, раскрытая в настоящем описании, приведет к улучшению ремиссии заболевания (быстрому контролю заболевания и/или увеличению длительности ремиссии), и к клиническому ответу, превосходящему достигаемые со стандартной терапией для таких субъектов.

В одном варианте осуществления изобретения лечение по настоящему изобретению воспалительного заболевания кишечника (IBD) у человека с IBD включает введение субъекту эффективного количества терапевтического агента, такого как антитело к интегрину бета7, и дополнительно включает введение субъекту эффективного количества второго лекарственного средства, которое представляет собой иммуносупрессор, обезболивающее средство, противодиарейное средство, антибиотик или их комбинацию.

В примере варианта осуществления изобретения указанное второе лекарственное средство выбрано из группы, состоящей из аминосалицилата, перорального кортикостероида, 6-меркаптопурина и азатиоприна. В другом примере варианта осуществления изобретения указанным вторым лекарственным средством является другой антагонист интегрина бета7, такой как другое антитело к интегрину бета7 или антитело к цитокину.

Все указанные вторые лекарственные средства можно использовать в комбинации друг с другом или индивидуально с первым лекарственным средством, так что выражение «второе лекарственное средство» в контексте настоящего изобретения не означает только одно лекарственное средство кроме, соответственно, первого лекарственного средства. Таким образом, второе лекарственное средство необязательно должно быть одно, и может состоять из или содержать более одного такого лекарственного соединения.

Объединенное введение в контексте настоящего изобретения включает совместное введение с использованием отдельных фармацевтических составов или одного состава, и последовательное введение в любом порядке, при котором обычно существует интервал, в течение которого оба (или все) действующие агенты одновременно проявляют свою биологическую активность.

Объединенное введение второго лекарственного средства включает совместное введение (одновременное введение) с использованием отдельных составов или одного фармацевтического состава, и последовательное введение в любом порядке, при котором обычно существует интервал, в течение которого оба (или все) действующие агенты (лекарственные средства) одновременно проявляют свою биологическую активность.

Е. Разработка схем лечения

Разработка лекарственных соединений является сложным и дорогостоящим процессом. Стоимость вывода нового лекарственного средства на рынок по оценке составляет от 800 миллионов до 1 миллиарда долларов. Менее 10% лекарственных средств из фазы I клинических испытаний доходят до стадии разрешения их применения. Двумя ключевыми причинами, по которым лекарственные средства не проходят последние стадии испытаний, являются отсутствие понимания взаимосвязи между дозо-концентрационным ответом и нежелательными побочными эффектами. В этих условиях важно иметь средства, которые позволяют прогнозировать поведение лекарственного средства in vivo и способствуют продвижению клинического терапевтического кандидата (Lakshmi Kamath, Drug Discovery and Development; Modeling Success in PK/PD Testing Drug Discovery & Development (2006)).

Фармакокинетика (ФК) характеризует всасывание, распределение, метаболизм и выведение (клиренс) лекарственного соединения. Фармакодинамика (ФД) определяет физиологический и биологический ответ на введенное лекарственное соединение. ФК/ФД-моделирование устанавливает математическую и теоретическую связь между этими двумя процессами и помогает лучше предсказывать действие лекарственного соединения. Интегрированное PK/PD-моделирование и компьютерный подбор испытаний посредством моделирования включены во многие программы разработки лекарственных средств и имеют все большее влияние (Lakshmi Kamath, Drug Discovery and Development; Modeling Success in PK/PD Testing Drug Discovery & Development (2006)).

ФК/ФД испытания, как правило, проводят на каждой стадии процесса разработки лекарственного средства. Вследствие того, что разработка становится все более сложной, времязатратной и дорогостоящей, компании ищут способы лучшего использования ФК/ФД данных для исключения неподходящих кандидатов на начальных стадиях и идентификации кандидатов, имеющих максимальные шансы клинического успеха. (Lakshmi Kamath, выше).

Доказано, что ФК/ФД моделирование подходит для определения взаимосвязи между ответом биомаркеров, содержанием лекарственного соединения и режимами дозирования. ФК/ФД профиль лекарственного соединения-кандидата и возможность прогноза реакции пациента являются решающими для успеха клинических испытаний. Недавние достижения в области молекулярной биологии и более полное понимание мишеней различных заболеваний валидировали биомаркеры в качестве хорошего клинического показателя терапевтической эффективности лекарственного соединения. Анализ биомаркеров помогает определить биологический ответ на соединение-кандидат. После клинической валидации биомаркера можно эффективно моделировать испытания. Биомаркеры обладают таким потенциалом, что могут когда-нибудь заменить клинические результаты в разработке лекарственных средств (Lakshmi Kamath, выше).

Количество биомаркеров в периферической крови можно использовать для определения биологического ответа на лечение антагонистами интегрина бета7, и, поэтому, функционирует в качестве хорошего клинического индикатора терапевтической эффективности потенциального метода лечения.

Традиционное ФК/ФД моделирование определяет параметры, такие как концентрация лекарственного соединения, эффекты воздействия лекарственного соединения, период полувыведения лекарственного соединения, концентрацию лекарственного соединения в зависимости от времени и эффекты лекарственного соединения в зависимости от времени. При более широком использовании количественные методики, такие как моделирование лекарственных соединений, моделирование заболеваний, моделирование испытаний и моделирование продаж, могут использоваться для поддержки всего процесса разработки, что приводит к лучшим решениям в результате лучшего учета рисков и лучшего использования информации. Для исследователей в области разработки лекарственных средств доступен ряд средств ФК/ФД моделирования, например, WinNonlin и Knowledgebase Server (PKS), разработанные Pharsight, Inc. Mountain View, California.

Предшествующее описание и нижеследующие примеры считаются достаточными для предоставления специалисту в данной области возможности осуществления изобретения на практике. Различные модификации изобретения дополнительно к показанным и описанным в настоящем описании будут очевидны для специалистов в данной области из предшествующего описания и нижеследующих примеров и попадают в объем приложенной формулы изобретения.

Следует понимать, что специалист в данной области будет способен применить идеи настоящего изобретения к конкретной проблеме или ситуации в свете описания идеи, изложенной в настоящем описании.

Дополнительные подробности изобретения проиллюстрированы следующими неограничивающими примерами. Раскрытие всех ссылок в настоящем описании явно включено в него посредством ссылки.

ПРИМЕРЫ

Пример 1

ФАЗА I - Многоцентровое, рандомизированное, плацебо-контролируемое, двойное слепое исследование для оценки безопасности, фармакокинетики, фармакодинамики и иммуногенности внутривенного и подкожного введения rhumab beta7 в однодозовой с увеличивающимися дозами стадии с последующей многодозовой параллельной стадией у пациентов с язвенным колитом

Описание исследования

Описание rhuMAb Beta7 (этролизумаб)

RhuMAb Beta7 (этролизумаб) представляет собой гуманизированное моноклональное антитело на основе консенсусных последовательностей VH III подгруппы IgG1 и VL I подгруппы κ-цепей человека и специфично направлено против β7-субъединицы интегринового гетеродимера. Было показано, что оно связывается с высокой аффинностью с α4β7 (Kd составляет примерно 116 пкМ) и с αΕβ7 (Kd составляет примерно 1800 пкМ).

Это рекомбинантное антитело имеет две тяжелых цепи (446 остатков) и две легких цепи (214 остатков), которые ковалентно связаны межцепочечными и внутрицепочечными дисульфидными связями, типичными для IgG1-антител. Для работы, описанной в настоящем описании, оно было получено в клетках яичника китайского хомячка (СНО). Молекулярная масса молекулы интактного негликозилированного rhuMAb Beta7 составляла приблизительно 144 кДа. Каждая тяжелая цепь rhuMAb Beta7 имела один консервативный сайт N-гликозилирования по Asn297. Олигосахариды, присоединенные к этому сайту, были типичны для наблюдаемых в рекомбинантных антителах, экспрессируемых в клетках СНО, с преобладающими гликоформами асиало-, биразветвленных гликанов G0 и G1. Масса наиболее превалирующей формы rhuMAb Beta7, содержащей два гликана G0 и не содержащей С-концевых остатков лизина, составляла приблизительно 147 кДа.

RhuMAb Beta7 поставлялся Genentech в виде от прозрачного до слегка опалесцирующего, от бесцветного или слегка желтого водного раствора в физиологически приемлемом буфере.

Общая схема исследования

Это впервые проводимые на людях исследование фазы I состояло из рандомизированной (в пределах когорты для одной дозы), двойной слепой, плацебо-контролируемой, однодозовой, с увеличением дозы стадии с последующей рандомизированной (для всех когорт), двойной слепой, плацебо-контролируемой, многодозовой, параллельной стадией. Пациенты, которые участвовали в однодозовой стадии исследования, которые получали rhuMAb Beta7, не имели права участвовать в многодозовой стадии. Однако пациентам, которые получали плацебо в однодозовой стадии исследования, позволяли принимать участие в многодозовой стадии. В данном исследовании принимали участие сорок восемь пациентов с язвенным колитом. Требовалось, чтобы пациенты имели диагноз язвенный колит в течение 12 недель. Исследование проводили на пациентах в возрасте 18-70 лет, которые имели диагноз умеренно-тяжелого язвенного колита, получали амбулаторное лечение и имели индекс по шкале Мейо (MCS) больше 5 на момент начала исследований. Шкала Мейо составляет от 0 до 12, и более высокие показатели указывают на более тяжелое течение заболевания (Schroeder et al., N. Engl. J. Med. 317:1625-1629 (1987); см. также таблицу 1 ниже). Пациентов с систематически плохим самочувствием и требующих госпитализации или хирургического вмешательства из-за язвенного колита не включали в исследование. В дополнение, подходящие для участия в исследовании пациенты считались исследователем кандидатами для биологической терапии, если они имели умеренное или тяжелое течение заболевания, и не отвечали на стандартную терапию с использованием 5-ASA, иммуносупрессорами (азатиоприном или 6-меркаптопурином) или стероидами.

Таблица 1
Шкала Мейо для оценки течения язвенного колита
Категория оценки
Баллы Частота стулаa Ректальное кровотечениеb Результаты эндоскопии Общая оценка состояния пациента терапевтомс
0 Нормальное число дефекаций для данного пациента Нет крови в стуле Норма или неактивное заболевание нормальное
1 На 1-2 дефекации чаще нормы Прожилки крови в стуле меньше чем в половине случаев Слабая степень заболевания (эритема, менее выраженный сосудистый рисунок, слабая рыхлость) Вялое течение заболевания
2 На 3-4 дефекации чаще нормы Явно выраженная кровь в стуле в большинстве случаев Умеренная степень заболевания (заметная эритема, отсутствие сосудистого рисунка, рыхлость, эрозии) Умеренное течение заболевания
3 На 5 и более дефекаций чаще нормы Выходит только кровь Тяжелая степень заболевания (спонтанные кровотечения, образование язв) Тяжелое течение заболевания
Показатель: от 0 до 3 Показатель: от 0 до 3 Показатель: от 0 до 3 Показатель: от 0 до 3
а Каждый пациент служит в качестве своего собственного контроля для установления степени нарушения частоты стула.
b Оценка ежедневного кровотечения представляет наиболее тяжелое кровотечение за день.
c Общая оценка состояния пациента врачом включает три
других критерия, ежедневную оценку пациентом дискомфорта в животе и общего самочувствия, и другие показатели, такие как физические признаки и общее состояние пациента.

Целью однодозовой с увеличением дозы стадии исследования была оценка безопасности и переносимости введения rhuMAb Beta7 пациентами с язвенным колитом. На этой стадии пациентов включали последовательно в пять когорт с восходящей дозой (когорты A-F; следует отметить, что первоначально планируемая когорта Е, участники которой должны были получить дозировку 1,0 мг/кг подкожно, была исключена, но обозначения A-F остались), и вводили им внутривенно (IV) или подкожно (SC) один из четырех уровней дозировок (0,3, 1,0, 3,0 или 10,0 мг/кг) (см. таблицу 2).

Планировалось включение пяти пациентов в каждую когорту. В каждой когорте пациентов случайным образом распределяли для получения rhuMAb Beta7 или плацебо. Для однодозовой стадии исследования, решения по увеличению дозы были основаны на оценке клинической безопасности когорт, получающих исследуемое лекарственное средство внутривенно (когорты A, B, C и D). На основании предшествующего опыта подкожного введения других моноклональных антител людям ожидалось, что степень воздействия после подкожного введения будет ниже степени воздействия, достигаемой после внутривенного введения.

Ожидалось, что любые возможные проявления острой токсичности (например, реакции гиперчувствительности, реакции на инфузии или сывороточные реакции) проявятся и, вероятно, исчезнут в течение 14-дневного периода последующего наблюдения для оценки безопасности. После завершения введения лекарственного средства в однодозовой стадии проводили оценку безопасности и фармакокинетических (ФК) данных до перехода к многодозовой стадии.

Многодозовую параллельную стадию (когорты G-J) начинали приблизительно через 10 недель после завершения введения лекарственного средства последнему пациенту в когорте F (3,0 мг/кг SC) из однодозовой стадии. В течение этих 10 недель были проанализированы фармакокинетические данные и информация по клинической безопасности для однодозовой стадии исследования. Параллельная схема и предложенный диапазон дозировок для многодозовой схемы зависели от максимально переносимой дозы (MTD), превышающей 10 мг/кг, из однодозовой стадии исследования, и были подтверждены анализом фармакокинетических данных в однодозовой стадии для подтверждения прогнозируемой (на основе исследований на яванских макаках) фармакокинетики у человека (см. ниже). Максимальная дозировка 4,0 мг/кг, вводимая три раза каждые четыре недели в многодозовой стадии, находилась в пределах коэффициента запаса, определенного из токсикологических данных, полученных на яванских макаках (международная патентная публикация № WO2009/140684; Stefanich et al., Br. J. Pharmacol, Accepted Article, doi: 10.1111/j.1476-5381.2011.01205.x), с коэффициентом запаса 16 на основе эквивалентной дозы для человека (HED) и 21 на основе воздействия, измеряемого площадью под кривой (AUC) (см. ниже). Основной целью многодозовой стадии была характеристика безопасности многодозового введения в предложенном диапазоне дозировок (0,5-4 мг/кг) и оценка потенциальной иммуногенности при повторном введении в группе пациентов с язвенным колитом. В этой части исследования пациентов распределяли случайным образом для получения rhuMAb Beta7 или плацебо в одну из четырех когорт по дозам (см. таблицу 2). RhuMAb Beta7 или плацебо вводили подкожно (0,5 мг/кг, 1,5 мг/кг или 3,0 мг/кг) или внутривенно (4,0 мг/кг) каждые 4 недели три раза в 1-й, 29-й и 57-й день (см. таблицу 2). Оценка безопасности на уровне 4,0 мг/кг была важна для оценки варианта введения rhuMAb Beta7 фиксированной дозой.

Оценивали частоту и природу побочных эффектов, тяжелых побочных эффектов и нарушений по данным лабораторных анализов. Безопасность оценивали по частоте побочных эффектов, используя шкалу Критериев токсичности для побочных эффектов от Национального института раковых заболеваний (NCI CTCAE), v3.0. Для оценки безопасности за пациентами наблюдали в течение 18 недель (до 127-го дня) в однодозовой стадии исследования, и в течение 28 недель (до 197-го дня) в многодозовой стадии исследования. Образцы крови собирали для оценки фармакокинетики, исследовательской фармакодинамики и антител к терапевтическому средству (АТА).

Таблица 2
Когорты в исследовании
Когорта Дозировка (мг/кг) Путь введения
A 0,3 IV
B 1 IV
C 3 IV
D 10 IV
E исключена
F 3 SC
G 0,5×3а SC
H 1,5×3а SC
I 3,0×3а SC
J 4,0×3а IV
IV=внутривенно; SC=подкожно.
а Исследуемое лекарственное средство вводили каждые 4 недели три раза в 1-й, 29-й и 57-й день.

Ограничивающая дозу токсичность (DLT)

DLT определяли как любой побочный эффект по шкале NCI CTCAE≥3, возникающий в течение 14 дней после введения исследуемого лекарственного средства в ходе однодозовой стадии исследования, который по мнению исследователя или организатора имел любую потенциальную взаимосвязь с rhuMAb Beta7. В пределах этой категории связанная с инфузиями токсичность 3-й степени (например, аллергическая реакция/гиперчувствительность, жар, боль, бронхоспазм, хрипы или гипоксия), возникающая в течение инфузии или в течение 24 часов после завершения инфузии, считалась DLT. Обострение язвенного колита не считалось DLT.

MTD определяли как уровень дозировки ниже уровня, при котором 2 или более пациентов, получающих лечение с использованием rhuMAb Beta7, испытывали DLT, описанную выше. Если не более 1 пациента испытывали DLT в каждой из шести однодозовых когорт, то MTD не была определена, и наивысшая исследованная дозировка составляла 10 мг/кг.

Обоснование схемы исследования

В данном исследовании оценивали безопасность, переносимость, ФК профиль, иммуногенность и исследовательские ФД маркеры для rhuMAb Beta7 на коротких и средних временных интервалах.

Обоснование двухстадийной схемы

Однодозовая стадия в основном была разработана для оценки острой токсичности. Примеры этого типа потенциальной токсичности включают реакции гиперчувствительности, сывороточную болезнь и местное раздражение тканей после подкожного введения. Этот тип токсичности может возникнуть после любого белкового лекарственного средства вне зависимости от его пути введения. Хотя мишенью rhuMAb Beta7 является β7высок. субпопуляции лимфоцитов, транслоцирующаяся в кишечник, которая составляет небольшую долю (приблизительно 2-10%) от общей популяции лимфоцитов человека (Rott et al., J Immunol. 156:3727-36, 1996), за любыми инфузионными реакциями велось пристальное наблюдение.

Введение множественных доз позволило провести оценку токсичности с повторно вводимыми подкожно и внутривенно дозами rhuMAb Beta7 с периодом последующего наблюдения, составляющим 28 недель. Для лучшей оценки потенциальной иммуногенности у популяции пациентов с IBD, в многодозовой стадии исследуемое лекарственное средство вводили пациентам три раза каждые 4 недели. В дополнение, в ходе многодозовой стадии исследования была обеспечена возможность оценки многодозовой фармакокинетики, исследовательских ФД маркеров и подтверждения биологической активности, и был упрощен выбор дозировок и интервалов дозировок для исследований фазы II (см. ниже).

Обоснование исследуемой популяции

Для данного исследования требовалось, чтобы пациенты имели язвенный колит с MCS≥5 на момент начала исследования и подходили по мнению исследователя для биологической терапии тем, то они имели умеренно-тяжелую степень заболевания, и у них наблюдался несоответствующий ответ на стандартную терапию с использованием 5-ASA лекарственных средств, иммуносупрессоров (азатиоприна или 6-меркаптопурина) или стероидов. Из участия в исследовании исключали любого пациента с историей клинически значимой оппортунистической инфекции, хронической или латентной инфекции, активной системной инфекции или лейкопенией. Эта популяция пациентов была выбрана для наилучшего приближения к случайной целевой популяции для данного терапевтического средства, одновременно минимизируя потенциальный риск усиления восприимчивости к инфекциям, введенными сопутствующим лечением с использованием высоких доз кортикостероидов и иммуносупрессоров.

Обоснование для исходной дозы, диапазона дозировок и схемы дозирования

Выбор дозировок в фазе I был основан на комбинации неклинического коэффициента запаса, прогнозируемой фармакокинетике у человека и исследовательских неклинических ФД данных. Многократное дозирование было включено в данное исследование для того, чтобы определить возможную иммуногенность повторного дозирования и для оценки безопасности накопительного воздействия rhuMAb Beta7. Предложенные уровни дозировок и частота введения обеспечили возможность оценки взаимодействия между ФК профилем, исследовательским ФД профилем и подтверждением биологической активности у пациентов с язвенным колитом. Это облегчило выбор соответствующего интервала дозировок и частоты введения для исследования по экспериментальной проверке концепции фазы II (см. ниже).

ФК данные по rhuMAb Beta7 на яванских макаках использовали для определения насыщения рецепторов β7 (международная патентная публикация № WO 2009/140684; Stefanich et al., Br. J. Pharmacol, Accepted Article, doi: 10.1111/j.1476-5381.2011.01205.x). Данные, собранные после однократного введения 1, 3 и 10 мг/кг rhuMAb Beta7, позволяли предположить нелинейную фармакокинетику ниже 3 мг/кг, что указывало на то, что дозировки 3 мг/кг и выше необходимы для полного насыщения опосредованного β7-рецептором клиренса. Поэтому, дозировка 1 мг/кг у яванского макака, по-видимому, представляла собой не насыщающую рецептор дозу; соответствующая средняя наблюдаемая максимальная сывороточная концентрация при этой дозировке составляла 25,1 мкг/мл. Эквивалентная для человека доза (HED) для ненасыщающей рецептор дозы 1 мг/кг у яванского макака составляет приблизительно 0,3 мг/кг; не ожидалось, что эта предложенная начальная однократная доза 0,3 мг/кг даст концентрацию в сыворотке больше 10 мкг/мл и поэтому не должна быть насыщающей дозой.

Предложенная начальная доза у человека 0,3 мг/кг rhuMAb Beta7, вводимая внутривенной инфузией, была выбрана для оценки любых острых реакций в качестве результата введения исследуемого лекарственного средства, и была подтверждена неклиническим токсикологическим исследованием на яванских макаках (международная патентная публикация № WO 2009/140684; Stefanich et al., Br. J. Pharmacol, Accepted Article, doi: 10.1111/j.1476-5381.2011.01205.x). Коэффициент запаса для однократной дозы в случае начальной дозировки оценивали на основе NOAEL≥50 мг/кг с дозами, вводимыми каждую неделю в течение 12 недель (международная патентная публикация № WO 2009140684), прогнозируемым клиренсом у человека (CL) и прогнозируемым объемом центральной камеры (V1) у человека. Коэффициент запаса составляет 53,7 на основе HED, 76,2 на основе воздействия (AUC), 167 на основе дозировки и 175 на основе ожидаемой максимальной концентрации (Cmax) (см. таблицу 3). При наиболее высоком предложенном многодозовом режиме введения 4 мг/кг IV с общим числом доз 3, коэффициент запаса составляет 16,1 на основе HED, 21,1 на основе AUC, 50 на основе дозировки и 34,4 на основе Cmax (см. таблицу 3).

Решение по выбору начальной дозы 0,3 мг/кг с использованием NOAEL, но не MABEL, основано на нескольких факторах. Во-первых, выбор интегринов в качестве терапевтической мишени не является новым, поскольку в предшествующих клинических исследованиях α4β7 являлся мишенью как для натализумаба, так и для MLN02 (также называемого MLN0002 или ведолизумаб) без тяжелых острых побочных эффектов (Feagan et al., N Engl. J Med. 352:2499-507 (2005); Sandborn et al., N Engl. J Med. 353:1912-25 (2005)). Во-вторых, предложенным механизмом действия rhuMAb Beta7 является блокирование перемещения лимфоцитов в кишечник и, возможно, блокирование удержания лимфоцитов в эпителии. С использованием предшествующих антагонистов интегрина было показано, что этот механизм действия не ассоциирован с острыми побочными эффектами. Кроме того, для rhuMAb Beta7 не было продемонстрировано ни видимых агонистических свойств, ни индукции высвобождения цитокинов in vitro. Наконец, для rhuMAb Beta7 не было показано ни антитело-зависимой клеточно-опосредованной цитотоксической, ни комплемент-зависимой цитотоксической активности in vitro вплоть до концентраций 10 мкг/мл. Также не было найдено изменений в субпопуляциях клеток периферических лимфоидных органов в доклинических исследованиях, выполненных на мышах и яванских макаках. Поэтому было решено, что 0,3 мг/кг является разумной начальной дозой для этого первого клинического испытания на людях в случае язвенного колита.

Таблица 3
Оценки коэффициентов запаса для однодозовых и многодозовых стадий исследования rhuMAb Beta7
Доза, предложенная для человека Коэффициент запаса
Уровень дозировкиа Доза (мг/кг) Кол-во доз Общая доза (мг/кг) Однократная доза Многократные дозы
HED (мг/кг)b
Однократная доза, низкая 0,3 1 0,3 53,7 644
Однократная доза, высокая 10 1 10 1,61 19,3
Многократная доза 4 3 12 1,34 16,1
Доза (мг/кг)с
Однократная доза, низкая 0,3 1 0,3 167 2000
Однократная доза, высокая 10 1 10 5,00 60,0
Многократная доза 4 3 12 4,17 50,0
Воздействие (AUC)d
Однократная доза, низкая 0,3 1 0,3 76,2 843
Однократная доза, высокая 10 1 10 2,29 25,3
Многократная доза 4 3 12 1,91 21,1
Концентрация (Cmax)е
Однократная доза, низкая 0,3 1 0,3 175 459
Однократная доза, высокая 10 1 10 5,26 13,8
Многократная доза 4 3 12 13,2 34,4f
AUC=площадь под кривой зависимости концентрации от времени; AUC=площадь под кривой зависимости концентрации от времени от нулевой временной точки до бесконечности; CL=клиренс; Cmax= максимальная наблюдаемая концентрация; HED=доза, эквивалентная для человека; IV=внутривенное; NOAEL=уровень без наблюдаемых побочных эффектов.
а Наименьшая однократная доза составляет 0,3 мг/кг IV. Наивысшая однократная доза составляет 10 мг/кг IV. Наивысшая многократная доза составляет 4 мг/кг IV каждые 4 недели всего для трех общих дозировок IV (параллельное исследование).
b Коэффициент запаса=HED/дозаh, где h обозначает человека. Перевод NOAEL для яванского макака в HED осуществляли на основании массы тела и вычисляли делением NOAEL на 3,1. Принимая то, что NOAEL≥50 мг/кг ×12, HED составляет 16,1 мг/кг для однодозового коэффициента запаса и 193 мг/кг (16,1 мг/кг ×12) для многодозового коэффициента запаса.
с Коэффициент запаса=дозас/дозаh, где c обозначает яванского макака, и h обозначает человека. Принимая то, что NOAEL≥50 мг/кг ×12, дозаc составляет 50 мг/кг для однодозового коэффициента запаса и 600 мг/кг (50 мг/кг ×12) для многодозового коэффициента запаса.
d Коэффициент запаса=AUCc/AUCh, где c обозначает яванского макака, и h обозначает человека. Для однодозового коэффициента запаса AUCc вычисляли, используя зависимость AUCc=дозаc/CLc. CLc, составляющий 2,93 мл/день/кг, определяли путем вычисления среднего CL после четырех еженедельных доз по 25 мг/кг у яванских макак. Принимая то, что NOAEL≥50 мг/кг ×12, AUCc составляла 17065 дней·мкг/мл для однодозового коэффициента запаса. Для многодозового коэффициента запаса AUCc, составляющую 188846 дней·мкг/мл, определяли путем вычисления геометрического среднего AUC для 50 мг/кг ×12 в группе с внутривенным введением. AUCh оценивали, используя зависимость AUCh= дозаh/(CLh). Наиболее консервативную оценку CLh использовали для коэффициента запаса на основе воздействия. CLh оценивали, используя метод распределения лекарственного средства вне зависимости от биологического вида (Dedrick 1973). Предполагаемая AUCh для внутривенного введения однократной дозы 0,3 мг/кг, однократной дозы 10 мг/кг и трех доз по 4 мг/кг составляла 224, 7463 и 8955 дней·мкг/мл, соответственно.
е Коэффициент запаса=Cmax-c/Cmax-h, где c обозначает яванского макака, и h обозначает человека. Cmax-c представляет собой геометрическое среднее максимальной наблюдаемой концентрации у яванского макака. Принимая то, что NOAEL≥50 мг/кг, геометрическое среднее C0-c, наблюдаемое после однократного внутривенного введения 50 мг/кг, составляло 1315 мкг/мл. Геометрическое среднее Cmax-c, наблюдаемое после 12 внутривенных доз по 50 мг/кг, составляло 3444 мкг/мл. Проводили оценку Cmax-h и определили, что оно аналогично наблюдаемым для других IgG1-антител у человека. Оцениваемое Cmax-h для внутривенного введения однократной дозы 0,3 мг/кг, однократной дозы 10 мг/кг и трех доз по 4 мг/кг составляло 7,5, 250 и 100 мкг/мл соответственно.
f Коэффициент запаса основан на предварительном Cmax-h, оцененном как доза/V1, что предполагает отсутствие накопления после повторного введения по 4 мг/кг каждые 4 недели всего в количестве трех доз.

Выбор целевого диапазона дозировок и режима дозирования осуществляли на основе моделируемых профилей зависимости сывороточной концентрации rhuMAb Beta7 от времени, экстраполированных для поддержания устойчивого минимального уровня выше целевой концентрации 1-10 мкг/мл. Эта целевая концентрация основана на результатах in vivo исследований rhuMAb Beta7 на мышах и яванских макаках, которые показали, что минимальная концентрация 1-10 мкг/мл была необходима для поддержания занятости β7-рецепторов на циркулирующих Т-клетках периферической крови. Занятость β7-рецепторов на циркулирующих Т-клетках периферической крови является исследовательским ФД маркером, который оценивали в исследовании фазы I. Пока не станет известно, как этот маркер коррелирует с клинической активностью, влияние целевой концентрации 1-10 мкг/мл на клиническую эффективность также будет неизвестно.

Предполагалось, что планируемая схема исследования с увеличением дозы оптимизирует возможность оценки безопасности rhuMAb Beta7 при введении в широком диапазоне дозировок и воздействия. Чрезмерное или неожиданное накопление исследуемого лекарственного средства после внутривенного введения каждые 4 недели не ожидалось.

Выходные показатели

Основными выходными показателями в данном исследовании были следующие: (1) частота, характер и тяжесть побочных эффектов (оцениваются по NCI CTCAE, версия 3.0) и (2) частота и характер отклонений по лабораторным показателям, исходя из результатов гематологических тестов, биохимии и анализа мочи.

Вторичными выходными показателями в данном исследовании были ФК профиль и параметры, выведенные из профиля зависимости концентрации в сыворотке от времени после введения rhuMAb Beta7, включая: Cmax; CL или кажущийся CL (CL/F) для лекарственных средств, вводимых подкожно; объем распределения (V) или кажущийся объем распределения (V/F) для лекарственных средств, вводимых подкожно; AUC; период полувыведения (t1/2); пропорциональность дозы; и биодоступность при подкожном введении. Вторичные выходные показатели также включают частоту образования антител к rhuMAb Beta7 на основе образцов, полученных во множественных временных точках до и после введения лекарственного средства для каждого пациента.

Также изучали некоторые исследовательские выходные показатели. Они включают изменения от исходного уровня ФД маркеров (которые могут включать занятость рецептора rhuMAb Beta7, относительный уровень β7-рецептора на клеточной поверхности) и/или экспрессирующие β7-интегрин Т-клеточные субпопуляции), измеряемые проточной цитометрией субпопуляций лимфоцитов; и изменение от исходного значения модифицированного MCS.

Исследуемая популяция

Для участия в исследовании были отобраны амбулаторные пациенты, имеющие умеренный или тяжелый язвенный колит и MCS≥5. Если пациенты получали высокие дозы кортикостероидов для неотложного лечения заболевания, то дозировку снижали до ≤20 мг/день преднизона, или его эквивалента, не менее чем за 2 недели до введения исследуемого лекарственного средства.

В любое время в течение исследования пациентам, которые имели обострение язвенного колита, было позволено проводить неотложную терапию стероидами (внутривенно, перорально и/или местно). Добавление или повышение дозировок 5-ASA (перорально или местно) и/или иммуносупрессоров (а именно, азатиоприна, 6-меркаптопурина или метотрексата) также позволялось в качестве неотложной терапии. Применение анти-TNF агентов (например, инфликсимаба, адалимумаба, цертолизумаба), Тизабри® (натализумаба), циклоспорина, такролимуса или любых исследуемых агентов не позволялось в качестве неотложной терапии в ходе исследования.

Пациенты из многодозовой стадии исследования, которые получали неотложную терапию для обострения язвенного колита, не получали дальнейших доз исследуемого лекарственного средства, но продолжали оставаться под наблюдением для оценки безопасности, ФК, исследовательской ФД и АТА.

Любого пациента с предполагаемой клинически достоверной иммуносупрессией (исходя из частоты и тяжести предшествующих оппортунистических инфекций и данных о лейкопении в периферической крови на момент отбора) не включали в исследование. Поскольку часть пациентов могла получать предшествующее лечение инфликсимабом, пациентам было необходимо отменить анти-TNF терапию по меньшей мере за 12 недель до начала лечения в данном исследовании. Время полужизни инфликсимаба составляет 8-9 дней; поэтому 12-недельный период полного удаления (приблизительно 10 периодов полувыведения) сочли достаточным для выведения биопрепарата, гарантирующим безопасность пациента и адекватную оценку любых побочных эффектов, ассоциированных с rhuMAb Beta7.

До участия в исследовании пациентов специально исследовали на любое наличие инфекции, в частности JC-вируса (определяемого по ДНК JCV в плазме крови), цитомегаловирусной (CMV) инфекции толстой кишки (по биопсии толстой кишки), респираторной, гельминтной или паразитарной инфекции. Пациентов исключали из исследования при наличии любой активной инфекции.

Критерии включения

Пациенты должны были соответствовать следующим критериям, чтобы подходить для включения в исследование: (1) способность и желание предоставить письменное информированное согласие; (2) 18-70 лет; (3) мужчины и женщины в репродуктивном возрасте: желание использовать надежный способ контрацепции (например, гормональные контрацептивы, пластырь, вагинальное кольцо, внутриматочную спираль или физический барьер) от начала исследований не менее чем до 4 месяцев (приблизительно 5 периодов полувыведения) после последнего введения исследуемого лекарственного средства; (4) диагноз умеренного или тяжелого язвенного колита с MCS≥5 баллов при отборе (см. выше); (5) рентген грудной клетки без клинически значимых патологий в течение 6 месяцев до процедуры отбора; (6) подходить для получения биотерапии по мнению исследователя, тем что пациенты имеют умеренную или тяжелую степень заболевания, которое, как было показано, дает неадекватный ответ на стандартную терапию с использованием 5-ASA, иммуносупрессоров (азатиоприна, 6-меркаптопурина или метотрексата) или стероидов. В Соединенных Штатах пациенты, которые принимают участие в многодозовой стадии, должны были иметь неадекватный ответ на терапию или непереносимость терапии как иммуносупрессорами, так и анти-TNF антителами; (7) длительность заболевания на момент отбора ≥12 недель (после первого диагноза, поставленного терапевтом); (8) пациенты, которые принимали высокие дозы кортикостероидов, должны были снизить их до ≤20 мг/день преднизона или эквивалента преднизона по меньшей мере за 2 недели до 1-го дня введения исследуемого лекарственного средства. Местные кортикостероиды и местные 5-ASA лекарственные средства должны быть отменены по меньшей мере за 1 неделю до 1-го дня введения исследуемого лекарственного средства; (9) пациенты, которые принимали перорально 5-ASA, должны быть на стабильной дозе или прекратить прием лекарственного средства по меньшей мере за 4 недели до 1-го дня введения исследуемого лекарственного средства; (10) пациенты, которые ранее получали лечение анти-TNF антителами, должны были прекратить лечение по меньшей мере за 12 недель до 1-го дня введения исследуемого лекарственного средства; (11) терапия иммуносупрессорами для однодозовой стадии: в Соединенных Штатах: пациенты должны были прекратить терапию иммуносупрессорами (а именно, азатиоприном, 6-меркаптопурином или метотрексатом) к 1-му дню введения исследуемого лекарственного средства. Вне Соединенных Штатов: по решению исследователя пациенты могли прекратить лечение иммуносупрессорами (а именно, азатиоприном, 6-меркаптопурином или метотрексатом) 1-му дню введения исследуемого лекарственного средства или могли продолжить получать данное лечение в стабильной дозе в течение исследования; (12) терапию иммуносупрессорами для многодозовой стадии: в Соединенных Штатах: по решению исследователя пациенты могли прекратить лечение иммуносупрессорами (а именно, азатиоприном, 6-меркаптопурином или метотрексатом) 1-му дню введения исследуемого лекарственного средства или могли продолжить получать данное лечение в стабильной дозе до 6 недель (43-го дня) в течение исследования. Однако на 43-й день все пациенты должны были прекратить терапию иммуносупрессорами на оставшееся время многодозовой стадии исследования (до 197-го дня). В дополнение, в случае пациентов, которые получали стероиды, для пациентов, достигших клинического ответа, необходимо было снижать дозу с 57-го дня или со следующего посещения по достижению клинического ответа. Клинический ответ будет оцениваться исследователем, и будет учитываться гибкая сигмоидоскопия, проведенная на 43-й день. Вне Соединенных Штатов: по решению исследователя пациенты могли прекратить лечение иммуносупрессорами (а именно, азатиоприном, 6-меркаптопурином или метотрексатом) 1-му дню введения исследуемого лекарственного средства или могли продолжать получать данное лечение в стабильной дозе в течение всего исследования.

Критерии исключения

Пациентов, которые отвечали следующим критериям, не включали в исследование. Критерии исключения, связанные с UC, включали: (1) необходимость в госпитализации вследствие тяжести язвенного колита; (2) анемию от средней до тяжелой (гемоглобин <10 г/дл); (3) любое проявление язвенного колита, вероятно, требующее (по мнению исследователя) лечения с использованием >20 мг/день преднизона (или его эквивалента) в ходе исследования.

Критерии исключения, связанные с общим состоянием здоровья, включали: (1) беременность или лактацию; (2) отсутствие доступа к периферическим венам; (3) неспособность к соблюдению протокола исследования, по мнению исследователя; (4) положительный анализ стула на яйца глист или паразитов, положительные культуры стула на патогены или положительные результаты на Clostridium difficile по анализу стула на токсины на момент отбора; (5) тяжелое неконтролируемое заболевание, такое как неврологическое, сердечное, легочное, почечное, печеночное, эндокринное или желудочно-кишечное заболевания; (6) значительные нарушения в ЭКГ, включая данные об остром инфаркте миокарда, полной блокаде левой ножки предсердно-желудочкового пучка, блокаде сердца второй степени или полной блокаде сердца; (7) плохо контролируемый диабет (гликозилированный гемоглобин [HbAlc] >8,0%); (8) заболевания, кроме язвенного колита (например, астму), которые требуют лечения с использованием более 20 мг/день преднизона (или его эквивалента) в ходе лечения; (9) наличие онкозаболеваний за исключением полностью удаленной базальноклеточной карциномы или сквамозноклеточной карциномы кожи; (10) нарушенную функцию почек (уровень креатинина более чем в полтора раза превышает норму [ULN]); (11) нарушенную функцию печени (уровень трансаминаз более чем в 2,5 раза превышает ULN, либо нарушения в печеночных пробах по мнению исследователя являются клинически значимыми).

Критерии исключения, связанные с факторами риска инфекций, включали: (1) врожденный иммунодефицит; (2) уровень иммуноглобулинов IgA и IgG в сыворотке (включая подклассы IgG 2 и 3) ниже лабораторной нормы; (3) положительный анализ на ДНК JCV в сыворотке; (4) положительные тесты на антитела, указывающие на активную или предшествующую инфекцию ВИЧ или гепатита В или С; (5) положительные титры IgM-антител при отрицательных титрах IgG на вирус Эпштейна-Барра (EBV); (6) биопсию слизистой кишечника, положительную по CMV; (7) положительный анализ на латентную инфекцию Mycobacterium tuberculosis по результатам реакции Манту или лабораторным анализам, таким как QuantiFERON®-TB Gold (QFT-G или эквивалентному анализу крови. QFT-G (или эквивалентный анализ крови) следует проводить у пациентов, ранее вакцинированных бациллой Кальметта-Герена (БЦЖ). Если отрицательная реакция Манту была получена в течение 3 месяцев до проведения отбора, ее не нужно повторять; (8) историю тяжелых системных бактериальных, грибковых или паразитарных инфекций (более двух госпитализаций в год или более двух курсов внутривенных антибиотиков в год); (9) историю инвазивных грибковых инфекций, таких как Candida или Aspergillus (исключая кандидоз полости рта или другие поверхностные грибковые инфекции), в течение 6 месяцев до начала лечения исследуемым лекарственным средством; (10) историю тяжелой герпетической инфекции (простого герпеса 1-го и 2-го типов или герпес зостер) или ее рецидива в течение 12 недель до начала лечения исследуемым лекарственным средством или частые рецидивы герпеса (более 2 раз за год); (11) историю любых других оппортунистических инфекций в течение 12 недель до начала лечения исследуемым лекарственным средством; (12) историю PML; (13) любые текущие или недавние (в течение 4 недель до начала лечения исследуемым лекарственным средством) признаки или симптомы инфекции; (14) получение перорально антибиотиков в течение 4 недель до начала лечения исследуемым лекарственным средством или внутривенно антибиотиков в течение 8 недель до начала лечения исследуемым лекарственным средством; (15) получение живой аттенуированной вакцины в течение 4 недель до начала отбора; (16) госпитализация в течение 4 недель до отбора.

Критерии исключения, связанные с лекарственными средствами, включали: (1) получение экспериментального лечения в течение 12 недель до отбора (или в течение 5 периодов полувыведения экспериментального продукта, что длиннее); (2) пациентов, которые завершили однодозовую стадию данного исследования, но не получали rhuMAb Beta7 (то есть получали плацебо), не будут исключать из участия многодозовой стадии; (3) получение любой биотерапии в течение 12 недель до отбора; (4) тромбоцитопению (тромбоциты <75000/мкл), нейтропению (общее число нейтрофилов <1500/мкл) или лимфопению (общее число лимфоцитов <800/мкл); (5) получение циклоспорина или такролимуса (FK506) в течение 3 месяцев до начала лечения исследуемым лекарственным средством.

Методы анализа

Анализ на ДНК JCV

Пациентов проверяли на ДНК JCV в сыворотке на момент начала и затем каждые 4 недели в течение исследования с использованием JCV DNA DetectR™ Qualitative Assay (#8145), причем результат считался положительным при 80 копиях/мл или выше. Количественный анализ ДНК JCV (JCV DNA Ultraquant™ Quantitative Assay [#8147]) проводили у пациентов, которые стали положительными по ДНК JCV в ходе исследования. Этот анализ имеет более низкий уровень детекции, 80 копий/мл.

Анализ фармакокинетики и антител к терапевтическому средству (АТА)

У всех пациентов получали образцы сыворотки для определения и характеристики фармакокинетики rhuMAb Beta7 и для оценки ATA. Уровень в сыворотке rhuMAb Beta7 и ATA для клинических образцов исследовали иммунометрическими методами в качестве части исследовательской программы, описанной ниже.

Программа исследования ATA соответствовала общему руководству по проверке ATA (Mire-Sluis et al. J Immunol. Methods 289:1-16 (2004)). Программа исследования АТА имела два этапа: скрининг и характеристику. Скрининг включал исходное скрининговое тестирование образцов сыворотки, подтверждающий тест для положительных образов из первого теста, и титрование подтвержденных положительных образцов. Положительную сыворотку сохраняли для дальнейшего использования. Результаты скринингового этапа повторно подтверждали. Вследствие того, что высокий уровень rhuMAb Beta7 в сыворотке нарушал детекцию ATA, после введения последней дозы rhuMAb Beta7 получали нейтральные образцы, когда, как ожидалось, уровень лекарственного средства упадет ниже уровня, влияющего на анализ.

Фармакокинеческий анализ

Сэндвич-ELISA с колориметрической детекцией был утвержден для количественной оценки rhuMAb Beta7 (PRO145223) в сыворотке человека. Микротитровочные планшеты покрывали анти-rhuMAb Beta7 антителом в концентрации 1 мкг/мкл для осаждения rhuMAb Beta7. В планшет добавляли разведенные образцы, стандарты и контроли, и инкубировали. Далее для детекции добавляли биотинилированное антитело к rhuMAb Beta7 и стрептавидин, конъюгированный с пероксидазой хрена (HRP), и инкубировали. Добавляли субстрат для пероксидазы (тетраметилбензидин) для появления цвета, и реакцию останавливали добавлением 1М фосфорной кислоты. Специфичное поглощение измеряли при 450 нм и при 620 или 630 нм референсное поглощение. Минимальная определяемая концентрация в данном анализе составляла 12,5 нг/мл.

Анализ антител к терапевтическому средству

Связывающий антитела электролюминесцентный анализ (ECLA) был утвержден для детекции антител к PRO145223 (rhuMAb Beta7) в сыворотке человека. В анализе использовали PRO145223, конъюгированные с Sulfo-TAG для осаждения антител к PRO145223. Биотинилированный конъюгат rhuMAb Beta7 в концентрации 2 мкг/мл и конъюгат Sulfo-TAG и rhuMAb Beta7 в концентрации 2 мкг/мл добавляли в 96-луночный полипропиленовый микропланшет (Corning). Далее в микропланшет добавляли разбавленные образцы и контроли и совместно инкубировали с конъюгатами в течение ночи. Покрытый стрептавидином Meso Scale Discovery® (MSD; Gaithersburg, MD) планшет также блокировали буфером для разведения в течение ночи при 2-8°C. Образцы из полипропиленового планшета затем переносили в блокированный MSD-планшет и инкубировали при комнатной температуре в течение 2 часов. MSD-планшет промывали три раза промывочным буфером. В MSD-планшет добавляли MSD 2x Read Buffer T, и поглощение измеряли на спектрофотометре MSD Sector Imager 6000. Титры антител определяли с помощью программы обработки данных логарифмичесого снижения титра.

В ходе проверки достоверности анализа минимальным определенным титром являлся: Log10(минимальное разведение)=1,30 титровочных единиц.

Фармакодинамический анализ

У пациентов брали образцы периферической крови и измеряли исследовательские ФД маркеры в режиме реального времени методом флуоресцентно-активированного клеточного сортинга (FACS) субпопуляций лимфоцитов периферической крови с использованием стандартных методов проточной цитометрии. Данные анализировали для каждой когорты после измерения всех образцов.

Анализ бета7 был разработан для оценки занятости и экспрессии бета7 с использованием конъюгированного с РЕ (фикоэритрином) rhuMAbBeta7 (конкурирующего антитела) для детекции свободных сайтов, доступных до и после введения лекарственного средства, вместе с конъюгированным с РЕ анти-бета7 антителом (неконкурентным антителом), которое не ингибируется присутствием rhuMAbBeta7 и обеспечивает оценку общей экспрессии бета7 при введении лекарственного средства.

Кратко, 100 мл цельной крови с антикоагулянтом гепарином натрия добавляли в соответственно подписанные пробирки для окрашивания на льду и инкубировали в течение 30 минут. После инкубации смесь, содержащую соответствующие смеси антител, добавляли в соответствующие пробирки и инкубировали в течение 30 мин на льду в темноте. Клетки затем промывали забуференным фосфатном солевым раствором, содержащим 2% нормальной телячьей сыворотки, и наконец ресуспендировали в 1% параформальдегиде и хранили при 2-8°C до проведения анализа на проточном цитометре Becton Dickinson FACSCalibur. Для каждого образца собирали по 50000 событий для анализа.

Результаты

Характеристики пациентов на момент начала исследования как для однодозовой, так и для многодозовой стадии приведены в следующих двух таблицах.

Таблица 4
Характеристики пациентов на начало однодозовой восходящей стадии (SAD) исследования
Когорта А (0,3 мг/кг, IV) n=4 Когорта В (1 мг/кг, IV)
n=4
Когорта С (3 мг/кг, SC)
n=4
Когорта D (10 мг/кг, IV)
n=4
Когорта F (3 мг/кг, SC)
n=4
Плацебо n=5 Всего n=25
Медианный возраст (диапазон) 39 (36-53) 45 (25-64) 46 (34-47) 41 (29-49) 35 (19-41) 26 (21-49) 38 (19-64)
Пол (М:Ж) 4:0 4:0 3:1 3:1 1:3 2:3 17:8
Медианный MCS на начало исследования (диапазон) 10 (6-11) 9 (8-9) 10 (8-11) 10 (8-12) 8 (5-9) 9 (7-10) 9 (5-12)
На стероидах 3 2 1 2 2 3 13
На иммуносупрессорах 1 1 2 1 2 0 7
На 5-ASA 3 1 2 3 3 3 15
Медианная длительность заболевания, годы (диапазон) 6,5
(4-9,2)
12,9
(5,7-24)
14,9
(6,9-22,8)
8,9
(2,7-19,6)
6,7
(2,4-8,3)
6
(4,6-29,9)
7,5
(2,4-29,9)
Таблица 5
Характеристики пациентов на начало многодозовой восходящей (MAD) стадии исследования
Когорта G (0,5 мг/кг, SC) n=4 Когорта H (1,5 мг/кг, SC) n=5 Когорта I (3 мг/кг, SC) n=4 Когорта J (4 мг/кг, IV) n=5 Плацебо n=5 Всего n=23
Медианный возраст (диапазон) 49 (31-57) 56 (33-63) 39 (25-57) 41 (20-55) 31 (20-62) 46 (20-63)
Пол (М:Ж) 2:2 3:2 3:1 5:0 3:2 16:7
Медианный MCS на начало исследования (диапазон) 10,5 (7-12) 11 (8-11) 8,5 (4-10) 9 (6-10) 10 (8-11) 10 (4-12)
На стероидах 3 2 2 1 4 12
На иммуносупрессорах 0 2 0 3 1 6
На 5-ASA 4 3 2 3 3 15
Предшествующее лечение анти-TNF агентами 4 3 2 3 3 15
Медианная длительность заболевания, годы (диапазон) 6 (4-17,2) 8,2
(1,6-23,9)
10,1
(4-29,9)
5,2
(2,7-19,7)
5,3
(1,6-25,2)
6
(1,6-29,9)

Как указано выше, основными выходными показателями данного исследования фазы I были безопасность и переносимость. В однодозовой стадии авторы не наблюдали ни дозолимитирующей токсичности, ни инфузионных или инъекционных побочных реакций. У семи пациентов наблюдались тяжелые побочные реакции (шесть получали rhuMAb Beta7, и один получал плацебо) в однодозовой стадии. Были две тяжелых побочных реакции, связанные с нарушенным ранозаживлением у двух пациентов, получавших активное лечение, которые прошли через срочную колэктомию при ухудшении язвенного колита, однако там были значительные отягчающие факторы. Не было клинически значимых реакций в месте инъекции в многодозовой стадии исследования. В многодозовой стадии исследования была одна тяжелая побочная реакция.

В исследовании фазы I не было вызывающих беспокойство реакций, идентифицированных для rhuMAb Beta7 при дозировках (однократной и многократных), протестированных в исследовании фазы I. Ни для одной дозы не были достигнуты определяемые протоколом критерии DLT (дозолимитирующей токсичности). Общее число побочных реакций было в общем одинаковым между когортами без видимого дозозависимого увеличения возникновения побочных реакций. Основными побочными реакциями были NCI CTCAE (степени 1 или 2). У семи пациентов, получавших rhuMAb Beta7 в исследовании фазы I, наблюдались тяжелые побочные реакции: у шести в однодозовой стадии, и у одного в многодозовой стадии. Не наблюдалось видимого дозозависимого увеличения числа связанных с инфекциями побочных реакций в однодозовой стадии исследования. Ни на одной стадии исследования не наблюдалось каких-либо тяжелых побочных реакций, связанных с инфузиями или инъекциями. Наблюдалось увеличение побочных реакций в течение 24 часов после введения исследуемого лекарственного средства у получавших rhuMAb Beta7 пациентов (у 45% пациентов в однодозовой стадии и у 55,6% пациентов в многодозовой стадии) по сравнению с плацебо (20% пациентов как в однодозовой, так и в многодозовой стадии). Однако все побочные реакции, возникающие в течение 24 часов после введения исследуемого лекарственного средства, представляли собой NCI CTCAE (стадия 1 или 2).

Образцы крови от каждого пациента собирали в определенное время на протяжении всего исследования, и для оценки ФК измеряли концентрацию rhuMAb Beta7 в сыворотке. Оценку ФК проводили для доступных данных по зависимости концентрации в сыворотке от времени посредством стандартных некомпартментализованных (NCA) фармакокинетических методов и компьютерной программы WinNonlin Pro version 5.1.1 (Pharsight). Использовали время актуального забора крови. Результаты показаны на фиг.1. На фиг.1А показаны результаты SAD-стадии исследования, на фиг.1В показан ФК профиль однократной дозы rhuMAb Beta7 (3,0 мг/кг, внутривенно) по сравнению с подкожным введением 3,0 мг/кг, и на фиг.1С показаны результаты MAD-стадии исследования.

Анализ данных, представленных на фиг.1А, показывает, что концентрация rhuMAb-Beta7 в сыворотке имеет двухфазное распределение с начальной фазой быстрого распределения, за которой следует медленная фаза выведения. После внутривенного введения Cmax увеличивалась дозозависимым образом в среднем до 9,33 мкг/мл в группе дозы 0,3 мг/кг и до 239 мкг/мл в группе дозы 10 мг/кг. Аналогичным образом, групповая средняя площадь под кривой зависимости концентрации от времени (AUC0_) варьировала от 76,9 до 2500 дней × мкг/мл и была приблизительно пропорциональна дозе, о чем свидетельствовали похожие значения AUC, нормализованной по дозе, по всему диапазону дозировок. Период полувыведения составлял приблизительно 2 недели (~14 дней). ФК профили низких дозировок (0,3 мг/кг и 1 мг/кг) позволял предположить небольшую нелинейность, возможно вследствие вклада мишень-опосредованного выведения антитела в низких концентрациях.

Анализ данных, представленных на фиг.1В показывает, что выведение в когорте подкожного введения в основном совпадало с когортой внутривенного введения. Приблизительная оценка сравнения значений AUC0_ когорты однократной дозы 3 мг/кг SC с AUC0_ когорты однократной дозы 3 мг/кг IV дала приблизительную биодоступность 66-67%.

Анализ данных, представленных на фиг.1С, показывает, что в согласии с ФК данными однодозовой стадии, концентрация rhuMAb Beta7 в сыворотке, в общем, была пропорциональна введенной дозе. Схема введения один раз в 4 недели приводила к минимальному или среднему накоплению лекарственного средства с течением времени. Максимальная дозировка в когорте 4 мг/кг IV давала среднюю (±стандартное отклонение) Cmax, составляющую 117±31 и 136±24 мкг/мл после введения первой и последней дозы соответственно. Аналогично кинетике однократной дозы, период полувыведения в многодозовых когортах составлял приблизительно 2 недели.

Предварительная популяционная оценка ФК была проведена для данных из всех однодозовых когорт с использованием NONMEM VI (ICON). Одномерный анализ полученных данных проводили, откладывая межиндивидуальную вариабельность (IIV) для клиренса (CL) или центрального объема распределения (V1) против массы тела (BW) в качестве ковариаты. CL или V1 для rhuMAb Beta7, по-видимому, не коррелировали с BW в этой оценке, позволяя предположить, что дозировку по массе тела можно заменить фиксированной дозировкой.

В итоге, описанный выше анализ указывает, в общем, на линейную фармакокинетику с небольшой тенденцией в нелинейность при дозировках <3 мг/кг. Период полувыведения после однократных доз 3 и 10 мг/кг, вводимых внутривенно, составлял приблизительно 2 недели (~14 дней), и биодоступность при подкожном введении составляла приблизительно 66-67%.

Результаты анализа на присутствие антител к терапевтическому средству (АТА) показали, что один пациент в однодозовой когорте, который получал 0,3 мг/кг внутривенно, был положительным на АТА на 29-й день и оставался положительным до 127-го дня. Положительная АТА-реакция не влияла на ФК (данные не показаны).

Занятость интегрина бета7 измеряли в образцах от каждого пациента в различных временных точках. Для SAD-стадии исследования занятость поддерживалась на уровне 1-10 мкг/мл (данные не показаны). На фиг.2 показаны результаты анализа занятости из MAD-стадии исследования. Данные позволяют предположить дозозависимую зависимость в длительности насыщения бета7-рецептора с полной занятостью, сохраняющейся уже при ежемесячной дозировке 0,5 мг/кг SC.

Авторы также проанализировали данные, свидетельствующие о возможной клинической активности. Одним исследуемым параметром было индивидуальное изменение индекса клинических проявлений по шкале Мейо (MCS). Эти результаты показаны на фиг.3. Для всех пациентов в многодозовой стадии средний (±SD) MCS на начало исследования(базовая линия) составлял 9,3±1,9. Клинический ответ определяли как снижение MCS на 3 пункта плюс 30%-е снижение от базовой линии и снижение ≥1 балл в ректальном кровотечении или показатель общего кровотечения, составляющий 0/1. Как показано на фиг.3А-Е на 71-й день 12 из 18 пациентов, получавших rhuMAb Beta7, и 4 из 5 пациентов, получавших плацебо, показали клинический ответ по этим критериям. В дополнение, клиническую ремиссию определяли как абсолютный MCS≤2 (плюс ни один из отдельных показателей не превышает 1). На фиг.3A-E показано, что 3 из 18 пациентов, получавших rhuMAb Beta7, и 1 из 5 пациентов, получавших плацебо, продемонстрировали клиническую ремиссию по этим критериям. Следует отметить, что клиническая активность наблюдалась у пациентов, получавших rhuMAb Beta7, которые не получали стероиды, и клиническая активность была более согласована в когортах H и I.

Пример 2

ФАЗА II - Рандомизированное, двойное слепое, плацебо-контролируемое исследование для оценки эффективности и безопасности rhumab beta7 у пациентов с умеренной и тяжелой формой язвенного колита и открытое расширенное исследование

Схема исследования

Описание исследования

Исследование фазы II представляет собой рандомизированное, двойное слепое, плацебо-контролируемое, мультицентровое исследование для оценки эффективности и безопасности двух уровней дозирования rhuMAb Beta7 по сравнению с плацебо у пациентов с формой язвенного колита от умеренной до тяжелой. Целевая популяция пациентов совпадала с описанной выше для фазы I. Основной эффект будут оценивать на 10-й неделе (через 2 недели после введения последней дозы исследуемого лекарственного средства) с дополнительной оценкой эффективности на 6-й неделе.

Пациентов распределяли случайным образом в соотношении 1:1:1 по диапазону дозировок rhuMAb Beta7, составляющих 100 мг подкожно (фиксированная доза) в 0-й, 4-й и 8-й неделе и 420 мг подкожно (фиксированная ударная доза) в 0-й неделе с последующими 300 мг подкожно в 2-й, 4-й и 8-й неделе, или соответствующего плацебо подкожно. Схема исследования приведена на фиг.7. Исследование разделяли на скрининговый период 0-35 дней, двойной слепой период лечения (10 недель) и период последующего наблюдения за безопасностью (18 недель), и период наблюдения на случай возникновения прогрессирующей мультифокальной лейкоэнцефалопатии (PML), составляющий 17 месяцев (2 года после случайного распределения).

Для включения в исследование пациенты должны были иметь не менее чем 12-недельную продолжительность язвенного колита, диагностированного в соответствии с практическим руководством Американского гастроэнтерологического колледжа (ACG); а именно, на основе клинических и эндоскопических данных, подтвержденных гистологическими данными, с данными о средней или тяжелой форме заболевания, о которой свидетельствует в некоторых случаях MCS≥5 или, в некоторых случаях - MCS≥6, включая эндоскопический показатель ≥2; показатель ректального кровотечения ≥1 (см. таблицу 1); и эндоскопические данные об активности заболевания минимум в 25 см от края ануса.

До случайного распределения пациенты должны получать стабильные дозы сопутствующих лекарственных средств для язвенного колита. Пероральные дозировки 5-аминосалициловой кислоты (5-ASA) и иммуносупрессора (азатиоприна [AZA], 6-меркаптопурина [6-MP] или метотрексата) должны были оставаться стабильными в течение по меньшей мере 4 недель до случайного распределения в 1-й день. Пациенты, получающие местные 5-ASA или кортикостероиды, должны были прекратить лечение за 2 недели до случайного распределения в 1-й день. Доза пероральных кортикостероидов должна была оставаться стабильной в течение 2 недель до случайного распределения в 1-й день. Пациенты, получающие высокие дозы кортикостероидов, должны были снизить их до ≤20 мг/день за 2 недели до случайного распределения в 1-й день. Для пациентов, получающих пероральные кортикостероиды в течение периода введения исследуемого лекарственного средства, снижение дозы кортикостероидов начинали на 10-й неделе со скоростью 5 мг преднизона или его эквивалента в неделю в течение 2 недель и затем со скоростью 2,5 мг преднизона или его эквивалента в неделю до полной отмены. Для пациентов, получающих пероральные иммуносупрессоры (кроме пероральндых кортикостероидов), их отмена должна была начинаться на 8-й неделе, и пациенты должны были полностью прекратить их прием к 10-й неделе. Пациенты, которые ранее получали анти-TNF терапию должны были прекратить данное лечение не менее чем за 8 недель до случайного распределения, чтобы получить исследуемое лекарственное средство в 1-й день. Если у пациентов наблюдалась персистирующая или увеличивающаяся активность заболевания в любое момент исследования, то можно использовать неотложную терапию в форме увеличения дозы или начала лечения стероидами или иммуносупрессорами по решению исследователей. Пациентам, которым понадобилось неотложное лечение, было разрешено остаться в исследовании, но прекращалось лечение исследуемым лекарственным средством, и в ходе анализа данных их классифицировали как неудачный результат исследуемого лечения.

Проводили оценку пациентов на предмет их неспособности отвечать на стандартную терапию, включая по меньшей мере один анти-TNF агент. В контексте настоящего описании потеря ответа и/или непереносимость анти-TNF агентов и иммуносупрессоров означает следующее. В отношении анти-TNF агентов потеря ответа и/или непереносимость означают, что симптомы активного заболевания остаются, несмотря на предшествующее лечение по меньшей мере одним или более лекарственными средствами из: (a) инфликсимаба: 5 мг/кг IV, 3 дозы за 6 недель в оценкой на 8 неделе; (b) адалимумаба: одна доза 160 мг подкожно в 0-й неделе, с последующими дозами 80 мг на 2-й неделе и затем по 40 мг на 4-й и 6-й неделе, с оценкой на 8-й неделе; либо рецидивирующие активные симптомы на фоне регулярного введения лекарственного средства после ранее детектируемого ответа (выборочная отмена лечения пациентом, которые отвечал на лечение и не потерял ответа не принимается); либо история непереносимости по меньшей мере одного анти-TNF антитела (включая, но необязательно или не ограничиваясь, ими, инфузионные или инъекционные побочные реакции, инфекцию, застойную сердечную недостаточность, демиелинизацию). В отношении иммуносупрессоров потеря ответа и/или непереносимость означают, что симптомы активного заболевания сохраняются, несмотря на предшествующее лечение одним или более из азатиоприна (≥1,5 мг/кг) или эквивалентной дозой 6-меркаптопурина (≥0,75 мг/кг) или метотрексата (25 мг подкожно/внутримышечно (или как указано) в неделю в течение по меньшей мере 8 недель); или историю непереносимости по меньшей мере одного иммуносупрессора (включая, но необязательно, панкреатит, лекарственную лихорадку, крапивницу, тошноту/рвоту, повышение показателей печеночных проб, генетическую мутацию тиопурин S-метилтрансферазы, инфекцию).

Случайное распределение по исследуемому лечению стратифицировали по сопутствующему лечению кортикостероидами (да/нет), сопутствующему лечению иммуносупрессорами (да/нет), предшествующему воздействию анти-TNF агентов (да/нет) (за исключением пациентов, случайно распределяемых в Соединенных Штатах) и месту исследования.

Активность язвенного колита оценивали с использованием MCS на момент отбора (и этот индекс считали базовым индексом MCS), на 6-й неделе (через 2 недели после введения на 4-й неделе) и на 10-й неделе (через 2 недели после последнего введения исследуемого лекарственного средства). Образцы биопсии прямой кишки получали в процессе гибкой сигмоидоскопии, проводимой в тех же временных точках. Во время исследования также получали частичный MCS. Также оценивали конечные результаты, по мнению пациентов, полученные путем использования короткого опросника при воспалительном заболевании кишечника (SIBDQ) и MCS, которые заполнялись пациентами в 1-й день и на 6-й и 10-й неделе. Кроме того, активность заболевания, ежедневные симптомы и влияние колита регистрировали в дневниках пациентов, заполняемых ими ежедневно от отбора (приблизительно за 7 дней и до 1-го дня) и по меньшей мере за 7 дней и до плановых посещений врача во время исследования на 6-й и 10-й неделе. Также получали образцы сыворотки и кала для анализа биомаркеров. Для измерения биомаркеров образцы стула собирали при отборе и на 6-й, 10-й и 28-й неделе. Примеры определяемых биомаркеров включали, но без ограничения ими, липокалин, калпротектин и лактоферрин. Для определения исследовательских биомаркеров сыворотку и плазму собирали при отборе, в 1-й день и на 4-й, 6-й, 10-й, 16-й и 28-й неделе.

Основным показателем эффективности для данного исследования являлась доля пациентов, достигающих клинической ремиссии, определенной как абсолютное снижение MCS≤2, причем ни один из отдельных показателей не превышал при этом 1 балл, к 10-й неделе. Дополнительные вторичные показатели эффективности перечислены в выходных показателях исследования.

Открытое расширенное исследование

Данное исследование представляет собой открытое расширенное (OLE) испытание для оценки безопасности и переносимости rhuMAb Beta7 у пациентов с умеренной и тяжелой формами UC, которые были включены в описанное выше исследование фазы II, и которые соответствовали критериям вхождения в OLE-исследование. В данном исследовании участвовало приблизительно 120 пациентов.

Все пациенты в данном OLE-исследовнии получали лечение rhuMAb Beta7 в дозировке 300 мг подкожно каждые 4 недели. Данное исследование разделяли на открытый период лечения в 104 недели и последующий 12-недельный период наблюдения, и период наблюдения на случай возникновения прогрессирующей мультифокальной лейкоэнцефалопатии (PML), составляющий 104 недели после введения последней дозы rhuMAb Beta7.

Все пациенты (плацебо или исследуемое лекарственное средство), принимающие участие в описанном выше исследовании фазы II, могли войти в данное OLE-исследование, если они удовлетворяли любому из нижеследующих критериев:

не имели клинического ответа в исследовании фазы II к 10-й неделе; пациенты могут принять участие в исследовании в любое время после 10-й недели и до 28-й недели (включительно); клинический ответ определен как в исследовании фазы II: по меньшей мере 3-бальное снижение и 30%-е уменьшение базового значения MCS, и снижение более чем на 1 балл показателя ректального кровотечения, либо абсолютная оценка ректального кровотечения, составляющая 0 или 1;

имели клинический ответ (описанный выше) в исследовании фазы II к 10-й неделе, но имели обострение UC между 10-й и 28-й неделями; обострение UC определяется, как и в исследовании фазы II: 2-бальное увеличение частичного MCS с 3 днями непрерывного ректального кровотечения и эндоскопический индекс, составляющий 2 на гибкой сигмоидоскопии;

завершили исследование фазы II на 28-й неделе периода последующего наблюдения.

Пациенты в США также должны были прекратить сопутствующую терапию иммуносупрессорами до участия в OLE-исследовании и должны были полностью прекратить примем пероральных кортикостероидов в течение 24 недель участия в OLE-исследовании.

Обоснование схемы исследования

Обострение дозировок

Обоснование предложенной схемы описано ниже.

Предлагаемые фиксированные дозы для подкожного введения в исследовании фазы II - 100, 300 и 420 мг - эквиваленты 1,25, 3,75, и 5,25 мг/кг соответственно для медианной массы пациента 80 кг. Ожидается, что дозировки, выбранные для исследования фазы II, обеспечивают наблюдаемый уровень воздействия, который показывал предварительную клиническую активность в исследовании фазы Ib (многодозовая стадия, описанная выше). Кроме того, как показывает профиль зависимости концентрации rhuMAb Beta7 в сыворотке от времени, смоделированный с использованием предварительных данных фазы I (фиг.4) предложенные группы дозировок 100 и 420/300 мг обеспечивают приблизительно 4,4-кратный диапазон доз и явное разграничение действия после учета межиндивидуальной вариабельности (IIV). Более того, ожидается, что группа 100 мг достигает равновесной минимальной концентрации 1-10 мкг/мл (минимальная остаточная концентрация, требуемая для занятости рецепторов) у всех пациентов, и группа дозировки 420/300 мг, как ожидается, будет давать равновесную минимальную концентрацию примерно 10 мкг/мл более чем у 90% пациентов. Предполагается, что первая ударная доза 420 мг и дополнительная доза 300 мг на 2-й неделе в этой группе максимизируют действие rhuMAb Beta7 раньше по ходу лечения для того, чтобы исследовать, может ли более раннее введение большего количества лекарственного средства вызвать более быстрое начало клинического ответа. По сравнению с наблюдаемыми данные по среднему действию в когорте 4 мг/кг IV из многодозовой стадии фазы I предсказанное действие в течение первых 2 или 4 недель (дни 0-14 или 0-28) для предложенной группы с высокой дозировкой имело коэффициент запаса 2,5 (на основе Cmax) или 1,3-2,2 (на основе AUC) (таблица 6).

Таблица 6
Коэффициент запаса для предложенной группы с высокой дозировкой по сравнению с действием в когорте 4 мг/кг IV из многодозовой стадии фазы I
Коэффициент запаса
Cmax,1 (мкг/мл) AUC0-14 (дни*мкг/мл) AUC0-28 (дни*мкг/мл) На основе Cmax,1 На основе AUC0-14 На основе AUC0-28
Наблюдаемые данные в фазе I Многодозовая стадия фазы 1, 4 мг/кг IV (3 раза каждые 4 недели) 117,1 785,9 1128,1
Моделированные данные фазы II 420+300 мг (2-я, 4-я и 8-я недели) 46,4 356 883,6 2,5 2,2 1,3

Фиксированная доза была предложена и подтверждена на основе следующих факторов. Во-первых, был проведен одномерный исследовательский анализ, к котором строили зависимость межиндивидуальной вариабельности (IIV) для выведения (CL) или центрального объема распределения (V1) (полученных из предварительной базовой популяционной ФК модели для внутривенного введения) относительно массы тела (BW) в качестве ковариаты. Графики IIV для CL или V1 относительно массы показывали небольшую зависимость или отсутствие зависимости CL или V1 от массы тела. Во-вторых, было проведено сравнение вариабельности в устойчивой максимальной сывороточной концентрации, предсказанной с помощью популяционной ФК модели (Cmax.ss) и площади под кривой зависимости сывороточной концентрации от времени от 0-го дня до 84-го дня (AUC0-84) для пациентов, получающих либо фиксированную дозу (300 мг), либо эквивалентную дозу по массе тела (3,75 мг/кг). Как продемонстрировано на фиг.5, медианные Cmax.ss и AUC0-84 были похожи для фиксированной дозы и дозы по массе тела. Смоделированными и показанными на фиг.5 варианты дозирования были доза по массе тела (3,75 мг/кг) и фиксированная доза (300 мг). На фиг.5 также показано, что межиндивидуальная вариабельность действия аналогична или немного меньше в случае фиксированных дозировок по сравнению с дозировкой по массе тела.

В итоге, предложенные для фазы II схемы дозирования, составляющие 100 мг SC в 0-ю, 4-ю и 8-ю недели, и 420 мг SC в 0-ю неделю с последующим введением 300 мг SC в 2-ю, 4-ю и 8-ю недели, основаны на объединенных клинических и ФК/ФД данных и уравновешивают необходимость соответствия безопасности и диапазону дозировок, а также потенциально демонстрируют клиническую активность. Использование фиксированной дозировки поддерживается и подтверждается известными ФК характеристиками rhuMAb Beta7 и результатом оценки вариабельности действия, описанными в настоящем описании.

Выходные показатели

Основной выходной показатель эффективности

Основным выходным показателем эффективности является клиническая ремиссия на 10-й неделе. Клиническую ремиссию определяют как MCS≤2, причем ни один из отдельных показателей не превышает 1 (см. таблицу 1).

Вторичные выходные показатели эффективности

Вторичными выходными показателями эффективности в данном исследовании являлись: (1) клинический ответ на 6-й и 10-й неделе, причем клинический ответ определяется по меньшей мере 3-балльным снижением и 30%-м уменьшением (относительно базовой линии) MCS и снижением более чем на 1 балл показателя ректального кровотечения, либо абсолютной оценкой ректального кровотечения, составляющей 0 или 1; (2) клиническая ремиссия (описанная выше) на 6-й неделе; и (3) эндоскопический показатель и показатель ректального кровотечения, составляющие 0, на 6-й и 10-й неделе.

Исследовательские выходные показатели

Исследовательскими выходными показателями в данном исследовании является время обострения язвенного колита у пациентов, которые достигали ответа или ремиссии. Для данного выходного показателя обострение определялось как 2-балльное увеличение частичного MCS, сопровождаемое 3 днями непрерывного ректального кровотечения и эндоскопическим индексом 2 на гибкой сигмоидоскопии.

Выходные показатели безопасности

Безопасность и переносимость rhuMAb Beta7 оценивали с использованием следующих показателей: (1) частота побочных эффектов и тяжелых побочных эффектов по шкале в соответствии с общими терминологическими критериями побочных эффектов, предложенными Национальным институтом раковых заболеваний (NCI CTCAE) версия 4.0; (2) клинически достоверные изменения в жизненных функциях и лабораторных показателях безопасности; (3) отмена лечения вследствие побочных эффектов; (4) частота и природа реакций и гиперчувствительности в местах инъекций; (5) частота инфекционных осложнений; и (6) иммуногенность, измеряемая частотой случаев ATA.

Фармакокинетические выходные показатели

Фармакокинетические выходные показатели включали следующее: (1) Cmax после первой и последней доз; (2) время достижения максимальной концентрации (Tmax) после первой и последней доз; (3) площадь под кривой (AUC) зависимости концентрации от времени в интервале дозировок после последней дозы; (4) AUC от 0-й временной точки до времени последнего наблюдения (AUCпослед.) или до бесконечности (AUC); (5) кажущийся клиренс (CL/F); (6) кажущийся объем распределения (V/F); и (7) период полувыведения (t1/2).

Критерии включения

Пациенты должны были соответствовать следующим критериям, чтобы подходить для включения в исследование: (1) способность и желание предоставить письменное информированное согласие; (2) 18-75 лет; (3) мужчины и женщины в репродуктивном возрасте должны выражать желание использовать надежный способ контрацепции (например, гормональные контрацептивы (перорально или в виде пластыря), вагинальное кольцо, внутриматочную спираль, физический барьер или наличие партнера с вазектомией) от начала исследований до не менее чем 4 месяцев (приблизительно 5 периодов полувыведения) после последнего введения исследуемого лекарственного средства; (4) диагноз умеренного или тяжелого язвенного колита у амбулаторных пациентов, в некоторых случаев с MCS≥5 баллов, или в некоторых случаях - с MCS≥6, включая эндоскопический показатель ≥2, показатель ректального кровотечения ≥1 (см. таблицу 1) и активность заболевания минимум в 25 см от края ануса; (5) длительность заболевания на момент отбора ≥12 недель (то есть после первой постановки диагноза терапевтом в соответствии с руководством ACG); (6) пациенты, которые принимают кортикостероиды, должны быть на стабильной дозе не более 20 мг/день преднизона или его эквивалента по меньшей мере за 2 недели до введения исследуемого лекарственного средства в 1-й день; (7) местные препараты кортикостероидов и 5-ASA должны быть отменены по меньшей мере за 2 недели до введения исследуемого лекарственного средства в 1-й день; (8) пациенты на пероральной 5-ASA должны быть на стабильной дозе по меньшей мере за 4 недели до введения исследуемого лекарственного средства в 1-й день; (9) пациенты, получающие иммуносупрессоры в форме AZA, 6-MP или метотрексата, должны быть на стабильной дозе по меньшей мере за 4 недели до введения исследуемого лекарственного средства в 1-й день. Пациенты, принимающие метотрексат, должны получить рекомендацию также принимать по 1 мг/день фолиевой кислоты (или ее эквивалента) при отсутствии противопоказаний; (10) пациенты на пробиотиках (например, Culturelle, Saccharomyces boulardii) должны быть на стабильных дозах по меньшей мере за 2 недели до введения исследуемого лекарственного средства в 1-й день; (11) пациенты на противодиарейных средствах (например, лоперамиде, дифероксилате с атропином) должны быть на стабильных дозах по меньшей мере за 2 недели до введения исследуемого лекарственного средства в 1-й день; (12) пациенты, которые ранее получали анти-TNF терапию, должны прекратить лечение не менее чем за 8 недель до введения исследуемого лекарственного средства в 1-й день; (13) пациенты, ранее получавшие лечение циклоспорином или такролимусом (FK506), должны прекратить терапию не менее чем за 4 недели до начала введения исследуемого лекарственного средства в 1-й день; (14) пациенты, которые ранее получали питание через зонд, определенные диеты или парентеральную поддержку/питание должны были прекратить эти процедуры за 3 недели до начала введения исследуемого лекарственного средства в 1-й день; (15) пациенты с диагнозом среднего или тяжелого язвенного колита должны были не отвечать или быть толерантными к иммуносупрессорам (например, AZA, 6-MP или метотрексату) и по меньшей мере одному анти-TNF средству.

Критерии исключения

Пациентов, которые отвечают следующим критериям, не включали в исследование. Критерии исключения, связанные с UC, включали: (1) обширную резекцию прямой кишки или почти полную или полную колэктомию; (2) присутствие илеостомии или колостомии; (3) анемия от средней до тяжелой (гемоглобин <9 г/дл); (4) история или данные о дисплазии слизистой оболочки толстой кишки.

Критерии исключения, связанные с общим состоянием здоровья, включали: (1) беременность или лактацию; (2) отсутствие доступа к периферическим венам; (3) неспособность к соблюдению протокола исследования по мнению исследователя; (4) тяжелое неконтролируемое заболевание, такие как неврологическое, сердечное, легочное, почечное, печеночное, эндокринное или желудочно-кишечное заболевания; (5) значительные нарушения в ЭКГ, включая данные об остром инфаркте миокарда, полной блокаде левой ножки предсердно-желудочкового пучка, блокаде сердца второй степени или полной блокаде сердца; (6) плохо контролируемый диабет (гликозилированный гемоглобин [HbAlc] >8,0%); (7) активное потребление алкоголя; (8) заболевания, кроме язвенного колита (например, астму), которые требуют лечения с использованием более 20 мг/день преднизона (или его эквивалента) в ходе лечения; (9) наличие онкозаболеваний за исключением полностью удаленной базальноклеточной карциномы или сквамозноклеточной карциномы кожи; (10) нарушенную функцию почек (уровень креатинина в сыворотке более чем в полтора раза превышает норму [ULN]); (11) нарушенную функцию печени в отсутствие диагноза первичного склерозирующего холангита (сывороточные трансаминазы более чем в 2,5 раза превышают ULN, щелочная фосфатаза более чем в 2,5 раза превышает ULN, общий билирубин более чем в 1,5 раза превышает ULN, либо нарушения в печеночных пробах по мнению исследователя являются клинически значимыми). Если пациент имеет диагноз первичного склерозирующего холангита, то: сывороточные трансаминазы более чем в 3 раза превышают ULN, щелочная фосфатаза более чем в 3 раза превышает ULN, общий билирубин более чем в 2,5 раза превышает ULN, либо нарушения в печеночных пробах по мнению исследователя являются клинически значимыми; (12) госпитализацию (кроме необязательной) в течение 4 недель до проведения отбора; (13) тромбоцитопению (тромбоциты <75000/мкл); (14) значительные нарушения при неврологическом обследовании при проведении отбора (включая нарушения в при кратком обследовании психического состояния (MMSE) и оценке PML).

Критерии исключения, связанные с факторами риска инфекций, включали: (1) врожденный иммунодефицит; (2) положительные тесты на антитела, указывающие на активную или предшествующую инфекцию ВИЧ или гепатита В (HBV) или С (HCV); (3) положительные титры IgM-антител при отрицательных титрах IgG на вирус Эпштейна-Барра; (4) положительный анализ стула на яйца глист или паразитов, положительные культуры стула на патогены или положительные результаты на Clostridium difficile по анализу стула на токсины на момент отбора; (5) биопсию слизистой кишечника, положительную по CMV; (6) положительный анализ при отборе на латентную инфекцию Mycobacterium tuberculosis (ТВ); (7) реакцию Манту или лабораторные методы анализа, такие как QuantiFERON®-TB Gold (QFT-G или эквивалентный анализ крови являются приемлемыми анализами при отборе; (8) QFT-G (или эквивалентный анализ крови) следует проводить у пациентов, ранее вакцинированных бациллой Кальметта-Герена (БЦЖ); (9) если отрицательная реакция Манту была получена в течение 3 месяцев до отбора, ее не нужно повторять; (10) пациенты с историей латентной туберкулезной инфекции, которые получали соответствующий и запротоколированный курс терапии, могут быть включены, если исследование на момент отбора и рентген грудной клетки, проведенный в течение 3 месяцев перед отбором, не выявили свидетельств текущей активной инфекции. В этом случае скрининговое исследование на туберкулез не требуется; (11) наличие любых оппортунистических инфекций в течение 12 недель перед началом лечения исследуемым лекарственным средством; (12) демиелинизирующее заболевание или наличие PML; (13) любые текущие или недавние (в течение 4 недель до начала лечения исследуемым лекарственным средством) признаки или симптомы инфекции; (14) прием пероральных антибиотиков в течение 4 недель до начала лечения исследуемым лекарственным средством или внутривенных антибиотиков в течение 8 недель до начала лечения исследуемым лекарственным средством; (15) получение живой аттенуированной вакцины в течение 4 недель до начала лечения исследуемым лекарственным средством; (16) нейтропению (общее число нейтрофилов <1500/мкл) или лимфопению (общее число лимфоцитов <500/мкл).

Критерии исключения, связанные с приемом сопутствующих лекарственных средств против язвенного колита, включали: (1) получение экспериментального лечения в течение 12 недель до начала лечения исследуемым лекарственным средством (или в течение 5 периодов полувыведения экспериментального продукта, что продолжительнее); (2) предшествующее введение ритуксимаба (в течение предшествующих 6 месяцев); (3) предшествующее введение rhuMAb Beta7; (4) история тяжелых аллергических или анафилактических реакций на химерные, человеческие или гуманизированные антитела или слитые белки.

Исследуемый метод лечения

Исследуемое лекарственное средство и плацебо

Лекарственное средство rhuMAb Beta7 и плацебо были произведены Genentech. Они представляли собой водные растворы от прозрачных до опалесцирующих, от бесцветных или слегка желтых. Оба раствора представляли собой стерильную и свободную от консервантов жидкость, предназначенную для внутривенного и подкожного введения.

Дозировки и введение

Пациентов распределяли случайным образом (1:1:1) для получения либо (1) 100 мг rhuMAb Beta7 в 0-й неделе с последующим введением плацебо на 2-й неделе, и по 100 мг rhuMAb Beta7 на 4-й и 8-й неделе; либо (2) 420 мг rhuMAb Beta7 в 0-й неделе с последующим введением по 300 мг на 2-й, 4-й и 8-й неделе; либо (3) плацебо в 0-й, 2-й, 4-й и 8-й неделе.

Все дозировки вводили подкожно. Инъекции производили в брюшинную область. Если брюшинная область не доступна для инъекций, то пациент получал лекарственное средство подкожно в бедро. Каждый пациент получал одну или более инъекций (сколько необходимо для конкретной вводимой дозировки).

Способы анализа

Анализ на антитела к терапевтическому средству

Для оценки АТА у всех пациентов получали образцы сыворотки. Образцы сыворотки на АТА анализировали с использованием утвержденного связывающего антитела электролюминесцентного метода анализа. При необходимости, для оценки АТА-ответа можно использовать ФК образцы. Методы анализа следовали общему руководству для тестов на АТА (Mire-Sluis et al. J Immunol. Methods 289:1-16 (2004)). Метод анализа подробно описан выше.

Фармакокинетические методы анализа

Для определения и описания фармакокинетики rhuMAb Beta7 у всех пациентов получали образцы сыворотки. ФК образцы сыворотки анализировали с использованием утвержденной связывающей ELISA с минимальной определяемой концентрацией 12,5 нг/мл. Метод анализа подробно описан выше.

Фармакодинамические методы анализа

Для анализа исследовательских ФД маркеров анализировали образцы цельной крови и/или сыворотки с использованием сертифицированных методов, включая проточную цитометрию, кОТ-ПЦР и/или ELISA. Более подробно методы анализа описаны выше. Однако в случае исследования фазы II, вместо rhuMabBeta7 использовали другое конкурирующее анти-бета7 антитело, FIB504 (которое связывает такой же эпитоп, что и rhuMAb Beta7).

Анализы эффективности

Основной показатель эффективности

Основным показателем эффективности является поддержание ремиссии. Поддержание ремиссии относится к доле пациентов в клинической ремиссии за заданный период времени, например, за 6 месяцев, 1 год или 2 года. Разницу между каждой группой, получающей rhuMAb Beta7, и плацебо оценивали с использованием статистического анализа Мантеля-Гензеля, стратифицированного по сопутствующему лечению кортикостероидами, сопутствующему лечению иммуносупрессорами и предшествующему лечению анти-TNF средствами. Дополнительно, разницу между группами оценивали путем создания 80%-х доверительных интервалов для основного показателя эффективности. Описание итогов статистической обработки приводили для каждой группы.

Также приводили оценку устойчивой ремиссии. Устойчивая ремиссия представляет собой число пациентов, которые после достижения ремиссии оставались в ней на протяжении всего времени. Это представляет собой восприятие индивидуального пациента от наступления ремиссии до следующего обострения. Это означает, что пациенту не требуется увеличение сопутствующего лекарственного средства для язвенного колита, чтобы находиться в ремиссии.

Вторичные показатели эффективности

Вторичными показателями эффективности для данного исследования являлись следующие: (1) доля пациентов с клиническим ответом на 6-й и 10-й неделе, причем клинический ответ определяется по меньшей мере 3-балльным снижением и 30%-м уменьшением (относительно базовой линии) MCS и снижением более чем на 1 балл показателя ректального кровотечения, либо абсолютной оценкой ректального кровотечения, составляющей 0 или 1; (2) доля пациентов в клинической ремиссии (описанной выше) на 6-й неделе; и (3) доля пациентов, которые достигли эндоскопического показателя и показателя ректального кровотечения, составляющих 0.

Вторичные показатели эффективности анализировали аналогично основному показателю эффективности (описано выше).

Анализ безопасности

Безопасность оценивали путем регистрации побочных эффектов, проведения клинических лабораторных обследований и оценки иммуногенности путем измерения АТА. Анализ пациентов проводили в согласии с фактически получаемым лечением.

Побочные эффекты регистрировали, начиная со времени выдачи информированного согласия и до завершения пациентом исследования или более раннего прекращения исследования. Отдельные итоги по побочным эффектам предоставляли для периода отбора, для 10-недельного периода лечения и для 18-недельного периода последующего наблюдения. Побочные эффекты группировали по группам воздействия.

Клинические лабораторные данные (биохимические, гематологические, включая клинический анализ крови с дифференциальным анализом и подсчетом тромбоцитов, и анализ мочи) объединяли по группам с использованием описательной статистики.

В анализ безопасности были включены все пациенты.

Фармакокинетические и фармакодинамические анализы

Фармакокинетические параметры, полученные из сывороточных концентраций rhuMAb Beta7, включая Cmax после первой и последней доз, Tmax после первой и последней доз, AUC в пределах последнего дозирования (AUC57-85) и от 0-й временной точки до времени последнего детектируемого наблюдения (AUCпослед.) или до бесконечности (AUC), CL/F, V/F и t1/2, оценивали для всех пациентов с использованием либо бескамерного или популяционного ФК методов. Получали графики профилей зависимости индивидуальных и средних концентраций rhuMAb Beta7 в сыворотке от времени. Концентрации rhuMAb Beta7 в сыворотке и ФК параметры приводили для каждого пациента и схемы дозирования, и обобщали с помощью описательной статистики.

ФК данные из данного исследования можно объединить с данными из исследования фазы I для проведения популяционного ФК анализа. Типовые значения ФК параметров для популяции оценивали для популяции из всего исследования, параллельно с оценкой внутренней и межиндивидуальной вариабельности и оценкой средней ошибки. Оценки параметров индивидуальных пациентов вычисляли с использованием процедуры ретроспективного анализа. Создавали план будущего анализа, и популяционный ФК анализ представляли в описании отдельно от описания клинического исследования. Популяционный ФК анализ может включать исследовательский анализ для идентификации базовых ковариат, которые влияют на фармакокинетику rhuMAb Beta7 в этой популяции пациентов. Базовые ковариаты, которые подлежат исследованию, включали демографические и другие характеристики пациентов, такие как тяжесть заболевания и отдельные лабораторные показатели. Данные обобщали с использованием соответствующей описательной статистически.

Оценка взаимосвязи действия лекарственного средства и клинического ответа была исследовательской, и может быть проведена оценка корреляции между воздействием rhuMAb Beta7 (Cmax, Cmin или AUC) и клиническими показателями (такими как MCS).

Все анализы, связанные с ФД биомаркерами, были исследовательскими. Результаты обобщали как абсолютные значения и/или изменения от базовой линии. В зависимости от обстоятельств проводили дополнительный ФК и ФД анализ.

Предварительные результаты расширенного исследования

Первые 16 пациентов в открытом расширенном исследовании, которые не отвечали на анти-TNF агенты, были обследованы с использованием частичного индекса клинических проявлений по шкале Мейо (pMCS). pMCS включал три составляющих полного индекса клинических проявлений по шкале Мейо: ежедневное число дефекаций, число ректальных кровотечений за день, и общую терапевтическую оценку состояния болезни, которая была основана на предшествующих двух составляющих, но также учитывала любую брюшную боль, которую испытывает пациент, а также как хорошо в общем себя чувствует пациент относительно своего язвенного колита. Предварительные результаты для каждого из 16 пациентов показаны на фиг.8.

Как видно из фиг.8, 13 из 16 пациентов демонстрировали по меньшей мере однобалльное улучшение в pMCS. 11 из 16 пациентов демонстрировали 2-балльное улучшение в pMCS. Кроме того, шесть пациентов получали лечение в течение 12-16 недель, и три четверти из них демонстрировали улучшение со временем. Поэтому, хотя и предварительно, эти данные свидетельствуют о клинической активности rhuMAb Beta7 у пациентов с умеренным и тяжелым язвенным колитом, устойчивым к анти-TNF терапии.

Таким образом, rhuMAb Beta7 связывается с α4β7 и αΕβ7, рецепторами, которые регулируют перемещение и удержание субпопуляций лимфоцитов соответственно в слизистой оболочке кишечника. Клинические исследования продемонстрировали эффективность анти-α4 антитела (натализумаба) для лечения CD, и обнадеживающие результаты наблюдались для анти-α4β7 антитела (LDP02/MLN02/MLN0002/ведолизумаба) при лечении UC. Эти данные валидируют α4β7 в качестве терапевтической мишени и поддерживают гипотезу, что взаимодействие между α4β7 и MAdCAM 1 вносит вклад в патогенез IBD. Специфичность rhuMAb Beta7 относительно блокирования перемещения лимфоцитов в слизистую оболочку кишечника в дополнение к потенциальным аддитивным терапевтическим эффектам направленного действия на αΕβ7 являются вескими причинами продолжения клинических исследований данного антитела для лечения IBD. Потенциальные эффекты rhuMAb Beta7 могут включать снижение тяжести заболевания у пациентов с UC, определяемое по индексу клинических проявлений по шкале Мейо, и могут также вызвать ремиссию, также определяемую по индексу клинических проявлений по шкале Мейо.

1. Способ лечения желудочно-кишечного воспалительного заболевания у пациента, включающий введение пациенту терапевтически эффективного количества антагониста интегрина бета 7, где антагонист интегрина бета 7 вводят подкожно в фиксированной дозе.

2. Способ по п. 1, в котором антагонист интегрина бета 7 представляет собой моноклональное анти-бета 7 антитело.

3. Способ по п. 2, в котором анти-бета 7 антитело вводят в фиксированной дозе от приблизительно 50 мг до приблизительно 450 мг.

4. Способ по п. 3, в котором фиксированная доза составляет приблизительно 50 мг.

5. Способ по п. 3, в котором фиксированная доза составляет приблизительно 100 мг.

6. Способ по п. 3, в котором фиксированная доза составляет приблизительно 150 мг.

7. Способ по п. 3, в котором фиксированная доза составляет приблизительно 200 мг.

8. Способ по п. 3, в котором фиксированная доза составляет приблизительно 300 мг.

9. Способ по п. 3, в котором фиксированная доза составляет приблизительно 350 мг.

10. Способ по п. 3, в котором фиксированная доза составляет приблизительно 400 мг.

11. Способ по п. 3, в котором фиксированная доза составляет приблизительно 420 мг.

12. Способ по п. 3, в котором фиксированная доза составляет приблизительно 450 мг.

13. Способ по п. 2, в котором анти-бета 7 антитело вводят раз в неделю или каждые две недели, или каждые четыре недели, или каждые шесть недель, или каждые восемь недель.

14. Способ по п. 13, в котором анти-бета 7 антитело вводят в течение двух месяцев или трех месяцев, или шести месяцев, или 12 месяцев, или 18 месяцев, или 24 месяцев, или в течение всей жизни пациента.

15. Способ по п. 1, в котором пациентом является человек.

16. Способ по п. 1, в котором желудочно-кишечным воспалительным заболеванием является воспалительное заболевание кишечника.

17. Способ по п. 16, в котором воспалительным заболеванием кишечника является язвенный колит или болезнь Крона.

18. Способ по п. 2, в котором анти-бета 7 антитело выбрано из химерного антитела, антитела человека и гуманизированного антитела.

19. Способ по п. 1, в котором антагонист интегрина бета 7 представляет собой фрагмент моноклонального анти-бета 7 антитела.

20. Способ по п. 2, в котором анти-бета 7 антитело содержит шесть гипервариабельных участков (HVR), в которых:
(i) HVR-L1 содержит аминокислотную последовательность А1-А11, где А1-А11 представляет собой RASESVDTYLH (SEQ ID NO: 1); RASESVDSLLH (SEQ ID NO: 7), RASESVDTLLH (SEQ ID NO: 8) или RASESVDDLLH (SEQ ID NO: 9), или вариант SEQ ID NO: 1, 7, 8 или 9 (SEQ ID NO: 26), в котором аминокислота A2 выбрана из группы, состоящей из A, G, S, Т и V, и/или аминокислота A3 выбрана из группы, состоящей из S, G, I, K, N, Р, Q, R и Т, и/или аминокислота А4 выбрана из группы, состоящей из Е, V, Q, A, D, G, Н, I, K, L, N и R, и/или аминокислота А5 выбрана из группы, состоящей из S, Y, A, D, G, Н, I, K, N, Р, R, Т и V, и/или аминокислота А6 выбрана из группы, состоящей из V, R, I, A, G, K, L, М и Q, и/или аминокислота А7 выбрана из группы, состоящей из D, V, S, А, Е, G, Н, I, K, L, N, Р, S и Т, и/или аминокислота А8 выбрана из группы, состоящей из D, G, N, Е, Т, Р и S, и/или аминокислота А9 выбрана из группы, состоящей из L, Y, I и М, и/или аминокислота А10 выбрана из группы, состоящей из L, А, I, М и V, и/или аминокислота All выбрана из группы, состоящей из Н, Y, F и S;
(ii) HVR-L2 содержит аминокислотную последовательность В1-В8, где В1-В8 представляет собой KYASQSIS (SEQ ID NO: 2), RYASQSIS (SEQ ID NO: 20) или XaaYASQSIS (SEQ ID NO: 21, где Хаа представляет собой любую аминокислоту), или вариант SEQ ID NO: 2, 20 или 21 (SEQ ID NO: 27), в котором аминокислота В1 выбрана из группы, состоящей из K, R, N, V, A, F, Q, Н, Р, I, L, Y и Хаа (где Хаа представляет собой любую аминокислоту), и/или аминокислота В4 выбрана из группы, состоящей из S и D, и/или аминокислота В5 выбрана из группы, состоящей из Q и S, и/или аминокислота Вб выбрана из группы, состоящей из S, D, L и R, и/или аминокислота В7 выбрана из группы, состоящей из I, V, Е и K;
(iii) HVR-L3 содержит аминокислотную последовательность С1-С9, где С1-С9 представляет собой QQGNSLPNT (SEQ ID NO: 3) или вариант SEQ ID NO: 3 (SEQ ID NO: 28), в котором аминокислота C8 выбрана из группы, состоящей из N, V, W, Y, R, S, Т, A, F, Н, I, L и М;
(iv) HVR-H1 содержит аминокислотную последовательность D1-D10, где D1-D10 представляет собой GFFITNNYWG (SEQ ID NO: 4);
(v) HVR-H2 содержит аминокислотную последовательность E1-E17, где Е1-Е17 представляет собой GYISYSGSTSYNPSLKS (SEQ ID NO: 5) или вариант SEQ ID NO: 5 (SEQ ID NO: 29), в котором аминокислота Е2 выбрана из группы, состоящей из Y, F, V и D, и/или аминокислота Е6 выбрана из группы, состоящей из S и G, и/или аминокислота Е10 выбрана из группы, состоящей из S и Y, и/или аминокислота Е12 выбрана из группы, состоящей из N, Т, А и D, и/или аминокислота 13 выбрана из группы, состоящей из Р, Н, D и А, и/или аминокислота Е15 выбрана из группы, состоящей из L и V, и/или аминокислота Е17 выбрана из группы, состоящей из S и G; и
(vi) HVR-H3 содержит аминокислотную последовательность F2-F11, причем F2-F11 представляет собой MTGSSGYFDF (SEQ ID NO: 6) или RTGSSGYFDF (SEQ ID NO: 19), или содержит аминокислотную последовательность F1-F11, где F1-F11 представляет собой AMTGSSGYFDF (SEQ ID NO: 16), ARTGSSGYFDF (SEQ ID NO: 17) или AQTGSSGYFDF (SEQ ID NO: 18), или вариант SEQ ID NO: 6, 16, 17, 18 или 19 (SEQ ID NO: 30), в котором аминокислота F2 является R, М, А, Е, G, Q, S, и/или аминокислота F11 выбрана из группы, состоящей из F и Y.

21. Способ по п. 20, в котором анти-бета 7 антитело содержит три последовательности гипервариабельных областей тяжелой цепи (HVR-H1-H3) и три последовательности гипервариабельных областей легкой цепи (HVR-L1-L3), в которых:
(i) HVR-L1 содержит SEQ ID NO: 7, SEQ ID NO: 8 или SEQ ID NO: 9;
(ii) HVR-L2 содержит SEQ ID NO: 2;
(iii) HVR-L3 содержит SEQ ID NO: 3;
(iv) HVR-H1 содержит SEQ ID NO: 4;
(v) HVR-H2 содержит SEQ ID NO: 5; и
(vi) HVR-H3 содержит SEQ ID NO: 6 или SEQ ID NO: 16, или SEQ ID NO: 17, или SEQ ID NO: 19.

22. Способ по п. 21, в котором анти-бета 7 антитело содержит:
(i) HVR-L1 содержит SEQ ID NO: 9;
(ii) HVR-L2 содержит SEQ ID NO: 2;
(iii) HVR-L3 содержит SEQ ID NO: 3;
(iv) HVR-H1 содержит SEQ ID NO: 4;
(v) HVR-H2 содержит SEQ ID NO: 5; и
(vi) HVR-H3 содержит SEQ ID NO: 19.

23. Способ по п. 21 или 22, в котором анти-бета 7 антитело вводят в фиксированной дозе приблизительно 100 мг каждые четыре недели, где пациент страдает язвенным колитом, и у пациента наблюдается заживление слизистой оболочки или снижение обострений со временем.

24. Способ по п. 21 или 22, в котором анти-бета 7 антитело вводят в фиксированной дозе приблизительно 300 мг каждые четыре недели, где пациент страдает язвенным колитом, и у пациента наблюдается заживление слизистой оболочки или снижение обострений со временем.

25. Способ лечения желудочно-кишечного воспалительного заболевания у пациента, включающий введение пациенту терапевтически эффективного количества антагониста интегрина бета 7, где введение включает введение первой ударной дозы и введение по меньшей мере одной последующей поддерживающей дозы, причем каждую из ударной дозы и по меньшей мере одной поддерживающей дозы вводят подкожно в фиксированной дозе.

26. Способ по п. 25, в котором антагонист интегрина бета 7 представляет собой моноклональное анти-бета 7 антитело.

27. Способ по п. 26, в котором ударная доза составляет от приблизительно 400 мг до приблизительно 450 мг, и поддерживающая доза составляет от приблизительно 50 мг до приблизительно 350 мг.

28. Способ по п. 27, в котором ударная доза составляет приблизительно 400 мг или приблизительно 420 мг, или приблизительно 430 мг, или приблизительно 450 мг.

29. Способ по п. 27, в котором поддерживающая доза составляет приблизительно 50 мг или приблизительно 100 мг, или приблизительно 150 мг, или приблизительно 200 мг, или приблизительно 300 мг, или приблизительно 350 мг.

30. Способ по п. 27, в котором ударная доза составляет приблизительно 400 мг, и поддерживающая доза составляет приблизительно 50 мг или приблизительно 100 мг, или приблизительно 150 мг, или приблизительно 200 мг, или приблизительно 300 мг, или приблизительно 350 мг.

31. Способ по п. 27, в котором ударная доза составляет приблизительно 420 мг, и поддерживающая доза составляет приблизительно 50 мг или приблизительно 100 мг, или приблизительно 150 мг, или приблизительно 200 мг, или приблизительно 300 мг, или приблизительно 350 мг.

32. Способ по п. 27, в котором ударная доза составляет приблизительно 430 мг, и поддерживающая доза составляет приблизительно 50 мг или приблизительно 100 мг, или приблизительно 150 мг, или приблизительно 200 мг, или приблизительно 300 мг, или приблизительно 350 мг.

33. Способ по п. 27, в котором ударная доза составляет приблизительно 450 мг, и поддерживающая доза составляет приблизительно 50 мг или приблизительно 100 мг, или приблизительно 150 мг, или приблизительно 200 мг, или приблизительно 300 мг, или приблизительно 350 мг.

34. Способ по п. 27, в котором ударная доза составляет приблизительно 400 мг или приблизительно 420 мг, или приблизительно 430 мг, или приблизительно 450 мг, и поддерживающая доза составляет приблизительно 50 мг.

35. Способ по п. 27, в котором ударная доза составляет приблизительно 400 мг или приблизительно 420 мг, или приблизительно 430 мг, или приблизительно 450 мг, и поддерживающая доза составляет приблизительно 100 мг.

36. Способ по п. 27, в котором ударная доза составляет приблизительно 400 мг или приблизительно 420 мг, или приблизительно 430 мг, или приблизительно 450 мг, и поддерживающая доза составляет приблизительно 150 мг.

37. Способ по п. 27, в котором ударная доза составляет приблизительно 400 мг или приблизительно 420 мг, или приблизительно 430 мг, или приблизительно 450 мг, и поддерживающая доза составляет приблизительно 200 мг.

38. Способ по п. 27, в котором ударная доза составляет приблизительно 400 мг или приблизительно 420 мг, или приблизительно 430 мг, или приблизительно 450 мг, и поддерживающая доза составляет приблизительно 300 мг.

39. Способ по п. 27, в котором ударная доза составляет приблизительно 400 мг или приблизительно 420 мг, или приблизительно 430 мг, или приблизительно 450 мг, и поддерживающая доза составляет приблизительно 350 мг.

40. Способ по п. 38, в котором ударная доза составляет приблизительно 420 мг.

41. Способ по п. 38, в котором ударная доза составляет приблизительно 450 мг.

42. Способ по п. 25, в котором первую поддерживающую дозу вводят через один день или через одну неделю, или чрез две недели, или через четыре недели после ударной дозы.

43. Способ по п. 25, в котором первую поддерживающую дозу вводят в тот же день, что и ударную дозу.

44. Способ по п. 42 или п. 43, в котором каждую вторую и каждую последующую поддерживающую дозу вводят каждые две недели или каждые четыре недели, или каждые восемь недель.

45. Способ по п. 25, в котором первую поддерживающую дозу вводят через две недели после ударной дозы, вторую поддерживающую дозу вводят через две недели после первой поддерживающей дозы, и каждую последующую поддерживающую дозу вводят каждые четыре недели.

46. Способ по п. 26, в котором анти-бета 7 антитело вводят в течение двух месяцев или трех месяцев, или шести месяцев, или 12 месяцев, или 18 месяцев, или 24 месяцев, или в течение всей жизни пациента.

47. Способ по п. 25, в котором пациентом является человек.

48. Способ по п. 25, в котором желудочно-кишечным воспалительным заболеванием является воспалительное заболевание кишечника.

49. Способ по п. 48, в котором воспалительным заболеванием кишечника является язвенный колит или болезнь Крона.

50. Способ по п. 26, в котором анти-бета 7 антитело выбрано из химерного антитела, антитела человека и гуманизированного антитела.

51. Способ по п. 25, в котором антагонист интегрина бета 7 представляет собой фрагмент моноклонального анти-бета 7 антитела.

52. Способ по п. 26, в котором анти-бета 7 антитело содержит шесть гипервариабельных участков (HVR), в которых:
(i) HVR-L1 содержит аминокислотную последовательность А1-А11, где А1-А11 представляет собой RASESVDTYLH (SEQ ID NO: 1); RASESVDSLLH (SEQ ID NO: 7), RASESVDTLLH (SEQ ID NO: 8) или RASESVDDLLH (SEQ ID NO: 9), или вариант SEQ ID NO: 1, 7, 8 или 9 (SEQ ID NO: 26), в котором аминокислота A2 выбрана из группы, состоящей из A, G, S, Т и V, и/или аминокислота A3 выбрана из группы, состоящей из S, G, I, K, N, Р, Q, R и Т, и/или аминокислота А4 выбрана из группы, состоящей из Е, V, Q, A, D, G, Н, I, K, L, N и R, и/или аминокислота А5 выбрана из группы, состоящей из S, Y, A, D, G, Н, I, K, N, Р, R, Т и V, и/или аминокислота А6 выбрана из группы, состоящей из V, R, I, A, G, K, L, М и Q, и/или аминокислота А 7 выбрана из группы, состоящей из D, V, S, А, Е, G, Н, I, K, L, N, Р, S и Т, и/или аминокислота А8 выбрана из группы, состоящей из D, G, N, Е, Т, Р и S, и/или аминокислота А9 выбрана из группы, состоящей из L, Y, I и М, и/или аминокислота А10 выбрана из группы, состоящей из L, А, I, М и V, и/или аминокислота A11 выбрана из группы, состоящей из Н, Y, F и S;
(ii) HVR-L2 содержит аминокислотную последовательность BIBB, где В1-В8 представляет собой KYASQSIS (SEQ ID NO: 2), RYASQSIS (SEQ ID NO: 20) или XaaYASQSIS (SEQ ID NO: 21, где Хаа представляет собой любую аминокислоту), или вариант SEQ ID NO: 2, 20 или 21 (SEQ ID NO: 27), в котором аминокислота В1 выбрана из группы, состоящей из K, R, N, V, A, F, Q, Н, Р, I, L, Y и Хаа (где Хаа представляет собой любую аминокислоту), и/или аминокислота В4 выбрана из группы, состоящей из S и D, и/или аминокислота В5 выбрана из группы, состоящей из Q и S, и/или аминокислота Вб выбрана из группы, состоящей из S, D, L и R, и/или аминокислота В7 выбрана из группы, состоящей из I, V, Е и K;
(iii) HVR-L3 содержит аминокислотную последовательность С1-С9, где С1-С9 представляет собой QQGNSLPNT (SEQ ID NO: 3) или вариант SEQ ID NO: 3 (SEQ ID NO: 28), в котором аминокислота С8 выбрана из группы, состоящей из N, V, W, Y, R, S, Т, A, F, Н, I, L и М;
(iv) HVR-H1 содержит аминокислотную последовательность D1-D10, где D1-D10 представляет собой GFFITNNYWG (SEQ ID NO: 4);
(v) HVR-H2 содержит аминокислотную последовательность E1-E17, где Е1-Е17 представляет собой GYISYSGSTSYNPSLKS (SEQ ID NO: 5) или вариант SEQ ID NO: 5 (SEQ ID NO: 29), в котором аминокислота Е2 выбрана из группы, состоящей из Y, F, V и D, и/или аминокислота Е6 выбрана из группы, состоящей из S и G, и/или аминокислота Е10 выбрана из группы, состоящей из S и Y, и/или аминокислота Е12 выбрана из группы, состоящей из N, Т, А и D, и/или аминокислота 13 выбрана из группы, состоящей из Р, Н, D и А, и/или аминокислота Е15 выбрана из группы, состоящей из L и V, и/или аминокислота Е17 выбрана из группы, состоящей из S и G; и
(vi) HVR-H3 содержит аминокислотную последовательность F2-F11, где F2-F11 представляет собой MTGSSGYFDF (SEQ ID NO: 6) или RTGSSGYFDF (SEQ ID NO: 19), или содержит аминокислотную последовательность F1-F11, где F1-F11 представляет собой AMTGSSGYFDF (SEQ ID NO: 16), ARTGSSGYFDF (SEQ ID NO: 17) или AQTGSSGYFDF (SEQ ID NO: 18), или вариант SEQ ID NO: 6, 16, 17, 18 или 19 (SEQ ID NO: 30), в котором аминокислота F2 является R, М, А, Е, G, Q, S, и/или аминокислота F11 выбрана из группы, состоящей из F и Y.

53. Способ по п. 52, в котором анти-бета 7 антитело содержит три последовательности гипервариабельных областей тяжелой цепи (HVR-H1-H3) и три последовательности гипервариабельных областей легкой цепи (HVR-L1-L3), в которых:
(i) HVR-L1 содержит SEQ ID NO: 7, SEQ ID NO: 8 или SEQ ID NO: 9;
(ii) HVR-L2 содержит SEQ ID NO: 2;
(iii) HVR-L3 содержит SEQ ID NO: 3;
(iv) HVR-H1 содержит SEQ ID NO: 4;
(v) HVR-H2 содержит SEQ ID NO: 5; и
(vi) HVR-H3 содержит SEQ ID NO: 6 или SEQ ID NO: 16, или SEQ ID NO: 17, или SEQ ID NO: 19.

54. Способ по п. 53, в котором анти-бета 7 антитело содержит:
(i) HVR-L1 содержит SEQ ID NO: 9;
(ii) HVR-L2 содержит SEQ ID NO: 2;
(iii) HVR-L3 содержит SEQ ID NO: 3;
(iv) HVR-H1 содержит SEQ ID NO: 4;
(v) HVR-H2 содержит SEQ ID NO: 5; и
(vi) HVR-H3 содержит SEQ ID NO: 19.

55. Способ по любому из пп. 1-54, в котором антагонист интегрина бета 7 вводят по меньшей мере с одним дополнительным соединением, выбранным из 5-аминосалициловой кислоты (5-ASA), азатиоприна (AZA), 6-меркаптопурина (6-МР) и метотрексата.

56. Способ по любому из пп. 1-54, в котором пациент ранее не отвечал по меньшей мере на один биологический агент.

57. Способ по п. 56, в котором биологический агент выбран из адалимумаба, этанерцепта, инфликсимаба, голимумаба, цертолизумаба пегола, натализумаба и ведолизумаба.

58. Способ по любому из пп. 1-54, в котором антагонист интегрина бета 7 вводят с помощью устройства для самоинъекций.

59. Способ по п. 58, в котором устройство для самоинъекций выбрано из предварительно заполненного шприца, устройства с микроиглой, устройства для автоматических инъекций и безыгольного устройства для инъекций.

60. Способ индукции ремиссии у пациента, страдающего язвенным колитом, включающий введение пациенту терапевтически эффективного количества моноклонального анти-бета 7 антитела, где это анти-бета 7 антитело вводят подкожно в фиксированной дозе либо приблизительно 100 мг, либо приблизительно 300 каждые четыре недели, при этом анти-бета 7 антитело содержит:
(i) HVR-L1 содержит SEQ ID NO: 9;
(ii) HVR-L2 содержит SEQ ID NO: 2;
(iii) HVR-L3 содержит SEQ ID NO: 3;
(iv) HVR-H1 содержит SEQ ID NO: 4;
(v) HVR-H2 содержит SEQ ID NO: 5; и
(vi) HVR-H3 содержит SEQ ID NO: 19.

61. Способ по п. 60, в котором моноклональное анти-бета 7 антитело представляет собой этролизумаб.

62. Способ по п. 60 или 61, дополнительно включающий определение индекса клинических проявлений по шкале Мейо или показателей шкалы Мейо, причем определяют, что пациент имеет абсолютный индекс Мейо ≤2, и ни один из индивидуальных показателей не превышает 1.

63. Способ по п. 62, в котором ремиссия начинается по меньшей мере к 10-й неделе после первого введения анти-бета 7 антитела.

64. Способ индукции стабильной ремиссии у пациента, страдающего язвенным колитом, включающий введение пациенту терапевтически эффективного количества моноклонального антибета 7 антитела, где анти-бета 7 антитело вводят подкожно в фиксированной дозе либо приблизительно 100 мг, либо приблизительно 300 мг каждые четыре недели, причем ремиссия сохраняется на протяжении 8 недель после начала или в течение 30 недель после начала, или в течение 50 недель после начала, или в течение 54 недель после начала ремиссии, при этом анти-бета 7 антитело содержит:
(i) HVR-L1 содержит SEQ ID NO: 9;
(ii) HVR-L2 содержит SEQ ID NO: 2;
(iii) HVR-L3 содержит SEQ ID NO: 3;
(iv) HVR-H1 содержит SEQ ID NO: 4;
(v) HVR-H2 содержит SEQ ID NO: 5; и
(vi) HVR-H3 содержит SEQ ID NO: 19.

65. Способ по п. 64, в котором моноклональное анти-бета 7 антитело представляет собой этролизумаб.

66. Способ по п. 64 или 65, в котором ремиссия возникает без стероидов.

67. Способ по п. 66, в котором ремиссия без стероидов продолжается в течение 20 недель после начала или в течение 24 недель, или более длительного периода после своего начала.



 

Похожие патенты:

Настоящее изобретение относится к производному трисахарида, пригодному для использования в качестве адъюванта, его получению и применению в медицине. Предложенное производное трисахарида содержит трисахаридное ядро из раффинозы, мелецитозы или мальтотриозы, полностью замещенное группами сложных эфиров жирных кислот и одной-двумя анионными группами, выбранными из сложного эфира серной кислоты или сложного эфира фосфорной кислоты, причем группа сложного эфира жирной кислоты представляет собой сложный эфир прямой, разветвленной, насыщенной или ненасыщенной жирной кислоты с длиной цепи от 4 до 20 атомов углерода.

Настоящее изобретение относится к области иммунологии. Предложено выделенное антитело и его антигенсвязывающий фрагмент, которые специфически связываются с индуцируемым глюкокортикоидами рецептором TNF (GITR) человека; а также композиции, в том числе фармацевтическая композиция, и способ усиления иммунного ответа у человека.

Изобретение относится к области биохимии, в частности к антителу против TNF(фактор некроза опухоли)-α или анти-TNF-α-связывающему фрагменту антитела. Также раскрыта фармацевтическая композиция для лечения патологий и заболеваний, связанных с TNF-α, содержащая терапевтически эффективное количество вышеуказанного антитела или его фрагмент.

Группа изобретений относится к медицине, фармакологии и касается применения 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-({3-нитро-4-[(тетрагидро-2Н-пиран-4-илметил)амино]фенил}сульфонил)-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамида, или 4-(4-{[2-(4-хлорфенил)-4,4-диметилциклогекс-1-ен-1-ил]метил}пиперазин-1-ил)-N-[(4-{[(транс-4-гидрокси-4-метилциклогексил)метил]амино}-3-нитрофенил)сульфонил]-2-(1Н-пирроло[2,3-b]пиридин-5-илокси)бензамида, или их фармацевтически приемлемых солей для получения лекарственного средства.

Изобретение относится к области медицины, в частности к способу иммунотерапии солидных опухолей. Способ иммунотерапии солидных опухолей, заключающийся в вакцинации пациента комбинацией препарата экзосом и олигодезоксинуклеотида Р-типа, при этом препарат включает экзосомы, выделенные культурой клеток K562/i-S9, и содержит белок, антигены CEA, 5Т4, лиганды FasL и TRAIL, а олигодезоксинуклеотид Р-типа представляет собой последовательность нуклеотидов GGGGCGCCGTGATGGCGAGCGCGCC, указанную комбинацию вводят подкожно в течение не менее 2 месяцев и не реже 1 раза в неделю в эффективном количестве, предпочтительно в дозах 0,01-0,04 мг/кг каждый.

Изобретение относится к медицине, а именно к иммунологии, и может быть использовано для применения производного олигохитозана в качестве адъюванта для вакцин. Производное олигохитозана состоит из звеньев глюкозамина 91-98% и (N-ацил)глюкозамина 2-9% с молекулярной массой от 5 до 15 кДа.

Группа изобретений относится к медицине, фармакологии и касается способов снижения продолжительности или тяжести воспалительного иммунного ответа у субъекта, а также фармацевтической композиции, содержащей как таковые карбоксилированные частицы.

Изобретение относится к биохимии. Описано применение антител или их фрагментов, которые специфично связывают hDH4 и блокируют взаимодействие между Dll4 и Notch-рецептором для предупреждения, лечения или ослабления сахарного диабета 1-го типа у субъекта.

Данное изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5 человека, охарактеризованное последовательностями гипервариабельных участков (HVR), и его антигенсвязывающий фрагмент.

Изобретение относится к области иммунологии и медицины. Предложено применение антитела или его антиген-связывающего фрагмента, которые специфически связываются с дельта-подобным лигандом 4 (Dll4) человека, в предупреждении рецидивирования рассеянного склероза или снижении развития данного заболевания при его рецидивировании у субъекта.

Изобретение относится к медицине, а именно к терапии, и касается лечения инфекционных заболеваний. Для этого вводят лекарственное средство, содержащее активированную - потенцированную форму антител к гамма -интерферону человека в сочетании с активированной - потенцированной формой антител к CD4 рецептору Т-лимфоцитов и активированной - потенцированной формой антител к гистамину.

Настоящее изобретение относится к области биотехнологии. Предложен способ приготовления очищенного конъюгата в растворе, включающий приведения в контакт майтансиноидной молекулы, содержащей тиоловую группу, с гетеробифункциональным линкерным реагентом для ковалентного присоединения линкера к майтансиноидной молекуле, затем конъюгацию антитела с майтансиноидной молекулой, связанной с линкерами, путем реакции полученной неочищенной смеси с антителом в растворе, имеющем рН от примерно 4 до примерно 9, и применение к полученной смеси тангенциальной поточной фильтрации, диализа, гелевой фильтрации, адсорбционной хроматографии, селективного осаждения или их комбинации для получения очищенного конъюгата.

Настоящее изобретение относится к области иммунологии. Предложено выделенное антитело и его антигенсвязывающий фрагмент, которые специфически связываются с индуцируемым глюкокортикоидами рецептором TNF (GITR) человека; а также композиции, в том числе фармацевтическая композиция, и способ усиления иммунного ответа у человека.

Изобретение относится к области биотехнологии и иммунологии Описаны выделенные антитела и их фрагменты, которые связываются с опухолевыми антигенами. Также описаны композиции и агенты для доставки, которые включают раскрываемые антитела; клетки, которые продуцируют эти антитела; способы продуцирования этих антител; способы применения этих антител, нацеливания на опухоли и/или метастатические клетки, образуемые ими, и/или опухолевые стволовые клетки, и лечение опухолей и/или метастатических клеток, образуемых ими, и/или опухолевых стволовых клеток; и способы прогнозирования рецидива рака у субъекта.

Изобретение относится к биохимии. Описано антитело, специфически связывающееся с CAPRIN-1, или его фрагмент, которые обладают иммунологической реактивностью в отношении белка CAPRIN-1, причем антитело или его фрагмент содержат вариабельную область тяжелой цепи, содержащую определяющие комплементарность области SEQ ID NO: 5, 6 и 7, и вариабельную область легкой цепи, содержащую определяющие комплементарность области SEQ ID NO: 9, 10 и 11.

Изобретение относится к области биохимии. Представлены антитела, связывающиеся с опухолеассоциированным антигенным полипептидом-мишенью (полипептидом «TAT»), который в более высокой степени экспрессируется на поверхности раковых клеток, чем на поверхности нормальных клеток.

Изобретение относится к области биохимии. Заявлено выделенное IL-17-связывающее антитело.

Настоящее изобретение относится к области медицины, биотехнологии и иммунологии. Предложено применение антитела анти-CD20 типа I для лечения рака, экспрессирующего CD20, а также применение для получения лекарственного средства, предназначенного для лечения рака, экспрессирующего CD20, отличающееся тем, что указанное антитело анти-CD20 типа I вводят совместно с антителом анти-CD20 типа II, где антителом анти-CD20 типа I является ритуксимаб, а антителом анти-CD20 типа II - гуманизированное антитело B-LyI, причем по меньшей мере 40% или более олигосахаридов Fc областей антител анти-CD20 типа II в составе композиции являются нефукозилированными, а раком, экспрессирующим CD20, является не-Ходжкинская лимфома.

Изобретение относится к области биохимии, в частности к антителу против TNF(фактор некроза опухоли)-α или анти-TNF-α-связывающему фрагменту антитела. Также раскрыта фармацевтическая композиция для лечения патологий и заболеваний, связанных с TNF-α, содержащая терапевтически эффективное количество вышеуказанного антитела или его фрагмент.

Группа изобретений относится к медицине и касается композиции для предотвращения передачи ВИЧ, включающей поликлональные антитела или их фрагменты, способные связываться с белком вирусной оболочки (Env) вируса иммунодефицита человека (ВИЧ) или его фрагментом, в которой поликлональные антитела или их фрагменты (i) способны связываться с белком Env из гетерологичного штамма ВИЧ и (ii) присутствуют в гипериммунном молоке животного или получены из гипериммунного молока животного, присутствуют в гипериммунном молозиве животного или получены из гипериммунного молозива животного или присутствуют в птичьем яйце или получены из птичьего яйца.

Настоящее изобретение относится к области медицины, конкретнее к области лечения опухолевых заболеваний. Изобретение представляет собой синергическую комбинацию (1) антитела, специфичного к CD38, содержащего HCDR1 участок с последовательностью SYYMN (SEQ ID NO: 14) или GFTFSSYYMN (SEQ ID NO: 1), HCDR2 участок с последовательностью GISGDPSNTYYADSVKG (SEQ ID NO: 2), HCDR3 участок с последовательностью DLPLVYTGFAY (SEQ ID NO: 3), LCDR1 участок с последовательностью SGDNLRHYYVY (SEQ ID NO: 4), LCDR2 участок с последовательностью GDSKRPS (SEQ ID NO: 5) и LCDR3 участок с последовательностью QTYTGGASL (SEQ ID NO: 6), и (2) леналидомида, помалидомида или бортезомиба, для применения при лечении множественной миеломы и/или неходжкинской лимфомы. Заявленное изобретение эффективно в лечении вышеуказанных опухолевых заболеваний. 16 з.п. ф-лы, 20 ил., 21 табл., 12 пр.
Наверх