Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua



Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua
Лечение заболеваний, связанных с геном альфа-l-идуронидазы (idua), путем ингибирования природного антисмыслового транскрипта гена idua

 

C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2597972:

КУРНА ИНК. (US)

Изобретение относится к области биотехнологии, конкретно к способу повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA), и может быть использовано в медицине. Изобретение также относится к идентификации антисмысловых олигонуклеотидов, которые нацелены на природные антисмысловые последовательности полинуклеотида IDUA, выбранные из SEQ ID NO: 2-9. Изобретение позволяет повышать экспрессию полинуклеотида IDUA, что применимо для лечения заболеваний и расстройств, ассоциированных с экспрессией гена IDUA. 9 н. и 30 з.п. ф-лы, 5 ил., 7 пр.

 

ОБЛАСТЬ ТЕХНИКИ

[0001] Данная заявка испрашивает приоритет на основании предварительной заявки на патент США №61/405758, поданной 22 октября 2010 года, полное содержание которой включено в настоящее описание посредством ссылки.

[0002] Варианты реализации настоящего изобретения включают олигонуклеотиды, модулирующие экспрессию и/или функцию гена IDUA и связанных с ним молекул.

УРОВЕНЬ ТЕХНИКИ

[0003] Гибридизация ДНК-РНК и РНК-РНК важна для многих аспектов функционирования нуклеиновых кислот, включая репликацию ДНК, транскрипцию и трансляцию. Гибридизация также играет главную роль во множестве технологий, которые позволяют либо обнаруживать конкретную нуклеиновую кислоту, либо изменять ее экспрессию. Антисмысловые нуклеотиды, например, нарушают экспрессию генов за счет гибридизации с РНК-мишенью, тем самым препятствуя сплайсингу РНК, транскрипции, трансляции и репликации. Антисмысловая ДНК обладает дополнительной особенностью, заключающейся в том, что гибриды ДНК-РНК выступают в качестве субстрата для ферментативного расщепления рибонуклеазой H, активность которой присутствует в большинстве типов клеток. Антисмысловые молекулы могут быть доставлены в клетки, как в случае для олигодезоксинуклеотидов (ОДН), или они могут представлять собой продукты экспрессии эндогенных генов в виде молекул РНК. Недавно Управление по контролю качества пищевых продуктов и лекарственных препаратов США (FDA) одобрило антисмысловое лекарственное средство, Витравен (VITRAVENE™) (для лечения цитомегаловирусного ретинита), что свидетельствует о возможности применения антисмыслового лекарственного средства в терапевтических целях.

КРАТКОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

[0004] Настоящее краткое описание предлагает краткое описание настоящего изобретения с той целью, чтобы вкратце обозначить предмет и сущность настоящего изобретения.

Краткое описание представляют с пониманием того, что его не следует применять для толкования или ограничения объема или смыслового содержания формулы изобретения.

[0005] В одном варианте реализации согласно изобретению предложены способы для ингибирования действия природного антисмыслового транскрипта путем применения антисмыслового олигонуклеотида (олигонуклеотидов), нацеленного на любую область природного антисмыслового транскрипта, приводящего к увеличению экспрессии соответствующего смыслового гена. Авторы настоящей заявки также предполагают, что ингибирование природного антисмыслового транскрипта может быть достигнуто с помощью малых интерферирующих РНК (миРНК), рибозимов и малых молекул, рассматриваемых в рамках настоящего изобретения.

[0006] Согласно одному варианту реализации предложен способ модулирования функции и/или экспрессии полинуклеотида IDUA в биологических системах, включая, но не ограничиваясь перечисленными, клетки или ткани пациента in vivo или in vitro, включающий осуществление контакта указанной биологической системы или указанных клеток или тканей с антисмысловым олигонуклеотидом длиной примерно от 5 примерно до 30 нуклеотидов, при этом последовательность указанного олигонуклеотида по меньшей мере на 50% идентична последовательности обратного комплемента полинуклеотида, содержащего от 5 до 30 последовательных нуклеотидов в пределах нуклеотидов 1-2695 последовательности SEQ ID NO: 2, или в пределах нуклеотидов 1-2082 последовательности SEQ ID NO: 3, или 1-322 последовательности SEQ ID NO: 4, или 1-677 последовательности SEQ ID NO: 5, или 1-716 последовательности SEQ ID NO: 6, или 1-466 последовательности SEQ ID NO: 7, или 1-1255 последовательности SEQ ID NO: 8 или 1-2739 последовательности SEQ ID NO: 9, с обеспечением тем самым модулирования функции и/или экспрессии полинуклеотида IDUA в указанных биологических системах, включая указанные клетки или ткани пациента in vivo или in vitro.

[0007] В одном варианте реализации олигонуклеотид нацелен на природную антисмысловую последовательность для полинуклеотидов IDUA, присутствующих в биологической системе, например, на нуклеотиды, указанные в последовательности, соответствующей SEQ ID NOS: 2-9, и любые их варианты, аллели, гомологи, мутанты, производные, фрагменты и последовательности, которые представляют собой их комплемент. Примеры антисмысловых олигонуклеотидов указаны в виде последовательностей, соответствующих SEQIDNOS: 10-28.

[0008] Согласно другому варианту реализации предложен способ модулирования функции и/или экспрессии полинуклеотида IDUA в клетках или тканях пациента in vivo или in vitro, включающий осуществление контакта указанных клеток или тканей с антисмысловым олигонуклеотидом длиной от 5 до 30 нуклеотидов, при этом последовательность указанного олигонуклеотида по меньшей мере на 50% идентична последовательности обратного комплемента антисмысловой последовательности для полинуклеотида IDUA;; с обеспечением тем самым модулирования функции и/или экспрессии полинуклеотида IDUA в клетках или тканях пациента in vivo или in vitro.

[0009] Согласно другому варианту реализации предложен способ модулирования функции и/или экспрессии полинуклеотида IDUA в клетках или тканях пациента in vivo или in vitro, включающий осуществление контакта указанных клеток или тканей с антисмысловым олигонуклеотидом длиной от 5 до 30 нуклеотидов, при этом последовательность указанного олигонуклеотида по меньшей мере на 50% идентична последовательности антисмыслового олигонуклеотида для полинуклеотида гена IDUA; с обеспечением тем самым модулирования функции и/или экспрессии полинуклеотида IDUA в клетках или тканях пациента in vivo или in vitro.

[0010] Согласно другому варианту реализации изобретение включает способ модулирования функции и/или экспрессии полинуклеотида IDUA в биологической системе, включающий осуществление контакта указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом, который нацелен на область природного антисмыслового транскрипта полинуклеотида IDUA; что приводит к модулированию функции и/или экспрессии полинуклеотида IDUA в указанной биологической системе.

[0011] Согласно другому варианту реализации изобретение включает способ модулирования функции и/или экспрессии полинуклеотида IDUA в биологической системе, включающий осуществление контакта указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом, который нацелен на область природного антисмыслового транскрипта полинуклеотида IDUA; с обеспечением тем самым модулирования функции и/или экспрессии полинуклеотида IDUA в указанной биологической системе.

[0012] В одном варианте реализации изобретение включает способ повышения функции и/или экспрессии полинуклеотида IDUA в биологической системе, который соответствует SEQ ID NO. 1, включающий осуществление контакта указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом, который нацелен на область природного антисмыслового транскрипта полинуклеотида IDUA; с обеспечением тем самым повышения функции и/или экспрессии указанного полинуклеотида IDUA или экспрессии его продуктов.

[0013] Согласно другому варианту реализации изобретение включает способ повышения функции и/или экспрессии полинуклеотида IDUA в биологической системе, который соответствует SEQ ID NO. 1, включающий осуществление контакта указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом, который нацелен на область природного антисмыслового транскрипта указанного полинуклеотида IDUA; с обеспечением тем самым повышения функции и/или экспрессии указанного полинуклеотида IDUA или экспрессии его продуктов, где природные антисмысловые транскрипты выбраны из SEQ ID NOS. 2-9.

[0014] Согласно другому варианту реализации изобретение включает способ повышения функции и/или экспрессии полинуклеотида IDUA в биологической системе, который соответствует SEQ ID NO. 1, включающий осуществление контакта указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом, который нацелен на область природного антисмыслового транскрипта указанного полинуклеотида IDUA; с обеспечением тем самым повышения функции и/или экспрессии указанного полинуклеотида IDUA или экспрессии его продуктов, где природные антисмысловые транскрипты выбраны из SEQ ID NOS. 2-9 и где антисмысловые олигонуклеотиды выбраны по меньшей мере из одной SEQ ID NOS. 10-28.

[0015] В одном варианте реализации композиция содержит один или более антисмысловых олигонуклеотидов, которые связываются со смысловыми и/или антисмысловыми полинуклеотидами гена IDUA.

[0016] В одном варианте реализации олигонуклеотиды содержат один или более модифицированных или замещенных нуклеотидов.

[0017] В одном варианте реализации олигонуклеотиды содержат одну или более модифицированных связей.

[0018] В еще одном варианте реализации модифицированные нуклеотиды содержат модифицированные основания, включая молекулы фосфотиоатных, метилфосфонатных производных нуклеиновых кислот, пептидо-нуклеиновых кислот, 2′-O-метил-, фтор- или углерод-, метилен- или других закрытых нуклеиновых кислот (ЗНК; locked nucleic acids, LNA). Предпочтительно, модифицированные нуклеотиды представляют собой молекулы закрытых нуклеиновых кислот, включая ЗНК с α-L-рибо-конфигурацией (α-L-ЗНК).

[0019] В одном варианте реализации олигонуклеотиды вводят пациенту любыми способами доставки, включая, но не ограниваясь перечисленными, перорально, трансдермально, ингаляционным путем, подкожно, внутримышечно, внутривенно или интраперитонеально.

[0020] В одном варианте реализации олигонуклеотиды вводят в составе фармацевтической композиции. Схема лечения включает по меньшей мере однократное введение антисмысловых соединений пациенту; однако, это лечение может быть модифицировано до введения многократных доз в течение некоторого периода времени. Лечение может быть объединено с одним или более другими типами терапии.

[0021] В одном варианте реализации олигонуклеотиды инкапсулированы в липосому или присоединены к молекуле-носителю (например, холестерину, ТАТ-пептиду).

[0022] Другие аспекты описаны ниже.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

[0023] На Фигуре 1 представлены результаты полимеразной цепной реакции (ПЦР) в режиме реального времени, которые показывают кратное изменение + стандартное отклонение для мРНК гена IDUA после обработки клеток HepG2 фосфоротиоатными олигонуклеотидами, введенными с применением липофектамина 2000, по сравнению с контролем. Столбцы диаграммы, обозначенные как CUR-1820-CUR-1823, соответствуют образцам, обработанным олигонуклеотидами с SEQ ID NOS: 10-13, соответственно.

[0024] На Фигуре 2 представлены результаты полимеразной цепной реакции (ПЦР) в режиме реального времени, которые показывают кратное изменение+стандартное отклонение для мРНК гена IDUA после обработки клеток HepG2 фосфоротиоатными олигонуклеотидами, введенными с применением липофектамина TM 2000, по сравнению с контролем.. Столбцы диаграммы, обозначенные как CUR-1973, CUR-1975, CUR-1976, CUR-1978, CUR-1981, CUR-1984, CUR-1985, CUR-1987, CUR-1988, соответствуют образцам, обработанным олигонуклеотидами с SEQ ID NOS: 14-22, соответственно.

[0025] На Фигуре 3 представлены результаты полимеразной цепной реакции (ПЦР) в режиме реального времени, которые показывают кратное изменение + стандартное отклонение для мРНК гена IDUA после обработки клеток HepG2 фосфоротиоатными олигонуклеотидами, введенными с применением липофектамина ТМ 2000, по сравнению с контролем.. Столбцы диаграммы, обозначенные как CUR-1974, CUR-1977, CUR-1986, CUR-1983, CUR-1979 и CUR-1982, соответствуют образцам, обработанным олигонуклеотидами с SEQ ID NOS: 23-28, соответственно.

[0026] На Фигуре 4 представлены результаты полимеразной цепной реакции (ПЦР) в режиме реального времени, которые показывают кратное изменение+стандартное отклонение для мРНК гена IDUA человека после обработки клеток SK-N-As фосфоротиоатными олигонуклеотидами, введенными с применением липофектамина TM 2000, по сравнению с контролем.. Столбцы диаграммы, обозначенные как CUR-1973, CUR-1975, CUR-1976, CUR-1978, CUR-1981, CUR-1984, CUR-1985, CUR-1987, CUR-1988, соответствуют образцам, обработанным олигонуклеотидами с SEQ ID NOS: 14-22, соответственно.

[0027] На Фигуре 5 (SEQ ID NO: 8) представлено удлинение на 578 нуклеотидов (серый) исходной последовательности собаки DN876121 (SEQ ID NO: 5) (без заливки), с применением Clone open biosystems: NAE04B03.

[0028] Описание Перечня последовательностей-SEQ ID NO: 1: альфа-L-идуронидаза человека (IDUA), мРНК (номер последовательности в базе данных NCBI (Национального центра биотехнологической информации США): NM_000203)); SEQ ID NO: 2: Природная антисмысловая последовательность (HS.656285) для гена IDUA; SEQ ID NO: 3: Природная антисмысловая последовательность (CR626108) для гена IDUA; SEQ ID NO: 4: Природная антисмысловая последовательность (DN334757) для гена IDUA; SEQ ID NO: 5: Природная антисмысловая последовательность (DN876121) для гена IDUA; SEQ ID NO: 6: Природная антисмысловая последовательность (DN744190) для гена IDUA; SEQ ID NO: 7: Природная антисмысловая последовательность (DN330918) для гена IDUA; SEQ ID NO: 8: Природная антисмысловая последовательность (DN876121-удлиненная) для гена IDUA; SEQ ID NO: 9: Природная антисмысловая-удлиненная последовательность для гена IDUA человека; SEQ ID NOS: 10-28: Антисмысловые олигонуклеотиды. Символ "*" обозначает фосфотиоатную связь; SEQ ID NOs: 29-45: UniGene Cluster Hs.656285.

ПОДРОБНОЕ ОПИСАНИЕ

[0029] Некоторые аспекты изобретения описаны ниже со ссылкой на примеры применения для иллюстрации. Следует понимать, что многочисленные конкретные детали, связи и способы приведены с целью обеспечения полного понимания изобретения. Однако специалист в данной области техники без труда обнаружит, что изобретение может быть применено на практике без одной или более конкретных деталей или с другими способами. Настоящее изобретение не ограничивается упорядочиванием действий или событий, так как некоторые действия могут быть осуществлены в разном порядке и/или одновременно с другими действиями или событиями. Кроме того, не все проиллюстрированные действия или события требуются для реализации методологии в соответствии с настоящим изобретением.

[0030] Все гены, названия генов и продукты генов, описанные в настоящей заявке, соответствуют гомологам из организмов любых видов, для которых применимы композиции и способы, предложенные в настоящей заявке. Таким образом, данные термины включают, но без ограничения, гены и генные продукты из организмов людей и мышей. Понимают, что, когда предложен ген или продукт гена из организма конкретного вида, этот элемент изобретения представлен исключительно в качестве примера, и его не следует истолковывать как ограничение, если контекст, в котором он появляется, ясно не указывает на обратное. Соответственно, например, гены, описанные в настоящей заявке, которые в некоторых вариантах реализации относятся к нуклеотидным и аминокислотным последовательностям млекопитающих, охватывают гомологичные и/или ортологичные гены и продукты генов из организмов других животных, включая, но без ограничения, других млекопитающих, рыб, земноводных, пресмыкающихся и птиц. В одном варианте реализации гены или нуклеотидные последовательности представляют собой гены или последовательности человека.

Определения

[0031] Терминология, применяемая в настоящей заявке, служит исключительно для описания конкретных вариантов реализации и не ограничивает изобретение. В настоящей заявке неопределенная и определенная формы единственного числа также включают множественные формы, если контекст ясно не предписывает иное. Кроме того, в той мере, в какой термины "включающий", "включает", "имеющий", "имеет", "с" или их варианты применяют в подробном описании и/или формуле изобретения, такие термины подразумевают включение в себя подобно термину "содержащий".

[0032] Термин "примерно" или "приблизительно" обозначает нахождение внутри диапазона приемлемой погрешности для конкретной величины, определенного специалистом в данной области техники, который будет зависеть отчасти от того, каким образом величину измеряют или определяют, т.е. от ограничений измерительной системы. Например, термин "примерно" может означать, что величина находится в пределах 1 или более чем 1 стандартного отклонения, как показывает практика в данной области техники. Альтернативно, термин "примерно" может означать диапазон погрешности, составляющий вплоть до 20%, предпочтительно вплоть до 10%, более предпочтительно вплоть до 5% и еще более предпочтительно вплоть до 1% от заданной величины. Альтернативно, применительно к биологическим системам или процессам, термин может означать нахождение в пределах порядка величины, предпочтительно в пределах пятикратного значения и более предпочтительно двукратного значения величины. В тех случаях, когда в заявке и формуле изобретения приведены конкретные значения, то, если не указано иное, следует предполагать термин "примерно", обозначающий нахождение внутри диапазона приемлемой погрешности для конкретной величины.

[0033] В настоящей заявке термин "мРНК" обозначает известный на настоящий момент мРНК-транскрипт(ы) гена-мишени и любые дополнительные транскрипты, происхождение которых может быть объяснено.

[0034] С помощью терминов "антисмысловые олигонуклеотиды" или "антисмысловое соединение" обозначают молекулу РНК или ДНК, которая связывается с другой РНК или ДНК (РНК-, ДНК-мишенью). Например, если антисмысловое соединение представляет собой олигорибонуклеотид, оно связывается с другой РНК-мишеныо за счет РНК-РНК-взаимодействий и изменяет активность РНК-мишени. Антисмысловой олигонуклеотид может увеличивать или подавлять экспрессию и/или функцию конкретного полинуклеотида. Определение включает любую чужеродную молекулу ДНК или РНК, подходящую с терапевтической, диагностической или другой точки зрения. Такие молекулы включают, например, молекулы антисмысловых ДНК или РНК, молекулы интерферирующих РНК (РНКи), микроРНК, ложные РНК, миРНК, ферментативные РНК, РНК, применяемые в исправляющей терапии, и РНК, имеющие свойства агонистов и антагонистов, антисмысловые олигомерные соединения, антисмысловые олигонуклеотиды, олигонуклеотиды внешней направляющей последовательности (external guide sequence, EGS), сплайс-варианты, праймеры, зонды и другие олигомерные соединения, которые гибридизуются с по меньшей мере частью нуклеиновой кислоты-мишени. В связи с этим данные соединения могут быть введены в форме одноцепочечных, двухцепочечных, частично одноцепочечных или кольцевых олигомерных соединений.

[0035] В контексте настоящего изобретения термин "олигонуклеотид" относится к олигомеру или полимеру рибонуклеиновой кислоты (РНК) или дезоксирибонуклеиновой кислоты (ДНК) или их миметикам. Термин "олигонуклеотид" также включает линейные или кольцевые олигомеры природных и/или модифицированных мономеров или связей, включая дезоксирибонуклеозиды, рибонуклеозиды, их замещенные и альфа-аномерные формы, пептидо-нуклеиновые кислоты (ПНК), закрытые нуклеиновые кислоты (ЗНК; locked nucleic acids, LNA), фосфотиоатные, метилфосфонатные производные и т.п. Олигонуклеотиды способны к специфичному связыванию с полинуклеотидом-мишенью за счет регулярных взаимодействий между мономерными звеньями, такими как Уотсон-Криковский тип спаривания оснований, Хугстиновский или обратный Хугстиновский типы спаривания оснований и т.п.

[0036] Олигонуклеотид может быть "химерным", то есть составленным из разных областей. В контексте настоящего изобретения "химерные" соединения представляют собой олигонуклеотиды, которые содержат две или более химически отличные области, например, область (области) ДНК, область (области) РНК, область (области) ПНК и т.д. Каждая химически отличная область состоит из по меньшей мере одной мономерной единицы, т.е. нуклеотида в случае олигонуклеотидного соединения. Эти олигонуклеотиды, как правило, содержат по меньшей мере одну область, в которой олигонуклеотид модифицирован с целью проявления одного или более желаемых свойств. Желаемые свойства олигонуклеотида включают, но без ограничения, например, повышенную устойчивость к деградации нуклеазами, повышенное клеточное поглощение и/или повышенную способность к связыванию с нуклеиновой кислотой-мишенью. Разные области олигонуклеотида могут, таким образом, обладать разными свойствами. Химерные олигонуклеотиды согласно настоящему изобретению могут быть получены в виде смешанных структур из двух или более олигонуклеотидов, модифицированных олигонуклеотидов, олигонуклеозидов и/или аналогов олигонуклеотидов, описанных выше.

[0037] Олигонуклеотид может быть составлен из областей, которые могут быть соединены в "ряд", то есть когда мономеры соединены последовательно, как в нативной ДНК, или соединены посредством спейсеров. Спейсеры формируют ковалентный "мостик" между областями и имеют в предпочтительных случаях длину, не превышающую примерно 100 углеродных атомов. Спейсеры могут иметь разные функциональные характеристики, например, нести положительный или отрицательный заряд, обладать свойствами специфичного связывания нуклеиновых кислот (интеркаляторы, вещества, связывающиеся с бороздками, токсины, флуорофоры и т.д.), быть липофильными, индуцировать образование специфических вторичных структур, как, например, аланинсодержащие пептиды, которые индуцируют образование альфа-спиралей.

[0038] В настоящей заявке термины "ген IDUA" и "альфа-L-идуронидаза" включают все члены семейства, мутанты, аллели, фрагменты, виды, кодирующие и некодирующие последовательности, смысловые и антисмысловые полинуклеотидные цепи и т.д.

[0039] В настоящей заявке слова 'альфа-L-идуронидаза', IDA, IDUA и MPS1 рассматривают как имеющие одно и то же значение в литературе и применяют взаимозаменяемо в настоящей заявке.

[0040] В настоящей заявке термин "олигонуклеотид, специфичный к" или "олигонуклеотид, нацеленный на" относится к олигонуклеотиду, содержащему последовательность, (i) способную образовывать стабильный комплекс с частью гена-мишени или (ii) способную образовывать стабильный дуплекс с частью мРНК-транскрипта гена-мишени. Стабильность комплексов и дуплексов может быть определена посредством теоретических расчетов и/или анализов in vitro. Типовые анализы для определения стабильности гибридизационных комплексов и дуплексов описаны в Примерах ниже.

[0041] В настоящей заявке термин "нуклеиновая кислота-мишень" охватывает ДНК, РНК (содержащую пре-мРНК и мРНК), транскрибируемую с такой ДНК, и также кДНК, получаемую на матрице такой РНК, кодирующие, некодирующие последовательности, смысловые или антисмысловые полинуклеотиды. Специфичная гибридизация олигомерного соединения с его нуклеиновой кислотой-мишенью препятствует нормальной функции нуклеиновой кислоты. Это модулирование функции нуклеиновой кислоты-мишени с помощью соединений, которые специфично гибридизуются с последней, в общем случае называют "антисенс-технологией". Затрагиваемые функции ДНК включают, например, репликацию и транскрипцию. Затрагиваемые функции РНК включают все жизненно важные функции, такие как, например, транслокация РНК к месту трансляции белков, трансляция белков на матрице РНК, сплайсинг РНК с образованием одного или более видов мРНК и каталитическая активность, которая может присутствовать у РНК или которой РНК может способствовать. Суммарный эффект такого препятствия функции нуклеиновой кислоты-мишени заключается в модулировании экспрессии кодируемого продукта или олигонуклеотидов.

[0042] РНК-интерференция "РНКи" опосредована молекулами двухцепочечной РНК (дцРНК), которые имеют последовательности, гомологичные их нуклеотидным последовательностям-"мишеням". В некоторых вариантах реализации настоящего изобретения посредники представляют собой дуплексы "малых интерферирующих" РНК (миРНК) длиной 5-25 нуклеотидов. миРНК образуются в результате разрезания дцРНК ферментом-РНКазой, известным как Дайсер (Dicer). Дуплексные продукты миРНК включаются в состав мультибелкового комплекса, называемого RISC (индуцируемый РНК комплекс сайленсинга). Без привязки к какой-либо конкретной теории, комплекс RISC, как полагают, нацелен на нуклеиновую кислоту-мишень (на роль которой подходит мРНК), при этом дуплекс миРНК взаимодействует с мРНК за счет комплементарности их последовательностей, вызывая расщепление мРНК каталитическим путем. Малые интерферирующие РНК, которые могут быть применены согласно настоящему изобретению, могут быть синтезированы и применены в соответствии со способами, которые хорошо известны в данной области техники и которые будут хорошо знакомы специалисту в данной области техники. Малые интерферирующие РНК для применения в соответствии со способами согласно настоящему изобретению подходящим образом содержат от примерно 1 до примерно 50 нуклеотидов (нт). В примерах неограничивающих вариантов реализации миРНК могут содержать от примерно 5 до примерно 40 нт, от примерно 5 до примерно 30 нт, от примерно 10 до примерно 30 нт, от примерно 15 до примерно 25 нт или примерно 20-25 нуклеотидов.

[0043] Отбор подходящих олигонуклеотидов упрощается при применении компьютерных программ, которые автоматически выравнивают нуклеотидные последовательности и отмечают идентичные или гомологичные области. Такие программы применяют для сравнения нуклеотидных последовательностей, полученных, например, в результате поиска в базах данных, таких как GenBank, или посредством секвенирования ПЦР-продуктов. Сравнение нуклеотидных последовательностей из организмов ряда видов позволяет отобрать нуклеотидные последовательности, которые обнаруживают подходящую степень идентичности между видами. В случае генов, которые не были просеквенированы, проводят блоттинги по Саузерну с целью определения степени идентичности между генами вида-мишени и других видов. Путем проведения блоттингов по Саузерну при различных степенях строгости условий гибридизации, как хорошо известно в данной области техники, можно получить приблизительную меру идентичности. Эти процедуры позволяют осуществить отбор олигонуклеотидов, которые показывают высокую степень комплементарности нуклеотидным последовательностям-мишеням субъекта, подлежащего контролю, и меньшую степень комплементарности соответствующим нуклеотидным последовательностям других видов. Специалист в данной области техники обнаружит, что существует значительная свобода выбора подходящих областей генов для применения согласно настоящему изобретению.

[0044] С помощью термина "ферментативная РНК" обозначают молекулу РНК, обладающую ферментативной активностью (Cech, (1988) J. American. Med. Assoc. 260, 3030-3035). Ферментативные нуклеиновые кислоты (рибозимы) действуют за счет, во-первых, связывания с РНК-мишенью. Такое связывание происходит через участок ферментативной нуклеиновой кислоты, связывающий РНК-мишень, который находится в непосредственной близости к ферментативному участку молекулы, катализирующему расщепление РНК-мишени. Таким образом, ферментативная нуклеиновая кислота сперва распознает и далее связывает РНК-мишень за счет спаривания оснований и, как только происходит связывание с нужным сайтом, проявляет ферментативную активность, разрезая РНК-мишень.

[0045] С помощью термина "ложная РНК" обозначают молекулу РНК, которая имитирует природный связывающий домен для лиганда. Ложная РНК, таким образом, конкурирует с природной связывающей мишенью за связывание конкретного лиганда. Например, было показано, что сверхэкспрессия РНК-элемента трансактивационного ответа (TAR) ВИЧ может действовать как "ложная" и эффективно связывает белок tat (транскрипционный трансактиватор) ВИЧ, таким образом препятствуя связыванию этого белка с последовательностями TAR, кодируемыми РНК ВИЧ. Подразумевают, что приведенная информация представляет собой конкретный пример. Специалисты в данной области техники обнаружат, что это всего лишь один пример, и другие варианты реализации могут быть легко разработаны с применением методик, общеизвестных в данной области техники.

[0046] В настоящей заявке термин "мономеры", как правило, обозначает мономеры, соединенные посредством фосфодиэфирных связей или их аналогов с образованием олигонуклеотидов, размеры которых изменяются в пределах от нескольких мономерных единиц, например, от примерно 3-4, до примерно нескольких сотен мономерных единиц. Аналоги фосфодиэфирных связей включают: фосфотиоатные, фосфодитиоатные, метилфосфонатные, фосфоселеноатные, фосфорамидатные связи и т.п., как более подробно описано ниже.

[0047] Термин "нуклеотид" распространяется на встречающиеся в природе нуклеотиды, а также не встречающиеся в природе нуклеотиды. Специалисту в данной области техники должно быть ясно, что различные нуклеотиды, которые ранее считали "не встречающимися в природе", были впоследствии найдены в природе. Таким образом, термин "нуклеотиды" включает не только известные молекулы, содержащие пуриновые и пиримидиновые гетероциклы, но также и их гетероциклические аналоги и таутомеры. Иллюстративные примеры других типов нуклеотидов представляют собой молекулы, содержащие аденин, гуанин, тимин, цитозин, урацил, пурин, ксантин, диаминопурин, 8-оксо-N6-метиладенин, 7-деазаксантин, 7-деазагуанин, N4,N4-этаноцитозин, N6,N6-этано-2,6-диаминопурин, 5-метилцитозин, 5-(C3-C6)-алкинилцитозин, 5-фторурацил, 5-бромурацил, псевдоизоцитозин, 2-гидрокси-5-метил-4-триазолпиридин, изоцитозин, изогуанин, инозин и "не встречающиеся в природе" нуклеотиды, описанные в публикации Benner et al, Патент США №5432272. Термин "нуклеотид" распространяется на каждый и все из этих примеров, а также их аналоги и таутомеры. Особенно интересными нуклеотидами являются те из них, которые содержат аденин, гуанин, тимин, цитозин и урацил, которые рассматривают как встречающиеся в природе нуклеотиды, относительно терапевтического и диагностического применения у людей. Нуклеотиды содержат природные 2′дезокси- и 2′-гидроксисахара, например, описанные в Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992), a также их аналоги.

[0048] Термин "аналоги" в применении к нуклеотидам включает синтетические нуклеотиды, содержащие модифицированные основания и/или модифицированные сахара (см., например, аналоги, описанные, в основном, в Scheit, Nucleotide Analogs, John Wiley, New York, 1980; Freier & Altmann, (1997) Nucl. Acid. Res., 25(22), 4429-4443, Toulme, J.J., (2001) Nature Biotechnology 19: 17-18; Manoharan M., (1999) Biochemica et Biophysica Acta 1489: 117-139; Freier S. M, (1997) Nucleic Acid Research, 25: 4429-4443, Uhlman, E., (2000) Drug Discovery & Development, 3: 203-213, Herdewin R, (2000) Antisense & Nucleic Acid Drug Dev., 10: 297-310); 2′-O, 3′-C-соединенные [3.2.0] бициклоарабинонуклеозиды. Такие аналоги включают синтетические нуклеотиды, направленные на усиление связывающих свойств, например, стабильности дуплексов или триплексов, специфичности и т.п.

[0049] В настоящей заявке термин "гибридизация" обозначает спаривание практически комплементарных цепей олигомерных соединений. Один механизм спаривания задействует образование водородных связей, которые могут представлять собой Уотсон-Криковские, Хугстиновские или обратные Хугстиновские водородные связи между комплементарными основаниями нуклеозидов или нуклеотидов (нуклеотидами) цепей олигомерных соединений. Например, аденин и тимин являются комплементарными нуклеотидами, которые спариваются за счет образования водородных связей. Гибридизация может происходить при различных условиях.

[0050] Антисмысловое соединение является "способным к специфичной гибридизации", если связывание указанного соединения с нуклеиновой кислотой-мишенью нарушает нормальное функционирование нуклеиновой кислоты-мишени, приводя к модулированию функции и/или активности, и степень комплементарности достаточна, чтобы избежать неспецифичного связывания указанного антисмыслового соединения с нуклеотидными последовательностями, не являющимися мишенями, в условиях, при которых необходимо специфичное связывание, т.е. в физиологических условиях в случае in vivo методик анализа или терапевтического воздействия и в условиях, при которых проводится анализ, в случае исследований in vitro.

[0051] В настоящей заявке фраза "строгие условия гибридизации" или "строгие условия" относится к условиям, при которых соединение согласно изобретению будет гибридизоваться со своей последовательностью-мишенью, но с минимальным количеством других последовательностей. Строгие условия зависят от последовательности и будут различаться в разных обстоятельствах, и, в контексте настоящего изобретения, "строгие условия", при которых олигомерные соединения гибридизуются с последовательностью-мишенью, определяются природой и составом олигомерных соединений и видами анализов, посредством которых их исследуют. В общем случае, строгие условия гибридизации включают низкие концентрации (<0,15 M) солей, содержащих неорганические катионы, такие как Na+ или K+ (т.е. низкую ионную силу), температуру выше точки, расположенной на 20°C-25°C ниже Tпл комплекса олигомерное соединение:последовательность-мишень, и присутствие денатурантов, таких как формамид, диметилформамид, диметилсульфоксид или детергент додецилсульфат натрия (ДСН). Например, скорость гибридизации снижается на 1,1% на каждый добавленный 1% формамида. Примером условий гибридизации с высокой степенью строгости является гибридизация с применением 0,1X буфера хлорид натрия-цитрат натрия (SSC, стандартный цитратно-солевой)/0,1% (масс./об.) ДСН при 60°C в течение 30 минут.

[0052] В настоящей заявке термин "комплементарный" относится к способности точного спаривания между двумя нуклеотидами или одной или двумя олигомерными цепями. Например, если нуклеиновое основание в определенном положении цепи антисмыслового соединения способно к образованию водородных связей с нуклеиновым основанием в определенном положении цепи нуклеиновой кислоты-мишени, причем, указанная нуклеиновая кислота-мишень представляет собой молекулу ДНК, РНК или олигонуклеотида, то положение, в котором происходит образование водородных связей между олигонуклеотидом и нуклеиновой кислотой-мишенью, считают комплементарным положением. Олигомерное соединение и дополнительная молекула ДНК, РНК или олигонуклеотида комплементарны друг другу, когда достаточное число комплементарных положений в каждой молекуле заняты нуклеотидами, способными образовывать водородные связи друг с другом. Таким образом, термины "специфично гибридизующийся" и "комплементарный" применяют для обозначения достаточной степени точного спаривания, или комплементарности, в пределах достаточного числа нуклеотидов, так что между олигомерным соединением и нуклеиновой кислотой-мишенью происходит стабильное и специфичное связывание.

[0053] Как понимают специалисты в данной области техники, последовательность олигомерного соединения не обязательно должна быть на 100% комплементарна последовательности его нуклеиновой кислоты-мишени для того, чтобы соединение было способно к специфичной гибридизации. Кроме того, олигонуклеотид может гибридизоваться поверх одного или более сегментов, так что промежуточные или соседние сегменты оказываются не вовлеченными в процесс гибридизации (например, петлевая структура, отсутствие комплементарности или шпилечная структура). Олигомерные соединения согласно настоящему изобретению содержат последовательность, комплементарную на по меньшей мере примерно 70%, или по меньшей мере примерно 75%, или по меньшей мере примерно 80%, или по меньшей мере примерно 85%, или по меньшей мере примерно 90%, или по меньшей мере примерно 95%, или по меньшей мере примерно 99% области-мишени в пределах нуклеотидной последовательности-мишени, на которую эти соединения нацелены. Например, антисмысловое соединение, в котором 18 из 20 нуклеотидов антисмыслового соединения комплементарны области-мишени и, следовательно, специфично гибридизовались бы с ним, характеризовалось бы 90% комплементарностью. В данном примере остальные некомплементарные нуклеотиды могут располагаться в кластерах комплементарных нуклеотидов или чередоваться с комплементарными нуклеотидами и не обязательно должны примыкать друг к другу или к комплементарным нуклеотидам. По этой причине антисмысловое соединение длиной 18 нуклеотидов, содержащее 4 (четыре) некомплементарных нуклеотида, которые фланкированы двумя областями, полностью комплементарными нуклеиновой кислоте-мишени, в целом характеризовалось бы 77,8% комплементарностью с нуклеиновой кислотой-мишенью и попадало бы, таким образом, в рамки настоящего изобретения. Процент комплементарности антисмыслового соединения с областью нуклеиновой кислоты-мишени может быть определен обычным способом с применением программ BLAST (средства поиска основного локального выравнивания) и программ PowerBLAST, известных в данной области техники. Процент гомологии, идентичности последовательностей или комплементарности может быть определен с помощью, например, программы Gap (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) с применением параметров, установленных по умолчанию, которая использует алгоритм Смита-Ватермана (Adv. Appl. Math., (1981) 2, 482-489).

[0054] В настоящей заявке термин "температура плавления (Tпл)" относится к температуре, в условиях определенной ионной силы, pH и концентрации нуклеиновой кислоты, при которой 50% олигонуклеотидов, комплементарных последовательности-мишени, гибридизуются с последовательностью-мишенью в состоянии равновесия. Как правило, строгие условия гибридизации будут отличаться тем, что концентрация соли составляет по меньшей мере примерно от 0,01 до 1,0 М концентрации ионов Na (или других солей) при pH, равном 7,0-8,3, и температура равна по меньшей мере примерно 30°C для коротких олигонуклеотидов (например, длиной от 10 до 50 нуклеотидов). Строгие условия могут также быть достигнуты путем добавления дестабилизирующих агентов, таких как формамид.

[0055] В настоящей заявке термин "модулирование" обозначает либо увеличение (стимулирование), либо ослабление (ингибирование) экспрессии гена.

[0056] Термин "вариант", применительно к последовательности полинуклеотида, может охватывать последовательность полинуклеотида, относящегося к гену дикого типа. Это определение может также включать, например, "аллельные", "сплайс-", "видовые" или "полиморфные" варианты. Сплайс-вариант может быть в значительной степени идентичным исходной молекуле, но будет в общем случае содержать большее или меньшее число полинуклеотидов вследствие альтернативного сплайсинга экзонов во время процессинга мРНК. Соответствующий полипептид может обладать дополнительными функциональными доменами или отличаться отсутствием доменов. Видовые варианты представляют собой последовательности полинуклеотидов, которые варьируют от одного вида к другому. Особенно полезными согласно настоящему изобретению являются варианты продуктов генов дикого типа. Варианты могут возникнуть в результате по меньшей мере одной мутации в нуклеотидной последовательности и могут приводить к появлению измененных мРНК или полипептидов, структура или функция которых могут быть или могут не быть изменены. Любой отдельно взятый природный или рекомбинантный ген может не иметь или иметь одну или много аллельных форм. Обычные мутационные изменения, вызывающие возникновение вариантов, в общем случае приписывают природным делениям, вставкам или заменам нуклеотидов. Каждый из этих типов изменений может произойти отдельно или в комбинации с остальными типами, один или более раз в данной последовательности.

[0057] Итоговые полипептиды в общем случае будут характеризоваться значительной идентичностью аминокислотных последовательностей относительно друг друга. Полиморфный вариант представляет собой вариацию в полинуклеотидной последовательности конкретного гена между отдельными особями данного вида. Полиморфные варианты также могут охватывать "одиночные нуклеотидные полиморфизмы" (ОНП), или мутации, затрагивающие одно основание, при которых полинуклеотидная последовательность изменяется на одно основание. Наличие ОНП может указывать на, например, некоторую популяцию со склонностью к болезненному состоянию, что отражает восприимчивость против устойчивости.

[0058] Производные полинуклеотиды включают нуклеиновые кислоты, подвергнутые химической модификации, например, замещению водорода на алкил, ацил или аминогруппу. Производные, например, производные олигонуклеотиды, могут содержать не встречающиеся в природе фрагменты, такие как измененные остатки сахаров или связи между остатками сахаров. Типовыми среди них являются фосфотиоатные и другие содержащие серу виды связей, которые известны в данной области техники. Производные нуклеиновые кислоты могут также содержать метки, включая радионуклеотиды, ферменты, флуоресцентные агенты, хемилюминесцентные агенты, хромогенные агенты, субстраты, кофакторы, ингибиторы, магнитные частицы и т.п.

[0059] "Производным" полипептидом или пептидом является тот, который модифицирован, например, посредством гликозилирования, пегилирования, фосфорилирования, сульфагирования, восстановления/алкилирования, ацилирования, химического сочетания или мягкой обработки формалином. Производное может также быть модифицировано добавлением детектируемой метки, либо напрямую, либо косвенно, включая, но без ограничения, радиоизотопную, флуоресцентную и ферментативную метку.

[0060] В настоящей заявке термин "животное" или "пациент" включает, например, людей, овцу, лосей, оленя, чернохвостого оленя, норок, млекопитающих, обезьян, лошадей, крупный рогатый скот, свиней, коз, собак, кошек, крыс, мышей, птиц, курицу, пресмыкающихся, рыбу, насекомых и паукообразных.

[0061] Термин "млекопитающее" распространяется на теплокровных млекопитающих, которым, как правило, оказывают медицинскую помощь (например, люди и одомашненные животные). Примеры включают кошачьих, псовых, лошадиных, бычьих, и человека, а также только человека.

[0062] Термин "лечение" распространяется на лечение болезненного состояния у млекопитающего и включает: (a) предотвращение возникновения болезненного состояния у млекопитающего, в частности, когда такое млекопитающее предрасположено к болезненному состоянию, но оно еще не было диагностировано у субъекта; (b) ингибирование болезненного состояния, например, остановку его развития; и/или (c) облегчение болезненного состояния, например, индукцию ремиссии болезненного состояния, до тех пор, пока не будет достигнут желаемый результат. Лечение также включает уменьшение интенсивности симптома заболевания (например, уменьшение боли или дискомфорта), при этом такое уменьшение интенсивности симптомов может напрямую влиять или не влиять на заболевание (например, причину, передачу, проявление и т.д.).

[0063] В настоящей заявке термин "неврологическое заболевание или расстройство" относится к любому заболеванию или расстройству нервной системы и/или зрительной системы. "Неврологическое заболевание или расстройство" включает заболевание или расстройства, которые затрагивают центральную нервную систему (мозг, ствол мозга и мозжечок), периферическую нервную систему (включая черепные нервы) и вегетативную нервную систему (части которой находятся и в центральной, и в периферической нервной системе). Неврологическое заболевание или расстройство включает, но без ограничения, приобретенную эпилептиформную афазию; острый диссеминированный энцефаломиелит; адренолейкодистрофию; возрастную макулярную дегенерацию; агенезию мозолистого тела; агнозию; синдром Айкарди; болезнь Александера; болезнь Альпера; альтернирующую гемиплегию; болезнь Альцгеймера; сосудистую деменцию; боковой амиотрофический склероз; анэнцефалию; синдром Ангельмана; ангиоматоз; аноксию; афазию; апраксию; арахноидальные кисты; арахноидит; мальформацию Арнольда-Киари; артериовенозную мальформацию; синдром Аспергера; атаксию-телеангиэктазию; синдром дефицита внимания и гиперактивности; аутизм; вегетативную дисфункцию; боль в спине; болезнь Баттена; болезнь Бехчета; паралич Белла; доброкачественный эссенциальный блефароспазм; доброкачественную фокальную эпилепсию; амиотрофию; доброкачественную внутричерепную гипертензию; болезнь Бинсвангера; блефароспазм; синдром Блоха-Сульцбергера; повреждение плечевого сплетения; абсцесс мозга; травму головного мозга; опухоли мозга (включая мультиформную глиобластому); опухоль спинного мозга; синдром Броун-Секара; болезнь Канавана; синдром запястного канала; каузалгию; центральный болевой синдром; центральный понтинный миелинолиз; цефалический синдром; аневризму сосудов головного мозга; церебральный артериосклероз; церебральную атрофию; церебральный гигантизм; церебральный паралич; болезнь Шарко-Мари-Тута; невропатию и невропатическую боль, вызванные химиотерапией; мальформацию Киари; хорею; хроническую воспалительную демиелинизирующую полинейропатию; хроническую боль; хронический региональный болевой синдром; синдром Коффина-Лоури; кому, включающую устойчивое вегетативное состояние; врожденную лицевую диплегию; кортикобазальную дегенерацию; височный артериит; краниосиностоз; болезнь Крейтцфельдта-Якоба; кумулятивные травматические расстройства; синдром Кушинга; инклюзионную цитомегалию; цитомегаловирусную инфекцию; синдром танцующих глаз-танцующих ног; синдром Денди-Уокера; болезнь Доусона; синдром Де Морсье; паралич Дежерин-Клюмпке; деменцию; дерматомиозит; диабетическую нейропатию; диффузный склероз; вегетативную дистонию; дисграфию; дислексию; дистонию; раннюю инфантильную эпилептическую энцефалопатию; синдром пустого турецкого седла; энцефалит; энцефалоцеле; энцефалотригеминальный ангиоматоз; эпилепсию; паралич Эрба; эссенциальный тремор; болезнь Фабри; синдром Фара; потерю сознания; семейный спастический паралич; фебрильные судороги; синдром Фишера; атаксию Фридрейха; лобно-височную деменцию и другие "таупатии"; болезнь Гоше; синдром Герстманна; гигантоклеточный артериит; гигантоклеточную инклюзионную болезнь; глобоидно-клеточную лейкодистрофию; синдром Гийена-Барре; HTLV-1-ассоциированную миелопатию (миелопатию, ассоциированную с вирусом T-клеточного лейкоза человека); болезнь Галлервордена-Шпатца; травму головы; головную боль; гемифациальный спазм; наследственную спастическую параплегию; наследственную полиневропатическую атаксию; синдром коленчатого узла; опоясывающий лишай; синдром Хираямы; ВИЧ-ассоциированные деменцию и нейропатию (также неврологические проявления СПИДа); голопрозэнцефалию; болезнь Хантингтона и другие заболевания, обусловленные наличием полиглутаминовых повторов; гидроанэнцефалию; гидроцефалию; гиперкортицизм; гипоксию; иммуноопосредованный энцефаломиелит; миозит с включениями телец; недержание пигмента; инфантильную форму болезни накопления фитановой кислоты; инфантильную болезнь Рефсума; инфантильные спазмы; воспалительную миопатию; внутричерепную кисту; внутричерепную гипертензию; синдром Жубера; синдром Кернса-Сейра; болезнь Кеннеди; синдром Kinsboume; синдром Клиппеля-Фейля; болезнь Краббе; болезнь Кугельберга-Веландер; куру; болезнь Лафора; миастенический синдром Ламберта-Итона; синдром Ландау-Клеффнера; боковой медуллярный синдром (синдром Валленберга); необучаемость; болезнь Лея; синдром Леннокса-Гасто; синдром Леша-Нихена; лейкодистрофию; деменцию с тельцами Леви; лиссэнцефалию; синдром окружения; болезнь Лу Герига (например, болезнь двигательных нейронов, или боковой амиотрофический склероз); заболевание поясничных дисков; болезнь Лайма - неврологические осложнения; болезнь Мачадо-Джозефа; макроэнцефалию; мегацефалию; синдром Мелькерссона-Розенталя; болезнь Меньера; менингит; болезнь Менкеса; метахроматическую лейкодистрофию; микроцефалию; мигрень; синдром Миллера-Фишера; мини-инсульты; митохондриальные миопатии; синдром Мебиуса; мономелическую амиотрофию; болезнь двигательных нейронов; болезнь мойя-мойя; мукополисахаридозы; мультиинфарктную деменцию; моторную мультифокальную невропатию; рассеянный склероз и другие демиелинизирующие расстройства; множественную системную атрофию с ортостатической гипотензией; мышечную дистрофию; тяжелую псевдопаралитическую миастению; диффузный миелинокластический склероз; раннюю миоклоническую энцефалопатию; миоклонус; миопатию; врожденную миотонию; нарколепсию; нейрофиброматоз; злокачественный нейролептический синдром; неврологические проявления СПИДа; неврологические осложнения после волчанки; нейромиотонию; нейрональный цероидный липофусциноз; нарушения миграции нейронов; болезнь Ниманна-Пика; синдром O′Салливана-МакЛауда; затьшочную невралгию; скрытую дизрафию спинного мозга; синдром Охтахара; оливопонтоцеребеллярную атрофию; опсоклонус-миоклонус синдром; неврит зрительного нерва; ортостатическую гипотензию; синдром перегрузки; парестезию; нейродегенеративное заболевание или расстройство (болезнь Паркинсона, болезнь Хантингтона, болезнь Альцгеймера, боковой амиотрофический склероз (БАС), деменцию, рассеянный склероз и другие заболевания и расстройства, связанные с гибелью нейронов); врожденную парамиотонию; паранеопластические заболевания; пароксизмальные приступы; синдром Парри-Ромберга; болезнь Пелицеуса-Мерцбахера; периодические параличи; периферическую нейропатию; болезненную нейропатию и нейропатическую боль; устойчивое вегетативное состояние; первазивные расстройства развития; световой рефлекс чихания; болезнь накопления фитановой кислоты; болезнь Пика; защемление нерва; опухоли гипофиза; полимиозит; порэнцефалию; постполиомиелитный синдром; постгерпетическую невралгию; постинфекционньгй энцефаломиелит; ортостатическую гипотензию; синдром Прадера-Вилли; первичный боковой склероз; прионные заболевания; прогрессирующую гемифациальную атрофию; прогрессирующую многоочаговую лейкоэнцефалопатию; прогрессирующую склерозирующую полиодистрофию; прогрессирующий надъядерный паралич; доброкачественную внутричерепную гипертензию; синдром Рамсея-Ханта (типы I и II); энцефалит Расмуссена; синдром рефлекторной симпатической дистрофии; болезнь Рефсума; повторяющиеся расстройства движения; туннельный синдром; синдром беспокойных ног; миелопатию, ассоциированную с ретровирусной инфекцией; синдром Ретта; синдром Рейе; пляску Святого Витта; болезнь Сапдхоффа; болезнь Шильдера; шизэнцефалию; септо-оптическую дисплазию; синдром детского сотрясения; опоясывающий лишай; синдром Шая-Дрейджера; синдром Шегрена; апноэ во сне; синдром Сотоса; спастичность; расщепленный позвоночник; повреждение спинного мозга; опухоли спинного мозга; спинальную мышечную атрофию; синдром мышечной скованности; инсульт; синдром Стерджа-Вебера; подострый склерозирующий панэнцефалит; подкорковую атеросклеротическую энцефалопатию; хорею Сиденгама; обмороки; сирингомиелию; позднюю дискинезию; болезнь Тея-Сакса; височный артериит; синдром фиксированного спинного мозга; болезнь Томсена; синдром верхней апертуры грудной клетки; невралгию тройничного нерва; паралич Тодда; синдром Туретта; транзиторную ишемическую атаку; трансмиссивные спонгиоформные энцефалопатии; поперечный миелит; черепно-мозговую травму; тремор; тригеминальную невралгию; тропический спастический парапарез; туберозный склероз; сосудистую деменцию (мультиинфарктную деменцию); васкулит, в том числе височный артериит; болезнь Гиппеля-Линдау; синдром Валленберга; болезнь Верднига-Гоффмана; синдром Веста; хлыстовую травму; синдром Вильямса; болезнь Вильсона и синдром Цельвегера. Полинуклеотидные и олигонуклеотидные композиции и молекулы

[0064] Мишени: В одном варианте реализации мишени включают нуклеотидные последовательности гена альфа-L-идуронидазы (IDUA), включая, без ограничения, смысловые и/или антисмысловые некодирующие и/или кодирующие последовательности, связанные с геном IDUA.

[0065] Альфа-L-идуронидаза (a-L-идуронидаза или a-L-идуронид-индуронгидролаза Е.С.3.2.1.76; IDUA) представляет собой лизосомальную гидролазу, необходимую для расщепления гликозаминогликанов гепаринсульфата и дерматансульфат. Лизосомальные ферменты претерпевают ряд модификаций и процессов созревания, для которых IDUA выбрана в качестве модели.

[0066] Лизосомальная гидролаза a-L-идуронидаза (IDUA) представляет собой один из ферментов метаболического пути, ответственного за деградацию сульфата гликозаминогликанов гепарансульфата и дерматансульфата. Дефицит IDUA у человека приводит к накоплению гликозаминогликанов, в результате чего возникает лизосомная болезнь накопления - мукополисахаридоз типа I.

[0067] Генетический дефицит расщепления углеводов, лизосомального фермента альфа-L-идуронидазы вызывает лизосомную болезнь накопления, известную как мукополисахаридоз I (МПС I). МПС I (MPS I) в тяжелой форме широко известный как синдром Гурлера, и связаный с множеством проблем, такими как задержка умственного развития, помутнение роговицы, грубые черты лица, сердечные заболевания, заболевания дыхательных путей, увеличение печени и селезенки, грыж, и скованность суставов. Пациенты, страдающие от синдрома Гурлера, обычно умирают в возрасте до 10 лет. При средней форме, известной как синдром Гурлера-Шейе, как правило, психические функции сильно не затрагиваются, но и физические проблемы могут привести к смерти в подростковом возрасте или в возраст от двадцати до двадцати девяти лет. Синдром Шейе представляет собой легкую форму МПС I. Он совместим с нормальной продолжительностью жизни, но скованность суставов, помутнение роговицы и болезни сердечных клапанов взывают серьезные проблемы.

[0068] Мукополисахаридоз типа I (МПС), также известный как синдром Гурлера, представляет собой наследственное метаболическое заболевание, вызванное дефектом фермента альфа-L-идуронидазы (IDUA), функция которого расщеплять мукополисахариды. Недостаточный уровень IDUA приводит к патологическому накоплению гепарансульфата и дерматансульфата, например, в сердце, печени и центральной нервной системе. Симптомы, включая нейродегенерацию и задержку умственного развития, появляются в детстве и, из-за повреждения органов, может произойти ранняя смерть. Как правило, лечение включает внутривенную заместительную терапию рекомбинантным ферментом IDUA. Однако, системно вводимый рекомбинантный IDUA не проникает через гематоэнцефалический барьер (ГЭБ), и, следовательно, имеет незначительное влияние на последствия этого заболевания в центральной нервной системе (ЦНС).

[0069] В одном варианте реализации антисмысловые олигонуклеотиды применяют для предотвращения или лечения заболеваний или расстройств, ассоциированных с членами семейства генов (IDUA). Типовые заболевания и расстройства, опосредованные геном альфа-L-идуронидазы (IDUA), которые можно лечить с помощью антисмысловых олигонуклеотидов согласно изобретению и/или с помощью клеток/тканей, регенерированных из стволовых клеток, полученных с применением антисмысловых соединений и/или содержащих антисмысловые соединения, включают: заболевание или расстройство, ассоциированное с аномальными функцией и/или экспрессией альфа-L-идуронидазы (IDUA); мукополисахаридоз типа I (МПС I), заболевание или расстройство, ассоциированное с аномальными уровнями геперансульфата и/или дерматансульфата; неврологическое заболевание или расстройство, нейродегенеративное заболевание или расстройство, ухудшение долговременной памяти, синдром Гурлера; синдром Гурлера-Шейе и синдром Шейе и т.д.

[0070] В одном варианте реализации модулирование гена IDUA с помощью одного или более антисмысловых олигонуклеотидов представляет собой введение последних пациенту, нуждающемуся в этом, для предотвращения или лечения любого заболевания или расстройства, связанного с аномальными экспрессией, функцией, активностью белка IDUA по сравнению с нормальным контролем.

[0071] В одном варианте реализации олигонуклеотиды специфичны для полинуклеотидов гена IDUA, которые содержат, без ограничения, некодирующие области. Мишени гена IDUA включают варианты гена IDUA; мутанты гена IDUA, в том числе ОНП; некодирующие последовательности гена IDUA; аллели, фрагменты и т.п. Предпочтительно, олигонуклеотид представляет собой молекулу антисмысловой РНК.

[0072] В соответствии с вариантами реализации изобретения, молекула нуклеиновой кислоты-мишени не ограничивается исключительно полинуклеотидами IDUA, но распространяется на любые из изоформ, рецепторов, гомологов, некодирующих областей гена IDUA и т.п.

[0073] В одном варианте реализации олигонуклеотид нацелен на природную антисмысловую последовательность (природную антисмысловую последовательность для кодирующих и некодирующих областей) для мишеней IDUA, включая, без ограничения, варианты, аллели, гомологи, мутанты, производные, фрагменты и последовательности, которые представляют собой их комплемент. Предпочтительно, олигонуклеотид представляет собой молекулу антисмысловой РНК или ДНК.

[0074] В одном варианте реализации олигомерные соединения согласно настоящему изобретению также включают варианты, в которых разные основания находятся в одном или более нуклеотидных положениях в соединении. Например, если первый нуклеотид представляет собой аденин, то могут быть получены варианты, содержащие тимидин, гуанозин, цитидин или другие природные или неприродные нуклеотиды в этом положении. Это может быть выполнено в любой из позиций антисмыслового соединения. Эти соединения далее исследуют применяя способы, описанные в настоящей заявке, с целью определения их способности ингибировать экспрессию нуклеиновой кислоты-мишени.

[0075] В некоторых вариантах реализации гомология, идентичность последовательностей или комплементарность между антисмысловым соединением и мишенью составляет от примерно 50% до примерно 60%. В некоторых вариантах реализации гомология, идентичность последовательностей или комплементарность составляет от примерно 60% до примерно 70%. В некоторых вариантах реализации гомология, идентичность последовательностей или комплементарность составляет от примерно 70% до примерно 80%. В некоторых вариантах реализации гомология, идентичность последовательностей или комплементарность составляет от примерно 80% до примерно 90%. В некоторых вариантах реализации гомология, идентичность последовательностей или комплементарность составляет примерно 90%, примерно 92%, примерно 94%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или примерно 100%.

[0076] Антисмысловое соединение является способным к специфичной гибридизации, если связывание указанного соединения с нуклеиновой кислотой-мишенью нарушает нормальное функционирование нуклеиновой кислоты-мишени, приводя к потере активности, и степень комплементарности достаточна, чтобы избежать неспецифичного связывания указанного антисмыслового соединения с нуклеотидными последовательностями, не являющимися мишенями, в условиях, при которых необходимо специфичное связывание. Такие условия включают, например, физиологические условия в случае in vivo методик анализа или терапевтического воздействия и условия, при которых проводится анализ, в случае исследований in vitro.

[0077] Антисмысловое соединение, будь то ДНК, РНК, химерное соединение, замещенное соединение и т.д., способно к специфичной гибридизации, когда связывание соединения с молекулой ДНК- или РНК-мишени нарушает нормальное функционирование ДНК- или РНК-мишени, приводя к потере функции, и степень комплементарности достаточна, чтобы избежать неспецифичного связывания указанного антисмыслового соединения с последовательностями, не являющимися мишенями, в условиях, при которых необходимо специфичное связывание, т.е. при физиологических условиях в случае in vivo методик анализа или терапевтического воздействия и условиях, при которых проводится анализ, в случае исследований in vitro.

[0078] В одном варианте реализации нацеленное воздействие на ген IDUA, включающее, без ограничения, антисмысловые последовательности, идентифицируемые и раскрываемые с применением, например, ПЦР, гибридизации и т.д., одну или несколько последовательностей, соответствующих SEQ ID NOS: 2-9, и т.п., модулирует экспрессию или функцию гена IDUA. В одном варианте реализации экспрессия или функция увеличиваются по сравнению с контролем. В одном варианте реализации экспрессия или функция подавляются по сравнению с контролем.

[0079] В одном варианте реализации олигонуклеотиды содержат нуклеотидные последовательности, соответствующие SEQ ID NOS: 10-28, включая антисмысловые последовательности, идентифицируемые и раскрываемые с применением, например, ПЦР, гибридизации и т.д. Эти олигонуклеотиды могут содержать один или более модифицированных нуклеотидов, более короткие или более длинные фрагменты, модифицированные связи и т.п. Примеры модифицированных связей или межнуклеотидных связей включают фосфотиоатные, фосфодитиоатные связи и т.п. В одном варианте реализации нуклеотиды содержат фосфатное производное. Фосфатное производное (или модифицированная фосфатная группа), которое может быть присоединено к остатку сахара или аналогу остатка сахара в модифицированных олигонуклеотидах согласно настоящему изобретению, может представлять собой монофосфат, дифосфат, трифосфат, алкилфосфат, алканфосфат, фосфотиоат и т.п. Получение указанных выше аналогов фосфата и их включение в состав нуклеотидов, модифицированных нуклеотидов и олигонуклеотидов, по сути, также известно и не обязательно должно быть описано в настоящей заявке.

[0080] Специфичность и чувствительность антисмысловой последовательности также используются специалистами в данной области техники для терапевтического применения. Антисмысловые олигонуклеотиды были применены в качестве терапевтических агентов для лечения болезненных состояний у животных и человека. Антисмысловые олигонуклеотиды были безопасно и эффективно введены людям, и многочисленные клинические испытания в настоящее время находятся в стадии реализации. Таким образом, установлено, что олигонуклеотиды могут представлять собой подходящие терапевтические средства, которые могут быть сконфигурированы так, чтобы подходить к режимам лечения для обработки клеток, тканей и животных, особенно людей.

[0081] В вариантах реализации настоящего изобретения олигомерные антисмысловые соединения, в частности, олигонуклеотиды, связываются с молекулами нуклеиновых кислот-мишеней и модулируют экспрессию и/или функцию молекул, кодируемых геном-мишенью. Затрагиваемые функции ДНК включают, например, репликацию и транскрипцию. Затрагиваемые функции РНК включают все жизненно важные функции, такие как, например, транслокация РНК к месту трансляции белков, трансляция белков на матрице РНК, сплайсинг РНК с образованием одного или более видов мРНК и каталитическая активность, которая может присутствовать у РНК или которой РНК может способствовать. Функции могут быть усилены или ингибированы в зависимости от желаемых функций.

[0082] Антисмысловые соединения включают антисмысловые олигомерные соединения, антисмысловые олигонуклеотиды, олигонуклеотиды внешней направляющей последовательности (EGS), сплайс-варианты, праймеры, зонды и другие олигомерные соединения, которые гибридизуются с по меньшей мере частью нуклеиновой кислоты-мишени. Сами по себе эти соединения могут быть введены в форме одноцепочечных, двухцепочечных, частично одноцепочечных или кольцевых олигомерных соединений.

[0083] Нацеливание антисмыслового соединения на молекулу конкретной нуклеиновой кислоты, в контексте настоящего изобретения, может представлять собой многоступенчатый процесс.Процесс обычно начинается с идентификации нуклеиновой кислоты-мишени, функция которой подлежит модулированию. Эта нуклеиновая кислота-мишень может являться, например, клеточным геном (или мРНК, транскрибируемой на матрице гена), экспрессия которого связана с конкретным расстройством или болезненным состоянием, или молекулой нуклеиновой кислоты из инфекционного агента. Согласно настоящему изобретению нуклеиновая кислота-мишень кодирует ген альфа-L-идуронидазы (IDUA).

[0084] Процесс нацеливания обычно также включает определение по меньшей мере одной области-мишени, сегмента или сайта в пределах нуклеиновой кислоты-мишени для того, чтобы антисмысловое взаимодействие могло произойти, так что желаемый эффект, например, модулирование экспрессии, будет достигнут. В контексте настоящего изобретения термин "область" определяют как часть нуклеиновой кислоты-мишени, имеющую по меньшей мере одну поддающуюся идентификации структуру, функцию или характеристику. Внутри областей нуклеиновых кислот-мишеней находятся сегменты. "Сегменты" определяют как меньшие области или части областей в пределах нуклеиновой кислоты-мишени. "Сайты" в настоящем изобретении определяют как позиции в пределах нуклеиновой кислоты-мишени.

[0085] В одном варианте реализации антисмысловые олигонуклеотиды связываются с природными антисмысловыми последовательностями гена альфа-L-идуронидазы (IDUA) и модулируют экспрессию и/или функцию гена IDUA (соответствующего SEQ ID NO: 1). Примеры антисмысловых последовательностей включают последовательности, соответствующие SEQ ID NOS: 2-28.

[0086] В одном варианте реализации антисмысловые олигонуклеотиды связываются с одним или более сегментами полинуклеотидов альфа-L-идуронидазы (IDUA) и модулируют экспрессию и/или функцию гена IDUA. Сегменты содержат по меньшей мере пять последовательных нуклеотидов смысловых или антисмысловых полинуклеотидов IDUA.

[0087] В одном варианте реализации антисмысловые олигонуклеотиды специфичны к природным антисмысловым последовательностям для гена IDUA, при этом связывание олигонуклеотидов с природными антисмысловыми последовательностями для гена IDUA модулирует экспрессию и/или функцию гена IDUA.

[0088] В одном варианте реализации олигонуклеотидные соединения содержат последовательности, соответствующие SEQ ID NOS: 10-28, антисмысловые последовательности, идентифицируемые и раскрываемые с применением, например, ПЦР, гибридизации и т.д. Эти олигонуклеотиды могут содержать один или более модифицированных нуклеотидов, более короткие или более длинные фрагменты, модифицированные связи и т.п. Примеры модифицированных связей или межнуклеотидных связей включают фосфотиоатные, фосфодитиоатные связи и т.п. В одном варианте реализации нуклеотиды содержат фосфатное производное. Фосфатное производное (или модифицированная фосфатная группа), которое может быть присоединено к остатку сахара или аналогу остатка сахара в модифицированных олигонуклеотидах согласно настоящему изобретению, может представлять собой монофосфат, дифосфат, трифосфат, алкилфосфат, алканфосфат, фосфотиоат и т.п. Получение указанных выше аналогов фосфата и их включение в состав нуклеотидов, модифицированных нуклеотидов и олигонуклеотидов, по сути, также известно и не обязательно должно быть описано в настоящей заявке.

[0089] Поскольку, как известно в данной области техники, инициаторный кодон представляет собой, как правило, 5′-AUG (в транскрибируемых молекулах мРНК; 5′-ATG в соответствующей молекуле ДНК), инициаторный кодон также часто называют "AUG кодон", "старт-кодон" или "AUG старт-кодон". Меньшая часть генов имеет инициаторный кодон, содержащий последовательность РНК 5′-GUG, 5′-UUG или 5′-CUG; и 5′-AUA, 5′-ACG и 5′-CUG, как было показано, функционируют in vivo. Таким образом, термин "инициаторный кодон" и "старт-кодон" может охватывать множество последовательностей кодонов, хотя инициаторная аминокислота в каждом случае представляет собой, как правило, метионин (у эукариот) или формилметионин (у прокариот). Эукариотические и прокариотические гены могут содержать два или более альтернативных старт-кодона, любой из которых может быть предпочтительно использоваться для инициации трансляции в конкретном типе клеток или ткани, или при конкретном наборе условий. В контексте настоящего изобретения, "старт-кодон" и "инициаторный кодон" относятся к кодону или кодонам, которые используются in vivo для инициации трансляции мРНК, транскрибируемой на матрице гена, кодирующего белок альфа-L-идуронидазы (IDUA), независимо от последовательности (последовательностей) таких кодонов. Кодон терминации трансляции (или "стоп-кодон") гена может иметь одну из трех последовательностей, т.е. 5′-UAA, 5′-UAG и 5′-UGA (соответствующими последовательностями ДНК являются 5′-TAA, 5′-TAG и 5′-TGA, соответственно).

[0090] Термины "область старт-кодона" и "область инициаторного кодона" относятся к части такой мРНК или гена, которая охватывает от примерно 25 до примерно 50 последовательных нуклеотидов в любом направлении (т.е. 5′ или 3′) от инициаторного кодона. Аналогично, термины "область стоп-кодона" и "область кодона терминации трансляции" относятся к части такой мРНК или гена, которая охватывает от примерно 25 до примерно 50 последовательных нуклеотидов в любом направлении (т.е. 5′ или 3′) от кодона терминации трансляции. Следовательно, "область старт-кодона" (или "область инициаторного кодона") и "область стоп-кодона" (или "область кодона терминации трансляции") обе являются областями, на которые могут быть эффективно нацелены антисмысловые соединения согласно настоящему изобретению.

[0091] Открытая рамка считывания (OPC) или "кодирующая область", которая, как известно в данной области техники, относится к области между инициаторным кодоном и кодоном терминации трансляции, также представляет собой область, на которую может быть эффективно направлено воздействие. В контексте настоящего изобретения область-мишень является внутригенной областью, включающей инициаторный кодон или кодон терминации трансляции открытой рамки считывания (OPC) гена.

[0092] Другая область-мишень включает 5′-нетранслируемую область (5′-НТО), обозначающую в данной области техники часть мРНК в 5′-направлении от инициаторного кодона и, таким образом, содержащую нуклеотиды между 5′-сайтом кэпирования и инициаторным кодоном мРНК (или соответствующие нуклеотиды гена). Еще одна область-мишень включает 3′-нетранслируемую область (3′-НТО), обозначающую в данной области техники часть мРНК в 3′-направлении от кодона терминации трансляции и, таким образом, содержащую нуклеотиды между кодоном терминации трансляции и 3′-концом мРНК (или соответствующие нуклеотиды гена). 5-сайт кэпирования мРНК содержит N7-метилированный остаток гуанозина, присоединенный к самому крайнему 5′-остатку мРНК посредством 5′-5′-трифосфатной связи. Область 5′-кэпа мРНК, как считают, включает собственно структуру 5′-кэпа, а также первых 50 нуклеотидов, прилегающих к сайту кэпирования. Другая область-мишень согласно настоящему изобретению представляет собой область 5′-кэпа.

[0093] Несмотря на то, что некоторые эукариотические мРНК-транскрипты прямо транслируются, многие из них содержат одну или более областей, известных как "интроны", которые вырезаются из транскрипта, прежде чем он подвергается трансляции. Остальные (и, таким образом, транслируемые) области известны как "экзоны", и они соединяются друг с другом с образованием непрерывной последовательности мРНК. В одном варианте реализации нацеливание на сайты сплайсинга, т.е. на места соединения интрон-экзон или места соединения экзон-интрон, особенно подходит в случаях, в которых аберрантный сплайсинг вовлечен в развитие заболевания или в которых сверхсинтез конкретного продукта сплайсинга вовлечен в развитие заболевания. Соединение в результате аберрантного слияния вследствие перестройки или делеции представляет собой другой вариант реализации сайта-мишени. мРНК-транскрипты, полученные в результате процесса сплайсинга двух (или более) мРНК из различных источников гена известны как "транскрипты слияния". Интроны могут быть эффективно задействованы в качестве мишени с применением антисмысловых соединений, нацеленных на, например, ДНК или пре-мРНК.

[0094] В одном варианте реализации антисмысловые олигонуклеотиды связываются с кодирующими и/или некодирующими областями полинуклеотида-мишени и модулируют экспрессию и/или функцию молекулы-мишени.

[0095] В одном варианте реализации антисмысловые олигонуклеотиды связываются с природными антисмысловыми полинуклеотидами и модулируют экспрессию и/или функцию молекулы-мишени.

[0096] В одном варианте реализации антисмысловые олигонуклеотиды связываются со смысловыми полинуклеотидами и модулируют экспрессию и/или функцию молекулы-мишени.

[0097] Альтернативные РНК-транскрипты могут быть получены из одной и той же геномной области ДНК. Эти альтернативные транскрипты в общем случае известны как "варианты". Конкретнее, "варианты пре-мРНК" представляют собой транскрипты, получаемые из одной и той же геномной ДНК, которые отличаются от других транскриптов, получаемых из этой же геномной ДНК, положением их либо старт-, либо стоп-кодона и содержат как интронные, так и экзонные последовательности.

[0098] После удаления одной или более экзонной или интроной областей или их частей в процессе сплайсинга варианты пре-мРНК становятся источниками меньших "вариантов мРНК". Следовательно, варианты мРНК являются процессированными вариантами пре-мРНК, и каждый уникальный вариант пре-мРНК должен всегда давать уникальный вариант мРНК в результате сплайсинга. Эти варианты мРНК также известны как "альтернативные сплайс-варианты". Если сплайсинга варианта пре-мРНК не происходит, то вариант пре-мРНК идентичен варианту мРНК.

[0099] Варианты могут быть получены путем применения альтернативных сигналов для запуска или остановки транскрипции. Пре-мРНК и мРНК могут иметь более одного старт-кодона или стоп-кодона. Варианты, которые происходят из пре-мРНК или мРНК, использующих альтернативные старт-кодоны, известны как "альтернативные старт-варианты" этих пре-мРНК или мРНК. Те транскрипты, которые используют альтернативный стоп-кодон, известны как "альтернативные стоп-варианты" этих пре-мРНК или мРНК. Один конкретный тип альтернативного стоп-варианта представляет собой "полиА-вариант", в котором множественные получаемые транскрипты являются результатом альтернативного выбора одного из "полиА-стоп-сигналов" транскрипционным аппаратом, что приводит к получению транскриптов, которые заканчиваются на уникальных полиА-сайтах. В контексте настоящего изобретения типы вариантов, описанные в настоящей заявке, также представляют собой варианты реализации нуклеиновых кислот-мишеней.

[00100] Области в целевой нуклеиновой кислоте, с которыми гибридизуются антисмысловые соединения, определяют как часть области-мишени длиной по меньшей мере 5 нуклеотидов, на которую нацелено активное антисмысловое соединение.

[00101] В то время как специфические последовательности некоторых типовых сегментов-мишеней приведены в настоящей заявке, как будет обнаружено специалистом в данной области техники, эти последовательности служат для иллюстрации и описания конкретных вариантов реализации в рамках настоящего изобретения. Дополнительные сегменты-мишени легко поддаются идентификации специалистом в данной области техники в свете настоящего описания.

[00102] Сегменты-мишени длиной 5-100 нуклеотидов, содержащие цепь из по меньшей мере пяти (5) последовательных нуклеотидов, выбранных из нуклеотидов в пределах иллюстративных предпочтительных сегментов-мишеней, как полагают, также являются подходящими для нацеливания.

[00103] Сегменты-мишени могут включать последовательности ДНК или РНК, которые содержат по меньшей мере 5 последовательных нуклеотидов с 5′-конца одного из иллюстративных предпочтительных сегментов-мишеней (остальные нуклеотиды представляют собой последовательную цепь той же самой ДНК или РНК, начинающуюся непосредственно выше от 5′-конца сегмента-мишени и продолжающуюся в пределах от примерно 5 до примерно 100 нуклеотидов). Аналогично предпочтительные сегменты-мишени представлены последовательностями ДНК или РНК, которые соделжат по меньшей мере 5 последовательных нуклеотидов с 3′-конца одного из иллюстративных предпочтительных сегментов-мишеней (остальные нуклеотиды представляют собой последовательную цепь той же самой ДНК или РНК, начинающуюся непосредственно ниже 3′-конца сегмента-мишени и продолжающуюся в пределах от примерно 5 до примерно 100 нуклеотидов). Специалист в данной области техники, имеющий в наличии сегменты-мишени, проиллюстрированные в настоящей заявке, будет способен без проведения лишних экспериментов идентифицировать далее предпочтительные сегменты-мишени.

[00104] Как только одну или более областей-мишеней, сегментов-мишеней или сайтов-мишеней идентифицируют, отбирают антисмысловые соединения, которые в достаточной степени комплементарны мишени, т.е. гибридизуются достаточно хорошо и с достаточной специфичностью с получением желаемого эффекта.

[00105] В вариантах реализации настоящего изобретения олигонуклеотиды связываются с антисмысловой цепью конкретной мишени. Олигонуклеотиды имеют длину по меньшей мере 5 нуклеотидов и могут быть синтезированы таким образом, что каждый олигонуклеотид нацелен на перекрывающиеся последовательности, так что олигонуклеотиды синтезируют для покрытия всей длины полинуклеотида-мишени. Указанные мишени также включают и кодирующие, и некодирующие области.

[00106] В одном варианте реализации предпочитают воздействовать на конкретные нуклеиновые кислоты антисмысловыми олигонуклеотидами. Нацеливание антисмыслового соединения нав конкретную нуклеиновую кислоту представляет собой многоступенчатый процесс. Процесс обычно начинается с идентификации последовательности нуклеиновой кислоты, функция которой подлежит модулированию. Эта последовательность может представлять собой, например, клеточный ген (или мРНК, транскрибируемую на матрице этого гена), экспрессия которого связана с конкретным расстройством или болезненным состоянием, или некодирующий полинуклеотид, такой как, например, некодирующая РНК (нкРНК).

[00107] Молекулы РНК могут быть классифицированы на (1) матричные РНК (мРНК), которые транслируются в белки, и (2) РНК, не кодирующие белки (нк РНК). нкРНК включают микроРНК, антисмысловые транскрипты и другие единицы транскрипции (ЕТ), содержащие высокую плотность стоп-кодонов и не имеющие каких-либо протяженных "открытых рамок считывания". Многие нкРНК, по-видимому, начинаются с сайтов инициации в 3′-нетранслируемых областях (3′-НТО) кодирующих белок локусов. нкРНК, как правило, редки и по меньшей мере половина из нкРНК, которые были просеквенированы Международным консорциумом по анализу РНК (FANTOM), по-видимому, не являются полиаденилированньгми. Большинство исследователей по очевидным причинам сфокусировали внимание на полиаденилированных мРНК, которые подвергаются процессингу и экспорту в цитоплазму. Недавно было показано, что набор неполиаденилированных ядерных РНК может быть очень большим и что многие такие транскрипты появляются из так называемых межгенных областей. Механизм, посредством которого нкРНК могут регулировать экспрессию генов, заключается в спаривании оснований с транскриптами-мишенями. РНК, которые функционируют за счет спаривания оснований, могут быть сгруппированы в (1) цис-кодируемые РНК, которые кодируются в одном и том же участке гена, но на противоположной цепи по отношению к РНК, на которые они воздействуют, показывая, таким образом, совершенную комплементарность их мишени, и (2) транс-кодируемые РНК, которые кодируются в участках хромосом, отличных от участков для РНК, на которые они воздействуют, и не показывают в совершенной степени потенциального спаривания оснований с их мишенями.

[00108] Без привязки к какой-либо конкретной теории, модификация антисмыслового полинуклеотида антисмысловыми олигонуклеотидами, описанными в настоящей заявке, может изменять экспрессию соответствующих смысловых информационных РНК. Однако такая регуляция может быть либо несогласованной (антисмысловой "нокдаун" приводит к повышению уровня информационной РНК), либо согласованной (антисмысловой "нокдаун" приводит к сопутствующему понижению уровня информационной РНК). В этих случаях антисмысловые олигонуклеотиды могут быть нацелены на перекрывающиеся или неперекрывающиеся части антисмыслового транскрипта, в результате чего происходит его "нокдаун" или секвестрирование. Кодирующие, а также некодирующие антисмысловые {молекулы} можно нацеливать одинаковым образом, и обе категории способны регулировать соответствующие смысловые транскрипты - либо согласованным, либо несогласованным образом. Стратегии, которые применяют для выявления новых олигонуклеотидов для взаимодействия с мишенями, могут быть основаны на "нокдауне" антисмысловых РНК-транскриптов антисмысловыми олигонуклеотидами или на любых других способах модулирования желаемой мишени.

[00109] Стратегия 1: В случае несогласованной регуляции "нокдаун" антисмыслового транскрипта повышает экспрессию обычного (смыслового) гена. В случае, если этот ген кодирует известную или предполагаемую мишень для лекарственного средства, то "нокдаун" его антисмыслового эквивалента может предположительно имитировать действие агониста рецептора или стимулятора фермента.

[00110] Стратегия 2: В случае согласованной регуляции можно одновременно осуществить "нокдаун" как антисмыслового, так и смыслового транскриптов и тем самым добиться синергетического уменьшения экспрессии обычного (смыслового) гена. Если, например, антисмысловой олигонуклеотид применяют для достижения "нокдауна", тогда эта стратегия может быть применена для нацеливания одного антисмыслового олигонуклеотида на смысловой транскрипт и другим антисмысловым олигонуклеотидом на соответствующий антисмысловой транскрипт или единственным энергетически симметричным антисмысловым олигонуклеотидом, одновременно нацеленным на перекрывающиеся смысловые и антисмысловые транскрипты.

[00111] Согласно настоящему изобретению, антисмысловые соединения включают антисмысловые олигонуклеотиды, рибозимы, олигонуклеотиды внешней направляющей последовательности (EGS), соединения миРНК, одно- или двухцепочечные РНК-интерферирующие (РНКи) соединения, такие как соединения миРНК, и другие олигомерные соединения, которые гибридизуются с по меньшей мере частью нуклеиновой кислоты-мишени и модулируют ее функцию. Соответственно, они могут представлять собой ДНК, РНК, ДНК-подобные соединения, РНК-подобные соединения или их смеси или могут представлять собой миметики одного или более из указанных соединений. Такие соединения могут представлять собой одноцепочечные, двухцепочечные, кольцевые или шпилькообразные олигомерные соединения и могут содержать структурные элементы, такие как внутренние или концевые выпетливания, некомплементарные положения или петли. Антисмысловые соединения обычно получают в виде линейных соединений, но они могут быть соединены или получены иным способом для получения кольцевых и/или разветвленных соединений. Антисмысловые соединения могут включать такие конструкты, как, например, две гибридизованных цепи, образующих полностью или частично двухцепочечное соединение или одиночную цепь с самокомплементарностью, достаточной для гибридизации и образования полностью или частично двухцепочечного соединения. Указанные две цепи могут быть связаны внутренними связями, имея свободные 3′- или 5′-концы, или могут быть связаны с образованием непрерывной шпилькообразной структуры или петли. Указанная шпилькообразная структура может содержать липкий конец либо на 5′-, либо на 3′-конце, образующий удлинение одноцепочечного характера. Указанные двухцепочечные соединения необязательно могут содержать липкие концы. Другие модификации могут включать конъюгированные группы, присоединенные к одному из концов, нуклеотидам в определенных положениях, сахарам в определенных положениях или к одной из межнуклеозидных связей. Альтернативно, указанные две цепи могут быть связаны посредством не-нуклеинового фрагмента или линкерной группы. Образованная только одиночной цепью дцРНК может принимать форму самокомплементарной шпилькообразной молекулы, складывающейся с самой собой с образованием дуплекса. Таким образом, указанные дцРНК могут быть полностью или частично двухцепочечными. Специфическое модулирование экспрессии генов может быть достигнуто за счет стабильной экспрессии шпилек дцРНК в трансгенных клеточных линиях, однако, в некоторых вариантах реализации указанные экспрессия или функция генов увеличиваются. При образовании из двух цепей или одиночной цепи, принимающей форму самокомплементарной шпилькообразной молекулы, складывающейся с самой собой с образованием дуплекса, указанные две цепи (или образующие дуплекс области одиночной цепи) представляют собой комплементарные цепи РНК, которые спариваются основаниями по Уотсону-Крику.

[00112] При попадании в систему, соединения согласно настоящему изобретению могут вызывать действие одного или нескольких ферментов или структурных белков по расщеплению или другим модификациям нуклеиновой кислоты-мишени или могут работать по механизму "занятия положения" (occupancy-based mechanism). В общем случае, нуклеиновые кислоты (в том числе олигонуклеотиды) могут быть описаны как "ДНК-подобные" (т.е. содержащие, как правило, один или более 2′-дезоксисахаров и, как правило, преимущественно T, а не U основания) или "РНК-подобные" (т.е. содержащие, как правило, один или более 2′-гидрокси- или 2′-модифицированных Сахаров и, как правило, преимущественно U, а не T основания). Спирали нуклеиновых кислот могут быть представлены структурами более чем одного типа, чаще всего A- и B-формами. Считают, что, в общем случае, олигонуклеотиды, которые имеют структуру, подобную B-форме, являются "ДНК-подобными", а олигонуклеотиды, которые имеют структуру, подобную A-форме, являются "РНК-подобными". В некоторых (химерных) вариантах реализации антисмысловое соединение может содержать области как A-, так и B-формы.

[00113] В одном варианте реализации желаемые олигонуклеотиды или антисмысловые соединения содержат по меньшей мере одно из следующего: антисмысловую РНК, антисмысловую ДНК, химерные антисмысловые олигонуклеотиды, антисмысловые олигонуклеотиды, содержащие модифицированные связи, интерферирующие РНК (РНКи), малые интерферирующие РНК (миРНК); микро интерферирующие РНК (микро-РНК); малые временные РНК (мвРНК); или короткие шпилечные РНК (кшРНК); малые РНК индуцированной активации гена (РНКа); малые активирующие РНК (маРНК) или их комбинации.

[00114] дцРНК может также активировать экспрессию генов, механизм, который получил название "малые РНК индуцированной активации генов" или РНКа. дцРНК, нацеленные на промоторы генов, вызывают мощную транскрипционную активацию ассоциированных генов. РНКа была продемонстрирована в клетках человека с помощью синтетических дцРНК, называемых "малые активирующие РНК" (маРНК). В настоящее время неизвестно, консервативна ли РНКа в других организмах.

[00115] Было обнаружено, что малые двухцепочечные РНК (дцРНК), такие как малые интерферирующие РНК (миРНК) и микроРНК (микро-РНК), запускают эволюционно консервативный механизм, известный как РНК-интерференция (РНКи). РНКи неизбежно ведет к выключению (сайленсингу) генов за счет ремоделирования хроматина, что приводит к подавлению транскрипции, деградации комплементарной мРНК или блокированию трансляции белка. Тем не менее, в примерах, подробно описанных в последующей экспериментальной части, показано, что олигонуклеотиды вызывают увеличение экспрессии и/или функции полинуклеотидов альфа-L-идуронидазы (IDUA) и кодируемых ими продуктов. дцРНК может также выступать в качестве малых активирующих РНК (маРНК). Без привязки к какой-либо конкретной теории, посредством нацеленного действия на последовательности в промоторах генов-мишеней маРНК индуцируют экспрессию гена-мишени в результате явления, называемого дцРНК индуцированной транскрипционной активацией (РНКа).

[00116] В другом варианте реализации "предпочтительные сегменты-мишени", определенные в настоящей заявке, можно применять для отбора дополнительных соединений, которые модулируют экспрессию полинуклеотидов альфа-L-идуронидазы (IDUA). "Модуляторы" представляют собой соединения, понижающие или повышающие экспрессию молекулы нуклеиновой кислоты, кодирующей ген IDUA, и содержащие по меньшей мере 5-нуклеотидный участок, комплементарный предпочтительному сегменту-мишени. Способ отбора включает этапы осуществления контакта предпочтительного сегмента-мишени молекулы нуклеиновой кислоты, кодирующей смысловые или природные антисмысловые полинуклеотиды IDUA с одним или более потенциальными модуляторами, и отбор одного или более потенциального модулятора, понижающего или повышающего экспрессию молекулы нуклеиновой кислоты, кодирующей полинуклеотиды IDUA, например, SEQ ID NO: 10-28. После того, как подтверждена способность потенциального(ых) модулятора(ов) к модулированию (например, понижению или повышению) экспрессии молекулы нуклеиновой кислоты, кодирующей полинуклеотиды IDUA, указанный модулятор можно применять для дальнейших исследований функций полинуклеотидов IDUA, или для применения в качестве агента для исследований, диагностики или лечения согласно настоящему изобретению.

[00117] Нацеленное воздействие при помощи природной антисмысловой последовательности предпочтительно модулирует функцию гена-мишени. Например, гена IDUA (в частности, под номером последовательности в базе данных NCBI NM_000203). В одном варианте реализации мишень представляет собой антисмысловой полинуклеотид гена IDUA. В одном варианте реализации антисмысловой олигонуклеотид нацелен на смысловые и/или природные антисмысловые последовательности полинуклеотидов IDUA (в частности, под номером последовательности в базе данных NCBI NM_000203), их варианты, аллели, изоформы, гомологи, мутанты, производные, фрагменты и комплементарные последовательности. Предпочтительно, указанный олигонуклеотид представляет собой антисмысловую молекулу, и указанные мишени включают кодирующие и некодирующие участки антисмысловых и/или смысловых полинуклеотидов IDUA.

[00118] Предпочтительные целевые сегменты согласно настоящему изобретению могут также быть скомбинированы с соответствующими комплементарными антисмысловыми соединениями, предложенными в настоящем изобретении, с формированием стабилизированных двухцепочечных (дуплексных) олигонуклеотидов.

[00119] В данной области техники показано, что такие двухцепочечные олигонуклеотидные фрагменты модулируют экспрессию мишеней и регулируют трансляцию, а также процессинг РНК, посредством антисмыслового механизма. Кроме того, указанные двухцепочечные фрагменты могут подвергаться химическим модификациям. Например, показано, что такие двухцепочечные фрагменты ингибируют мишень посредством классической гибридизации антисмысловой цепи указанного дуплекса с мишенью, запуская тем самым ферментное расщепление мишени.

[00120] В одном варианте реализации антисмысловой олигонуклеотид нацелен на полинуклеотиды альфа-L-идуронидазы (IDUA) (в частности, под номером последовательности в базе данных NCBI NM_000203), их варианты, аллели, гомологи, мутанты, производные, фрагменты и комплементарные последовательности. Предпочтительно, указанный олигонуклеотид представляет собой антисмысловую молекулу.

[00121] Согласно вариантам реализации настоящего изобретения целевая молекула нуклеиновой кислоты не ограничивается собственно геном IDUA и может быть представлена любыми его полинуклеотидными вариантами и любыми полинуклеотидам, которые продуцируются, влияют, сильно воздействуют или являются следствием или относятся к продуктам экспрессии IDUA и/или любым его изоформам.

[00122] В одном варианте реализации олигонуклеотид нацелен на природную антисмысловую последовательность полинуклеотидов IDUA, например, полинуклеотидов, представленных в последовательностях SEQ ID NOS: 2-9, и любых их вариантов, аллелей, гомологов, мутантов, производных, фрагментов и комплементарных последовательностей. Примеры антисмысловых олигонуклеотидов представлены последовательностями SEQID NOS: 10-28.

[00123] В одном варианте реализации указанные олигонуклеотиды комплементарны или связываются с нуклеотидными последовательностями антисмысловых последовательностей для гена IDUA, включающими, не ограничиваясь перечисленными, некодирующие смысловые и/или антисмысловые последовательности, связанные с полинуклеотидами IDUA, и модулируют экспрессию и/или функцию молекул IDUA.

[00124] В одном варианте реализации указанные олигонуклеотиды комплементарны нуклеотидным последовательностям природных антисмысловых последовательностей для гена IDUA, соответствующим SEQ ID NOS: 2-9, или связываются с ними, и модулируют экспрессию и/или функцию молекул IDUA.

[00125] В одном варианте реализации олигонуклеотиды содержат последовательности, состоящие по меньшей мере из 5 последовательных нуклеотидов последовательностей SEQ ID NOS: 10-28, и модулируют экспрессию и/или функцию молекул IDUA.

[00126] Указанные полинуклеотидные мишени включают IDUA, в том числе представителей этого семейства, варианты IDUA; мутанты IDUA, в том числе однонуклеотидный полиморфизм; некодирующие последовательности IDUA; аллели IDUA; видовые варианты, фрагменты и т.п. Предпочтительно, указанный олигонуклеотид представляет собой антисмысловую молекулу.

[00127] В одном варианте реализации олигонуклеотид, который нацелен на полинуклеотиды IDUA, включает: антисмысловую РНК, интерферирующую РНК (мРНК), малую интерферирующую РНК (миРНК); микро интерферирующую РНК (микроРНК), малую, временную РНК (мвРНК), или короткую шпилечную РНК (кшРНК); малую РНК-индуцированной активации гена (РНКа), или малую активирующую РНК (маРНК).

[00128] В одном варианте реализации направленное воздействие с помощью олигонуклеотидов на полинуклеотиды альфа-L-идуронидазы (IDUA), например, соответствующие SEQ ID NOS: 2-28, модулируют экспрессию или функцию этих мишеней. В одном варианте реализации экспрессия или функция увеличивается по сравнению с контролем. В одном варианте реализации экспрессия или функция подавляется по сравнению с контролем.

[00129] В одном варианте реализации антисмысловые соединения включают последовательности, соответствующие SEQ ID NOS: 10-28. Такие олигонуклеотиды могут содержать один или более модифицированный нуклеотид, более короткие или более длинные фрагменты, модифицированные связи и т.п.

[00130] В одном варианте реализации последовательности SEQ ID NOS: 10-28 содержат один или более ЗНК-нуклеотид. В Таблице 1 приведены типовые антисмысловые олигонуклеотиды, подходящие для применения в способах согласно настоящему изобретению.

Таблица 1:
ID последовательности Наименование антисмысловой последовательности Последовательность
SEQ ID NO: 10 CUR-1820 T*C*T*C*T*C*G*C*C*T*T*T*C*C*C*T*C*C*C*T
SEQ ID NO: 11 CUR-1821 C*T*C*A*A*G*C*A*A*T*C*T*C*C*C*A*C*C*T*C*A
SEQ ID NO: 12 CUR-1822 T*C*C*C*A*G*C*T*A*C*T*C*A*G*G*A*G*G*C*T
SEQ ID NO: 13 CUR-1823 C*A*T*G*T*C*T*T*G*T*G*T*G*G*C*T*G*G*G*A*T
SEQ ID NO: 14 CUR-1973 G*A*G*T*C*A*T*C*G*G*T*C*C*T*C*A*G*A*G*C*A*G
SEQ ID NO: 15 CUR-1975 A*T*T*C*T*C*C*T*T*C*C*T*G*C*T*A*A*A*G*C
SEQ ID NO: 16 CUR-1976 A*T*T*A*T*T*T*C*G*T*A*T*T*G*C*T*T*T*G*G*C
SEQ ID NO: 17 CUR-1978 C*A*C*A*C*A*T*G*C*A*T*A*C*A*T*G*G*A*C*T
SEQ ID NO: 18 CUR-1981 C*T*C*A*G*T*T*C*T*C*T*G*A*C*G*C*T*T*T*G*A*G
SEQ ID NO: 19 CUR-1984 G*C*C*A*C*A*G*T*G*T*G*A*G*G*A*A*C*G
SEQ ID NO: 20 CUR-1985 G*T*A*A*T*A*A*T*T*T*T*T*C*C*T*G*A*C*C*C
SEQ ID NO: 21 CUR-1987 A*G*T*C*G*T*T*T*A*A*T*A*A*T*T*C*T*G*G*A*G*T
SEQ ID NO: 22 CUR-1988 T*T*A*C*T*A*A*G*T*T*T*C*A*T*G*A*G*G*T*T
SEQ ID NO: 23 CUR-1974 A*T*G*G*C*T*C*A*A*C*T*C*A*C*A*T*A*G*C*A
SEQ ID NO: 24 CUR-1977 T*T*A*T*A*C*A*A*T*G*T*T*T*G*C*T*T*G*G*A*T*T
SEQ ID NO: 25 CUR-1986 T*T*G*T*T*G*C*A*C*A*A*T*G*T*A*C*A*A*G
SEQ ID NO: 26 CUR-1983 T*G*G*T*T*G*C*T*C*T*C*A*G*G*A*G*G*C*G*G*C*T
SEQ ID NO: 27 CUR-1979 A*T*T*T*T*A*G*T*T*G*T*T*T*T*C*T*C*T*G*G
SEQ ID NO: 28 CUR-1982 C*A*C*G*G*T*G*T*G*G*G*A*C*T*G*G*T*G*G*T

[00131] Модулирование нужной целевой нуклеиновой кислоты может быть осуществлена несколькими известными в данной области техники способами. Например, антисмысловые олигонуклеотиды, миРНК и т.д. Молекулы ферментативной нуклеиновой кислоты (например, рибозимы) представляют собой молекулы нуклеиновой кислоты, способные катализировать одну или несколько разнообразных реакций, включая способность многократно расщеплять другие отдельные молекулы нуклеиновой кислоты чувствительным к последовательности нуклеиновых оснований сиквенс-специфичным образом. Такие молекулы ферментативной нуклеиновой кислоты могут применяться, например, для нацеленного действия на практически любой РНК-транскрипт.

[00132] Из-за сиквенс-специфичности транс-расщепляющие молекулы ферментативной нуклеиновой кислоты являются многообещающими потенциальными терапевтическими агентами для лечения заболеваний человека. Ферментативные молекулы нуклеиновых кислот могут быть сконструированы для расщепления конкретных РНК мишеней в общем пуле клеточной РНК. Такое расщепление делает указанные мРНК нефункциональными и отменяет экспрессию белка с этой РНК. Таким образом, синтез белка, связанного с болезненным состоянием может быть избирательно заблокирована.

[00133] В общем случае, ферментативные нуклеиновые кислоты с активностью по расщеплению РНК действуют, во-первых, за счет связывания с РНК-мишенью. Такое связывание происходит посредством мишень-связывающего фрагмента ферментативной нуклеиновой кислоты, который располагается в непосредственной близости к ферментативному фрагменту указанной молекулы, расщепляющему целевую РНК. Таким образом, указанная ферментативная нуклеиновая кислота сначала распознает целевую РНК, а потом связывается с ней посредством комплементарного спаривания оснований, и после связывания с соответствующим участком ферментативно расщепляет целевую РНК. Стратегическое расщепление такой целевой РНК уничтожит ее способность к прямому синтезу кодируемого белка. После того, как ферментативная нуклеиновая кислота связала и расщепила целевую РНК, она отсоединяется от этой РНК, освобождается для другой мишени и может повторно связывать и расщеплять новые мишени.

[00134] Ряд подходов, таких как in vitro стратегии отбора (извлечения) (Orgel, (1979) Proc. R. Soc. London, B 205, 435), были использованы для получения новых нуклеиновых катализаторов, способных катализировать различные реакции, такие как расщепление и лигирование фосфодиэфирных связей и амидных связей.

[00135] Получение рибозимов, обладающих оптимальной каталитической активностью, внесет существенный вклад в любую стратегию, включающую применение РНК-расщепляющих рибозимов для регулирования генной экспрессии. Рибозим типа «головка молотка», например, функционирует со скоростью каталитической реакции (kcat) приблизительно 1 мин-1 в присутствии насыщающих (10 мМ) концентраций кофактора Mg2+. Показано, что синтетический «РНК-лигазный» рибозим катализирует соответствующую реакцию самоизменения со скоростью приблизительно 100 мин-1. Кроме того, известно, что определенные модифицированные рибозимы типа «головка молота», имеющие связывающие субстрат состоящие из ДНК «ручки», катализируют расщепление РНК со скоростями оборотов, достигающими 100 мин-1. Наконец, замещение специфического остатка каталитического ядра «головки молота» определенными нуклеотидными аналогами дает модифицированные рибозимы, демонстрирующие повышение скорости каталитической реакции вплоть до 10-кратного. Эти результаты показывают, что рибозимы могут обеспечивать химические преобразования с каталитическими скоростями, значительно превышающими таковые, демонстрируемые in vitro большинством природных саморасщепляющих рибозимов. В этом случае возможно, что структуры некоторых саморасщепляющих рибозимов можно оптимизировать, чтобы получить максимальную каталитическую активность, или что могут быть получены совершенно новые РНК мотивы, демонстрирующие значительно увеличенные скорости фосфодиэфирного расщепления РНК.

[00136] Внутримолекулярное расщепление РНК-субстрата РНК катализатором, соответствующим модели «головка молота», впервые было показано в 1987 (Uhlenbeck, О.С. (1987) Nature, 328: 596-600). Указанный РНК катализатор был выделен и вступал в реакцию с различными РНК-молекулами, подтверждая, что он действительно является катализатором.

[00137] Каталитические РНК, сконструированные на основе мотива «головка молота», применялись для расщепления специфических целевых последовательностей осуществлением подходящего спаривания оснований в каталитической РНК для обеспечения необходимого спаривания оснований с целевыми последовательностями. Это позволило применить указанную каталитическую РНК для расщепления специфических целевых последовательностей и показать, что каталитические РНК, сконструированные согласно модели "головка молота", предположительно способны расщеплять специфические субстратные РНК in vivo.

[00138] РНК-интерференция (РНКи) стала мощным инструментом модулирования генной экспрессии у млекопитающих и в клетках млекопитающих. Этот подход предполагает получение малых интерферирующих РНК (миРНК) в виде самой РНК или в виде ДНК, с применением экспрессионной плазмиды или вируса и кодирующей последовательности для малых шпилечных РНК, которые процессируются в миРНК. Эта система обеспечивает эффективный транспорт пре-миРНК в цитоплазму, где они проявляют активность, и позволяет применение регулируемых и тканеспецифичных промоторов генной экспрессии

[00139] В одном варианте реализации олигонуклеотид или антисмысловое соединение содержит олигомер или полимер рибонуклеиновой кислоты (РНК) и/или дезоксирибонуклеиновой кислоты (ДНК), или их миметик, химеру, аналог или гомолог. Этот термин включает олигонуклеотиды, состоящие из встречающихся в природе нуклеотидов, сахаров и ковалентных межнуклеозидных (скелетных) связей, а также олигонуклеотиды, содержащие не встречающиеся в природе фрагменты, функционирующие сходным образом. Такие модифицированные или замещенные олигонуклеотиды часто предпочтительнее нативных форм, так как они обладают необходимыми свойствами, такими как, например, увеличенное поглощение клетками, увеличенная связывающая способность в отношении целевой нуклеиновой кислоты и повышенная стабильность в присутствии нуклеаз.

[00140] Согласно настоящему изобретению указанные олигонуклеотиды или «антисмысловые соединения» включают антисмысловые олигонуклеотиды (например, РНК, ДНК, их миметики, химеры, аналоги или гомологи), рибозимы, олигонуклеотиды внешних вспомогательных последовательностей (EGS), соединения миРНК, одно- или двухцепочечные РНК-интерферирующие (РНКи) соединения, такие как соединения миРНК, каРНК, аРНК, и другие олигомерные соединения, которые гибридизуются по меньшей мере с частью целевой нуклеиновой кислоты и модулируют ее функцию. Соответственно, они могут представлять собой ДНК, РНК, ДНК-подобные соединения, РНК-подобные соединения или их смеси, или могут представлять собой миметики одного или более из указанных соединений. Такие соединения могут представлять собой одноцепочечные, двухцепочечные, кольцевые или шпилькообразные олигомерные соединения и могут содержать структурные элементы, такие как внутренние или концевые выпетливания, некомплементарные положения или петли. Антисмысловые соединения обычно получают в виде линейных соединений, но они могут быть объединены или получены иным способом для получения кольцевых или и/или разветвленных соединений. Антисмысловые соединения могут включать такие конструкты, как, например, две гибридизованных цепи, формирующих полностью или частично двухцепочечное соединение, или одиночная цепь с достаточной самокомплементарностью для гибридизации и формирования полностью или частично двухцепочечного соединения. Указанные две цепи могут быть связаны внутренними связями, имея свободные 3′ или 5′ концы, или могут связываться с образованием непрерывной шпилькообразной структуры или петли. Указанная шпилькообразная структура может содержать липкий конец на 5′ или на 3′ конце, образующий удлинение одноцепочечного характера. Указанные двухцепочечные соединения в некоторых случаях могут содержать липкие концы. Другие модификации могут включать конъюгированные группы, присоединенные к одному из концов, нуклеотидам в определенных положениях, сахарам в определенных положениях или к одной из межнуклеозидных связей. Как вариант, указанные две цепи могут быть связаны посредством не-нуклеинового фрагмента или линкерной группы. Сформированная одиночной цепью дцРНК может принимать форму самокомплементарной шпилькообразной молекулы, складывающейся с самой собой с образованием дуплекса. Таким образом, указанные дцРНК могут быть полностью или частично двухцепочечными. Специфическое модулирование генной экспрессии может быть достигнуто стабильной экспрессией дцРНК-шпилек в трансгенных клеточных линиях. При формировании из двух цепей или одиночной цепи, принимающей форму самокомплементарной шпилькообразной молекулы, складывающейся с самой собой с формированием дуплекса, указанные две цепи (или формирующие дуплекс участки одиночной цепи) представляют собой комплементарные цепи РНК, которые спариваются по Уотсону-Крику.

[00141] При введении в систему соединения, предложенные в настоящем изобретении, могут приводить к активации одного или более ферментов или структурных белков, влияя на расщепление или иные модификации целевой нуклеиновой кислоты, либо могут действовать через механизмы «заполнения». Как правило, нуклеиновые кислоты (включая олигонуклеотиды) могут быть названы «ДНК-подобными» (т.е., как правило, содержащими один или более 2′-дезокси-сахар и, как правило, преимущественно T, а не U, основания) или «РНК-подобными» (т.е., как правило, содержащими один или более 2′-гидроксил или 2′-модифицированные сахара и, как правило, преимущественно T, а не U, основания). Спирали нуклеиновых кислот могут быть представлены структурами более чем одного типа, чаще всего A- и B-формами. Предполагают, что, как правило, олигонуклеотиды, имеющие структуру типа B-формы, «ДНК-подобны», а имеющие структуру типа A-формы, «РНК-подобны». Согласно некоторым вариантам реализации (с химерами) антисмысловое соединение может содержать участки как A-, так и B-формы.

[00142] Антисмысловые соединения согласно настоящему изобретению могут содержать антисмысловой фрагмент приблизительно от 5 до приблизительно 80 нуклеотидов (т.е. приблизительно от 5 до приблизительно 80 связанных нуклеозидов) длиной. Это относится к длине указанной антисмысловой цепи или части указанного антисмыслового соединения. Иными словами, одноцепочечное антисмысловое соединение, предложенное в настоящем изобретении, содержит от 5 до приблизительно 80 нуклеотидов, а двухцепочечное антисмысловое соединение, предложенное в настоящем изобретении, (такие как, например, дцРНК) содержит смысловую и антисмысловую цепь или фрагменты от 5 до приблизительно 80 нуклеотидов длиной. Специалисту в данной области техники будет ясно, что под этим понимаются антисмысловые фрагменты, составляющие в длину 5, 6, 7,8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 или 80 нуклеотидов, или принадлежащие любому диапазону в пределах указанного.

[00143] В одном варианте реализации антисмысловые соединения, предложенные в настоящем изобретении, содержат антисмысловые фрагменты 10-50 нуклеотидов длиной. Специалисту в данной области техники будет ясно, что в указанный диапазон включены олигонуклеотиды, содержащие антисмысловые фрагменты, составляющие в длину 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, или 50 нуклеотидов, или принадлежащие любому диапазону в пределах указанного. Согласно некоторым вариантам реализации длина указанных олигонуклеотидов составляет 15 нуклеотидов.

[00144] В одном варианте реализации антисмысловые или олигонуклеотидные соединения, предложенные в настоящем изобретении, содержат антисмысловые фрагменты, составляющие от 12 или 13 до 30 нуклеотидов в длину. Специалисту в данной области техники будет ясно, что сюда включены антисмысловые соединения, содержащие антисмысловые фрагменты, составляющие в длину 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или принадлежащие любому диапазону в пределах указанного.

[00145] В одном варианте реализации олигомерные соединения, предложенные в настоящем изобретении, также включают варианты, в которых в одном или нескольких положениях нуклеотидов указанного соединения присутствуют различающиеся основания. Например, если первый нуклеотид представляет собой аденозин, могут быть получены варианты, которые содержат тимидин, гуанозин или цитидин в этом положении. Это может быть осуществлено в любом положении указанного антисмыслового или дцРНК-соединения. Такие соединения затем тестируют с применением способов, описанных в настоящей заявке, для определения их способности ингибировать экспрессию целевой нуклеиновой кислоты.

[00146] Согласно некоторым вариантам реализации степень гомологии, идентичности последовательностей или комплементарности между указанным антисмысловым соединением и мишенью составляет от приблизительно 40% до приблизительно 60%. Согласно некоторым вариантам реализации степень гомологии, идентичности последовательностей или комплементарности составляют приблизительно от 60% до приблизительно 70%. Согласно некоторым вариантам реализации степень гомологии, идентичности последовательностей или комплементарности составляют приблизительно от 70% до приблизительно 80%. Согласно некоторым вариантам реализации степень гомологии, идентичности последовательностей или комплементарности составляют приблизительно от 80% до приблизительно 90%. Согласно некоторым вариантам реализации гомология, идентичность последовательностей или комплементарность составляют приблизительно 90%, приблизительно 92%, приблизительно 94%, приблизительно 95%, приблизительно 96%, приблизительно 97%, приблизительно 98%, приблизительно 99% или приблизительно 100%.

[00147] В одном варианте реализации антисмысловые олигонуклеотиды, такие как, например, молекулы нуклеиновой кислоты, представленные в последовательностях SEQ ID NOS: 10-28, включают одну или более чем одну замену или модификацию. Согласно одному из вариантов реализации указанные нуклеотиды заменены закрытыми нуклеиновыми кислотами (ЗНК).

[00148] В одном варианте реализации указанные олигонуклеотиды нацеленно взаимодействуют с одним или более участком молекул нуклеиновой кислоты смысловых и/или антисмысловых кодирующих и/или некодирующих последовательностей, связанных с геном IDUA, и последовательностей, соответствующих SEQ ID NOS: 1-9. Олигонуклеотиды также нацелены на перекрывающиеся участки, соответствующие SEQ ID NOS: 1-9.

[00149] Некоторые предпочтительные олигонуклеотиды, предложенные в настоящем изобретении, представляют собой химерные олигонуклеотиды. «Химерные олигонуклеотиды» или «химеры» в контексте настоящего изобретения представляют собой олигонуклеотиды, которые содержат два или более химически отличных участка, каждый из которых состоит по меньшей мере из одного нуклеотида. Такие олигонуклеотиды, как правило, содержат по меньшей мере один участок модифицированных нуклеотидов, обеспечивающий одно или более полезное свойство (такое как, например, увеличенная устойчивость к нуклеазам, увеличенное поглощение клетками, повышенная связывающая способность по отношению к мишени) и участок, который представляет собой субстрат для ферментов, способных к расщеплению РНЮДНК или РНК:РНК гибридов. Как пример, РНКаза H представляет собой клеточную эндонуклеазу, которая расщепляет РНК-цепь РНК:ДНК дуплекса. Активация РНКазы H, таким образом, приводит к расщеплению целевой РНК, тем самым значительно повышая эффективность антисмыслового модулирования генной экспрессии. Соответственно, при использовании химерных олигонуклеотидов сопоставимые результаты часто могут быть получены с более короткими олигонуклеотидами, по сравнению с использованием фосфоротиоатных дезоксиолигонуклеотидов, гибридизующихся с тем же целевым участком. Расщепление целевой РНК можно определять стандартным способом посредством гель-электрофореза и, при необходимости, сопутствующих методик гибридизации нуклеиновых кислот, известных в данной области техники. В одном варианте реализации химерный олигонуклеотид содержит по меньшей мере один участок, модифицированный для увеличения способности связываться с мишенью, и, как правило, участок, функционирующий как субстрат РНКазы H. Связывающая способность олигонуклеотида по отношению к мишени (в данном случае, нуклеиновой кислоте, кодирующей ras) определяется стандартным способом - измерением температуры плавления пары олигонуклеотид/мишень, представляющим собой температуру, при которой олигонуклеотид и мишень диссоциируют; диссоциацию определяют спектрофотометрически. Чем выше температура плавления, тем больше связывающая способность указанного олигонуклеотида по отношению к мишени.

[00150] Химерные антисмысловые соединения, предложенные в настоящем изобретении, могут быть получены в виде составных структур из двух или более олигонуклеотидов, модифицированных олигонуклеотидов, олигонуклеозидов и/или миметиков олигонуклеотидов согласно приведенным выше описаниям. Такие соединения также известны в данной области техники как гибриды или гапмеры. Примеры патентов США, в которых описано получение таких гибридных структур, включают, не ограничиваясь перечисленными, патенты США 5013830; 5149797; 5220007; 5256775; 5366878; 5403711; 5491133; 5565350; 5623065; 5652355; 5652356; и 5700922, каждый из которых включен в настоящую заявку посредством ссылки.

[00151] В одном варианте реализации модифицируемый участок указанного олигонуклеотида содержит по меньшей мере один нуклеотид, модифицированный по 2′ положению сахара, наиболее предпочтительно 2′-O-алкил, 2′-O-алкил-O-алкил или 2′-фтор-модифицированный нуклеотид. В другом варианте реализации РНК модификации включают 2′-фтор, 2′-амино и 2′-O-метильные модификации рибозы пиримидинов, лишенные азотистого основания остатки или обратное основание на 3′-конце указанной РНК. Такие модификации олигонуклеотидов осуществляют стандартными способами; показано, что такие олигонуклеотиды имеют более высокую температуру плавления (т.е. большую способность связываться с мишенью), чем 2′-дезоксиолигонуклеотиды, относительно определенной мишени. В результате такой повышенной связывающей способности значительно усиливается ингибирование генной экспрессии РНКи-олигонуклеотидом. РНКаза Н представляет собой клеточную эндонуклеазу, расщепляющую РНК цепь РНК:ДНК дуплексов; активация этого фермента, таким образом, приводит к расщеплению целевой РНК, и, следовательно, может значительно увеличивать эффективность РНКи ингибирования. Расщепление целевой РНК может быть подтверждено обычным способом посредством гель-электрофореза. В одном варианте реализации указанный химерный олигонуклеотид также модифицирован для увеличения устойчивости к нуклеазе. Клетки содержат множество экзо- и эндонуклеаз, способных разлагать нуклеиновые кислоты. Показано, что некоторые нуклеотидные и нуклеозидные модификации придают олигонуклеотиду, в состав которого они входят, большую устойчивость к нуклеазному расщеплению по сравнению с нативным олигодезоксинуклеотидом. Устойчивость к нуклеазам измеряют обычным способом, инкубируя олигонуклеотиды с клеточными экстрактами или растворами с выделенными нуклеазами и измеряя содержание интактных олигонуклеотидов спустя определенное время, как правило, посредством гель-электрофореза. Олигонуклеотиды, модифицированные для увеличения устойчивости к нуклеазам, остаются интактными на протяжении более длительного времени по сравнению с немодифицированными олигонуклеотидами. Показано, что ряд модификаций олигонуклеотидов усиливают или придают им устойчивость к нуклеазам. Олигонуклеотиды, которые содержат по меньшей мере одну фосфоротиоатную модификацию, на настоящий момент более предпочтительны. В некоторых случаях модификации олигонуклеотидов, усиливающие способность связываться с мишенью также, независимым образом, способны повышать устойчивость к нуклеазам.

[00152] Специфические примеры некоторых предпочтительных олигонуклеотидов, предусмотренных настоящим изобретением, включают содержащие модифицированные остовы, например, фосфоротиоаты, фосфотриэфиры, метилфосфонаты, алкильные с короткой цепью или циклоалкильные связи между сахарами или гетероатомные с короткой цепью или гетероциклические связи между сахарами. Наиболее предпочтительными являются олигонуклеотиды с фосфоротиоатными остовами и с гетероатомными остовами, в частности, CH2-NH-O-CH2, CH, -N(CH3)-O-CH2 [известный как метилен(метилимино) или MM1 остов], CH2-O-N(CH3)-CH2, CH2-N(CH3)-N(CH3)-CH2 и O-N(CH3)-CH2-CH2 остовы, где нативный фосфодиэфирный остов представлен в виде O-P-O-CH,). Амидные остовы, описанные в De Mesmaeker et al. (1995) Асе. Chem. Res. 28: 366-374, также являются предпочтительными. Также предпочтительными являются олигонуклеотиды, содержащие морфолиновые остовы (Summerton and Weller, патент США 5034506). В другом варианте реализации, таком как остов на основе пептидной нуклеиновой кислоты (ПНК), фосфодиэфирный остов олигонуклеотида заменен полиамидным остовом, нуклеотиды связаны прямо или непрямо с азотными атомами азагрупп полиамидного остова. Олигонуклеотиды могут также содержать один или более фрагмент замещенного сахара. Предпочтительные олигонуклеотиды содержат один из следующих заместителей в положении 2′: OH, SH, SCH3, F, OCN, OCH3, O(CH2)nCH3, O(CH2)nNH2 или O(CH2)nCH3, где n принимает значения от 1 до приблизительно 10; C1-C10 низшие алкилы, алкоксиалкокси, замещенные низшие алкилы, алкарил или аралкил; Cl; Br; CN; CF3; OCF3; O-, S-, или N-алкил; О-, S-, или N-алкенил; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; гетероциклоалкил; гетероциклоалкарил; аминоалкиламино; полиалкиламино; замещенные силилы; РНК расщепляющую группу; репортерную группу; интеркалятор; группу, улучшающую фармакокинетические свойства олигонуклеотида; или группу, улучшающую фармакодинамические свойства олигонуклеотида, и другие заместители, обладающие сходными свойствами. Предпочтительная модификация включает 2′-метоксиэтокси [2′-O-CH2CH2OCH3, также известный как 2′-O-(2-метоксиэтил)]. Другие предпочтительные модификации включают 2′-метокси(2′-O-CH3), 2′-пропокси(2′-OCH2CH2CH3) и 2′-фтор (2′-F). Сходные модификации могут быть также осуществлены в других положениях олигонуклеотида, в частности, по 3′ положению сахара 3′ концевого нуклеотида и 5′ положению 5′ концевого нуклеотида. Олигонуклеотиды могут также содержать миметики сахаров, такие как циклобутилы, вместо пентофуранозильной группы.

[00153] Олигонуклеотиды могут также содержать, дополнительно или альтернативно, модификации или замены нуклеинового основания (часто называемого в данной области техники просто «основанием»). Используемые в настоящей заявке термины «немодифицированные» или «природные» нуклеотиды включают аденин (A), гуанин (G), тимин (T), цитозин (C) и урацил (U). Модифицированные нуклеотиды включают нуклеотиды, обнаруживаемые в природных нуклеиновых кислотах редко или временно, например, гипоксантин, 6-метиладенин, 5-Me пиримидины, в частности, 5-метилцитозин (также называемый 5-метил-2′ дезоксицитозин и часто упоминаемый в данной области техники как 5-Me-C), 5-гидроксиметилцитозин (ГМЦ), гликозил ГМЦ и гентобиозил ГМЦ, а также синтетические нуклеотиды, например, 2-аминоаденин, 2-(метиламино)аденин, 2-(имидазолилалкил)аденин, 2-(аминоалкиламино)аденин или другие гетерозамещенные алкиладенины, 2-тиоурацил, 2-тиотимин, 5-бромурацил, 5-гидроксиметилурацил, 8-азагуанин, 7-деазагуанин, N6 (6-аминогексил)аденин и 2,6-диаминопурин. «Универсальное» основание из известных в данной области техники, например, инозин, может также быть включено. Показано, что 5-Me-C замещения увеличивают стабильность дуплексов нуклеиновых кислот на 0,6-1,2°C и на настоящий момент являются предпочтительными замещениями оснований.

[00154] Другая модификация олигонуклеотидов, предложенных в настоящем изобретении, включает химическое связывание с указанным олигонуклеотидом одного или нескольких фрагментов или конъюгатов, увеличивающих активность или поглощение клетками указанного олигонуклеотида. Такие фрагменты включают, не ограничиваясь перечисленными, липидные фрагменты, такие как фрагменты холестерина, фрагмент холестерила, алифатические цепи, например, додекандиольные или ундецильные остатки, цепь полиамина или полиэтиленгликоля, или адамантан-уксусную кислоту. Олигонуклеотиды, содержащие липофильные фрагменты, и способы получения таких олигонуклеотидов известны в данной области техники, см., например, патенты США №5138045, 5218105 и 5459255.

[00155] Необязательно, чтобы все положения конкретного нуклеотида были модифицированы единообразно, и на самом деле в одном олигонуклеотиде, или даже в одном нуклеозиде в составе олигонуклеотида может содержаться более одной из упомянутых выше модификаций. Настоящее изобретение также включает олигонуклеотиды, которые представляют собой химерные олигонуклеотиды согласно данному выше определению.

[00156] В другом варианте реализации молекула нуклеиновой кислоты, предложенная в настоящем изобретении, конъюгирована с другим фрагментом, включая, но не ограничиваясь перечисленными, лишенные оснований нуклеотиды, полиэфиры, полиамины, полиамиды, пептиды, углеводороды, липиды или полиуглеводородные соединения. Специалистам в данной области техники будет ясно, что такие молекулы могут быть связаны с любым одним или более чем одним нуклеотидом, содержащим молекулу нуклеиновой кислоты, в нескольких положениях на сахаре, основании или фосфатной группе.

[00157] Олигонуклеотиды, применяемые согласно настоящему изобретению, могут быть удобно и просто получены с применением общеизвестной техники твердофазного синтеза. Оборудование для такого синтеза коммерчески доступно от ряда поставщиков, включая Applied Biosystems. Можно также применять любые другие способы такого синтеза; фактический синтез указанного олигонуклеотида не представляет трудностей для среднего специалиста в данной области техники. Также общеизвестна возможность применения сходных методик для получения других олигонуклеотидов, таких как фосфоротиоатные и алкилатные производные. Также общеизвестна возможность применения сходных техник и коммерчески доступных модифицированных амидитов и продуктов на основе стекла с контролируемым размером пор (CPG), таких как биотин-, флуоресцеин-, акридин- или псорален-модифицированные амидиты и/или CPG (доступные от Glen Research, Sterling VA) для синтеза флуоресцентно меченых, биотинилированных или других модифицированных олигонуклеотидов, таких как холестерин-модифицированные олигонуклеотиды.

[00158] В соответствии с настоящим изобретением подразумевается применение модификаций, например, применение мономеров ЗНК для усиления силы, специфичности и продолжительности действия и расширение диапазона путей введения олигонуклеотидов, состоящих из конкретных компонентов, таких как МОЭ, АНК, ФАНК, ФТ и т.д. Это может быть достигнуто замещением некоторых мономеров в конкретных олигонуклеотидах ЗНК-мономерами. ЗНК-модифицированный олигонуклеотид может иметь размер, соответствующий исходному соединению, или может быть больше, либо, предпочтительно, меньше. Предпочтительно, чтобы такие ЗНК-модифицированные олигонуклеотиды содержали менее чем приблизительно 70%, более предпочтительно менее чем приблизительно 60%, наиболее предпочтительно менее чем приблизительно 50% мономеров ЗНК, и чтобы их размеры составляли приблизительно от 5 до 25 нуклеотидов, более предпочтительно приблизительно от 12 до 20 нуклеотидов.

[00159] Предпочтительные модифицированные олигонуклеотидные остовы включают, не ограничиваясь перечисленными: фосфоротиоаты, хиральные фосфоротиоаты, фосфородитаоаты, фосфотриэфиры, аминоалкилфосфотриэфиры, метил- и другие алкилфосфонаты, включая 3′алкиленфосфонаты и хиральные фосфонаты, фосфинаты, фосфорамидаты, включая 3′-амино фосфорамидат и аминоалкилфосфорамидаты, тионофосфорамидаты, тионоалкилфосфонаты, тионоалкилфосфотриэфиры, и боранофосфаты, включающие нормальные 3′-5′ связи, 2′-5′ связанные аналоги, и имеющие обращенную полярность, где соседние пары нуклеозидныхединиц связаны 3′-5′ к 5′-3′ или 2′-5′ к 5′-2′. Различные соли, смешанные соли и свободные кислоты также включены.

[00160] Примеры патентов США, раскрывающих получение вышеприведенных фосфорсодержащих связей, включают, не ограничиваясь перечисленными, патенты США 3687808; 4469863; 4476301; 5023243; 5177196; 5188897; 5264423; 5276019; 5278302; 5286717; 5321131; 5399676; 5405939; 5453496; 5455233; 5466677; 5476925; 5519126; 5536821; 5541306; 5550111; 5563253; 5571799; 5587361; и 5625050, каждый из которых включен в настоящую заявку посредством ссылки.

[00161] Предпочтительные модифицированные олигонуклеотидные остовы, не включающие атомы фосфора, образованы алкильными с короткой цепью или циклоалкильными межнуклеозидными связями, смешанными гетероатомными и алкильными или циклоалкильными межнуклеозидными связями, или одной или более гетероатомными с короткой цепью или гетероциклическими межнуклеозидными связями. Они включают остовы с морфолиновыми связями (образованными частично сахаром нуклеозида); силоксановые остовы; сульфидные, сульфоксидные и сульфоновые остовы; формацетильные и тиоформацетильные остовы; метиленформацетильные и тиоформацетильные остовы; алкенсодержащие остовы; сульфаматные остовы; метилениминовые и метиленгидразиновые остовы; сульфонатные и сульфонамидные остовы; амидные остовы; и другие, содержащие смешанные N, O, S и CH2-компоненты.

[00162] Примеры патентов США, содержащие указание по получению описанных выше олигонуклеотидов, включают, не ограничиваясь перечисленными, патенты США 5034506; 5166315; 5185444; 5214134; 5216141; 5235033; 5264562; 5264564; 5405938; 5434257; 5466677; 5470967; 5489677; 5541307; 5561225; 5596086; 5602240; 5610289; 5602240; 5608046; 5610289; 5618704; 5623070; 5663312; 5633360; 5677437; и 5677439, каждый из которых включен в настоящую заявку посредством ссылки.

[00163] В других предпочтительных миметиках олигонуклеотидов и сахара, и межнуклеозидная связь, т.е. остов, нуклеотидных единиц, заменены новыми группами. Основания сохраняют для гибридизации с подходящим целевым соединением нуклеиновой кислоты. Одно из таких олигомерных соединений, олигонуклеотидный миметик, продемонстрировавший прекрасную способность к гибридизации, называют пептидной нуклеиновой кислотой (ПНК). В ПНК-соединениях сахарный остов олигонуклеотида заменен амидсодержащим остовом, например, аминоэтилглициновым остовом. Основания нуклеиновых кислот сохранены и связаны прямо или непрямо с азотными атомами азагрупп амидной части остова. Примеры патентов США, в которых описано получение ПНК-соединений, включают, не ограничиваясь перечисленными, патенты США 5539082; 5714331; и 5719262, каждый из которых включен в настоящую заявку посредством ссылки. Дальнейшее описание ПНК-соединений можно найти у Nielsen, et al. (1991) Science 254,1497-1500.

[00164] В одном варианте реализации изобретения олигонуклеотиды с фосфоротиоатными остовами и олигонуклеозиды с гетероатомными остовами, и в частности- CH2-NH-O-CH2-, -CH2-N-(CH3)-O-CH2-, известным как метилен (метилимино) или MM1 остов, - CH2-O-N(CH3)-CH2-, -CH2N(CH3)-N(CH3) CH2- и -O-N(CH3)-CH2-CH2-, где нативный фосфодиэфирный остов представлен как -O-P-O-CH2- согласно упомянутому выше патенту США 5489677, и амидные остовы согласно упомянутому выше патенту США 5602240. Также предпочтительными являются олигонуклеотиды, содержащие морфолиновые остовы согласно вышеупомянутому патенту США 5034506.

[00165] Модифицированные олигонуклеотиды могут также содержать один или более фрагмент замещенного сахара. Предпочтительные олигонуклеотиды содержат один из следующих заместителей по положению 2′: ОН; F; O-, S-, или N-алкил; O-, S-, или N-алкенил; О-, S- или N-алкинил; или O алкил-O-алкил, где указанные алкил, алкенил и алкинил могут представлять собой замещенный или незамещенный C1-C10 алкил или C2-C10 алкенил и алкинил. В частности, предпочтительными являются O(CH2)nOmCH3, O(CH2)n, OCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2 и O(CH2)nON(CH3)2, где n и m могут принимать значения от 1 до приблизительно 10. Другие предпочтительные олигонуклеотиды содержат один из следующих заместителей по положению 2′: C→CO, (низшие алкилы, замещенные низшие алкилы, алкарил, аралкил, O-алкарил или O-аралкил, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, гетероциклоалкил, гетероциклоалкарил, аминоалкиламино, полиалкиламино, замещенные силилы, РНК расщепляющую группу, репортерную группу, интеркалятор, группу, улучшающую фармакокинетические свойства олигонуклеотида, или группу, улучшающую фармакодинамические свойства олигонуклеотида, и другие заместители, обладающие сходными свойствами. Предпочтительная модификация включает 2′-метоксиэтокси (2′-O-CH2CH2OCH3, также известную как 2′-O-(2-метоксиэтил) или 2′-МОЭ), т.е. алкоксиалкокси группу. Еще одна предпочтительная модификация включает 2′-диметиламинооксиэтокси, т.е., O(Ch2)2ON(CH3)2 группу, также известную как 2′-ДМАОЭ, согласно описанию в приведенных ниже в настоящей заявке примерах, и 2′-диметиламиноэтоксиэтокси (также известной в данной области техники как 2′-O-диметиламиноэтоксиэтил или 2′-ДМАЭОЭ), т.е., 2′-O-CH2-O-CH2-N(CH2)2.

[00166] Другие предпочтительные модификации включают 2′-метокси (2′-OCH3), 2′-аминопропокси (2′-OCH2CH2CH2NH2) и 2′-фтор (2′-F). Сходные модификации могут быть также осуществлены в других положениях олигонуклеотида, в частности, по 3′ положению сахара 3′ концевого нуклеотида или в 2′-5′связанных олигонуклеотидах и 5′ положению 5′ концевого нуклеотида. Олигонуклеотиды могут также содержать миметики сахаров, например, циклобутильные фрагменты вместо пентофуранозильного сахара. Примеры патентов США, в которых описано получение таких модифицированных сахарных структур, включают, не ограничиваясь перечисленными, патенты США 4981957; 5118800; 5319080; 5359044; 5393878; 5446137; 5466786; 5514785; 5519134; 5567811; 5576427; 5591722; 5597909; 5610300; 5627053; 5639873; 5646265; 5658873; 5670633; и 5700920, каждый из которых включен в настоящую заявку посредством ссылки.

[00167] Олигонуклеотиды могут также содержать модифицированные или замещенные нуклеиновые основания (часто называемое в данной области техники просто «основания»). В контексте настоящей заявки «немодифицированные» или «природные» нуклеотиды включают пуриновые основания аденин (A) и гуанин (G), и пиримидиновые основания тимин (T), цитозин (C) и урацил (U). Модифицированные нуклеотиды включают другие синтетические и природные нуклеотиды, такие как 5-метилцитозин (5-me-C), 5-гидроксиметил цитозин, ксантин, гипоксантин, 2-аминоаденин, 6-метил и другие алкильные производные аденина и гуанина, 2-пропил и другие алкильные производные аденина и гуанина, 2-тиоурацил, 2-тиотимин и 2-тиоцитозин, 5-галогенурацил и цитозин, 5-пропинил урацил и цитозин, 6-азо урацил, цитозин и тимин, 5-урацил (псевдо-урацил), 4-тиоурацил, 8-галоген, 8-амино, 8-тиол, 8-тиоалкил, 8-гидроксил и другие 8-замещенные аденины и гуанины, 5-галоген, в частности, 5-бром, 5-трифторметил и другие 5-замещенные урацилы и цитозины, 7-метилгуанин и 7-метиладенин, 8-азагуанин и 8-азааденин, 7-деазагуанин и 7-деазааденин и 3-деазагуанин и 3-деазааденин.

[00168] Далее, нуклеотиды включают описанные в патенте США 3687808, описанные в 'The Concise Encyclopedia of Polymer Science And Engineering', стр.858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, описанные у Engllsch et al., 'Angewandle Chemie, international Edition', 1991, 30, стр.613, и описанные у Sanghvl, Y.S., Chapter 15, 'Antlsense Research and Applications', стр.289-302, Crooke, S.T. и Lebleu, B. ea., CRC Press, 1993. Некоторые из этих нуклеотидов подходят, в частности, для увеличения связывающей способности олигомерных соединений, предложенных в настоящем изобретении. Такие включают 5-замещенные пиримидины, 6- азапиримидины и N-2, N-6 и O-6 замещенные пурины, в том числе 2-аминопропиладенин, 5-пропинилурацил и 5-пропинилцитозин. 5-метилцитозиновые замещения, как было показано, повышают стабильность дуплексов нуклеиновых кислот на 0,6-1,2°C (Sanghv1, Y.S., Crooke, S.T., Lebleu, В., eds, 'Antlsense Research and Applications', CRC Press, Boca Raton, 1993, pp.276-278) и на настоящий момент являются предпочтительными замещениями оснований, в частности, в комбинации с 2'-O-метоксиэтиловыми модификациями сахаров.

[00169] Примеры патентов США, в которых описано получение вышеупомянутых модифицированных нуклеотидов, а также других модифицированных нуклеотидов, включают, не ограничиваясь перечисленными, патенты США 3687808, а также 4845205; 5130302; 5134066; 5175273; 5367066; 5432272; 5457187; 5459255; 5484908; 5502177; 5525711; 5552540; 5587469; 5596091; 5614617; 5750692 и 5681941, каждый из которых включен в настоящую заявку посредством ссылки.

[00170] Другая модификация олигонуклеотидов, предложенных в настоящем изобретении, подразумевает химическое связывание с олигонуклеотидом одного или более фрагмента или конъюгата, стимулирующего активность, распределение в клетках или поглощение клетками указанного олигонуклеотида.

[00171] Такие фрагменты содержат, не ограничиваясь перечисленными, липидные фрагменты, такие как фрагменты холестерина, холевая кислота, тиоэфир, например, гексил-S-тритилтиол, тиохолестерин, алифатические цепи, например, додекандиольные или ундецильные остатки, фосфолипид, например, ди-гексадецил-rac-глицерин или триэтиламмоний 1,2-ди-O-гексадецил-гас-глицеро-3-H-фосфонат, цепь полиамина или полиэтиленгликоля, или адамантан-уксусную кислоту, пальмитиновый фрагмент, или октадециламиновый или гексиламино-карбонил-t оксихолестериновый фрагмент.

[00172] Примеры патентов США, в которых описано получение таких олигонуклеотидных конъюгатов, включают, не ограничиваясь перечисленными, патенты США 4828979; 4948882; 5218105; 5525465; 5541313; 5545730; 5552 538; 5578717, 5580731; 5580731; 5591584; 5109124; 5118802; 5138045; 5414077; 5486603; 5512439; 5578718; 5608046; 4587044; 4605735; 4667025; 4762779; 4789737; 4824941; 4835263; 4876335; 4904582; 4958013; 5082 830; 5112963; 5214136; 5082830; 5112963; 5214136; 5245022; 5254469; 5258506; 5262536; 5272250; 5292873; 5317098; 5371241, 5391723; 5416203,5451463; 5510475; 5512667; 5514785; 5565552; 5567810; 5574142; 5585481; 5587371; 5595726; 5597696; 5599923; 5599928 и 5688941, каждый из которых включен в настоящую заявку посредством ссылки.

[00173] Поиск новых лекарственных средств: Соединения, предложенные в настоящем изобретении, могут также применяться для поиска новых лекарств и валидации мишеней.

Настоящее изобретение включает применение описанных в настоящей заявке соединений и предпочтительных целевых сегментов при поиске новых лекарственных средств для выяснения взаимосвязей, существующих между полинуклеотидами альфа-L-идуронидазы (IDUA) и болезнью, фенотипом или состоянием. Такие способы включают обнаружение или модулирование полинуклеотидов IDUA, включая осуществление контакта образца, ткани, клетки или организма с соединениями, предложенными в настоящем изобретении, измерение уровня нуклеиновой кислоты или белка полинуклеотидов IDUA и/или оценка соответствующего фенотипического или химического конечного состояния через некоторое время после лечения, и, в некоторых случаях, сравнение измеряемой величины с необработанными образцами или образцами, обработанными другими предложенными в настоящем изобретении соединениями. Эти способы могут применяться параллельно или в комбинации с другими экспериментами по определению функций неизвестных генов в процессе валидации мишеней или для определения обоснованности применения конкретного генного продукта в качестве мишени для лечения или предотвращения конкретного заболевания, состояния или фенотипа.

Оценка увеличения или жгибирования экспрессии генов:

[00174] Перенос экзогенной нуклеиновой кислоты в клетку-хозяина или в организм-хозяина может быть оценен прямым определением присутствия указанной нуклеиновой кислоты в указанных клетке или организме. Такое определение может быть проведено несколькими известными специалистам в данной области техники способами. Например, присутствие экзогенной нуклеиновой кислоты может быть определено посредством саузерн-блоттинга или полимеразной цепной реакции (ПЦР) с применением праймеров, специфически амплифицирующих нуклеотидные последовательности, связанные с указанной нуклеиновой кислотой. Экспрессия указанных экзогенных нуклеиновых кислот также может быть измерена с применением общепринятых способов, в том числе анализа генной экспрессии. Например, мРНК, полученная из экзогенной нуклеиновой кислоты, может быть обнаружена и количественно определена с применением нозерн-блоттинга и ПЦР с обратной транскрипцией (ОТ-ПЦР).

[00175] Экспрессия РНК с указанной экзогенной нуклеиновой кислоты может также быть определена измерением ферментативной активности или активности репортерного белка. Например, антисмысловая модулирующая активность может быть непрямо измерена через понижение или повышение экспрессии целевой нуклеиновой кислоты в качестве показателя того, что экзогенная нуклеиновая кислота производит эффекторную РНК. Используя консервативность последовательностей, можно сконструировать праймеры и использовать для амплификации кодирующих участков указанных генов-мишеней. Сначала можно использовать наиболее активно экспрессируемую кодирующая область каждого гена для построения модели контрольного гена, хотя может быть использована любая кодирующая или некодирующая область. Каждый контрольный ген получен встраиванием каждой кодирующей области между кодирующей репортер областью и ее поли(A)-сигналом. Эти плазмиды производят мРНК с репортерным геном в вышележащей части гена и потенциальной мишенью РНКи в 3′ некодирующей области. Эффективность индивидуальных антисмысловых олигонуклеотидов может быть проанализирована по модулированию репортерного гена. Репортерные гены, подходящие для применения в способах, предложенных в настоящем изобретении, включают гены синтазы ацетогидроксикислот (АГКС), щелочной фосфатазы (ЩФ), бетагалактозидазы (LacZ), бета глюкоронидазы (GUS), хлорамфеникол ацетилтрансферазы (XAT), зеленого флуоресцентного белка (GFP), красного флуоресцентного белка (RFP), желтого флуоресцентного белка (YFP), голубого флуоресцентного белка (CFP), пероксидазы хрена (ПОХ), люциферазы (Luc), нопалин синтазы (NOS), октопин синтазы (OCS) и их производных. Доступны различные селективные маркеры, придающие устойчивость к ампициллину, блеомицину, хлорамфениколу, гентамицину, гигромицину, канамицину, линкомицину, метотрексату, фосфинотрицину, пуромицину и тетрациклину. Способы определения модулирования репортерного гена хорошо известны в данной области техники, и включают, не ограничиваясь перечисленными: флуорометрические способы (например, флуоресцентная спектроскопия, сортировка флуоресцентно-активированных клеток (FACS), флуоресцентная микроскопия), определение устойчивости к антибиотику.

[00176] Экспрессия белка и мРНК IDUA может быть проанализирована с применением известных специалистам в данной области техники способов, описанных в любом из разделов настоящей заявки. Например, для измерения уровней белка могут применяться методы иммуноанализа, такие как ИФА. Наборы ИФА для анализа IDUA коммерчески доступны, например, от R&D Systems (Minneapolis, MN).

[00177] В вариантах реализации экспрессия IDUA (например, мРНК или белка) в образце (например, в клетках или тканях in vivo или in vitro), обработанном с применением антисмыслового олигонуклеотида, предложенного в настоящем изобретении, оценивается посредством сравнения с экспрессией IDUA в контрольном образце. Например, экспрессия белка или нуклеиновой кислоты может сравниваться с применением известных специалистам в данной области техники способов с таковой в плацебо-образце или в необработанном образце. Как вариант, может быть проведено сравнение с образцом, обработанным контрольным антисмысловым олигонуклеотидом (например, имеющим измененную или иную последовательность), в зависимости от того, какую информацию необходимо получить. Согласно другому варианту реализации различие в экспрессии белка или нуклеиновой кислоты IDUA между необработанным и обработанным образцами может сравниваться с различием в экспрессии различных нуклеиновых кислот (включая любые стандартные, признанные исследователем подходящими, например, конститутивный ген) в обработанном и необработанном образцах.

[00178] Наблюдаемые различия могут быть выражены в удобной форме, например, в виде пропорции или доли, для сравнения с контролем. В вариантах реализации уровень мРНК или белка IDUA в образце, обработанном антисмысловым олигонуклеотидом, предложенным в настоящем изобретении, повышается или снижается приблизительно 1,25-кратно-10-кратно или более относительно необработанного образца или образца, обработанного контрольной нуклеиновой кислотой. В вариантах реализации уровень мРНК или белка IDUA повышается или снижается по меньшей мере приблизительно 1,25-кратно, по меньшей мере приблизительно 1,3-кратно, по меньшей мере приблизительно 1,4-кратно, по меньшей мере приблизительно 1,5-кратно, по меньшей мере приблизительно 1,6-кратно, по меньшей мере приблизительно 1,7-кратно, по меньшей мере приблизительно 1,8-кратно, по меньшей мере приблизительно 2-кратно, по меньшей мере приблизительно 2,5-кратно, по меньшей мере приблизительно 3-кратно, по меньшей мере приблизительно 3,5-кратно, по меньшей мере приблизительно 4-кратно, по меньшей мере приблизительно 4,5-кратно, по меньшей мере приблизительно 5-кратно, по меньшей мере приблизительно 5,5-кратно, по меньшей мере приблизительно 6-кратно, по меньшей мере приблизительно 6,5-кратно, по меньшей мере приблизительно 7-кратно, по меньшей мере приблизительно 7,5-кратно, по меньшей мере приблизительно 8-кратно, по меньшей мере приблизительно 8,5-кратно, по меньшей мере приблизительно 9-кратно, по меньшей мере приблизительно 9,5-кратно, или по меньшей мере приблизительно 10-кратно или более.

Наборы, реагенты для исследования, диагностика и терапия

[00179] Соединения, предложенные в настоящем изобретении, можно применять для диагностики, лечения и профилактики, а также в качестве реагентов для исследований и компонентов наборов. Кроме того, антисмысловые олигонуклеотиды, способные ингибировать генную экспрессию с высокой специфичностью, часто используются специалистами в данной области техники для выяснения функций отдельных генов или распознавания функций различных компонентов биологического пути.

[00180] Для применения в наборах и для диагностики, и в различных биологических системах, соединения, предложенные в настоящем изобретении, по отдельности или в комбинации с другими соединениями или терапевтическими средствами подходят в качестве инструмента дифференциального и/или комбинаторного анализа для определения паттернов экспрессии части или всего набора генов, экспрессируемых в клетках и тканях.

[00181] Используемый в настоящей заявке термин "биологическая система" или "система" определен как любой организм, клетка, клеточная культура или ткань, экспрессирующая, или с приобретенной способностью экспрессировать, продукты генов альфа-L-идуронидазы (IDUA). Они включают, не ограничиваясь перечисленными: человека, трансгенных животных, клетки, культуры клеток, ткани, ксенотрансплантаты, трансплантаты и их комбинации.

[00182] Согласно одному из неограничивающих примеров паттерны экспрессии в клетках или тканях, обработанных одним или несколькими антисмысловыми соединениями, сравнивают с контрольными клетками или тканями, не обработанными антисмысловыми соединениями, и исходя из полученных паттернов анализируют дифференциальные уровни генной экспрессии, так как они связаны, например, с болезнью, сигнальными путями, локализацией в клетках, уровнями экспрессии, размером, структурой или функцией изучаемых генов. Эти исследования могут быть выполнены на стимулированных или не стимулированных клетках в присутствии или в отсутствие других соединений, которые влияют на паттерны экспрессии.

[00183] Примеры способов анализа генной экспрессии, известных в данной области техники, включают анализ на ДНК-чипах или на микрочипах, SAGE (серийный анализ экспрессии генов), READS (рестриктазная амплификация расщепляемых кДНК), TOGA (полный анализ генной экспрессии), белковые чипы и протеомику, секвенирование меток экспрессируемой последовательности (EST), вычитающий РНК фингерпринтинг (SuRF), вычитающее клонирование, дифференциальный дисплей (DD), сравнительная геномная гибридизация, FISH (флуоресцентная гибридизация in situ) и масс-спектрометрические методы.

[00184] Соединения, предложенные в настоящем изобретении, подходят для исследований и диагностики, поскольку такие соединения гибридизуются с нуклеиновыми кислотами, кодирующими альфа-L-идуронидазу (IDUA). Например, олигонуклеотиды, гибридизующиеся с эффективностью и в условиях, описанных в настоящей заявке, являясь эффективными модуляторами гена IDUA, представляют собой эффективные праймеры или зонды в условиях, благоприятных для амплификации или определения гена, соответственно. Такие праймеры и зонды подходят для способов, требующих специфического определения молекул нуклеиновой кислоты, кодирующих IDUA, и для амплификации указанных молекул нуклеиновой кислоты для определения или для применения в дальнейших исслеованиях гена IDUA. Гибридизация указанных антисмысловых олигонуклеотидов, в частности, праймеров и зондов, предложенных в настоящем изобретении, с нуклеиновой кислотой, кодирующей IDUA, может быть определена при помощи известных в данной области техники способов. Такие способы могут включать конъюгирование фермента с указанным олигонуклеотидом, радиоактивное мечение указанного олигонуклеотида и любые другие подходящие способы детекции. Могут также быть подготовлены наборы для определения уровней IDUA в образце при помощи таких способов определения.

[00185] Специфичность и чувствительность антисмысловых соединений также используются специалистами в данной области техники для терапевтических целей. Антисмысловые соединения применялись в качестве терапевтических компонентов при лечении болезненных состояний у животных, в том числе человека. Лекарственные средства на основе антисмысловых олигонуклеотидов безопасно и эффективно вводили людям, и в настоящее время проводятся многочисленные клинические испытания. Таким образом, установлено, что антисмысловые соединения могут применяться в качестве терапевтических средств, которые могут быть модифицированы под терапевтические схемы для лечения клеток, тканей и животных, в особенности человека.

[00186] В случае терапевтических средств животное, предпочтительно человек, у которого, предположительно, имеется заболевание или расстройство, лечение которого может проводиться модулированием экспрессии полинуклеотидов IDUA, получает лечение в виде введения антисмысловых соединений в соответствии с настоящим изобретением. Например, согласно одному из неограничивающих вариантов реализации указанные способы включают этап введения животному, нуждающемуся в лечении, терапевтически эффективного количества модулятора гена IDUA. Модуляторы гена IDUA, предложенные в настоящем изобретении, эффективно модулируют активность гена IDUA или модулируют экспрессию белка IDUA. Согласно одному из вариантов реализации указанные активность или экспрессия гена IDUA у животного подавлены приблизительно на 10% по сравнению с контролем. Предпочтительно, указанные активность или экспрессия гена IDUA у животного подавлены приблизительно на 30%. Более предпочтительно, указанные активность или экспрессия гена IDUA у животного подавлены приблизительно на 50% или более. Таким образом, указанные олигомерные соединения модулируют экспрессию мРНК гена альфа-L-идуронидазы (IDUA) по меньшей мере на 10%, по меньшей мере на 50%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 40%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 98%, по меньшей мере на 99%, или на 100% относительно контроля.

[00187] В одном варианте реализации указанные активность и/или экспрессия гена альфа-L-идуронидазы (IDUA) у животного повышены приблизительно на 10% по сравнению с контролем. Предпочтительно, указанные активность или экспрессия гена IDUA у животного повышены приблизительно на 30%. Более предпочтительно, указанные активность или экспрессия гена IDUA у животного повышены на 50% или более. Таким образом, указанные олигомерные соединения изменяют экспрессию мРНК гена IDUA по меньшей мере на 10%, по меньшей мере на 50%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 40%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 98%, по меньшей мере на 99%, или на 100% относительно контроля.

[00188] Например, повышение или снижение экспрессии гена альфа-L-идуронидазы (IDUA) может быть определено в сыворотке, крови, жировой ткани, печени или любой другой жидкости организма, ткани или органе указанного животного. Предпочтительно, клетки, содержащиеся в указанных анализируемых жидкостях, тканях или органах, содержат молекулу нуклеиновой кислоты, кодирующую пептиды IDUA и/или собственно белок IDUA.

[00189] Соединения, предложенные в настоящем изобретении, применять в фармацевтических композициях посредством добавления эффективного количества соединения к подходящему фармацевтически приемлемому разбавителю или носителю. Применение соединений и способов, предложенных в настоящем изобретении, может также подходить для профилактики.

Конъюгаты

[00190] Другая модификация олигонуклеотидов, предложенных в настоящем изобретении, включает химическое связывание с указанным олигонуклеотидом одного или нескольких фрагментов или конъюгатов, которые повышают активность, усиливают клеточное распределение или поглощение клетками указанного олигонуклеотида. Такие фрагменты или конъюгаты могут включать конъюгированные группы, ковалентно связанные с функциональными группами, такими как первичные или вторичные гидроксильные группы. Конъюгированные группы, предложенные в настоящем изобретении, включают интеркаляторы, репортерные молекулы, полиамины, полиамиды, полиэтиленгликоли, простые полиэфиры, группы, улучшающие фармакодинамические свойства олигомеров, и группы, улучшающие фармакокинетические свойства олигомеров. Типовые конъюгированные группы включают холестерины, липиды, фосфолипиды, биотин, феназин, фолат, фенантридин, антрахинон, акридин, флуоресцеины, родамины, кумарины и красители. Группы, усиливающие фармакодинамические свойства, в контексте настоящего изобретения включают группы, улучшающие поглощение, повышающие сопротивление разрушению и/или усиливающие сиквенс-специфичную гибридизацию с целевой нуклеиновой кислотой. Группы, улучшающие фармакокинетические свойства, в контексте настоящего изобретения включают группы, улучшающие поглощение, распределение, метаболизм или выведение соединений, предложенных в настоящем изобретении. Типовые конъюгированные группы описаны в международной заявке на патент PCT/US92/09196, поданной 23 октября 1992, и патенте США 6287860, включенных в настоящую заявку посредством ссылки. Конъюгированные фрагменты включают, не ограничиваясь перечисленными: липидные фрагменты, такие как фрагменты холестерина, холевую кислоту, тиоэфир, например, гексил-5-тритилтиол, тиохолестерин, алифатические цепи, например, додекандиольные или ундецильные остатки, фосфолипид, например, ди-гексадецил-rac-глицерин или триэтиламмоний 1,2-ди-O-гексадецил-rac-глицеро-3-Нфосфонат, цепь полиамина или полиэтиленгликоля, или адамантан-уксусную кислоту, пальмитиловый фрагмент, октадециламин или фрагмент гексиламино-карбонил-оксихолестерина. Олигонуклеотиды, предложенные в настоящем изобретении, могут быть также конъюгированы с активными лекарственными веществами, например, аспирином, варфарином, фенилбутазоном, ибупрофеном, супрофеном, фенбуфеном, кетопрофеном, (S)-(+)-пранопрофеном, карпрофеном, дансилсаркозином, 2,3,5-трийодбензойной кислотой, флуфенамовой кислотой, фолиновой кислотой, бензотиадиазидом, хлортиазидом, диазепином, индометицином, барбитуратом, цефалоспорином, сульфамидным препаратом, антидиабетическим средством, антибактериальным веществом или антибиотиком.

[00191] Примеры патентов США, в которых описано получение таких олигонуклеотидньгх конъюгатов, включают, не ограничиваясь перечисленными: патенты США 4828979; 4948882; 5218105; 5525465; 5541313; 5545730; 5552538; 5578717, 5580731; 5580731; 5591584; 5109124; 5118802; 5138045; 5414077; 5486603; 5512439; 5578718; 5608046; 4587044; 4605735; 4667025; 4762779; 4789737; 4824941; 4835263; 4876335; 4904582; 4958013; 5082830; 5112963; 5214136; 5082830; 5112963; 5214136; 5245022; 5254469; 5258506; 5262536; 5272250; 5292873; 5317098; 5371241, 5391723; 5416203, 5451463; 5510475; 5512667; 5514785; 5565552; 5567810; 5574142; 5585481; 5587371; 5595726; 5597696; 5599923; 5599928 и 5688941.

Составы

[00192] Соединения, предложенные в настоящем изобретении, также могут быть смешаны, инкапсулированы, конъюгированы или иным образом связаны с другими молекулами, молекулярными структурами или смесями соединений, например, липосомами, молекулами-мишенями рецепторов, составами для перорального, ректального, местного или иного пути введения, для способствования поглощению, распределению и/или абсорбции. Примеры патентов США, в которых описано получение таких способствующих поглощению, распределению и/или абсорбции составов, включают, не ограничиваясь перечисленными: патенты США 5108921; 5354844; 5416016; 5459127; 5521291; 5543165; 5547932; 5583020; 5591721; 4426330; 4534899; 5013556; 5108921; 5213804; 5227170; 5264221; 5356633; 5395619; 5416016; 5417978; 5462854; 5469854; 5512295; 5527528; 5534259; 5543152; 5556948; 5580575; и 5595756, каждый из которых включен в настоящую заявку посредством ссылки.

[00193] Хотя указанные антисмысловые олигонуклеотиды не обязательно должны вводиться при помощи вектора, чтобы модулировать экспрессию и/или функцию мишени, варианты реализации настоящего изобретения включают векторные конструкции для экспрессии антисмысловых олигонуклеотидов, включая промоторы, последовательности генов составных промоторов и обладающие выраженной конститутивной промоторной активностью, или промоторной активностью, которая может быть индуцирована при необходимости.

[00194] В одном варианте реализации осуществление изобретения включает введение по меньшей мере одного из вышеуказанных антисмысловых олигонуклеотидов при помощи подходящей системы доставки на основе нуклеиновой кислоты. Согласно одному из вариантов реализации такая система включает невирусный вектор, функционально связанный с указанным полинуклеотидом. Примеры таких невирусных векторов включают собственно олигонуклеотид (например, любая(ые) из последовательностей SEQ ID NOS: 10-28) или его комбинацию с подходящим белковым, полисахаридным или липидным составом.

[00195] Дополнительно, подходящие системы доставки нуклеиновой кислоты включают вирусные векторы, как правило, на основе последовательности одного или нескольких аденовирусов, аденоассоциированного вируса (ААВ), хелпер-зависимого аденовируса, ретровируса, или липосомального комплекса с японским гемагглютинирующим вирусом (HVJ). Предпочтительно, указанный вирусный вектор содержит сильный эукариотический промотор, функционально связанный с указанным полинуклеотидом, например, промотор цитомегаловируса (ЦМВ).

[00196] Дополнительные предпочтительные векторы включают вирусные векторы, белки слияния и химические конъюгаты. Ретровирусные векторы включают вирусы мышиного лейкоза Молони и ВИЧ-вирусы. Один из предпочтительных ВИЧ-вирусных векторов содержит по меньшей мере два вектора, где гены gag и pol происходят из генома ВИЧ, а ген env - из другого вируса. Предпочтительными являются ДНК-вирусные векторы. Такие векторы включают pox-векторы, такие как ортопокс- или авипокс-векторы, герпесвирусные векторы, такие как векторы на основе вируса простого герпеса (HSV) 1, аденовирусные векторы и векторы на основе аденоассоциированного вируса.

[00197] Антисмысловые соединения, предложенные в настоящем изобретении, включают любые фармацевтически приемлемые соли, сложные эфиры или соли таких сложных эфиров, или любое другое соединение, которое при введении животному, включая человека, способно обеспечить получение (прямо или непрямо) биологически активного метаболита или его компонента.

[00198] Термин «фармацевтически приемлемые соли» относится к физиологически и фармацевтически приемлемым солям соединений, предложенных в настоящем изобретении: т.е. солям, сохраняющим необходимую биологическую активность исходного соединения и, кроме того, не дающих нежелательных токсических эффектов. Предпочтительные примеры фармацевтически приемлемых солей олигонуклеотидов и их применение подробнее описаны в патенте США 6287860, включенном в настоящую заявку посредством ссылки.

[00199] Настоящее изобретение также включает фармацевтические композиции и составы, содержащие антисмысловые соединения, предложенные в настоящем изобретении. Фармацевтические композиции, предложенные в настоящем изобретении, могут вводиться различными способами в зависимости от того, требуется ли местное или системное лечение, и от того, на какую область необходимо воздействовать. Введение может быть местным (в том числе через глаза и через слизистые оболочки, включая вагинальное и ректальное введение), через легкие, например, посредством вдыхания или вдувания порошков или аэрозолей, в том числе при помощи небулайзера; интратрахеально, интраназально, эпидермально и трансдермально), пероральным или парентеральным. Парентеральное введение включает внутривенные, внутриартериальные, подкожные, внутрибрюшинные или внутримышечные инъекцию или инфузию; или внутричерепное, например, интратекальное или интравентрикулярное, введение.

[00200] При лечении тканей центральной нервной системы введение может осуществляться, например, инъекцией или инфузией в спинномозговую жидкость. Введение антисмысловой РНК в спинномозговую жидкость описано, например, в заявке на патент США, опубликованной под номером 2007/0117772, "Methods for slowing familial ALS disease progression)) («Способы замедления развития наследственного заболевания БАС»), включенной в настоящую заявку посредством ссылки во всей полноте.

[00201] Если предполагается введение антисмыслового олигонуклеотида, предложенного в настоящем изобретении, в клетки центральной нервной системы, введение может осуществляться совместно с одним или несколькими агентами, способными обеспечить проникновение указанного антисмыслового олигонуклеотида через гематоэнцефалический барьер. Инъекция может быть сделана, например, в энторинальную область коры или гиппокамп. Доставка нейротрофических факторов введением аденовирусного вектора в двигательные нейроны мышечной ткани описана, например, в патенте США 6632427, "Adenoviral-vector-mediated gene transfer into medullary motor neurons» («Перенос генов в двигательные нейроны мозга, опосредованный аденовирусным вектором»), включенном в настоящую заявку посредством ссылки. Доставка векторов непосредственно в мозг, например, в стриатум, таламус, гиппокамп или черную субстанцию известна в данной области техники и описана, например, в патенте США 6756523, «Adenovirus vectors for the transfer of foreign genes into cells of the central nervous system particularly in brain» («Аденовирусные векторы для переноса чужеродных генов в клетки центральной нервной системы, в частности, клетки мозга»), включенном в настоящую заявку посредством ссылки. Введение может быть быстрым в случае инъекции или осуществляться в течение некоторого промежутка времени в случае медленной инфузии или введения составов с замедленным высвобождением.

[00202] Рассматриваемые антисмысловые олигонуклеотиды могут быть связаны или конъюгированы с агентами, обеспечивающими необходимые фармацевтические или фармакокинетические свойства. Например, указанный антисмысловой олигонуклеотид может сочетаться с любым веществом, которое, как известно в данной области техники, способствует проникновению или транспорту через гематоэнцефалический барьер, таким как антитело к рецептору трансферрина, и вводимому путем внутривенной инъекции. Указанное антисмысловое соединение может быть связано с вирусным вектором, например, придающим указанному антисмысловому соединению большую эффективность и/или усиливающим транспорт указанного антисмыслового соединения через гематоэнцефалический барьер. Осмотическое преодоление гематоэнцефалического барьера может также быть достигнуто, например, инфузией сахаров, включая, но не ограничиваясь перечисленными, мезоэритрит, ксилит, D(+) галактозу, D(+) лактозу, D(+) ксилозу, дульцит, миоинозитол, L(-) фруктозу, D(-) маннит, D(+) глюкозу, D(+) арабинозу, D(-) арабинозу, целлобиозу, D(+) мальтозу, D(+) раффинозу, L(+) рамнозу, D(+) мелибиозу, D(-) рибозу, адонит, D(+) арабит, L(-) арабит, D(+) фукозу, (L-) фукозу, D(-) ликсозу, L(+) ликсозу и L(-) ликсозу, или аминокислот, включая, но не ограничиваясь перечисленными, глутамин, лизин, аргинин, аспарагин, аспарагиновую кислоту, цистеин, глутаминовую кислоту, глицин, гистидин, лейцин, метионин, фенилаланин, пролин, серии, треонин, тирозин, валин и таурин. Способы и материалы для повышения проникновения через гематоэнцефалический барьер описаны, например, в патенте США 4866042, «Method for the delivery of genetic material across the blood brain barrier» («Способы доставки генетического материала через гематоэнцефалический барьер»), патенте США 6294520, «Material for passage through the blood-brain barrier» («Материал для прохождения через гематоэнцефалический барьер») и патенте США 6936589, ((Parenteral delivery systems» («Парентеральные системы доставки»), включенных в настоящую заявку посредством ссылки во всей полноте.

[00203] Рассматриваемые антисмысловые соединения могут быть смешаны, инкапсулированы, конъюгированы или иным образом связаны с другими молекулами, молекулярными структурами или смесями соединений, например, липосомами, молекулами-мишенями рецепторов, составами для перорального, ректального, местного или иного пути введения, для способствования поглощению, распределению и/или абсорбции. Например, катионные липиды могут также быть включены в указанный состав для облегчения поглощения олигонуклеотидов. Одной из таких композиций, как показано, способствующей поглощению, является LIPOFECTin (доступный у GIBCO-BRL, Bethesda, MD).

[00204] Олигонуклеотиды, содержащие по меньшей мере одну 2′-O-метоксиэтильную модификацию, предположительно подходят, в частности, для перорального введения. Фармацевтические композиции и составы для местного применения могут включать трансдермальные пластыри, мази, лосьоны, кремы, гели, капли, суппозитории, спреи, жидкости и порошки. Обычные фармакологические носители, водные, порошковые или масляные основы, загустители и т.п. могут быть необходимы или желательны. Подходящие применения включают также покрытия для презервативов, перчаток и т.п.

[00205] Фармацевтические составы, предложенные в настоящем изобретении, которые могут быть представлены в виде удобной единичной дозированной формы, могут быть получены согласно общепринятым методикам, хорошо известным в области фармацевтической индустрии. Такие техники включают этап соединения активных ингредиентов с фармацевтическими носителями и вспомогательными веществами. Как правило, указанные составы получают равномерным глубоким соединением активных ингредиентов с жидкими носителями или тонкомолотыми твердыми носителями, или с ними обоими, и затем, при необходимости, придают продукту форму.

[00206] Композиции, предложенные в настоящем изобретении, могут быть получены в виде любой из многих возможных лекарственных форм, включая, но не ограничиваясь перечисленными, таблетки, капсулы, гелевые капсулы, жидкие сиропы, мягкие гели, суппозитории и клизмы. Композиции, предложенные в настоящем изобретении, могут также быть получены в виде суспензий на основе водных, неводных или смешанных сред. Водные суспензии могут дополнительно содержать вещества, увеличивающие вязкость суспензии, включая, например, натрия карбоксиметилцеллюлозу, сорбит и/или декстран. Указанная суспензия может также содержать стабилизаторы.

[00207] Фармацевтические композиции, предложенные в настоящем изобретении, включают, не ограничиваясь перечисленными: растворы, эмульсии, пены и содержащие липосомы составы. Фармацевтические композиции и составы, предложенные в настоящем изобретении, могут содержать один или более усилители проникновения, носители, вспомогательные вещества или другие активные или неактивные ингредиенты.

[00208] Эмульсии представляют собой, как правило, гетерогенные системы, где одна жидкость распределена в другой в виде капель, как правило, более 0,1 мкм в диаметре. Эмульсии могут содержать дополнительные компоненты помимо дисперсных фаз, и активное лекарственное вещество может присутствовать в растворе в водной фазе, масляной фазе или быть представлено отдельной фазой. Микроэмульсии также относятся к вариантам реализации настоящего изобретения. Эмульсии и их применение хорошо известны в данной области техники и подробнее описаны в патенте США 6287860.

[00209] Составы, предложенные в настоящем изобретении, включают липосомальные составы. В контексте настоящего изобретения термин «липосома» означает пузырьки, состоящие из амфифильных липидов, образующих один или более чем один сферический бислой. Липосомы представляют собой однослойные или многослойные пузырьки с мембраной, образованной липофильными веществами и водной внутренней фазой, где содержится композиция, которую необходимо доставить. Катионные липосомы представляют собой положительно заряженные липосомы, которые предположительно взаимодействуют с отрицательно заряженными молекулами ДНК с образованием стабильного комплекса. pH-чувствительные или отрицательно заряженные липосомы, предположительно, скорее захватывают ДНК, чем образуют с ней комплексы. Как катионные, так и некатионные липосомы применялись для доставки ДНК в клетки.

[00210] Липосомы также включают «стерически стабилизированные» липосомы, что при использовании в настоящей заявке относится к липосомам, содержащим один или более специализированный липид. После включения в липосомы эти специализированные липиды образуют липосомы с увеличенной продолжительностью существования по сравнению с липосомами, не содержащими таких специализированных липидов. Примеры стерически стабилизированных липосом являются такие, в которых часть образующего пузырек липидного компонента липосомы содержит один или более гликолипид или дериватизирован одним или несколькими гидрофильными полимерами, таких как фрагмент полиэтиленгликоля (ПЭГ). Липосомы и их применение подробнее описаны в патенте США 6287860.

[00211] Фармацевтические составы и композиции, предложенные в настоящем изобретении, могут также включать поверхностно-активные вещества. Применение поверхностно-активных веществ в лекарственных продуктах, составах и эмульсиях хорошо известно в данной области техники. Поверхностно-активные вещества и их применение подробнее описаны в патенте США 6287860, включенном в настоящую заявку посредством ссылки.

[00212] Согласно одному из вариантов реализации настоящее изобретение включает различные усилители проникновения, способствующие эффективной доставке нуклеиновых кислот, в частности, олигонуклеотидов. Кроме способствования диффузии нелипофильных препаратов через клеточные мембраны, усилители проникновения повышают проникающую способность липофильных препаратов. Усилители проникновения могут быть разделены на пять больших категорий, а именно, поверхностно-активные вещества, жирные кислоты, соли желчных кислот, хелатирующие агенты, и нехелатирующие не-ПАВ-вещества. Усилители проникновения и их применение подробнее описаны в патенте США 6287860, включенном в настоящую заявку посредством ссылки.

[00213] Специалисту в данной области техники будет понятно, что составы получают согласно стандартным методикам в соответствии с их назначением, т.е. способом введения.

[00214] Предпочтительные составы для местного применения включают такие, в которых олигонуклеотиды, предложенные в настоящем изобретении, смешаны с агентами для местного введения, такими как липиды, липосомы, жирные кислоты, сложные эфиры жирных кислот, стероиды, хелатирующие агенты и поверхностно-активные вещества. Предпочтительные липиды и липосомы включают нейтральные (например, диолеилфосфатидил DOPE этаноламин, димиристоилфосфатидил холин DMPC, дистеаролфосфатидилхолин) отрицательно заряженные (например, димиристоилфосфатидил глицерина DMPG) и катионные (например, диолеилтетраметиламинопропил DOTAP и диолеилфосфатидил этаноламин DOTMA).

[00215] Для местного или другого применения олигонуклеотиды, предложенные в настоящем изобретении, могут быть инкапсулированы в липосомы или входить в состав липосомальных комплексов, в частности, с катионными липосомами. Как вариант, олигонуклеотиды могут входить в состав липидных комплексов, в частности с катионными липидами. Предпочтительные жирные кислоты и сложные эфиры, их фармацевтически приемлемые соли, и их применение подробнее описаны в патенте США 6287860.

[00216] Композиции и составы для перорального введения включают порошки или гранулы, содержащие микрочастицы, наночастицы, суспензии или растворы в воде или неводных средах, капсулы, гелевые капсулы, порционные упаковки, таблетки или минитаблетки. Присутствие загустителей, вкусоароматических агентов, разбавителей, эмульгаторов, диспергирующих агентов или связующих веществ может быть желательным. Предпочтительными составами для перорального приема являются такие, в которых олигонуклеотиды, предложенные в настоящем изобретении, вводятся совместно с одним или несколькими усилителями проникновения, поверхностно-активными веществами и хелатирующими веществами. Предпочтительные поверхностно-активные вещества включают жирные кислоты и/или сложные эфиры или их соли, желчные кислоты и/или их соли. Предпочтительные желчные кислоты/соли и жирные кислоты и их применение подробнее описаны в патенте США 6287860, включенном в настоящую заявку посредством ссылки. Также предпочтительными являются комбинации усилителей проникновения, например, жирные кислоты/соли в комбинации с желчными кислотами/солями. В частности, предпочтительной является комбинация натриевой соли лауриновой кислоты, каприновой кислоты и УДХК. Другие усилители проникновения включают полиоксиэтилен-9-лауриловый эфир, полиоксиэтилен-20-цетиловый эфир. Олигонуклеотиды, предложенные в настоящем изобретении, могут быть введены перорально, в гранулированной форме, включая высушенные распылением частицы, или в составе комплексов микро- или наночастиц. Комплексообразующие агенты для олигонуклеотидов и их применение подробнее описаны в патенте США 6287860, включенном в настоящую заявку посредством ссылки.

[00217] Композиции и составы для парентерального, интратекального или интравентрикулярного введения могут включать стерильные водные растворы, которые могут также содержать буферы, разбавители и другие подходящие добавки, включая, но не ограничиваясь перечисленными, усилители проникновения, переносчики и другие фармацевтически приемлемые носители или вспомогательные вещества.

[00218] Определенные варианты реализации настоящего изобретения включают фармацевтические композиции, содержащие одно или более олигомерное соединение и один или более другой химиотерапевтический агент, действующий с помощью не-антисмыслового механизма. Примеры таких химиотерапевтических агентов включают, не ограничиваясь перечисленными, химиотерапевтические лекарственные средства для лечения рака, такие как даунорубицин, дауномицин, дактиномицин, доксорубицин, эпирубицин, идарубицин, эзорубицин, блеомицин, мафосфамид, ифосфамид, цитозина арабинозид, бис-хлорэтил-нитрозомочевина, бусульфан, митомицин C, актиномицин D, митрамицин, преднизон, гидроксипрогестерон, тестостерон, тамоксифен, дакарбазин, прокарбазин, гексаметилмеламин, пентаметилмеламин, митоксантрон, амсакрин, хлорамбуцил, метилциклогексилнитрозомочевина, мустарген, мелфалан, циклофосфамид, 6-меркаптопурин, 6-тиогуанин, цитарабин, 5- азацитидин, гидроксимочевина, дезоксикоформицин, 4-гидроксипероксицикло-фосфорамид, 5-фторурацил (5-FU), 5-фтордезоксиуридин (5-FUdR), метотрексат (МТХ), колхицин, таксол, винкристин, винбластин, этопозид (VP-16), триметрексат, иринотекан, топотекан, гемцитабин, тенипозид, цисплатин и диэтилстильбэстрол (DES). При применении с соединениями, предложенными в настоящем изобретении, такие химиотерапевтические агенты могут применяться индивидуально (например, 5-FU и олигонуклеотид), последовательно (например, 5-FU и олигонуклеотид в течение некоторого времени, затем МТХ и олигонуклеотид), или в комбинации с одним или несколькими другими такими химиотерапевтическими агентами (например, 5-FU, МТХ и олигонуклеотид, или 5-FU, лучевая терапия и олигонуклеотид). Противовоспалительные лекарственные средства, включая, но не ограничиваясь перечисленными, нестероидные противовоспалительные лекарственные средства и кортикостероиды, и противовирусные лекарственные средства, включая, но не ограничиваясь перечисленными, рибавирин, видарабин, ацикловир и ганцикловир, могут также быть скомбинированы в композициях, предложенных в настоящем изобретении. Комбинации антисмысловых соединений и других не-антисмысловых лекарственных средств также входят в объем настоящего изобретения. Два или более скомбинированных соединения могут применяться совместно или последовательно.

[00219] В другом сходном варианте реализации композиции, предложенные в настоящем изобретении, могут содержать одно или несколько антисмысловых соединений, в частности, олигонуклеотидов, нацеленных на первую нуклеиновую кислоту, и одно или несколько дополнительных антисмысловых соединений, нацеленных на вторую нуклеиновую кислоту. Например, первой мишенью может быть конкретная антисмысловая последовательность для гена альфа-L-идуронидазы (IDUA), а второй мишенью может быть участок другой нуклеотидной последовательности. Как вариант, композиции, предложенных в настоящем изобретении, могут содержать два антисмысловых соединения или более, нацеленных на разные участки одной и той же целевой нуклеиновой кислоты альфа-Ь-идуронидазы (IDUA). Многочисленные примеры антисмысловых соединений приведены в настоящей заявке, другие могут быть выбраны из подходящих соединений, известных в данной области техники. Два или более скомбинированных соединения могут применяться совместно или последовательно.

Дозирование:

[00220] Получение фармацевтических композиций и их последующее введение (дозирование) должны быть знакомы специалистам в данной области техники. Дозы зависят от тяжести и чувствительности к лечению болезненного состояния-мишени терапии, курс лечения может длиться от нескольких дней до нескольких месяцев, или до излечения, или до облегчения болезненного состояния. Оптимальный режим дозирования может быть рассчитан на основании измерений накопления препарата в организме пациента. Специалист без труда определит оптимальные дозировки, методологию дозировок и частоту повторения. Оптимальные дозы могут варьировать в зависимости от относительной эффективности конкретных олигонуклеотидов, и, как правило, могут быть рассчитаны исходя из EC50, эффективных для животных моделей in vitro и in vivo. Как правило, доза составляет от 0,01 мкг до примерно 10 мг на кг массы тела, и может вводиться однократно или чаще ежедневно, еженедельно, ежемесячно или ежегодно, или даже каждые 2-20 лет. Специалист без труда может рассчитать частоту введения доз, основанную на времени удержания и концентрациях лекарства в жидкостях или тканях организма. После проведения эффективного лечения может быть желательно применение поддерживающей терапии у пациента для предотвращения рецидива заболевания, при этом указанный олигонуклеотид вводится в поддерживающих дозах, варьирующих от 0,01 мкг до примерно 10 мг на кг массы тела, от однократного или более частого ежедневного приема до однократного приема один раз в 2-20 лет.

[00221] Согласно вариантам реализации пациент получает дозу лекарственного средства, составляющую по меньшей мере приблизительно 1, по меньшей мере приблизительно 2, по меньшей мере приблизительно 3, по меньшей мере приблизительно 4, по меньшей мере приблизительно 5, по меньшей мере приблизительно 6, по меньшей мере приблизительно 7, по меньшей мере приблизительно 8, по меньшей мере приблизительно 9, по меньшей мере приблизительно 10, по меньшей мере приблизительно 15, по меньшей мере приблизительно 20, по меньшей мере приблизительно 25, по меньшей мере приблизительно 30, по меньшей мере приблизительно 35, по меньшей мере приблизительно 40, по меньшей мере приблизительно 45, по меньшей мере приблизительно 50, по меньшей мере приблизительно 60, по меньшей мере приблизительно 70, по меньшей мере приблизительно 80, по меньшей мере приблизительно 90, или по меньшей мере приблизительно 10 мг/кг массы тела. Некоторые вводимые дозировки антисмысловых олигонуклеотидов описаны, например, в патенте США 7563884, «Antlsense modulation of PTP1 В expression)) («Антисмысловое модулирование экспрессии PTP1 В»), включенном в настоящую заявку посредством ссылки во всей полноте.

МПС-1 (т.е. мукополисахаридоз типа 1) представляет собой редкую лизосомную болезнь накопления. У этой болезни существует три группы пациентов с различными симптомами в зависимости от тяжести заболевания (синдром Гурлера, синдром Гурлера-Шейе, синдром Шейе). В исследованиях, чтобы определить и подтвердить способ определения и выбора наиболее предпочтительного олигонуклеотида для любого конкретного пациента или группы пациентов, имеющих данное заболевание, может быть выполнен следующий общий протокол. В этом способе, конечно, могут быть использованы любые клетки или ткани, типично имеющие полинуклеотиды IDUA и продукты экспрессии, полученные из них. Группа пациентов может быть выбрана с применением следующих критериев 1, 2; затем после принятия критерия, выполняют пункты 3, 4, 5 и 6: (1) пациенты с выраженным МПС-1 (т.е. мукополисахаридозом типа 1) из-за недостатка активности IDUA. (2) После медицинского обследования эти пациенты будут разделены, как имеющие синдром Гурлера, или синдром Гурлера-Шейе или синдром Шейе. (3) После согласия пациента/опекуна, у пациента берут биопсию кожи; также пациента проверяют на любые другие заболевания (например, инфекционные заболевания), которые требуют специальных мер предосторожности при обращении с биологическими образцами пациентов. (4) После составления полной документации о состоянии пациента, биопсия кожи подвергается обработке in vitro для выращивания фибробластов кожи. (5) Фибробласты кожи обрабатывают различными олигонуклеотидами в различных концентрациях; олигонуклеотиды представляют собой выбранный набор олигонуклеотидов, комплементарный природной антисмысловой последовательности гена IDUA человека, который ранее был охарактеризован как увеличивающий экспрессию IDUA (мРНК, белка и активности). (6) Процентное увеличение активности IDUA измеряется в супернатанте культуры клеток фибробластов кожи. NCBI (Национальный центр биотехнологической информации США) характеризует активность IDUA в различных подгруппах пациентов (или контроле) следующим образом: у пациента с двумя аллелями гена IDUA дикого типа (ген IDUA от каждого из родителей представляет собой дикий тип, не имеющий мутации) активность IDUA составляет 83-121%; У пациентов с одной сильной мутацией в IDUA (гетерозиготы) активность IDUA составляет от 19 до 60%; У пациентов с двумя очень сильными мутациями в IDUA, суммарная активность IDUA составляет 0-3%. Гетерозиготы являются только носителями этого заболевания и не проявляют симптомов заболевания. Олигонуклеотиды, повышающие активность IDUA примерно более чем на 10% от суммарной активности, наблюдаемой в нормальных клетках, можно рассматривать как кандидатов в активные лекарственные средства. Предпочтительно, процентное увеличение составит более примерно 20%. Олигонуклеотид с самым высоким процентным увеличением в повышении регуляции IDUA выбирают в качестве кандидата лекарственного средства для конкретного пациента, для которого было сделано измерение фибробластов. Олигонуклеотид также может быть полезен для подгруппы пациентов с таким же состоянием заболевания, или для лечения болезни у всех пациентов с таким заболеванием.

[00222] Хотя выше и были описаны различные варианты реализации настоящего изобретения, следует понимать, что они представлены только в качестве примеров, а не для ограничения. Многочисленные модификации раскрытых вариантов реализации могут быть осуществлены согласно описаниям в настоящей заявке, не выходя за рамки сущности и объема настоящего изобретения. Таким образом, объем и сущность настоящего изобретения не ограничены какими-либо из приведенных выше вариантов реализации.

[00223] Все упоминаемые здесь документы включены в настоящую заявку посредством ссылок. Все публикации и патентные документы, упомянутые в настоящей заявке, включены посредством ссылок в том же объеме, как если бы каждая публикация или каждый патентный документ были упомянуты в индивидуальном порядке. Цитируя различные источники в данном документе, заявители не признают, что какой-либо из источников представляет «предшествующий уровень техники» относительно настоящего изобретения. Варианты реализации предложенных в изобретении композиций и способов проиллюстрированы приведенными ниже примерами.

ПРИМЕРЫ

[00224] Следующие неограничивающие Примеры предназначены для иллюстрации некоторых вариантов реализации настоящего изобретения. Следует иметь в виду, что вариации содержания и вариантов элементов описанных компонентов очевидны специалистам в данной области техники и входят в объем вариантов реализации настоящего изобретения.

Пример 1: Конструирование антисмысловых олигонуклеотидов, специфичных к молекуле нуклеиновой кислоты, антисмысловой к альфа-L-идуронидазы (IDUA), и/или смысловой цепи полинуклеотида IDUA

[00225] Как указано выше, термин «олигонуклеотид, специфичный для» или «олигонуклеотид с нацеленным действием» относится к олигонуклеотиду, содержащему последовательность, (i) способную формировать стабильный комплекс с фрагментом гена-мишени или (ii) способную формировать стабильный дуплекс с фрагментом мРНК-транскрипта гена-мишени.

[00226] Отбор подходящих олигонуклеотидов упрощается при применении компьютерных программ (например, IDT AntiSense Design, IDT OligoAnalyzer), автоматически идентифицирующих в каждой конкретной последовательности субпоследовательности из 19-25 нуклеотидов, способных образовывать гибриды с целевой полинуклеотидной последовательностью, имеющие требуемую температуру плавления (как правило, 50-60°C), и не образующие авто-димеров или других комплексных вторичных структур.

[00227] Отбор подходящих олигонуклеотидов также упрощается при применении компьютерных программ, которые автоматически выравнивают нуклеотидные последовательности и определяют участки идентичности или гомологии. Такие программы применяют для сравнения нуклеотидных последовательностей, полученных, например, в результате поиска в базах данных, таких как GenBank, или посредством секвенирования ПЦР-продуктов. Сравнение нуклеотидньгх последовательностей различных генов и межгенных областей конкретного генома позволяет отобрать нуклеотидные последовательности, которым свойственна необходимая степень специфичности к нужному гену. Такие процедуры позволяют провести отбор олигонуклеотидов, проявляющих значительную степень комплементарности целевым нуклеотидыым последовательностям и более низкую степень комплементарности другим нуклеотидным последовательностям из конкретного генома. Специалисту в данной области техники будет ясно, что существует значительная свобода выбора подходящих участков генов для применения согласно настоящему изобретению.

[00228] Антисмысловое соединение является «способным к специфичной гибридизации», если связывание указанного соединения с целевой нуклеиновой кислотой нарушает нормальное функционирование целевой нуклеиновой кислоты, приводя к модулированию функции и/или активности, и степень комплементарности достаточна, чтобы избежать неспецифичного связывания указанного антисмыслового соединения с нецелевыми нуклеотидными последовательностями в условиях, при которых необходимо специфичное связывание, т.е. в физиологических условиях в случае in vivo методик анализа или терапевтического воздействия и в условиях, при которых проводится анализ, в случае исследований in vitro.

[00229] Характеристики гибридизации олигонуклеотидов, описанных в настоящей заявке, могут быть определены с применением одного или более in vitro способов анализа из известных специалистам в данной области техники. Например, указанные характеристики олигонуклеотидов, описанных в настоящей заявке, могут быть получены путем определения силы связывания целевых природных антисмысловых последовательностей и молекул потенциального лекарственного средства с применением анализа кривых плавления.

[00230] Сила связывания целевых природных антисмысловых последовательностей и молекулы потенциального лекарственного средства (далее - Молекулы) может быть оценена с применением любых стандартных способов измерения силы межмолекулярных взаимодействий, например, анализа кривых плавления.

[00231] Анализ кривых плавления определяет температуру, при которой происходит быстрый переход от двухцепочечной к одноцепочечной конформации комплекса природной антисмысловой последовательности/молекулы. Эта температура широко используется как надежная мера силы взаимодействия между двумя молекулами.

[00232] Анализ кривых плавления может быть выполнен с применением кДНК-копии актуальной природной антисмысловой молекулы РНК или синтетического нуклеотида ДНК или РНК, соответствующего связывающему сайту Молекулы. Доступны многочисленные наборы, содержащие все необходимые реагенты для проведения анализа (например, набор MeltDoctor от Applied Biosystems Inc.). Такие наборы содержат подходящий буферный раствор, содержащий один из связывающих двухцепочечную ДНК (дцДНК) красителей (таких как красители HRM от ABI, SYBR Green, SYTO и т.д.). Свойства ддДНК-красителей таковы, что они практически не флуоресцируют в свободной форме, но очень выраженно флуоресцируют при связывании с дцДНК.

[00233] Для проведения анализа указанную кДНК или соответствующий олигонуклеотид смешивали с Молекулой в концентрациях, определенных согласно протоколам конкретных производителей. Смесь подогревали до 95°C для диссоциации пре-формированных комплексов дцДНК, затем медленно охлаждали до комнатной температуры или другой более низкой температуры, указанной производителем набора, для ренатурации молекул ДНК. Вновь сформировавшиеся комплексы затем медленно нагревали до 95°C, одновременно непрерывно измеряя интенсивность флуоресценции в результате реакции. Интенсивность флуоресценции обратно пропорциональна количеству присутствующих в реакции дцДНК. Информация может быть получена с применением инструмента на основе ПЦР в режиме реального времени, совместимого с набором (например, StepOne Plus Real Time PCR System от ABI или инструмент lightTyper от Roche Diagnostics, Lewes, UK).

[00234] Пики плавления получали построением графика зависимости отрицательной производной флуоресценции по температуре (-d(Флуоресценция)/dT) по оси y) от температуры (ось x) с применением подходящего программного обеспечения (например, lightTyper (Roche) или SDS Dissociation Curve, ABI). Информацию анализировали с целью определить температуру быстрого перехода комплекса дцДНК в одноцепочечные молекулы. Эту температуру называют температурой плавления, и она прямо пропорциональна силе взаимодействия между двумя молекулами. Как правило, температура плавления превышает 40°C.

Пример 2: Модулирование полинуклеотидов IDUA

[00235] Все антисмысловые олигонуклеотиды, используемые в примере 2, были сконструированы как описано в примере 1. Производителю (IDT Inc. of Coralville, IA) было поручено производство сконструированных фосфоротиоат-связанных олигонуклеотидов и производство фосфоротиоатных аналогов, представленных в таблице 1. Знак звездочка между нуклеотидами указывает на наличие фосфоротиоатной связи. Олигонуклеотиды, необходимые для эксперимента в примере 2, могут быть синтезированы с использованием любых соответствующих современных методов, например, метода, с применением IDT: твердофазной подложки, такой как стеклянные бусины (CPG) с контролируемым размером пор 5 микрон, и амидофосфитных мономеров (нормальных нуклеотидов, у которых все активные группы защищены защитными группами, например, тритил на сахаре, бензоил на A и C и N-2-изобутирил на G). Защитные группы предотвращали нежелательные реакции в процессе синтеза олигонуклеотидов. Защитные группы удаляли в конце процесса синтеза. Начальный нуклеотид связан с твердофазной подложкой через 3′-углерод и синтез протекает в направлении 3′→5′ Добавление нового основания к растущей олигонуклеотидной цепи происходит в четыре этапа: 1) удаление защитных групп от 5′-кислорода иммобилизованного нуклеотида с помощью трихлоруксусной кислоты; 2) связывание между собой иммобилизованных и следующих в последовательности нуклеотидов с помощью тетразола; реакция протекает с образованием тетразолилфосфорамидата в качестве промежуточного соединения; 3) вымывание непрореагировавших свободных нуклеотидов и побочных продуктов реакции и блокирование непрореагировавших иммобилизованных олигонуклеотидов для предотвращения их участия в следующем раунде синтеза; блокировка достигается путем ацетилировапия свободного 5′-гидроксила при помощи уксусного ангидрида и N-метил-имидазола; 4) для стабилизации связей между нуклеотидами - окисление фосфора при помощи йода и воды, если должна быть получена фосфодиэфирная связь, или при помощи реагента Бокажа (3H-1,2-бензодитиол-3-он-1,1-диоксид), если требуется фосфоротиоатная связь. Путем чередования двух окисляющих агентов, может быть построен химерный остов. Четыре этапа цикла, описанного выше, повторяются для каждого нуклеотида в последовательности. После синтеза полной последовательности, олигонуклеотид отщеплялся от твердофазной подложки и с него снимали защитные группы с применением гидроксида аммония при высокой температуре. Защитные группы вымывали путем обессоливания, а остающиеся олигонуклеотиды лиофилизировали.

Обработка клеток HepG2 аптисмысловыми олигонуклеотидами

[00236] Для выполнения эксперимента, описанного в примере 2, клетки HepG2 из АТСС (cat#НВ-8065) выращивали на ростовой среде (MEM/EBSS (Hyclone cat#SH30024, либо Mediatech cat#MT-10-010-CV)+10% ЭБС (Mediatech cat#MT35-011-CV) + пенициллин/стрептомицин (Mediatech cat#MT30-002-CI)) при 37°C и 5% CO2. За день до эксперимента клетки пересевали с плотностью 0,5×104/мл в 6-луночные планшеты и инкубировали при 37°C и 5% CO2. В день эксперимента среду в 6-луночньгх планшетах заменяли на свежую ростовую среду.

[00237] Олигонуклеотиды, полученные от производителя в лиофилизированной форме, разводили до концентрации 20 мкМ деионизованной водой, свободной от РНКаз/ДНКаз. Два мкл этого раствора инкубировали с 400 мкл среды OptiMEM (Gibco cat#31985-070) и 4 мкл Липофектамина 2000 (Lipofectamine 2000) (Invitrogen cat#11668019) при комнатной температуре в течение 20 мин, затем вносили по каплям в одну лунку 6-луночного планшета с клетками HepG2. Аналогичную смесь, содержащую 2 мкл воды вместо раствора олигонуклеотида, применяли для контрольной "пустой" трансфекции. После 3-18 ч инкубации при 37°C и 5% CO2 среду заменяли на свежую ростовую среду. Через 48 ч после добавления антисмысловых олигонуклеотидов среду удаляли и выделяли РНК из клеток с применением SV Total RNA Isolation System от Promega (cat#Z3105) или набора RNeasy Total RNA Isolation kit от Qiagen (cat# 74181), следуя инструкциям производителя. 600 нг выделенной РНК вводили в реакцию обратной транскрипции, проводимую с применением набора кДНК Verso cDNA kit от Thermo Scientific (cat#AB1453B) или набора High Capacity cDNA Reverse Transcription Kit (cat# 4368813) согласно описанию в протоколе производителя. кДНК, полученные в результате реакции обратной транскрипции, применяли для мониторинга генной экспрессии при помощи ПЦР в режиме реального времени с применением ABI Taqman Gene Expression Mix (cat#4369510) и праймеров/зондов, сконструированных ABI (Applied Biosystems Taqman Gene Expression Assay: Hs00164940_m1 (IDUA) от Applied Biosystems Inc., Foster City CA). Использовали следующий цикл ПЦР: 50°C в течение 2 мин, 95°C в течение 10 мин, 40 циклов при (95°C в течение 15 секунд, 60°C в течение 1 мин) с применением термоциклера Мх4000 (Stratagene) или аппарата для ПЦР в режиме реального времени StepOne Plus Real Time PCR Machine (Applied Biosystems). Кратность изменения экспрессии гена после обработки антисмысловыми олигонуклеотидами вычисляли на основании разности значений dCt, нормализованных по 18S, между обработанными и ложнотрансфицированными образцами.

[00238] Результаты: Результаты ПЦР в режиме реального времени показывают, что уровни мРНК гена IDUA в клетках HepG2 значимо повышаются через 48 ч после обработки антисмысловыми олигонуклеотидами к антисмысловой последовательности IDUA человека HS.656285, олигонуклеотидами CUR-1820 и CUR-1821 (Фигура 1), олигонуклеотидами CUR-1978, CUR-1984, CUR-1985, CUR-1987 и CUR1988 (Фигура 2), и олигонуклеотидами CUR-1974 и CUR-1986 (Фигура 3).

Обработка клеток SK-N-AS антисмысловыми олигонуклеотидами

[00239] В этом примере SK-N-AS антисмысловые олигонуклеотиды различной структуры, нацеленные на IDUA-специфичный природный антисмысловой транскрипт, были проанализированы в конечной концентрации 20 нМ в клеточной линии SK-N-AS нейробластомы человека.

[00240] Материалы и методы: клеточная линия SK-N-AS. Клеточную линию SK-N-AS нейробластомы человека из АТСС (cat#CRL-2137) выращивали на ростовой среде (DMEM (Mediatech cat#10-013-CV)+10% ЭБС (Mediatech cat#MT35-011-CV) + пенициллин/стрептомицин (Mediatech cat#MT30-002-CI) + не незаменимые аминокислоты (NEAA)(HyClone SH30238.01)) при 37°C и 5% CO2. Клетки обрабатьюали антисмысловыми олигонуклеотидами с применением одного из следующих способов. Способ "На следующий день": за день до эксперимента клетки пересевали с плотностью приблизительно 3×105/лунку в 6-луночные планшеты с ростовой средой и инкубировали при 37°C и 5% CO2. На следующий день среду в 6-луночных планшетах заменяли на свежую ростовую среду (1,5 мл/лунка) и клетки обрабатывали антисмысловыми олигонуклеотидами. Все антисмысловые олигонуклеотиды были произведены IDT Inc. (Coralville, IA) или Exiqon (Vedbaek, Denmark). Последовательности для всех олигонуклеотидов приведены в таблице 1. Стоковые растворы олигонуклеотидов разводили до концентрации 20 мкМ стерильной водой, свободной от РНКаз/ДНКаз. Доза на одну лунку составляла 1 мкл этого раствора с 200 мкл среды Opti-MEM (Gibco cat#31985-070) и 2 мкл Липофектамина 2000 (Lipofectamine 2000) (Invitrogen cat#11668019) при комнатной температуре в течение 20 мин, затем вносили по каплям в одну лунку 24-луночного планшета с клетками. Аналогичную смесь, содержащую 1 мкл воды вместо раствора олигонуклеотида, применяли для контрольной "пустой" трансфекции. Через примерно 18 ч инкубации при 37°C и 5% CO2 среду заменяли на свежую ростовую среду. Через 48 ч после добавления антисмысловых олигонуклеотидов среду удаляли и выделяли РНК из клеток с применением SV Total RNA Isolation System от Promega (cat#Z3105), следуя инструкциям производителя. 600 нг очищенной тотальной РНК вводили в реакцию обратной транскрипции, проводимую с применением набора Superscript VILO cDNA Synthesis Kit от Invitrogen (cat#11754-250) согласно описанию в протоколе производителя. кДНК, полученные в результате реакции обратной транскрипции, применяли для мониторинга генной экспрессии при помощи ПЦР в режиме реального времени с применением ABI Taqman Gene Expression Mix (cat#4369510) и праймеров/зондов, сконструированных ABI (образцы Hs00164940_m1). Результаты, полученные с применением всех трех образцов были очень похожи. Использовали следующий цикл ПЦР: 50°C в течение 2 мин, 95°C в течение 10 мин, 40 циклов при (95°C в течение 15 секунд, 60°C в течение 1 мин) с применением аппарата для ПЦР в режиме реального времени StepOne Plus Real Time PCR Machine (Applied Biosystems). Образец для 18S был изготовлен ABI (cat#4319413E). Кратность изменения экспрессии гена после обработки антисмысловыми олигонуклеотидами вычисляли на основании разности значений dCt, нормализованных по 18S, между обработанными и ложнотрансфицированными образцами. Результаты: Результаты ПЦР в режиме реального времени показывают, что уровни мРНК гена IDUA в клетках SK-N-AS значимо повышаются через 48 ч после обработки антисмысловым олигонуклеотидами CUR-1976, CUR-1978 и CUR-1987 к природной антисмысловой последовательности IDUA человека HS.656285 (Фигура 4).

Пример 3: Удлинение потенциальной природной антисмысловой последовательности IDUA собаки

[00241] Задача данного эксперимента заключалась в удлинении известной последовательности природной антисмысловой последовательности DN876121 гена IDUA собаки, путем секвенирования всей последовательности. Оригинальный РНК транскрипт DN876121 был получен из минусовой линзы и ткани роговицы глаза собаки. Направленно клонированная кДНК-библиотека была приготовлена в векторе pCMVSport6 (Invitrogrn) в Bioserve Biotechnology Лорелом (Laurel MD). Эта работа была выполнена к апрелю 2005 года. В настоящее время клон DN876121 доступен на Open Biosystems (Open Biosystems Products, Huntsville, AL). В апреле 2005 года, клон DN876121 не был секвенирован полностью. ОРКО-CURNA получили клон DN876121 и секвенировали полную вставку. Для достижения этого, бактериальный клон, содержащий плазмиду со вставкой DN876121 был приобретен у Open Biosystems и высеян в чашки с агаром Лурия-Бертани (Luria Bertani (LB)) с ампициллином, чтобы изолировать отдельные колонии. Затем колонии размножили в 5 мл питательной среды. Плазмиду, содержащую вставку DN876121, затем изолировали из этих бактерий и отправили для секвенирования в Davis Sequencing (Davis, СА).

[00242] Материалы и методы: Выделение и секвенирование плазмиды, содержащей кДНК потенциальной природной антисмысловой последовательности IDUA собаки DN876121-Суспензия замороженных бактерий, содержащих плазмиду DN876121, была получена от Open Biosystems (Open Biosystems Products, cat#NAE04B03), разведена 1:10, 1:100, 1:1000, 1:10000, 1:100000 раз, высеяна в чашки с агаром Лурия-Бертани (LB) (BD, cat#244520), чашки (Falcon, cat#351005) с 100 мкг/мл ампицилина (Calbiochem, cat#171254). Через 15 ч, 20 отдельных колоний бактерий были выделены из чашки в разведении 1:100000 и выращены раздельно в 5 мл питательной среды LB (Fisher Scientific, cat#BP1426-2) в течение 15-24 часов. В это же время, бактерий осаждали и выделяли плазмиду (содержащую кДНК транскрипта РНК DN876121) с применением набора PureYieldTM Plasmid Miniprep System kit от Promega (Promega, cat#A1222), согласно описанию в протоколе производителя.

Выделенную ДНК разбавляли до 200 нг/мл и 12 мкл плазмиды от каждой колонии отправляли на секвенирование в Davis sequencing (Davis, СА).

Результаты: Последовательности, полученные от Davis sequencing, показали существенное удлинение известной последовательности DN876121, показанной на Фигуре 5.

Вывод: Успешное удлинение известной последовательности DN876121 на 578 нуклеотидов послужило основой для разработки антисмысловых олигонуклеотидов к потенциальной природной антисмысловой последовательности IDUA собаки DN876121-удлиненной (SEQ ID NO: 8).

Пример 4: Активность IDUA

[00243] Задача данного эксперимента заключалась в ранжировании соединений в соответствии с их способностью повышать активность IDUA в разных клетках, на основании ферментативной активности IDUA. Этот способ можно применять для ранжирования олигонуклеотидов комплементарных природной антисмысловой последовательности IDUA по их способности повышать активность IDUA, и известных, как способных увеличивать экспрессию мРНК гена IDUA (и белка IDUA). Этот протокол в сочетании с протоколом размножения клеток фибробластов пациента мог бы позволить проводить скрининг подходящего олигонуклеотида in vitro, комплементарного к природной антисмысловой последовательности IDUA, и способного повышать активность IDUA, прежде чем предлагать этот олигонуклеотид пациенту в качестве лечения.

Материалы и методы: Клетки обрабатывали олигонуклеотидами, комплементарными к природной антисмысловой последовательности IDUA, в концентрации от 0 до 80 нМ с применением липофектамина ТМ 2000. Через 24 ч питательную среду удаляли и добавляли свежую питательную среду от 24 часов до 72 часов включительно. В то же время, среду сохраняли и проверяли на активность IDUA. Активность IDUA измеряли с применением рекомбинантного IDUA человека (от R&D systems Inc. Minneapolis MN) в качестве контроля, серийно разбавленного (максимальная концентрация в 0,2 мкг/мл) в буфере для образцов (50 мМ ацетата натрия, 150 мМ NaCl, 0,02% БРИДЖ-35 (масса/объем) pH 3,5). Равные объемы рекомбинантного IDUA человека в буфере для образцов и субстрата (4-метилумберллиферил-альфа-L-идуронид) от Glycosynth (Warrington, UK) в 200 мкМ буфере для образцов смешивали в 96-луночном планшете (100 мкл каждого реакционного раствора). Инкубировали в течение 10 мин при комнатной температуре. Разводили смеси максимум до 0,005 мкг/мл рекомбинантного IDUA человека (и 5 мкМ субстрата) в проявляющем буфере (0,1 М Трис pH 9,0). Наносили 100 мкл разбавленной реакционной смеси на планшеты для флуоресцентного анализа. Проводили измерения для раствора при 365 нм и 445 нм. Удельную активность (пмоль/мин/мкг) рассчитывали по следующей формуле:

В данном протоколе измеряли активность IDUA в клеточном супернатанте путем добавления клеточного супернатанта от клеток, которые обработаны в различных количествах различными олигонуклеотидами, комплементарными природному антисмысловому транскрипту IDUA, вместо рекомбинантного IDUA человека.

Пример 5: ИФА для белка IDUA

[00244] Задача данного эксперимента заключалась в ранжировании соединений в соответствии с их способностью повышать экспрессию белка IDUA в разных клетках с применением помощи методики, называемой твердофазным иммуноферментным анализом (ИФА).

Материалы и методы: Количества белка IDUA, продуцируемого клетками, количественно определяли с помощью ИФА. Для достижения этого, клетки выращивали в 24-луночных планшетах, используя подходящие условия роста. Через сорок восемь часов после добавления небольших соединений, питательную среду удаляли и промывали клетки 3 раза фосфатно-солевым буфером Дульбекко без кальция и магния (ФСБ) (Mediatech cat#21-031-CV). Затем ФСБ удаляли и фиксировали клетки в 24-луночном планшете с применением 100 мкл 100% метанола в течение 15 мин при температуре -20°C. После удаления метанола и промывки ФСБ, клетки инкубировали с 3% перекиси водорода (Fisher Chemical cat#H325-100) в течение 5 мин при температуре 21°C. Клетки промывали ФСБ три раза по 5 мин, затем инкубировали с 100 мкл 0,1% бычьего сывороточного альбумина (БСА) (Sigma cat#А-9647) в ФСБ в течение 30 мин при 21°C. Клетки промывали ФСБ три раза по 5 мин, затем инкубировали с 300 мкл раствора авидина (Vector Laboratories cat#SP-2001) в течение 30 мин при температуре 21°C. Клетки быстро промывали ФСБ три раза, затем инкубировали с раствором биотина (Vector Laboratories cat#SP-2001) в течение 30 мин при температуре 21°C. Клетки промывали ФСБ три раза и затем инкубировали в течение ночи при температуре 4°C с 100 мкл на лунку антител кролика на участок внутренней последовательности аминокислот 244-274 IDUA человека (Abeam cat#ab103949) в 0,1% ФСБ/БСА. После уравновешивания планшета течение 5 мин при 21°C, клетки промывали ФСБ три раза по 5 мин, затем инкубировали с антителами козы против антител кролика, разведенными 1:200 в 0,1% ФСБ/БСА в течение 30 мин при 21°C. Клетки промывали ФСБ три раза по 5 мин и затем инкубировали с 300 мкл Vectastain Elite ABC реагента А+раствор B ((Vector Laboratories cat#РК-6101) в течение 30 мин; готовили Vectastain Elite ABC реагент A + раствор В при 21°C за 30 минут до инкубации с клетками путем добавления и перемешивания последовательно 2 капель реагента A с 5 мл ФСБ, а затем с 2 капелями реагента B. Клетки промывали ФСБ три раза по 5 мин при 21°C и затем инкубировали с тетраметилбензидиновым (ТМБ) субстратным раствором пероксидазы (Thermo Scientific cat#N301). После того, как супернатант станет синим, его переносили в новый 96 луночный планшет ИФА (Greiner bio one cat#65121) и добавляли 1 М серной кислоты. Поглощение измеряли при 450 нм, используя спектрофотометр Multiskan Spectrum (Thermo Scientific). Фоновый сигнал, измеренный в ячейках, окрашенных IgG антителами кролика к мыши в качестве первичных антител (Abeam cat#ab6709), вычитали из всех показаний IDUA и актина. Использовали антитела кролика к актину от Abeam (cat#abl801). Сигнал IDUA нормализовали с сигналом актина для каждого состояния и сравнивали нормированные значения для каждого экспериментального варианта.

Пример 6: Иммуногистохимия IDUA

[00245] Задача данного эксперимента заключается в ранжировании соединений в соответствии с их способностью повышать экспрессию белков IDUA в разных клетках, с применением метода иммуногистохимии.

Материалы и методы: белок IDUA определяли внутри клетки с помощью метода иммуногистохимии. Для достижения этого, клетки выращивали в 24-луночных планшетах, используя подходящие условия роста. Через сорок восемь часов после добавления небольших соединений, питательную среду удаляли и промывали клетки 3 раза фосфатно-солевым буфером Дульбекко без кальция и магния (ФСБ) (Mediatech cat#21-031-CV). Затем ФСБ удаляли и фиксировали клетки в 24-луночном планшете с применением 300 мкл 100% метанола в течение 15 мин при температуре -20°C. После удаления метанола и промывки ФСБ, клетки инкубировали с 3% перекиси водорода (Fisher Chemical cat#H325-100) в течение 5 мин при температуре 21°C. Клетки промывали ФСБ три раза по 5 мин, затем инкубировали с 300 мкл 0,1% бычьего сывороточного альбумина (БСА) (Sigma cat#А-9647) в ФСБ в течение 30 мин при 21°C. Клетки промывали ФСБ три раза по 5 мин, затем инкубировали с 300 мкл раствора авидина (Vector Laboratories cat#SP-2001) в течение 30 мин при температуре 21°C. Клетки быстро промывали ФСБ три раза, затем инкубировали с раствором биотина (Vector Laboratories cat#SP-2001) в течение 30 мин при температуре 21°C. Клетки промывали ФСБ три раза и затем инкубировали в течение ночи при температуре 4°C с 300 мкл на лунку с антител кролика на участок внутренней последовательности аминокислот 244-274 IDUA человека (Abeam cat#ab 103949) в 0,1% ФСБ/БСА. После уравновешивания планшета течение 5 мин при 21°C, клетки промывали ФСБ три раза по 5 мин, затем инкубировали с антителами козы к антителам кролика, разведенными 1:200 в 0,1% ФСБ/БСА, в течение 30 мин при 21°C. Клетки промывали ФСБ три раза по 5 мин и затем инкубировали с 300 мкл Vectastain Elite ABC реагента А+раствор В ((Vector Laboratories cat#РК-6101) в течение 30 мин; Vectastain Elite ABC реагент A + раствор B готовили при 21°C за 30 минут до инкубации с клетками путем добавления и смешивания последовательно 2 капель реагента A в 5 мл ФСБ, а затем 2 капель реагента B. Клетки промывали ФСБ три раза по 5 мин при 21°C и затем инкубировали с диаминобензидиновым (ДАБ) субстратным раствором пероксидазы (Vector Laboratories cat#SK-4105) до тех пор пока клетки не окрасятся; ДАБ субстратный раствор пероксидазы перед добавлением к клеткам повторно растворяли путем смешения 1 мл разбавителя ImmPACT™DAB с 30 мкл концентрата хромогена ImmPACT™DAB. В это же время клетки быстро промывали ФСБ три раза и оставляю 300 мкл ФСБ в каждой ячейке. Окрашивание клеток анализировали непосредственно в 24-луночном планшете с помощью инвертного микроскопа Nikon Eclipse TS100, оборудованного камерой Nikon DS-Ril в сочетании с оборудованием Nikon Digital-Sight, на экране ноутбука Dell Latitude D630. Фотографии отдельных ячеек делали с использованием программного обеспечения NIS-Elements D 3.0, поставляемого вместе с камерой Nikon.

Пример 7: Фибробласты пациентов

[00246] Задача данного эксперимента заключалась в определении подходящих олигонуклеотидов, известных как повышающих экспрессию мРНК гена IDUA у подходящих групп пациентов. Мутация гена IDUA также присутствует в клетках фибробластов кожи пациента. Путем введения лекарственного средства in vitro, возможно определить, какие олигонуклеотиды, комплементарные природной антисмысловой последовательности IDUA, могут принести пациенту пользу от этого инновационного лечения.

Материалы и методы: биопсию кожи осуществляли в соответствии с правилами FDA и с согласия пациента, чтобы размножить фибробласты кожи пациента в культуре клеток для тестирования in vitro олигонуклеотидов, комплементарных природной антисмысловой последовательности IDUA. Этот биоптат обрабатывали коллагеназой, чтобы разъединить клетки кожи, и эту клеточную суспензию помещали в лунки 6-луночных планшетов с 2 мл среды Игла в модификации Дульбекко / итательной смеси F-12 (Invitrogen cat# 10565) с 20% эмбриональной телячьей сыворотки (от GIBO/Invitrogen Cat.#35-011CV). Когда клетки достигали 70% степени слияния монослоя, их разделяли 1:4 в 2 мл среды Игла в модификации Дульбекко / питательной смеси F-12 (Invitrogen cat#10565) с 20% эмбриональной телячьей сыворотки (от GIBO/Invitrogen Cat.#35-011CV). В эти клетки вводили олигонуклеотиды, комплементарные природной антисмысловой последовательности IDUA, по тому же протоколу, как описано ранее для проверки повышения экспрессии мРНК гена IDUA. Тотальную РНК клетки проверяли на повышение экспрессии мРНК гена IDUA после введения олигонуклеотидов, комплементарных природному антисмысловому трансрипту IDUA. Супернатант этих клеток проверяли на повышение активности IDUA после дозирования олигонуклеотидов, комплементарных природному антисмысловому трансрипту IDUA.

[00247] Несмотря на то, что настоящее изобретение проиллюстрировано и описано посредством ссылок на один или несколько вариантов реализации, эквивалентные изменения и модификации будут очевидны для специалистов в данной области техники после прочтения и понимания настоящего описания и прилагаемых чертежей. Кроме того, хотя конкретные свойства согласно настоящему изобретению могут раскрываться только в одном из нескольких вариантов реализации, такие свойства могут быть скомбинированы с одним или несколькими другими свойствами других вариантов реализации, что может быть необходимо и предпочтительно для любого заданного или частного случая применения.

[00248] Реферат настоящего изобретения позволит читателю быстро понять техническую сущность изобретения. Подразумевается, что он не будет использован для целей толкования или ограничения сущности и объема приведенной ниже формулы изобретения.

1. Способ повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA) в биологической системе, включающий: осуществление контакта указанной системы с по меньшей мере одним антисмысловым олигонуклеотидом длиной от 10 до 30 нуклеотидов, при этом последовательность указанного по меньшей мере одного олигонуклеотида по меньшей мере на 80% идентична последовательности обратного комплемента природной антисмысловой последовательности полинуклеотида альфа-L-идуронидазы (IDUA); причем указанная природная антисмысловая последовательность полинуклеотида альфа-L-идуронидазы (IDUA) выбрана из SEQ ID NO: 2-9, с обеспечением тем самым повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA).

2. Способ по п. 1, отличающийся тем, что указанный по меньшей мере один олигонуклеотид содержит по меньшей мере одну из олигонуклеотидных последовательностей, соответствующих SEQ ID NOS: 10-28.

3. Способ повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA) в биологической системе по п. 1, отличающийся тем, что последовательность указанного по меньшей мере одного олигонуклеотида идентична последовательности обратного комплемента полинуклеотида, содержащего от 10 до 30 последовательных нуклеотидов в природном антисмысловом транскрипте: нуклеотиды 1-2695 последовательности SEQ ID NO: 2, или 1-2082 последовательности SEQ ID NO: 3, или 1-322 последовательности SEQ ID NO: 4, или 1-677 последовательности SEQ ID NO: 5, или 1-716 последовательности SEQ ID NO: 6, или 1-466 последовательности SEQ ID NO: 7; или 1-1255 последовательности SEQ ID NO: 8; или 1-2739 последовательности SEQ ID NO: 9.

4. Способ повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA) в клетках или тканях пациента in vivo или in vitro, включающий: осуществление контакта указанных клеток или тканей с по меньшей мере одним антисмысловым олигонуклеотидом длиной от 10 до 30 нуклеотидов, при этом последовательность указанного олигонуклеотида по меньшей мере на 80% идентична РНК, транскрибируемой с полинуклеотида альфа-L-идуронидазы (IDUA), имеющего последовательность SEQ ID NO: 1; с обеспечением тем самым повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA) в клетках или тканях пациента in vivo или in vitro;
причем указанный антисмысловой олигонуклеотид полинуклеотида альфа-L-идуронидазы (IDUA) выбран из SEQ ID NO: 2-9.

5. Способ повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA) в клетках или тканях пациента по п. 3, отличающийся тем, что последовательность указанного по меньшей мере одного олигонуклеотида идентична последовательности обратного комплемента полинуклеотида, содержащего от 10 до 30 последовательных нуклеотидов в пределах нуклеотидов природного антисмыслового транскрипта: 1-2695 последовательности SEQ ID NO: 2, или 1-2082 последовательности SEQ ID NO: 3, или 1-322 последовательности SEQ ID NO: 4, или 1-677 последовательности SEQ ID NO: 5, или 1-716 последовательности SEQ ID NO: 6, или 1-466 последовательности SEQ ID NO: 7; или 1-1255 последовательности SEQ ID NO: 8; или 1-2739 последовательности SEQ ID NO: 9.

6. Способ повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA) в биологической системе, включающий: осуществление контакта указанной системы с по меньшей мере одним антисмысловым олигонуклеотидом длиной от 10 до 30 нуклеотидов, который нацелен на область природного антисмыслового полинуклеотида полинуклеотида альфа-L-идуронидазы (IDUA), выбранного из группы, состоящей из SEQ ID NOS: 2-9, и специфично гибридизуется с ним; с обеспечением тем самым повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA).

7. Способ по п. 6, отличающийся тем, что экспрессия альфа-L-идуронидазы (IDUA) увеличиваются in vivo или in vitro по сравнению с контролем.

8. Способ по п. 6, отличающийся тем, что указанный по меньшей мере один антисмысловой олигонуклеотид нацелен на участок природного антисмыслового олигонуклеотида полинуклеотида альфа-L-идуронидазы (IDUA), выбранного из SEQ ID NO: 2-9.

9. Способ по п. 6, отличающийся тем, что указанный по меньшей мере один антисмысловой олигонуклеотид нацелен на природный антисмысловой полинуклеотид к некодирующим нуклеотидным последовательностям полинуклеотида альфа-L-идуронидазы (IDUA).

10. Способ по п. 6, отличающийся тем, что указанный по меньшей мере один антисмысловой олигонуклеотид нацелен на перекрывающиеся и/или неперекрывающиеся последовательности полинуклеотида альфа-L-идуронидазы (IDUA).

11. Способ по п. 6, отличающийся тем, что указанный по меньшей мере один антисмысловой олигонуклеотид содержит одну или более модификаций, выбранных из: по меньшей мере одного модифицированного остатка сахара, по меньшей мере одной модифицированной межнуклеозидной связи, по меньшей мере одного модифицированного нуклеотида и их комбинаций.

12. Способ по п. 11, отличающийся тем, что указанные одна или более модификаций включают по меньшей мере один модифицированный остаток сахара, выбранный из: 2′-O-метоксиэтил-модифицированного остатка сахара, 2′-метокси-модифицированного остатка сахара, 2′-O-алкил-модифицированного остатка сахара, бициклического остатка сахара и их комбинаций.

13. Способ по п. 11, отличающийся тем, что указанные одна или более модификаций включают по меньшей мере одну модифицированную межнуклеозидную связь, выбранную из: фосфотиоата, 2′-O-метоксиэтила (МОЭ), 2′-фтор, алкилфосфоната, фосфодитиоата, алкилфосфонотиоата, фосфорамидата, карбамата, карбоната, триэфирфосфата, ацетамидата, карбоксиметилового эфира и их комбинаций.

14. Способ по п. 11, отличающийся тем, что указанные одна или более модификаций включают по меньшей мере один модифицированный нуклеотид, выбранный из: пептидо-нуклеиновой кислоты, закрытой нуклеиновой кислоты, арабинонуклеиновой кислоты (2′-дезокси-2′-фтор-β-D-арабинонуклеиновой кислоты, FANA), их аналога, производного и комбинаций.

15. Способ повышения экспрессии гена альфа-L-идуронидазы (IDUA) в клетках или тканях млекопитающих in vivo или in vitro, включающий: осуществление контакта указанных клеток или тканей с по меньшей мере одним олигонуклеотидом малой интерферирующей РНК (миРНК) длиной от 19 до 30 нуклеотидов, причем указанный по меньшей мере один олигонуклеотид миРНК специфичен к природному антисмысловому полинуклеотиду полинуклеотида альфа-L-идуронидазы (IDUA), выбранному из SEQ ID NO: 2-9.

16. Способ повышения экспрессии гена альфа-L-идуронидазы (IDUA) в клетках или тканях млекопитающих in vivo или in vitro, включающий: осуществление контакта указанных клеток или тканей с по меньшей мере одним антисмысловым олигонуклеотидом длиной примерно от 10 до 30 нуклеотидов, специфичным к природной антисмысловой цепи полинуклеотида альфа-L-идуронидазы (IDUA), при этом последовательность указанного по меньшей мере одного антисмыслового олигонуклеотида по меньшей мере на 80% иденична области нуклеотидной последовательности, соответствующей SEQ ID NO: 1.

17. Синтетический антисмысловой олигонуклеотид длиной примерно от 10 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций; при этом указанный олигонуклеотид гибридизуется с природным антисмысловым олигонуклеотидом гена альфа-L-идуронидазы (IDUA) и повышает экспрессию гена альфа-L-идуронидазы (IDUA) in vivo или in vitro по сравнению с нормальным контролем, причем указанный природный антисмысловой олигонуклеотид гена альфа-L-идуронидазы (IDUA) выбран из SEQ ID NO: 2-9.

18. Олигонуклеотид по п. 17, отличающийся тем, что указанный олигонуклеотид имеет длину от 10 до 30 нуклеотидов и его последовательность идентична последовательности обратного комплемента, содержащего 10-30 последовательных нуклеотидов в пределах природного антисмыслового транскрипта гена IDUA.

19. Олигонуклеотид по п. 18, отличающийся тем, что указанная по меньшей мере одна модификация включает межнуклеотидную связь, выбранную из группы, состоящей из: фосфотиоата, алкилфосфоната, фосфодитиоата, алкилфосфонотиоата, фосфорамидата, карбамата, карбоната, триэфирфосфата, ацетамидата, карбоксиметилового эфира и их комбинаций.

20. Олигонуклеотид по п. 18, отличающийся тем, что указанный олигонуклеотид содержит по меньшей мере одну фосфотиоатную межнуклеотидную связь.

21. Олигонуклеотид по п. 18, отличающийся тем, что указанный олигонуклеотид содержит остов из фосфотиоатных межнуклеотидных связей.

22. Олигонуклеотид по п. 18, отличающийся тем, что указанный олигонуклеотид содержит по меньшей мере один модифицированный нуклеотид, при этом указанный модифицированный нуклеотид выбран из: пептидо-нуклеиновой кислоты, закрытой нуклеиновой кислоты, их аналога, производного и комбинации.

23. Олигонуклеотид по п. 18, отличающийся тем, что указанный олигонуклеотид содержит множество модификаций, при этом указанные модификации включают модифицированные нуклеотиды, выбранные из: фосфотиоата, алкилфосфоната, фосфодитиоата, алкилфосфонотиоата, фосфорамидата, карбамата, карбоната, триэфирфосфата, ацетамидата, карбоксиметилового эфира и их комбинаций.

24. Олигонуклеотид по п. 18, отличающийся тем, что указанный олигонуклеотид содержит множество модификаций, при этом указанные модификации включают модифицированные нуклеотиды, выбранные из: пептидо-нуклеиновых кислот, закрытых нуклеиновых кислот, их аналогов, производных и комбинации.

25. Олигонуклеотид по п. 18, отличающийся тем, что указанный олигонуклеотид содержит по меньшей мере один модифицированный остаток сахара, выбранный из: 2′-O-метоксиэтил-модифицированного остатка сахара, 2′-метокси-модифицированного остатка сахара, 2′-O-алкил-модифицированного остатка сахара, бициклического остатка сахара и их комбинации.

26. Олигонуклеотид по п. 18, отличающийся тем, что указанный олигонуклеотид содержит множество модификаций, при этом указанные модификации включают модифицированные остатки сахаров, выбранные из: 2′-O-метоксиэтил-модифицированного остатка сахара, 2′-метокси-модифицированного остатка сахара, 2′-O-алкил-модифицированного остатка сахара, бициклического остатка сахара и их комбинации.

27. Олигонуклеотид по п. 18, отличающийся тем, что указанный олигонуклеотид имеет длину по меньшей мере примерно от 10 до 30 нуклеотидов и гибридизуется с природным антисмысловым полинуклеотидом альфа-L-идуронидазы (IDUA), и повышает экспрессию по меньшей мере одного полинуклеотида альфа-L-идуронидазы (IDUA) in vivo или in vitro по сравнению с нормальным контролем.

28. Олигонуклеотид по п. 18, отличающийся тем, что указанный олигонуклеотид содержит последовательности, соответствующие SEQ ID NOS: 10-28.

29. Фармацевтическая композиция для лечения или предотвращения заболевания, ассоциированного с по меньшей мере одним полинуклеотидом альфа-L-идуронидазы (IDUA) и/или по меньшей мере одним продуктом, кодируемым указанным полинуклеотидом, содержащая терапевтически эффективное количество одного или более олигонуклеотидов по пп. 17-28 и фармацевтически приемлемое вспомогательное вещество.

30. Композиция по п. 29, отличающаяся тем, что последовательности указанных олигонуклеотидов идентичны любой из нуклеотидных последовательностей, соответствующих SEQ ID NOS: 10-28.

31. Композиция по п. 29, отличающаяся тем, что указанные олигонуклеотиды содержат нуклеотидные последовательности, соответствующие SEQ ID NOS: 10-28.

32. Композиция по п. 31, отличающаяся тем, что олигонуклеотиды, соответствующие SEQ ID NOS: 10-28, содержат одну или более модификаций или замен.

33. Композиция по п. 32, отличающаяся тем, что указанные одна или более модификаций выбраны из: фосфотиоата, метилфосфоната, пептидо-нуклеиновой кислоты, закрытой нуклеиновой кислоты и их комбинаций.

34. Способ предотвращения или лечения заболевания, ассоциированного с по меньшей мере одним полинуклеотидом альфа-L-идуронидазы (IDUA) и/или по меньшей мере одним продуктом, кодируемым указанным полинуклеотидом, включающий: введение пациенту терапевтически эффективной дозы по меньшей мере одного олигонуклеотида по любому из пп. 17-28, который повышает экспрессию указанного по меньшей мере одного полинуклеотида альфа-L-идуронидазы (IDUA); с обеспечением тем самым предотвращения или лечения заболевания, ассоциированного с указанным по меньшей мере одним полинуклеотидом альфа-L-идуронидазы (IDUA) и/или по меньшей мере одним продуктом, кодируемым указанным полинуклеотидом,
причем указанная природная антисмысловая последовательность полинуклеотида альфа-L-идуронидазы (IDUA) выбрана из SEQ ID NO: 2-9.

35. Способ по п. 34, отличающийся тем, что заболевание, ассоциированное с указанным по меньшей мере одним полинуклеотидом альфа-L-идуронидазы (IDUA), выбрано из: заболевания или расстройства, ассоциированного с аномальными функцией и/или экспрессией альфа-L-идуронидазы; мукополисахаридоза 1 (МПС 1); заболевания или расстройства, ассоциированного с аномальными уровнями геперансульфата и/или дерматансульфата; неврологического заболевания или расстройства, нейродегенеративного заболевания или расстройства, ухудшения долговременной памяти, синдрома Гурлера; синдрома Гурлера-Шейе и синдрома Шейе и т.д.

36. Способ повышения экспрессии полинуклеотида IDUA или экспрессии его продуктов у пациентов, нуждающихся в таком лечении, включающий введение олигонуклеотида, последовательность которого нацелена на природный антисмысловой транскрипт указанного полинуклеотида IDUA у указанного пациента, и при этом увеличение экспрессии гена IDUA по сравнению с контролем составляет более примерно десяти процентов,
причем указанный природный антисмысловой транскрипт полинуклеотида альфа-L-идуронидазы IDUA выбран из SEQ ID NO: 2-9.

37. Способ по п. 36, отличающийся тем, что увеличение экспрессии по сравнению с контролем составляет более примерно пятнадцати процентов.

38. Способ по п. 36, отличающийся тем, что увеличение экспрессии по сравнению с контролем составляет более примерно девятнадцати процентов.

39. Способ по п. 36, отличающийся тем, что увеличение экспрессии по сравнению с контролем составляет более примерно двадцати пяти процентов.



 

Похожие патенты:

Изобретение относится к генной инженерии. Описан способ доставки нуклеиновой кислоты в митохондрию и генетической модификации клетки, включающий воздействие на клетку композицией, содержащей по меньшей мере одну нуклеиновую кислоту и по меньшей мере один органоидно-направленный наноноситель, где наноноситель доставляет по меньшей мере одну нуклеиновую кислоту сквозь клеточную мембрану в митохондрию.

Изобретение относится к области биохимии. Представлен способ ингибирования репликации вируса иммунодефицита человека (ВИЧ), включающий обработку клеток млекопитающего агентом, выбранным из группы пептидов, интерферирующей РНК или антисмыслового олигонуклеотида, разрушающим структуру белков виментина и/или кератина-10 цитоскелетных промежуточных филаментов (IF) в клетке млекопитающего.

Настоящее изобретение относится к биотехнологии и представляет собой фармацевтические составы для перорального введения антисмыслового олигонуклеотида против SMAD7, фармацевтически приемлемые таблетки для перорального применения антисмыслового олигонуклеотида против SMAD7, а также пероральную дозированную форму, содержащие указанный антисмысловой олигонуклеотид и энтеросолюбильное покрытие, содержащее сополимер этилакрилата-метакриловой кислоты.

Изобретение относится к области биохимии, в частности к трансгенному растению осины со следующими признаками повышенной продуктивности - увеличенным выходом биомассы, листьями большего размера, увеличенной активностью глутаминсинтетазы и повышенной эффективностью использования азота, а также с модифицированной древесиной по сравнению с нетрансформированным растением осины, содержащему нуклеиновую кислоту, кодирующую глутаминсинтетазу, а также к способу его получения.

Изобретение относится к области биохимии, в частности к трансгенному растению березы со следующими признаками повышенной продуктивности - увеличенным выходом биомассы, листьями большего размера, увеличенной активностью глутаминсинтетазы и повышенной эффективностью использования азота по сравнению с аналогом дикого типа, содержащему нуклеиновую кислоту, кодирующую глутаминсинтетазу, а также к способу его получения.

Настоящее изобретение относится к биохимии, в частности к одноцепочечным модифицированным олигонуклеотидам, способным ингибировать экспрессию транстиретина в клетке.

Изобретение относится к области биохимии. Представлены варианты молекулы нуклеиновой кислоты, связывающейся с SDF-1.

Изобретение относится к области биотехнологии, в частности к рекомбинантной плазмидной ДНК, созданной при помощи новых праймеров CTTCCATATGGAACGAAGGCGTTTGTG и TGTGGATCCAGCTAGTTAGGCATGAAA. Указанная рекомбинантная плазмидная ДНК используется для получения рекомбинантного белка PRAME-F, состоящего из пептида MGSSHHHHHHSSGLVPRGSH слитого с последовательностью природного белка PRAME, путём её экспрессии в бактериальных клетках.

Изобретение относится к биохимии. Описаны антисмысловые олигонуклеотиды, которые увеличивают экспрессию указанного гена альфа-субъединицы потенциалзависимого натриевого канала (SCNA) in vivo или in vitro по сравнению с нормальным контролем.

Настоящее изобретение относится к области биотехнологии, конкретно к получению иммуностимулирующих олигодезоксинуклеотидов общей формулы 5′[G]х{[Т]pTTCGTC [Т]q}n[G]z 3′, где х = 3-10, z = 0-10, n = 2-100, p = 1-15, и может быть использовано в ветеринарии.

Изобретение относится к медицине и может быть использовано для повышения устойчивости организма к хроническому комбинированному токсическому действию наночастиц оксида никеля и оксида марганца у лиц, относящихся к группе риска.

Изобретение касается способа диагностики волчанки у человека. Представленное изобретение включает определение наличия вариации по меньшей мере в одном локусе риска SLE, причем указанная вариация по меньшей мере в одном локусе представляет собой аллель риска однонуклеотидного полиморфизма (SNP).

Изобретение относится к фармацевтической промышленности, а именно к экстракту Helichrysum gymnocephalum (DC) Humbert для ингибирования синтеза меланина, содержащему молекулы формулы (I) в определенном количестве на 100 г сухого вещества экстракта где - одинарная связь или двойная связь; R1=Н или СН3 и R2=Н или ОН. Способ получения экстракта Helichrysum gymnocephalum (DC) Humbert, включающий определенные этапы.
Изобретение относится медицине, а именно к анестезиологии и реаниматологии, и может быть использовано при проведении общей управляемой гипертермии человеческого организма.

Изобретение относится к медицине. Описано противоопухолевое средство, содержащее в качестве активного ингредиента диоксид углерода.

Изобретение относится к медицине, а именно к вакцинопрофилактике. Предложена композиция вакцины, содержащая один или более антигенов, и адъювант, содержащий олеиновую кислоту и моноолеин для применения в интраназальной вакцинации пациента.

Изобретение относится к области медицины и токсикологии, в частности, лечебно-профилактическому питанию населения в зонах экологического неблагополучия. Раскрыт способ приготовления антимутагенного продукта в виде мармелада из смеси соков крыжовника обыкновенного (Ribes uva-crispa L.) и клубней топинамбура (Helianthus tuberosus L.), включающий получение с помощью прессования диффузионных соков крыжовника обыкновенного и топинамбура, концентрирование соков упариванием до уменьшения объема в 2 раза, смешивание концентрированных соков в объемном соотношении 1:1 и выпаривание в течение 3-4 часов на водяной бане до студнеобразования или содержания сухих веществ 68-70%.

Настоящее изобретение относится к способу получения фармацевтической композиции, содержащей деферазирокс. Способ включает стадии получения дисперсии деферазирокса с по меньшей мере одним эксципиентом в воде, гомогенизирования деферазирокса и по меньшей мере одного эксципиента до получения гомогенной дисперсии деферазирокса и измельчения указанной гомогенной дисперсии до получения взвеси со средним размером частиц менее или равным 2000 нм.
Изобретение относится к медицине, а именно к косметической медицине и офтальмологии, и касается коррекции эпикантуса. Для этого осуществляют инъекцию геля стабилизированной гиалуроновой кислоты неживотного происхождения плотностью 22 мг/мл.

Изобретение относится к медицине, а именно к лечебной косметологии, и может быть использовано для лечения и профилактики синдрома хронической усталости. Для этого пациенту вводят препарат Лаеннек курсом 5-10 процедур внутримышечно по 1-3 мл в трапециевидную мышцу шейно-воротниковой зоны и по 1-3 мл в ягодичную мышцу 2 раза в неделю, препарат Энтеросан по 100-300 мг в виде капсул 3 раза в день, за 10-15 минут до еды, 10-20 дней.

Изобретение относится к биохимии. Описана молекула нуклеиновой кислоты для генетической терапии мукополисахаридозов.
Наверх