Антисмысловая регуляция экспрессии gcgr



Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr
Антисмысловая регуляция экспрессии gcgr

 

C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2598709:

АЙСИС ФАРМАСЬЮТИКАЛС, ИНК. (US)

Настоящее изобретение относится к биотехнологии. Предложены соединение, способное ингибировать экспрессию рецептора глюкагона (GCGR), состоящее из 12-30 соединенных нуклеозидов, композиция, снижающая экспрессию GCGR, способы лечения метаболического заболевания, снижения или задержки начала повышения уровней глюкозы в крови, профилактики заболевания, ассоциированного с GCGR, применение предложенного соединения для приготовления лекарственного средства. Предложенные соединение, композиция и способы могут быть использованы в медицине для снижения экспрессии мРНК и белка GCGR при лечении или профилактике заболеваний, связанных с нарушением обмена веществ. 17 н. и 41 з.п. ф-лы, 31 табл., 19 пр.

 

Перечень последовательностей

Настоящая заявка подана вместе с перечнем последовательностей в электронном формате. Перечень последовательностей представлен в виде файла с именем BIOL0161USSEQ.txt, созданного 19 сентября 2012 г., размером 60 кБ. Информация о перечне последовательностей в электронном формате полностью включена сюда посредством ссылки во всей своей полноте.

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Здесь представлены способы, соединения и композиции для снижения экспрессии GCGR мРНК и белка в организме животного. Такие способы, соединения и композиции можно применять, например, для лечения, профилактики, задержки или ослабления заболеваний, связанных с нарушениями обмена веществ, в частности, с нарушениями, связанными с диабетом.

УРОВЕНЬ ТЕХНИКИ

Инсулин и глюкагон представляют собой два гормона поджелудочной железы, участвующие в регуляции гомеостаза и метаболизма глюкозы. Глюкагон секретируется си-клетками островков поджелудочной железы и регулирует гомеостаз глюкозы путем регуляции продукции глюкозы в печени (Quesada et al., J. Endocrinol. 2008. 199: 5-19). Основной функцией глюкагона является противодействие действию инсулина.

Нарушение регуляции метаболизма глюкозы может быть вызвано либо дефектной секрецией и/или действием инсулина, либо нарушением супрессии глюкагона после приема пищи (Shah et al., Am. J. Physiol. Endocrinol. Metab. 1999. 277: E283-E290). Показано, что ингибирование секреции глюкагона после приема пищи у пациентов с диабетом значительно снижает уровень глюкозы в крови, что указывает на значительный вклад глюкагона в гипергликемию у пациентов с сахарным диабетом 2 типа (Shah et al., J. Clin. Endocrinol. Metab. 2000. 85: 4053-4059).

Диабет 2 типа характеризуется нарушением секреции и/или действия инсулина, и также для многих субъектов характерны неадекватные уровни циркулирующего глюкагона натощак и после приема пищи. Увеличение коэффициента глюкагон/инсулин, вероятно, является важным фактором, определяющим гипергликемию у пациентов с сахарным диабетом 2 типа (Baron et al., Diabetes. 1987. 36: 274-283). Отсутствие подавления секреции глюкагона после приема пищи у пациентов с СД 2 типа также играет важную роль в патогенезе гипергликемии после приема пищи (Henkel et al., Metabolism. 2005. 54: 1168-1173).

Глюкагон оказывает действие на ткани-мишени посредством активации его рецептора GCGR. Рецептор глюкагон является 62 кДа белком, который является членом класса В семейства рецепторов, сопряженных с G-белком (Brubaker et al., Recept. Channels. 2002. 8: 179-88). Активация GCGR приводит к передаче сигнала G-белками (Gsα и Gq), причем Gsα активирует аденилатциклазу, вызывая продукцию цАМФ, что приводит к увеличению уровней протеинкиназы А. Сигнальный путь GCGR в печени приводит к увеличению продукции глюкозы в печени путем индукции гликогенолиза и глюконеогенеза наряду с ингибированием гликогенеза (Jiang and Zhang. Am. J. Physiol. Endocrinol. Metab. 2003. 284: E671-E678). GCGR экспрессируется также во внепеченочных тканях, которые включают сердце, гладкие мышцы кишечника, почки, головной мозг и жировую ткань (Hansen et al., Peptides. 1995. 16: 1163-1166).

Антисмысловое ингибирование GCGR обеспечивает уникальное преимущество по сравнению с традиционными низкомолекулярными ингибиторами, заключающееся в том, что антисмысловые ингибиторы не основаны на конкурентном связывании соединения с белком и ингибируют активность непосредственно за счет снижения экспрессии GCGR. Типичным патентом США, описывающим антисмысловые ингибиторы GCGR, является патент США №7750142, полностью включенный в настоящий документ посредством ссылки. Антисмысловая технология становится эффективным средством снижения экспрессии определенных генных продуктов и, следовательно, может оказаться исключительно полезной в ряде терапевтических, диагностических и исследовательских вариантах применения для регуляции GCGR.

В настоящее время отсутствуют приемлемые варианты лечения расстройств обмена веществ. Соответственно, цель настоящей заявки заключается в обеспечении соединений и способов для лечения таких заболеваний и расстройств. Настоящее изобретение относится к обнаружению новых, сильнодействующих ингибиторов экспрессии гена GCGR.

Все документы или части документов, цитируемые в настоящей заявке, включая патенты, патентные заявки, статьи, книги и монографии, но не ограничиваясь ими, включены в настоящую заявку посредством ссылок в виде частей обсуждаемых здесь документов, а также во всей своей полноте.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Здесь представлены способы, соединения и композиции для регуляции экспрессии GCGR и лечения, профилактики, задержки или ослабления заболеваний, связанных с нарушениями обмена веществ, в частности, нарушениями, связанными с диабетом, и/или их симптомом.

ПОДРОБНОЕ ОПИСАНИЕ

Следует понимать, что как предшествующее общее описание, так и последующее подробное описание являются лишь иллюстративными и пояснительными и не ограничивают приведенного здесь описания, указанного в формуле изобретения. Использование единственного числа здесь включает множественное число, если иное не указано определенным образом. При использовании здесь, союз "или" означает "и/или", если не указано иное. Кроме того, использование термина "включая", а также других форм, таких как "включает" и "включенный", не является ограничивающим. Кроме того, такие термины как "элемент" или "компонент" охватывают как элементы и компоненты, содержащие один блок, так и элементы и компоненты, которые включают более чем одну субъединицу, если иное не указано определенным образом.

Заголовки разделов, использованные здесь, предназначены только для организационных целей и не должны рассматриваться как ограничивающие описанный объект изобретения. Все документы или части документов, цитируемые в настоящей заявке, включая патенты, патентные заявки, статьи, книги и монографии, но не ограничиваясь ими, включены в настоящую заявку посредством ссылок как в виде частей обсуждаемых здесь документов, так и полностью.

Определения

Если не представлены конкретные определения, номенклатура, используемая в этой связи, а также процедуры и методики аналитической химии, химии органического синтеза и медицинской и фармацевтической химии, описанные здесь, являются хорошо известными методикам и обычно используются в данной области техники. Для химического синтеза и химического анализа можно использовать стандартные методики. В допустимых случаях все документы или части документов, цитируемые в настоящей заявке, включая, но не ограничиваясь этим, патенты, заявки, опубликованные заявки и другие журнальные публикации, учетные номера GENBANK и связанная с ними информация о последовательностях, получаемая из таких баз данных как Национальный центр биотехнологической информации (NCBI), и другие данные, цитируемые в настоящей заявке, включены в настоящую заявку посредством ссылок как в виде частей обсуждаемых документов, так и полностью.

Если не указано иное, то следующие термины имеют следующие значения:

"2′-O-метоксиэтил" (также 2′-МОЕ и 2′-O(СН2)2-ОСН3) относится к O-метоксиэтильной модификации 2′-положения фурозильного кольца. 2′-O-метоксиэтил-модифицированная сахароза является модифицированной сахарозой.

"2′-O-метоксиэтилнуклеотид" означает нуклеотид, содержащий 2′-O-метоксиэтил-модифицированную группу сахарозы.

"3′-сайт-мишень" относится к нуклеотиду нуклеиновой кислоты-мишени, комплементарному 3′-концевому нуклеотиду конкретного антисмыслового соединения.

"5′-сайт-мишень" относится к нуклеотиду нуклеиновой кислоты-мишени, комплементарному 5′-концевому нуклеотиду конкретного антисмыслового соединения.

"5-метилцитозин" означает цитозин, модифицированный метильной группой, присоединенной в 5′-положении. 5′-метилцитозин является модифицированным нуклеиновым основанием.

"Приблизительно" означает в пределах ±10% от указанного значения. Например, если указано, что "маркер может быть повышен приблизительно на 50%", подразумевается, что маркер может быть повышен на 45-55%.

"Активный фармацевтический агент" означает вещество или вещества в составе фармацевтической композиции, которые обеспечивают терапевтически благоприятный эффект при введении субъекту. Например, в некоторых вариантах воплощения антисмысловой олигонуклеотид, мишенью которого является GCGR, является активным фармацевтическим агентом.

"Активная область-мишень" или "область-мишень" означает область, являющуюся мишенью одного или более активных антисмысловых соединений. "Активные антисмысловые соединения" означают антисмысловые соединения, которые снижают уровни целевой нуклеиновой кислоты или белка-мишени.

"Ожирение" или "тучность" относится к состоянию ожирения или чрезмерно высокому количеству жира или жировой ткани по отношению к мышечной массе тела. Количество жира включает как аспекты распределения жира в организме, так и размер и массу отложений жировой ткани. Распределение жира в организме можно оценить путем измерений кожных складок, соотношений окружности талии и бедер или таких методик как УЗИ, компьютерная томография или магнитно-резонансная томография. По данным Центра по контролю и профилактике заболеваний люди с индексом массы тела (ИМТ) от 30 и более считаются тучными. Термин "ожирение", при использовании здесь, включает состояния, при которых увеличение жира в организме выходит за пределы физических потребностей в результате чрезмерного накопления жировой ткани в организме. Термин "ожирение" включает следующие состояния: ожирение с началом заболевания во взрослом возрасте; алиментарное ожирение; эндогенное или воспалительное ожирение; эндокринное ожирение; семейное ожирение; гиперинсулиновое ожирение; гиперпластическо-гипертрофическое ожирение; ожирение при гипогонадизме; ожирение при гипотиреозе; пожизненное ожирение; патологическое ожирение и экзогенное ожирение, но не ограничивается ими.

"Сопутствующее введение" означает совместное введение двух агентов любым способом, при котором фармакологические эффекты обоих агентов проявляются у пациента одновременно. Сопутствующее введение не требует введения обоих агентов в составе одной фармацевтической композиции, в одной и той же лекарственной форме или одним и тем же путем введения. Эффекты обоих препаратов не обязательно проявляются сами по себе в одно и то же время. Указанные эффекты должны лишь взаимно перекрываться в течение некоторого периода времени, и их продолжительность не обязательно должна быть одинакова.

"Введение" означает предоставление агента животному и включает, не ограничиваясь этим, введение медицинским работником и самостоятельное введение.

"Агент" означает активное вещество, которое может обеспечить терапевтический благоприятный эффект при введении в организм животного. "Первый агент" означает терапевтическое соединение, представленное здесь. Например, первый агент может являться антисмысловым олигонуклеотидом, мишенью которого является GCGR. "Второй агент" означает второе терапевтическое соединение, описанное здесь (например, второй антисмысловой олигонуклеотид, мишенью которого является GCGR), и/или терапевтическое соединение для воздействия на мишени, отличающиеся от GCGR.

"Облегчение" относится к уменьшению по меньшей мере одного показателя, признака или симптома ассоциированного заболевания, расстройства или состояния. Степень тяжести показателей можно определить с помощью субъективных или объективных средств, известных специалистам в данной области техники.

"Животное" относится к человеку или животному, не являющемуся человеком, включая, но не ограничиваясь этим, мышей, крыс, кроликов, собак, кошек, свиней и не являющихся человеком приматов, в том числе обезьян и шимпанзе, но не ограничиваясь ими.

"Антисмысловая активность" означает любую обнаруживаемую или измеримую активность, относящуюся к гибридизации антисмыслового соединения с нуклеиновой кислотой-мишенью. В некоторых вариантах воплощения антисмысловая активность является уменьшением количества или экспрессии нуклеиновой кислоты-мишени или белка, кодируемого такой нуклеиновой кислотой-мишенью.

"Антисмысловое соединение" означает олигомерное соединение, способное подвергаться гибридизации с нуклеиновой кислотой-мишенью за счет водородных связей.

"Антисмысловое ингибирование" означает снижение уровней нуклеиновой кислоты-мишени или уровней белка-мишени в присутствии антисмыслового соединения, комплементарного нуклеиновой кислоте-мишени, по сравнению с уровнями нуклеиновой кислоты-мишени или уровнями белка-мишени в отсутствие антисмыслового соединения.

"Антисмысловой олигонуклеотид" означает одноцепочечный олигонуклеотид, обладающий последовательностью нуклеиновых оснований, дающей возможность гибридизации с соответствующей областью или сегментом нуклеиновой кислоты-мишени.

"Бициклическая сахароза" означает фурозильное кольцо, модифицированное путем образования мостика между двумя негеминальными кольцевьми атомами. Бициклическая сахароза является модифицированной сахарозой.

"Бициклическая нуклеиновая кислота" или "БНА" относится к нуклеозиду или нуклеотиду, в котором фуранозная часть нуклеозида или нуклеотида включает мостик, соединяющий два атома углерода в фуранозном кольце, тем самым образуя бициклическую кольцевую систему.

"Кэп-структура" или "концевая кэп-группа" означает химическую модификацию, внедренную на любом конце антисмыслового соединения.

"Химически различная область" относится к области антисмыслового соединения, которая некоторым образом химически отличается от другой области того же антисмыслового соединения. Например, область, содержащая 2′-O-метоксиэтилнуклеотиды, химически отличается от области, содержащей нуклеотиды без 2′-O-метоксиэтильных модификаций.

"Химерное антисмысловое соединение" означает антисмысловое соединение, которое имеет по меньшей мере две химически различные области.

"Совместное введение" означает введение двух или более агентов субъекту. Указанные два или более агентов могут находиться в составе одной фармацевтической композиции или могут находиться в раздельных фармацевтических композициях. Каждый из указанных двух или более агентов можно вводить одинаковым путем или различными путями введения. Совместное введение охватывает параллельное или последовательное введение.

"Холестерин" является стериновой молекулой, присутствующей в клеточных мембранах всех животных тканей. Холестерин должен транспортироваться в плазме крови животных липопротеинами, включающими липопротеины очень низкой плотности (ЛПОНП), липопротеины промежуточной плотности (ЛППП), липопротеины низкой плотности (ЛПНП) и липопротеины высокой плотности (ЛПВП). "Холестерин плазмы" относится к сумме всех липопротеинов (ЛПОНП, ЛППП, ЛПНП, ЛПВП), этерифицированному и/или неэтерифицированному холестерину, присутствующему в плазме или сыворотке.

"Комплементарность" означает способность к спариванию между нуклеиновыми основаниями первой нуклеиновой кислоты и второй нуклеиновой кислоты.

"Смежные нуклеиновые основания" означает нуклеиновые основания, непосредственно примыкающие друг к другу.

"Дезоксирибонуклеотид" означает нуклеотид, имеющий атом водорода по 2′-положению сахарозной части нуклеотида. Дезоксирибонуклеотиды могут быть модифицированы любым из множества заместителей.

"Сахарный диабет" или "диабет" является синдромом, характеризующимся расстройством метаболизма и аномально высоким уровнем сахара в крови (гипергликемией) в результате недостаточного уровня инсулина или снижения чувствительности к инсулину. Характерными симптомами являются избыточный диурез (полиурия) из-за высокого уровня глюкозы в крови, избыточная жажда и повышенное потребление жидкости (полидипсия) для компенсации повышенного мочеиспускания, затуманенное зрение из-за влияния высокого уровня глюкозы в крови на оптическую систему глаза, необъяснимая потеря веса и вялость.

"Диабетическая дислипидемия" или "сахарный диабет 2 типа с дислипидемией" означает состояние, характеризующееся сахарным диабетом 2 типа, пониженным ЛПВП-X, повышенным уровнем триглицеридов и повышенным уровнем небольших плотных частиц ЛПНП.

"Разбавитель" означает ингредиент композиции, не обладающий фармакологической активностью, но являющийся фармацевтически необходимым или желательным. Например, разбавитель в композиции для инъекций может являться жидкостью, например, физиологическим раствором.

"Дислипидемия" относится к расстройству метаболизма липидов и/или липопротеинов, в том числе избыточной продукции или недостаточности липидов и/или липопротеинов. Дислипидемии могут проявляться повышением уровня липидов, например, холестерина и триглицеридов, а также липопротеинов, например, холестерина липопротеинов низкой плотности (ЛПНП).

"Дозированная форма" означает форму, в которой представлен фармацевтический агент, например, пилюлю, таблетку или другую дозированную форму, известную в данной области техники. В некоторых вариантах воплощения дозированная форма представляет собой флакон, содержащий лиофилизированный антисмысловой олигонуклеотид. В некоторых вариантах воплощения дозированная форма представляет собой флакон, содержащий восстановленный антисмысловой олигонуклеотид.

"Доза" означает определенное количество фармацевтического агента, вводимое при однократном приеме или в течение определенного периода времени. В некоторых вариантах воплощения дозу можно вводить в одном, двух или более болюсах, таблетках или инъекциях. Например, в некоторых вариантах воплощения, где желательно подкожное введение, для желательной дозы необходим объем, с трудом вводимый путем однократной инъекции; таким образом, для достижения желательной дозы можно использовать две или более инъекции. В некоторых вариантах воплощения фармацевтический агент вводят путем вливания, выполняемого в течение длительного периода времени или непрерывно. Дозы можно определять как количество фармацевтического агента в час, день, неделю или месяц.

"Эффективное количество" или "терапевтически эффективное количество" означает количество активного фармацевтического агента, достаточное для осуществления желаемого физиологического результата у индивида, нуждающегося в агенте. Эффективное количество может варьироваться от индивида к индивиду в зависимости от здоровья и физического состояния индивида, подлежащего лечению, таксономической группы индивидов, подлежащих лечению, состава композиции, оценки медицинского состояния индивида и других значимых факторов.

"Полностью комплементарный" или "на 100% комплементарный" означает, что каждому нуклеиновому основанию последовательности нуклеиновых оснований первой нуклеиновой кислоты соответствует комплементарное нуклеиновое основание во второй последовательности нуклеиновых оснований второй нуклеиновой кислоты. В некоторых вариантах воплощения первая нуклеиновая кислота является антисмысловым соединением, а нуклеиновая кислота-мишень является второй нуклеиновой кислотой.

"Гэпмер" означает химерное антисмысловое соединение, в котором внутренняя область, имеющая множество нуклеозидов, поддерживающих расщепление РНКазой Н, расположена между внешними областями, имеющими один или более нуклеозидов, причем нуклеозиды, содержащиеся во внутренней области, химически отличаются от нуклеозида или нуклеозидов, содержащихся во внешних областях. Внутренняя область может называться "сегментом разрыва", а внешние области могут называться "сегментами крыльев".

"С расширенным разрывом" означает химерное антисмысловое соединение, имеющее сегмент разрыва из 12 или более смежных 2′-дезоксирибонуклеозидов, расположенных между и в непосредственной близости от 5′- и 3′-сегментов крыльев, имеющих от одного до шести нуклеозидов.

"Рецептор глюкагона" или "GCGR" означает любую нуклеиновую кислоту или белок GCGR.

"Экспрессия GCGR" означает уровень мРНК, транскрибируемой с гена, кодирующего GCGR, или уровень белка, транслируемого с мРНК. Экспрессию GCGR можно определять известными в данной области техники способами, например, нозерн- или вестерн-блоттингом.

"Нуклеиновая кислота GCGR" означает любую нуклеиновую кислоту, кодирующую GCGR. Например, в некоторых вариантах воплощения нуклеиновая кислота GCGR включает последовательность ДНК, кодирующую GCGR, последовательность РНК, транскрибируемую с ДНК, кодирующей GCGR (в том числе геномной ДНК, включающей интроны и экзоны), и последовательность мРНК, кодирующую GCGR. "мРНК GCGR " означает мРНК, кодирующую белок GCGR.

"Глюкоза" является моносахаридом, используемым клетками в качестве источника энергии, и интермедиатом воспаления. "Глюкоза плазмы" относится к глюкозе, присутствующей в плазме.

"Гибридизация" означает отжиг комплементарных молекул нуклеиновой кислоты. В некоторых вариантах воплощения комплементарные молекулы нуклеиновой кислоты включают антисмысловое соединение и нуклеиновую кислоту-мишень.

"Гиперлипидемия" или "гиперлипемия" представляет собой состояние, характеризующееся повышенным содержанием липидов в сыворотке или циркулирующих липидов (в плазме). Это состояние проявляется аномально высокой концентрацией жиров. Липидные фракции циркулирующей крови представляют собой холестерин, липопротеины низкой плотности, липопротеины очень низкой плотности и триглицериды.

"Гипертриглицеридемия" означает состояние, характеризующееся повышенными уровнями триглицеридов.

"Выявление" или "выбор животного с метаболическим расстройством" означает выявление или выбор субъекта с диагнозом метаболического заболевания или метаболического расстройства или выявление, или выбор субъекта с любым симптомом метаболического заболевания, включая метаболический синдром, гипергликемию, гипертриглицеридемию, гипертензию, повышенную инсулинорезистентность, пониженную чувствительность к инсулину, избыточную массу тела и/или избыток жира или любую комбинацию вышеперечисленного, но не ограничиваясь ими. Такое выявление можно осуществить любым способом, включая, но не ограничиваясь этим, стандартные клинические анализы или оценки, например, измерение глюкозы в сыворотке или циркулирующей глюкозы (в плазме) крови, измерение триглицеридов в сыворотке или циркулирующих триглицеридов (в плазме), измерение артериального давления, измерение жира, измерение массы тела и т.п.

"Непосредственно примыкающий" означает отсутствие промежуточных элементов между непосредственно примыкающими элементами.

"Индивид" или "субъект", или "животное" означает человека или животное, не являющееся человеком, выбранное для лечения или терапии.

"Ингибирование экспрессии или активности" относится к снижению или блокаде экспрессии или активности РНК или белка и не обязательно указывает на полную ликвидацию экспрессии или активности.

Инсулинорезистентность определяют как состояние, при котором нормального количества инсулина недостаточно для получения нормального ответа жировых, мышечных клеток и клеток печени на инсулин. Инсулинорезистентность жировых клеток приводит к гидролизу хранящихся триглицеридов, что повышает уровень свободных жирных кислот в плазме крови. Инсулинорезистентность в мышцах снижает поглощение глюкозы, в то время как инсулинорезистентность в печени снижает хранение глюкозы, причем оба указанные эффекта служат для повышения уровня глюкозы в крови. Высокие уровни инсулина и глюкозы в плазме, обусловленные инсулинорезистентностью, часто приводят к метаболическому синдрому и диабету 2 типа.

"Чувствительность к инсулину" является мерой эффективности переработки глюкозы в организме индивида. Индивид с высокой чувствительностью к инсулину эффективно перерабатывает глюкозу, в то время как индивид с низкой чувствительностью к инсулину неэффективно перерабатывает глюкозу.

"Межнуклеозидная связь" относится к химической связи между нуклеозидами.

"Внутривенное введение" означает введение в вену.

"Связанные нуклеозиды" означает соседние нуклеозиды, связанные друг с другом.

"Гиполипидемическая терапия" или "гиполипидемический агент" означает терапевтическую схему для обеспечения снижения уровня одного или более липидов у субъекта. В некоторых вариантах воплощения гиполипидемическую терапию осуществляют для снижения уровня одного или более из АроВ, общего холестерина, ЛПНП-Х, ЛПОНП-Х, ЛППП-Х, не-ЛПВП-Х, триглицеридов, мелких плотных частиц ЛПНП и Lp(a) у субъекта. Примеры гиполипидемических терапевтических средств включают статины, фибраты и ингибиторы МТР.

"Основные факторы риска" относится к факторам, способствующим высокому риску конкретного заболевания или состояния. В некоторых вариантах воплощения основные факторы риска развития коронарной болезни сердца включают, без ограничения, курение, гипертензию, низкий ЛПВП-Х, семейный анамнез коронарной болезни сердца, возраст и другие факторы, описанные здесь.

"Метаболическое заболевание" или "метаболическое расстройство" относится к состоянию, характеризующемуся изменением или нарушением метаболической функции. "Метаболический" и "метаболизм" представляют собой термины, хорошо известные в данной области техники и обычно включающие весь спектр биохимических процессов, протекающих в живом организме. Метаболические заболевания или расстройства включают ожирение, диабет, гипергликемию, преддиабет, неалкогольную жировую дистрофию печени (НАЖДП), метаболический синдром, инсулинорезистентность, диабетическую дислипидемию или гипертриглицеридемию, или их комбинацию, но не ограничиваются ими.

"Метаболический синдром" означает состояние, характеризующееся кластеризацией липидных и нелипидных факторов сердечно-сосудистого риска метаболического происхождения. В некоторых вариантах воплощения метаболический синдром выявляют по наличию любых 3-х из следующих факторов: окружность талии более 102 см у мужчин или более 88 см у женщин; уровень триглицеридов в сыворотке по меньшей мере 150 мг/дл; ЛПВП-Х менее 40 мг/дл у мужчин и менее 50 мг/дл у женщин; артериальное давление по меньшей мере 130/85 мм рт.ст.; и уровень глюкозы натощак по меньшей мере 110 мг/дл. Эти детерминанты легко измерить в клинической практике (JAMA, 2001, 285: 2486-2497).

"Несовпадение" или "некомплементарное нуклеиновое основание" относится к случаю, когда нуклеиновое основание первой нуклеиновой кислоты неспособно спариваться с соответствующим нуклеиновым основанием второй нуклеиновой кислоты или нуклеиновой кислоты-мишени.

"Смешанная дислипидемия" означает состояние, характеризующееся повышенными уровнями холестерина и триглицеридов.

"Модифицированная межнуклеозидная связь" относится к замещению или любому изменению природной межнуклеозидной связи (т.е. фосфодиэфирной межнуклеозидной связи).

"Модифицированное нуклеиновое основание" относится к любому нуклеиновому основанию, кроме аденина, цитозина, гуанина, тимидина или урацила. "Немодифицированное нуклеиновое основание" означает пуриновые основания аденин (А) и гуанин (G) и пиримидиновые основания тимин (Т), цитозин (С) и урацил (U).

"Модифицированный нуклеозид" означает нуклеозид, независимо имеющий модифицированную сахарозную группу или модифицированное нуклеиновое основание.

"Модифицированный нуклеотид" означает нуклеотид, независимо имеющий модифицированную сахарозную группу, модифицированную межнуклеозидную связь или модифицированное нуклеиновое основание. "Модифицированный нуклеозид" означает нуклеозид, независимо имеющий модифицированную сахарозную группу или модифицированное нуклеиновое основание.

"Модифицированный олигонуклеотид" означает олигонуклеотид, включающий по меньшей мере один модифицированный нуклеотид.

"Модифицированная сахароза" относится к замещению или изменению природной сахарозы.

"Мотив" означает схему химически различных областей в антисмысловом соединении.

"Природная межнуклеозидная связь" означает 3′-5′-фосфодиэфирную связь.

"Природная сахарозная группа" означает сахарозу, присутствующую в ДНК (2′-Н) или РНК (2′-ОН).

"Неалкогольная жировая дистрофия печени" или "НАЖДП" означает состояние, характеризующееся жировым воспалением печени, не обусловленным чрезмерным употреблением алкоголя (например, потреблением алкоголя свыше 20 г/сутки). В некоторых вариантах воплощения НАЖДП связана с инсулинорезистентностью и метаболическим синдромом. НАЖДП охватывает спектр заболеваний, начиная от простого накопления триглицеридов в гепатоцитах (стеатоз печени) до стеатоза печени с воспалением (стеатогепатита), фиброза и цирроза печени.

"Неалкогольный стеатогепатит" (НАСГ) происходит при прогрессировании НАЖБП за стадию отложения триглицеридов. Для развития НАСГ требуется "второй удар", способный индуцировать некроз, воспаление и фиброз. Потенциальные факторы второго удара можно разделить на широкие группы: факторы, вызывающие усиление окислительного стресса, и факторы, способствующие экспрессии провоспалительных цитокинов.

"Нуклеиновая кислота" относится к молекулам, состоящим из мономерных нуклеотидов. Нуклеиновая кислота включает рибонуклеиновые кислоты (РНК), дезоксирибонуклеиновые кислоты (ДНК), одноцепочечные нуклеиновые кислоты, двуцепочечные нуклеиновые кислоты, малые интерферирующие рибонуклеиновые кислоты (миРНК) и микроРНК. Нуклеиновая кислота может также включать комбинацию этих элементов в одной молекуле.

"Нуклеиновое основание" означает гетероциклическую группу, способную спариваться с основанием другой нуклеиновой кислоты.

"Последовательность нуклеиновых оснований" означает порядок смежных нуклеиновых оснований независимо от любой модификации сахарозы, связи или нуклеинового основания.

"Нуклеозид" означает нуклеиновое основание, связанное с сахарозой.

"Нуклеозидный миметик" включает структуры, используемые для замены сахарозы или сахарозы и основания и, необязательно, связи в одном или более положений олигомерного соединения, например, нуклеозидные миметики, имеющие морфолиновые, циклогексенильные, циклогексильные, тетрагидропиранильные, бицикло или трициклогруппы, сахарозные миметики, например, нефуранозные сахарозные единицы.

"Нуклеотид" означает нуклеозид, имеющий фосфатную группу, ковалентно присоединенную к сахарозному фрагменту нуклеозида.

"Нуклеотидный миметик" включает структуры, используемые для замены нуклеозида и связи в одном или более положений олигомерного соединения, например, пептидные нуклеиновые кислоты или морфолиногруппы (морфолиногруппы, соединенные -N(H)-C(=O)-O- или другой нефосфодиэфирной связью).

"Олигомерное соединение" или "олигомер" относится к полимерной структуре, содержащей две или более субструктур и способной к гибридизации с областью молекулы нуклеиновой кислоты. В некоторых вариантах воплощения олигомерные соединения являются олигонуклеозидами. В некоторых вариантах воплощения олигомерные соединения являются олигонуклеотидами. В некоторых вариантах воплощения олигомерные соединения являются антисмысловыми соединениями. В некоторых вариантах воплощения олигомерные соединения являются антисмысловыми олигонуклеотидами. В некоторых вариантах воплощения олигомерные соединения являются химерными олигонуклеотидами.

"Олигонуклеотид" означает полимер из соединенных нуклеозидов, каждый из которых может быть модифицированным или немодифицированным независимо друг от Друга.

"Парентеральное введение" означает введение посредством инъекции или вливания. Парентеральное введение включает подкожное введение, внутривенное введение, внутримышечное введение, внутриартериальное введение, внутрибрюшинное введение или внутричерепное введение, например, интратекальное или интрацеребровентрикулярное введение. Введение может быть непрерывным или постоянным, или краткосрочным, или периодическим.

"Пептид" означает молекулу, образованную путем соединения по меньшей мере двух аминокислот посредством амидных связей. Пептид относится к полипептидам и белкам.

"Фармацевтический агент" означает вещество, обеспечивающее терапевтический благоприятный эффект при введении в организм индивида. Например, в некоторых вариантах воплощения антисмысловой олигонуклеотид, мишенью которого является GCGR, является фармацевтическим агентом.

"Фармацевтическая композиция" означает смесь веществ, подходящую для введения в организм индивида. Например, фармацевтическая композиция может включать один или более активных агентов и стерильный водный раствор.

"Фармацевтически приемлемый носитель" означает среду или разбавитель, который не оказывает вреда структуре олигонуклеотида. Некоторые из таких носителей обеспечивают возможность составления фармацевтических композиций в виде, например, таблеток, пилюль, драже, капсул, жидкостей, гелей, сиропов, взвесей, суспензий и пастилок, для перорального введения субъекту. Например, фармацевтически приемлемый носитель может являться стерильным водным раствором.

"Фармацевтически приемлемое производное" охватывает фармацевтически приемлемые соли, конъюгаты, пролекарства или изомеры соединений, описанных здесь.

"Фармацевтически приемлемые соли" означает физиологически и фармацевтически приемлемые соли антисмысловых соединений, т.е. соли, сохраняющие желательную биологическую активность исходного олигонуклеотида и не придающие ему нежелательного токсического действия.

"Фосфортиоатная связь" означает связь между нуклеозидами, где фосфодиэфирная связь модифицирована путем замены одного из немостиковых атомов кислорода атомом серы. Фосфортиоатная связь является модифицированной межнуклеозидной связью.

"Фрагмент" означает определенное количество смежных (т.е. соединенных) нуклеиновых оснований нуклеиновой кислоты. В некоторых вариантах воплощения фрагмент представляет собой определенное количество смежных нуклеиновых оснований нуклеиновой кислоты-мишени. В некоторых вариантах воплощения фрагмент представляет собой определенное количество смежных нуклеиновых оснований антисмыслового соединения.

"Предотвратить" относится к задержке или предупреждению наступления или развития заболевания, расстройства или состояния на период времени от нескольких минут до неопределенного срока. Термин "предотвратить" также означает снижение риска развития заболевания, расстройства или состояния.

"Пролекарство" означает терапевтический агент, который получают в неактивной форме, преобразующейся в активную форму в организме или его клетках под действием эндогенных ферментов или других химических веществ или условий.

"Побочные эффекты" означает физиологические реакции, относящиеся к лечению и не являющиеся желательными эффектами. В некоторых вариантах воплощения побочные эффекты включают реакции в месте инъекции, аномалии анализов функции печени, аномалии функции почек, гепатотоксичность, нефротоксичность, аномалии центральной нервной системы, миопатии и недомогание. Например, повышение уровня аминотрансфераз в сыворотке может указывать на гепатотоксичность или аномалию функции печени. Например, повышение уровня билирубина может указывать на гепатотоксичность или аномалии функции печени.

"Одноцепочечный олигонуклеотид" означает олигонуклеотид, не гибридизованный с комплементарной цепью.

"Специфически гибридизуемый" относится к антисмысловому соединению, обладающему достаточной степенью комплементарности между антисмысловым олигонуклеотидом и нуклеиновой кислотой-мишенью для получения желательного эффекта при минимальном или отсутствующем взаимодействии с нуклеиновыми кислотами, не являющимися мишенями, в условиях, когда желательно специфическое связывание, т.е. в физиологических условиях в случае анализов in vivo и при лечении.

"Статин" означает агент, ингибирующий активность ГМГ-КоА-редуктазы.

"Подкожное введение" означает введение непосредственно под кожу.

"Адресное воздействие" или "для адресного воздействия" означает процесс конструирования и выбора антисмыслового соединения, специфически гибридизующегося с нуклеиновой кислотой-мишенью и вызывающего желательный эффект.

Все из терминов "нуклеиновая кислота-мишень", "РНК-мишень" и "РНК-транскрипт-мишень" относятся к нуклеиновой кислоте, способной являться мишенью антисмысловых соединений.

"Сегмент-мишень" означает последовательность нуклеотидов нуклеиновой кислоты-мишени, на которую происходит адресное воздействие антисмыслового соединения. "5′-сайт-мишень" относится к концевому 5′-нуклеотиду сегмента-мишени. "3′-сайт-мишень" относится к концевому 3′-нуклеотиду сегмента-мишени.

"Терапевтически эффективное количество" означает количество агента, обеспечивающее терапевтический благоприятный эффект для индивида.

"Терапевтическое изменение образа жизни" означает изменения питания и образа жизни, предназначенные для снижения массы жира/жировой ткани и/или холестерина. Такое изменение может снизить риск развития сердечного заболевания и может включать рекомендации по потреблению общего ежедневного количества калорий, общего жира, насыщенных жиров, полиненасыщенных жиров, мононенасыщенных жиров, углеводов, белка, холестерина, нерастворимых волокон, а также рекомендации по физической активности.

"Триглицерид" или "ТГ" означает липид или нейтральный жир, состоящий из глицерина в сочетании с тремя молекулами жирной кислоты.

"Диабет 2 типа" (также известный как "сахарный диабет 2 типа" и ранее называвшийся "сахарным диабетом 2 типа", "инсулин-независимым сахарным диабетом (ИНСД)", "диабетом, связанным с ожирением" или "диабетом зрелого возраста") представляет собой метаболическое расстройство, в первую очередь характеризующееся инсулинорезистентностью, относительной недостаточностью инсулина и гипергликемией.

"Лечить" относится к введению фармацевтической композиции животному для стимуляции изменения или улучшения заболевания, расстройства или состояния.

"Немодифицированный нуклеотид" означает нуклеотид, состоящий из природных нуклеиновых оснований, сахарозных групп и межнуклеозидных связей. В некоторых вариантах воплощения немодифицированный нуклеотид является РНК-нуклеотидом (т.е. β-D-рибонуклеозидами) или ДНК-нуклеотидом (т.е. β-D-дезоксирибонуклеозидом).

Некоторые варианты воплощения

Некоторые варианты воплощения обеспечивают способы, соединения и композиции для ингибирования экспрессии GCGR.

Некоторые варианты воплощения обеспечивают антисмысловые соединения, мишенью которых является нуклеиновая кислота GCGR. В некоторых вариантах воплощения нуклеиновая кислота GCGR является любой из последовательностей, приведенных под учетным номером GENBANK NM_000160.3 (включенной в настоящий документ как SEQ ID NO:1) или под учетным номером GENBANK NW_926918.1, обрезанной от нуклеотидов 16865000 до 16885000 (включенной в настоящий документ как SEQ ID NO:2). В некоторых вариантах воплощения GCGR обладает последовательностью макака-резуса, приведенной как SEQ ID NO:3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 12-30 нуклеозидов, обладающий последовательностью нуклеиновых оснований, комплементарной фрагменту равной длины любой из SEQ ID NOs:1-3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, состоят из 12-30 соединенных нуклеозидов и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований любой из SEQ ID NOs:4-115.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, состоят из 12-30 соединенных нуклеозидов и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований любой из SEQ ID NOs:11, 17, 31, 80 или 85.

В некоторых вариантах воплощения соединение или композиция, представленное здесь, является или включает ISIS NOs:449884, 459014, 398471, 448766 или 459157.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, состоят из 12-30 соединенных нуклеозидов и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:11.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, состоят из 12-30 соединенных нуклеозидов и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:80.

В некоторых вариантах воплощения указанное соединение или композиция является или включает ISIS NO:449884.

В некоторых вариантах воплощения указанное соединение или композиция является или включает ISIS NO:459014.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 15-30 нуклеозидов, обладающий последовательностью нуклеиновых оснований, комплементарной фрагменту равной длины любой из SEQ ID NOs:1-3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, состоят из 15-30 соединенных нуклеозидов и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований любой из SEQ ID NOs:4-115.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, состоят из 15-30 соединенных нуклеозидов и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований любой из SEQ ID NOs:11, 17, 31, 80 или 85.

В некоторых вариантах воплощения соединение или композиция, представленное здесь, является или включает ISIS NOs:449884, 459014, 398471, 448766 или 459157.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, состоят из 15-30 соединенных нуклеозидов и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:11.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, состоят из 15-30 соединенных нуклеозидов и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:80.

В некоторых вариантах воплощения соединение или композиция, представленное здесь, является или включает ISIS NO:449884.

В некоторых вариантах воплощения соединение или композиция, представленное здесь, является или включает ISIS NO:459014.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 16-21 нуклеозидов, обладающий последовательностью нуклеиновых оснований, комплементарной фрагменту равной длины любой из SEQ ID NOs:1-3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 16-21 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований любой из SEQ ID NOs:4-115.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 16-21 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований любой из SEQ ID NOs:11, 17, 31, 80 или 85.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 16-21 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:11.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 16-21 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:80.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-35 нуклеозидов, обладающий последовательностью нуклеиновых оснований, комплементарной фрагменту равной длины любой из SEQ ID NOs:1-3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-35 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:4-115.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 2O-35 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:11, 17, 31, 80 или 85.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, могут состоять из 17-35 соединенных нуклеозидов и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:11.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, могут состоять из 17-35 соединенных нуклеозидов и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:80.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-30 нуклеозидов, обладающий последовательностью нуклеиновых оснований, комплементарной фрагменту равной длины любой из SEQ ID NOs:1-3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-30 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:4-115.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-30 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:11, 17, 31, 80 или 85.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-30 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:11.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-30 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:80.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-25 нуклеозидов, обладающий последовательностью нуклеиновых оснований, комплементарной фрагменту равной длины любой из SEQ ID NOs:1-3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-25 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:4-115.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-25 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:11, 17, 31, 80 или 85.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-25 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:11.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-25 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:80.

В некоторых вариантах воплощения соединения или композиции, описанные здесь, включают модифицированный олигонуклеотид, состоящий из 17-24 нуклеозидов, обладающий последовательностью нуклеиновых оснований, комплементарной фрагменту равной длины любой из SEQ ID NOs:1-3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-24 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:4-115.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-24 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:11, 17, 31, 80 или 85.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-24 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:11.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-24 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:80.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-23 нуклеозидов, обладающий последовательностью нуклеиновых оснований, комплементарной фрагменту равной длины любой из SEQ ID NOs:1-3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-23 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:4-115.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-23 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:11,17, 31, 80 или 85.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-23 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:11.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-23 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:80.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-22 нуклеозидов, обладающий последовательностью нуклеиновых оснований, комплементарной фрагменту равной длины любой из SEQ ID NOs:1-3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-22 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:4-115.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-22 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:11, 17, 31, 80 или 85.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-22 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:11.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-22 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:80.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-21 нуклеозидов, обладающий последовательностью нуклеиновых оснований, комплементарной фрагменту равной длины любой из SEQ ID NOs:1-3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-21 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:4-115.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-21 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:11,17, 31, 80 или 85.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-21 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:11.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17-21 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:80.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 20 нуклеозидов, обладающий последовательностью нуклеиновых оснований, комплементарной фрагменту равной длины любой из SEQ ID NOs:1-3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 20 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:4-115.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 20 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NOs:11,17, 31, 80 или 85.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 20 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:11.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 20 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований SEQ ID NO:80.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17 нуклеозидов, обладающий последовательностью нуклеиновых оснований, комплементарной фрагменту равной длины любой из SEQ ID NOs:1-3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16 или 17 смежных нуклеиновых оснований SEQ ID NOs:4-115.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11,12, 13, 14, 15, 16 или 17 смежных нуклеиновых оснований SEQ ID NOs:11, 17, 31, 80 или 85.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16 или 17 смежных нуклеиновых оснований SEQ ID NO:11.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, и обладают последовательностью нуклеиновых оснований, включающей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16 или 17 смежных нуклеиновых оснований SEQ ID NO:80.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают соль модифицированного олигонуклеотида.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, дополнительно включают фармацевтически приемлемый носитель или разбавитель.

В некоторых вариантах воплощения последовательность нуклеиновых оснований модифицированного олигонуклеотида по меньшей мере на 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 или 100% комплементарна любой из SEQ ID NOs:1-3 согласно измерению на всем протяжении модифицированного олигонуклеотида.

В некоторых вариантах воплощения последовательность нуклеиновых оснований модифицированного олигонуклеотида обладает по меньшей мере 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 или 100% идентичностью с любой из SEQ ID NOs:4-115 согласно измерению на всем протяжении модифицированного олигонуклеотида.

В некоторых вариантах воплощения последовательность нуклеиновых оснований модифицированного олигонуклеотида обладает по меньшей мере 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 или 100% идентичностью с любой из SEQ ID NOs:11, 17, 31, 80 или 85 согласно измерению на всем протяжении модифицированного олигонуклеотида.

В некоторых вариантах воплощения последовательность нуклеиновых оснований модифицированного олигонуклеотида обладает по меньшей мере 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 или 100% идентичностью с SEQ ID NO:11 согласно измерению на всем протяжении модифицированного олигонуклеотида.

В некоторых вариантах воплощения последовательность нуклеиновых оснований модифицированного олигонуклеотида обладает по меньшей мере 70, 75, 80, 85, 90, 95, 96, 97, 98, 99%или 100% идентичностью с SEQ ID NO:80 согласно измерению на всем протяжении модифицированного олигонуклеотида.

В некоторых вариантах воплощения мишенью антисмысловых соединений или модифицированных олигонуклеотидов является область нуклеиновой кислоты GCGR. В некоторых вариантах воплощения такие соединения или олигонуклеотиды, мишенью которых является область нуклеиновой кислоты GCGR, имеют непрерывный фрагмент из нуклеиновых оснований, комплементарный фрагменту из нуклеиновых оснований равной длины указанной области. Например, указанный фрагмент может являться фрагментом из по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований, комплементарным фрагменту равной длины области, указанной здесь. В некоторых вариантах воплощения мишенью таких соединений или олигонуклеотида являются следующие нуклеотидные области SEQ ID NO:2: 6691-6707, 7267-7280, 7267-7283, 7267-7284, 7267-7285, 7267-7286, 7267-7287, 7267-7457, 7268-7284, 7268-7285, 7268-7286, 7268-7287, 7269-7285, 7269-7286, 7269-7287, 727O-7285, 727O-7286, 727O-7287, 7271-7287, 7291-7312, 7292-7308, 7292-7309, 7292-7310, 7292-7311, 7292-7312, 7293-7309, 7293-7310, 7293-7311, 7293-7312, 7294-7310, 7294-7311, 7294-7312, 7295-7310, 7295-7311, 7295-7312, 7296-7312, 7316-7332, 7316-7333, 7316-7334, 7316-7335, 7316-7336, 7317-7333, 7317-7334, 7317-7335, 7317-7336, 7318-7334, 7318-7335, 7318-7336, 7319-7334, 7319-7335, 7319-7336, 732O-7336, 7339-7405, 7339-7406, 7339-7407, 7339-7408, 7339-7409, 7341-7354, 7341-7357, 7341-7358, 7341-7359, 7341-7360, 7341-7361, 7342-7358, 7342-7359, 7342-7360, 7342-7361, 7343-7359, 7343-7360, 7343-7361, 7344-7360, 7344-7361, 7345-7361, 7347-7456, 7365-7381, 7365-7382, 7365-7383, 7365-7384, 7365-7385, 7366-7382, 7366-7383, 7366-7384, 7366-7385, 7367-7383, 7367-7384, 7367-7385, 7368-7383, 7368-7384, 7368-7385, 7369-7385, 7388-7382, 7389-7407, 7389-7408, 7389-7409, 739O-7406, 739O-7407, 739O-7408, 739O-7409, 7391-7407, 7391-7408, 7391-7409, 7392-7407, 7392-7408, 7392-7409, 7393-7409, 7413-7433, 7414-7430, 7414-7431, 7414-7432, 7414-7433, 7415-7431, 7415-7432, 7415-7433, 7416-7432, 7416-7433, 7417-7433, 7437-7453, 7437-7454, 7437-7455, 7437-7456, 7437-7457, 7438-7454, 7438-7455, 7438-7456, 7438-7457, 7439-7455, 7439-7456, 7439-7457, 744O-7455, 744O-7456, 744O-7457, 7441-7457, 774O-7756, 7782-7798, 7782-7801, 7782-7913, 7783-7799, 7785-7801, 7785-7913, 7897-7913, 803O-8049, 8132-8151, 8133-8152, 8133-8155, 8133-8156, 8133-8157, 8133-8159, 8139-8155, 8139-8156, 8139-8157, 8139-8159, 814O-8156, 814O-8157, 814O-8159, 8141-8157, 8141-8159, 8141-8160, 8143-8159, 8144-8160, 8386-8402, 8448-8464, 8454-8473, 9002-9019, 9002-9020, 9002-9021, 9002-9026, 9003-9019, 9003-9020, 9003-9021, 9003-9026, 9004-9020, 9004-9021, 9004-9026, 9008-9027, 901O-9026, 913O-9146, 9245-9264, 9246-9262, 9249-9265, 9592-9611, 9804-9823, 9808-9824, 10667-10683, 10667-10684, 10667-10695, 10668-10684, 10668-10695, 10676-10683, 10676-10684, 10676-10695, 10718-10734, 10772-10788, 11667-11686, 11667-11691, 11667-11695, 11675-11691, 11675-11695, 11676-11695, 11724-11741, 11724-11743, 11725-11741, 11725-11743, 11818-11834, 11819-11835, 11819-11838, 11819-11842, 11826-11842, 11962-11978, 12025-12044, 12025-12046, 12025-12049, 12025-12051, 12025-12052, 12026-12042, 12026-12044, 12026-12046, 12026-12047, 12026-12048, 12026-12049, 12026-12050, 12026-12051, 12026-12055, 12027-12046, 12027-12049, 12027-12051, 12027-12052, 12028-12044, 12028-12046, 12028-12047, 12028-12048, 12028-12049, 12028-12050, 12028-12051, 12028-12055, 12029-12045, 12029-12046, 12029-12047, 12029-12048, 12029-12049, 12029-12050, 12029-12051, 12029-12055, 1203O-12046, 1203O-12047, 1203O-12048, 1203O-12049, 1203O-12050, 1203O-12051, 1203O-12055, 12031-12045, 12031-12048, 12031-12049, 12031-12050, 12031-12051, 12031-12055, 12032-12048, 12032-12049, 12032-12050, 12032-12051, 12032-12052, 12032-12055, 12033-12049, 12033-12050, 12033-12051, 12033-12052, 12033-12055, 12035-12051, 12035-12055, 12036-12055, 12175-12091, 12175-12094, 12178-12194, 13003-13022, 13034-13050, 13303-13022, 13314-13333, 13366-13382, 1349O-13509, 13515-13534, 14138-14157, 14779-14795, 15007-15023, 15075-15094, 15075-15113, 15075-15121, 15075-15127, 15075-15133, 15094-15113, 15094-15121, 15094-15127, 15094-15133, 15102-15121, 15102-15127, 15102-15133, 15108-15127, 15108-15133, 15114-15133, 15374-15390, 15716-15735, 15742-15761, 15742-15762, 15743-15762, 15744-15760, 15744-15762, 15744-15763, 15744-15764, 15744-15765, 15745-15764, 15745-15765, 15746-15760, 15746-15762, 15746-15763, 15746-15764, 15746-15765, 15747-15763, 15747-15764, 15747-15765, 15748-15764, 15748-15765 и 15749-15765.

В некоторых вариантах воплощения мишенью антисмысловых соединений или модифицированных олигонуклеотидов является область нуклеиновой кислоты GCGR. В некоторых вариантах воплощения такие соединения или олигонуклеотиды, мишенью которых является область нуклеиновой кислоты GCGR, имеют непрерывный фрагмент из нуклеиновых оснований, комплементарный фрагменту из нуклеиновых оснований равной длины указанной области. Например, указанный фрагмент может являться фрагментом из по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований, комплементарным фрагменту равной длины области, указанной здесь. В некоторых вариантах воплощения мишенью таких соединений или олигонуклеотида являются следующие нуклеотидные области SEQ ID NO:2: 7267-7287, 727O-7286, 7292-7312, 7295-7311, 7316-7336, 7319-7335, 7341-7361, 7344-7360, 7365-7385, 7368-7384, 7389-7409, 7392-7408, 7416-7432, 7437-7457, 744O-7456, 7783-7799, 8133-8152, 8144-8160, 9804-9823, 10718-10734 и 15743-15762.

В некоторых вариантах воплощения мишенью антисмысловых соединений или модифицированных олигонуклеотидов является область нуклеиновой кислоты GCGR. В некоторых вариантах воплощения такие соединения или олигонуклеотиды, мишенью которых является область нуклеиновой кислоты GCGR, имеют непрерывный фрагмент из нуклеиновых оснований, комплементарный фрагменту из нуклеиновых оснований равной длины указанной области. Например, указанный фрагмент может являться фрагментом из по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеиновых оснований, комплементарным фрагменту равной длины области, указанной здесь. В некоторых вариантах воплощения мишенью таких соединений или олигонуклеотида являются следующие нуклеотидные области SEQ ID NO:2: 727O-7286, 7295-7311, 7319-7335, 7344-7360, 7368-7384, 7392-7408, 7416-7432, 744O-7456 и 10716-10734.

В некоторых вариантах воплощения мишенью следующих антисмысловых соединений является область SEQ ID NO:2, нуклеиновая кислота, кодирующая GCGR человека и демонстрирующая по меньшей мере 70% ингибирование последовательности гена GCGR: ISIS NOs:325568, 310457, 449823, 450035, 449881, 449882, 398457, 449883, 449884, 449885, 450039, 449894, 449895, 450040, 398471, 449905, 449906, 449907, 449908, 449910, 449912, 398486, 449916, 449917, 449922, 450049, 450050, 448762, 448766, 450054, 449759, 449760, 436034, 450059, 448799, 449938, 448802, 398585, 449944, 449945, 448806, 450061, 449948, 449949, 449951, 398504, 449952, 449953, 449954, 448817, 449955, 449956, 449958, 448818, 449960, 448819, 449797, 448840, 449967, 448848, 448850, 449819, 448860, 449836, 450074, 448890, 448897, 448901, 448903, 448905, 449851, 449856, 449858, 449859, 449860, 449861, 315163, 459032, 459046, 459076, 459157, 459010, 459011, 459058, 459088, 459087, 459086, 459083, 459082, 459158, 448754, 448718, 448730, 448738, 436140, 398455, 398470, 398491, 398501, 398503, 398506, 398507, 398508, 304535, 304538, 304539, 436141 и 436164.

В некоторых вариантах воплощения мишенью следующих антисмысловых соединений является область SEQ ID NO:2, нуклеиновая кислота, кодирующая GCGR человека и демонстрирующая по меньшей мере 75% ингибирование последовательности гена GCGR: ISIS NOs:325568, 310457, 449823, 450035, 449881, 449882, 398457, 449883, 449884, 449885, 450039, 449894, 449895, 450040, 398471, 449905, 449906, 449907, 449908, 449910, 449912, 398486, 449916, 449917, 449922, 450049, 450050, 448762, 448766, 450054, 449759, 449760, 450059, 448799, 449938, 448802, 398585, 449944, 449945, 448806, 450061, 449948, 449949, 449951, 398504, 449952, 449953, 449954, 448817, 449955, 449956, 449958, 448818, 449960, 448819, 449797, 448840, 449967, 448848, 448850, 449819, 448860, 449836, 450074, 448890, 448897, 448901, 448903, 448905, 449851, 449856, 449858, 449859, 449860, 449861, 459032, 459076, 459157, 459010, 459011, 459058, 459088, 459087, 459086, 459083, 459082, 459158, 448754, 448718, 448738, 436140, 398455, 398470, 398491, 398501, 398503, 398506, 398507, 398508, 304535, 304538, 304539, 436141 и 436164.

В некоторых вариантах воплощения мишенью следующих антисмысловых соединений является область SEQ ID NO:2, нуклеиновая кислота, кодирующая GCGR человека и демонстрирующая по меньшей мере 80% ингибирование последовательности гена GCGR: ISIS NOs:310457, 449823, 450035, 449881, 449882, 398457, 449883, 449884, 449885, 450039, 449894, 449895, 450040, 398471, 449905, 449906, 449907, 449908, 449910, 449912, 398486, 449916, 449917, 449922, 450049, 450050, 448762, 448766, 450054, 449759, 449760, 450059, 448799, 449938, 448802, 398585, 449944, 449945, 448806, 450061, 449948, 449949, 449951, 398504, 449952, 449953, 449954, 448817, 449955, 449956, 449958, 448818, 449960, 448819, 449797, 448840, 449967, 448848, 448850, 449819, 449836, 450074, 448890, 448897, 448901, 448903, 448905, 449851, 449856, 449858, 449859, 449860, 449861, 459032, 459076, 459157, 459010, 459011, 459088, 459087, 459086, 459083, 459082, 459158, 448718, 436140, 398455, 398470, 398491, 398501, 398503, 398506, 398507, 398508, 304535, 304538, 304539, 436141 и 436164.

В некоторых вариантах воплощения мишенью следующих антисмысловых соединений является область SEQ ID NO:2, нуклеиновая кислота, кодирующая GCGR человека и демонстрирующая по меньшей мере 85% ингибирование последовательности гена GCGR: ISIS NOs:310457, 449823, 449881, 449882, 398457, 449883, 449884, 449885, 450039, 449894, 449895, 449905, 449906, 449907, 449910, 398486, 449916, 449917, 449922, 450049, 448766, 449760, 450059, 449938, 448802, 398585, 449945, 448806, 450061, 449948, 449949, 449951, 398504, 449952, 449953, 449954, 448817, 449955, 449956, 449958, 449960, 448819, 449967, 448848, 449836, 450074, 448890, 448903, 449851, 449856, 449858, 449859, 449860, 459157, 459010, 459011, 459088, 459087, 459086, 459083, 459082, 459158, 436140, 398455, 398470, 398503, 398506, 398507, 398508, 304535, 304538, 304539, 436141 и 436164.

В некоторых вариантах воплощения мишенью следующих антисмысловых соединений является область SEQ ID NO:2, нуклеиновая кислота, кодирующая GCGR человека и демонстрирующая по меньшей мере 90% ингибирование последовательности гена GCGR: ISIS NOs:449823, 398457, 449883, 449884, 449885, 449894, 449895, 449906, 398486, 449917, 449938, 449945, 448806, 450061, 449951, 398504, 449952, 449953, 449954, 448817, 449955, 449958, 449960, 448819, 448848, 450074, 449859, 459157, 459010, 459087, 459086, 459083, 459082, 459158, 436140, 398503, 398507, 304535, 304538, 304539, 436141 и 436164.

В некоторых вариантах воплощения мишенью следующих антисмысловых соединений является область SEQ ID NO:2, нуклеиновая кислота, кодирующая GCGR человека и демонстрирующая по меньшей мере 90% ингибирование последовательности гена GCGR: ISIS NOs:398457, 449883, 398486, 448806, 448817, 448819, 459010, 459087, 459086,398507, 304535 и 304538.

В некоторых вариантах воплощения мишенью следующих антисмысловых соединений является область SEQ ID NO:2, нуклеиновая кислота, кодирующая GCGR человека и демонстрирующая значение IC50 менее 3 мкМ: ISIS NOs:304535, 304538, 304539, 398455, 398457, 398470, 398471, 398486, 398491, 398501, 398503, 398504, 398506, 398507, 398508, 398585, 436034, 436140, 436141, 436164, 448718, 448730, 448738, 448754, 448762, 448766, 448799, 448802, 448806, 448817, 448818, 448819, 448840, 448848, 448850, 448860, 448890, 448897, 448901, 448903, 448905, 449884, 459009, 459010, 459011, 459014, 459024, 459032, 459040, 459046, 459058, 459063, 459076, 459082, 459083, 459086, 459087, 459088, 459157 и 459158.

В некоторых вариантах воплощения мишенью следующих антисмысловых соединений является область SEQ ID NO:2, нуклеиновая кислота, кодирующая GCGR человека и демонстрирующая значение IC50 менее 1 мкМ: ISIS NOs:304535, 304538, 304539, 398455, 398457, 398470, 398471, 398486, 398491, 398501, 398503, 398504, 398506, 398507, 398508, 398585, 436034, 436140, 436141, 436164, 448718, 448730, 448738, 448754, 448762, 448766, 448799, 448802, 448806, 448817, 448818, 448819, 448840, 448848, 448850, 448860, 448890, 448897, 448901, 448903, 448905, 449884, 459009, 459010, 459011, 459024, 459032, 459040, 459046, 459058, 459063, 459076, 459082, 459083, 459086, 459087, 459088, 459157 и 459158.

В некоторых вариантах воплощения мишенью следующих антисмысловых соединений является область SEQ ID NO:2, нуклеиновая кислота, кодирующая GCGR человека и демонстрирующая значение IC50 менее 0,5 мкМ: ISIS NOs:304535, 304538, 304539, 398455, 398457, 398470, 398471, 398486, 398491, 398501, 398503, 398504, 398506, 398507, 398508, 398585, 436034, 436140, 436141, 436164, 448718, 448730, 448738, 448754, 448762, 448799, 448802, 448806, 448817, 448818, 448819, 448840, 448848, 448850, 448860, 448890, 448897, 448901, 448903, 448905, 449884, 459009, 459010, 459011, 459024, 459040, 459046, 459058, 459063, 459076, 459082, 459083, 459086, 459087, 459088, 459157 и 459158.

В некоторых вариантах воплощения мишенью следующих антисмысловых соединений является область SEQ ID NO:2, нуклеиновая кислота, кодирующая GCGR человека и демонстрирующая значение IC50 менее 0,3 мкМ: ISIS NOs:304535, 304538, 398455, 398457, 398470, 398471, 398486, 398504, 398506, 398507, 436164, 448718,448730, 448762, 446766, 448799, 448802, 448806, 448817, 448819, 448848, 448850, 448860, 448890, 448897, 448905, 449884, 459010, 459011, 459040, 459046, 459076, 459082, 459083, 459086, 459087, 459088, 459157 и 459158.

В некоторых вариантах воплощения мишенью следующих антисмысловых соединений является область SEQ ID NO:2, нуклеиновая кислота, кодирующая GCGR человека и демонстрирующая значение IC50 менее 0,2 мкМ: ISIS NOs:304538, 398457, 398486, 398504, 398506, 398507, 448730, 448802, 448819, 448848, 448850, 448890, 449884, 459010, 459011, 459040, 459076, 459082, 459083, 459157 и 459158.

В некоторых вариантах воплощения мишенью следующих антисмысловых соединений является область SEQ ID NO:2, нуклеиновая кислота, кодирующая GCGR человека и демонстрирующая значение IC50 менее 0,1 мкМ: ISIS NOs:398457, 398507, 448819, 448848, 448850, 459010, 459011, 459083, 459157 и 459158.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, причем указанные соединенные нуклеозиды включают по меньшей мере фрагмент из 8 смежных нуклеиновых оснований, комплементарный фрагменту из нуклеиновых оснований равной длины, расположенному в пределах области, выбранной из нуклеотидов 727O-7286, 7295-7311, 7319-7335, 7344-7360, 7368-7384, 7392-7408, 7416-7432, 744O-7456 или 10716-10734 SEQ ID NO:2.

В некоторых вариантах воплощения указанный модифицированный олигонуклеотид имеет фрагмент из по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15 или по меньшей мере 16 смежных нуклеиновых оснований, комплементарный фрагменту равной длины, расположенному в пределах области, выбранной из нуклеотидов 727O-7286, 7295-7311, 7319-7335, 7344-7360, 7368-7384, 7392-7408, 7416-7432, 744O-7456 или 10716-10734 SEQ ID NO:2. В некоторых вариантах воплощения указанный модифицированный олигонуклеотид на 90, 95, 99 или 100% комплементарен нуклеиновой кислоте, кодирующей GCGR человека, например, SEQ ID No:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из по меньшей мере 17 соединенных нуклеозидов, на 60% комплементарный области, выбранной из нуклеотидов 7267-7287, 727O-7286, 7292-7312, 7295-7311, 7316-7336, 7319-7335, 7341-7361, 7344-7360, 7365-7385, 7368-7384, 7389-7409, 7392-7408, 7416-7432, 7437-7457, 744O-7456, 7783-7799, 8133-8152, 8144-8160, 9804-9823, 10718-10734 или 15743-15762 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из по меньшей мере 17 соединенных нуклеозидов, на 70% комплементарный области, выбранной из нуклеотидов 7267-7287, 727O-7286, 7292-7312, 7295-7311, 7316-7336, 7319-7335, 7341-7361, 7344-7360, 7365-7385, 7368-7384, 7389-7409, 7392-7408, 7416-7432, 7437-7457, 744O-7456, 7783-7799, 8133-8152, 8144-8160, 9804-9823, 10718-10734 или 15743-15762 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из по меньшей мере 17 соединенных нуклеозидов, на 80% комплементарный области, выбранной из 7267-7287, 727O-7286, 7292-7312, 7295-7311, 7316-7336, 7319-7335, 7341-7361, 7344-7360, 7365-7385, 7368-7384, 7389-7409, 7392-7408, 7416-7432, 7437-7457, 744O-7456, 7783-7799, 8133-8152, 8144-8160, 9804-9823, 10718-10734 или 15743-15762 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из по меньшей мере 17 соединенных нуклеозидов, на 90% комплементарный области, выбранной из нуклеотидов 7267-7287, 727O-7286, 7292-7312, 7295-7311, 7316-7336, 7319-7335, 7341-7361, 7344-7360, 7365-7385, 7368-7384, 7389-7409, 7392-7408, 7416-7432, 7437-7457, 744O-7456, 7783-7799, 8133-8152, 8144-8160, 9804-9823, 10718-10734 или 15743-15762 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из по меньшей мере 17 соединенных нуклеозидов, на 95% комплементарный области, выбранной из нуклеотидов 7267-7287, 727O-7286, 7292-7312, 7295-7311, 7316-7336, 7319-7335, 7341-7361, 7344-7360, 7365-7385, 7368-7384, 7389-7409, 7392-7408, 7416-7432, 7437-7457, 744O-7456, 7783-7799, 8133-8152, 8144-8160, 9804-9823, 10718-10734 или 15743-15762 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из по меньшей мере 17 соединенных нуклеозидов, на 99% комплементарный области, выбранной из нуклеотидов 7267-7287, 727O-7286, 7292-7312, 7295-7311, 7316-7336, 7319-7335, 7341-7361, 7344-7360, 7365-7385, 7368-7384, 7389-7409, 7392-7408, 7416-7432, 7437-7457, 744O-7456, 7783-7799, 8133-8152, 8144-8160, 9804-9823, 10718-10734 или 15743-15762 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из по меньшей мере 17 соединенных нуклеозидов, на 100% комплементарный области, выбранной из нуклеотидов 7267-7287, 727O-7286, 7292-7312, 7295-7311, 7316-7336, 7319-7335, 7341-7361, 7344-7360, 7365-7385, 7368-7384, 7389-7409, 7392-7408, 7416-7432, 7437-7457, 744O-7456, 7783-7799, 8133-8152, 8144-8160, 9804-9823, 10718-10734 или 15743-15762 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 60% комплементарный нуклеотидам 727O-7286, 7295-7311, 7319-7335, 7344-7360, 7368-7384, 7392-7408, 7416-7432 и 744O-7456 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 70% комплементарный нуклеотидам 727O-7286, 7295-7311, 7319-7335, 7344-7360, 7368-7384, 7392-7408, 7416-7432 и 744O-7456 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 80% комплементарный нуклеотидам 727O-7286, 7295-7311, 7319-7335, 7344-7360, 7368-7384, 7392-7408, 7416-7432 и 744O-7456 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 90% комплементарный нуклеотидам 727O-7286, 7295-7311, 7319-7335, 7344-7360, 7368-7384, 7392-7408, 7416-7432 и 744O-7456 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 95% комплементарный нуклеотидам 727O-7286, 7295-7311, 7319-7335, 7344-7360, 7368-7384, 7392-7408, 7416-7432 и 744O-7456 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 99% комплементарный нуклеотидам 727O-7286, 7295-7311, 7319-7335, 7344-7360, 7368-7384, 7392-7408, 7416-7432 и 744O-7456 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 100% комплементарный нуклеотидам 727O-7286, 7295-7311, 7319-7335, 7344-7360, 7368-7384, 7392-7408, 7416-7432 и 744O-7456 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 60% комплементарный нуклеотидам 10718-10734 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 70% комплементарный нуклеотидам 10718-10734 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 80% комплементарный нуклеотидам 10718-10734 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 90% комплементарный нуклеотидам 10718-10734 SEQ IDNO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 95% комплементарный нуклеотидам 10718-10734 SEQ ID NO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 99% комплементарный нуклеотидам 10718-10734 SEQ IDNO:2.

Некоторые варианты воплощения обеспечивают соединения, включающие модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, на 100% комплементарный нуклеотидам 10718-10734 SEQ ID NO:2.

В некоторых вариантах воплощения такие соединения или олигонуклеотиды, мишенью которых является область нуклеиновой кислоты GCGR, имеют фрагмент из смежных нуклеиновых оснований, комплементарный фрагменту из нуклеиновых оснований равной длины, расположенному в пределах области 727O-7286, 7295-7311, 7319-7335, 7344-7360, 7368-7384, 7392-7408, 7416-7432, 744O-7456 или 10718-10734 SEQ ID NO:2.

В некоторых вариантах воплощения следующие нуклеотидные области SEQ ID NO:2 при адресном воздействии антисмысловых соединений или олигонуклеотидов проявляют по меньшей мере 65% ингибирование: 7267-7287, 727O-7286, 7292-7312, 7295-7311, 7316-7336, 7319-7335, 7341-7361, 7344-7360, 7365-7385, 7368-7384, 7389-7409, 7392-7408, 7416-7432, 7437-7457, 744O-7456, 7783-7799, 8133-8152, 8144-8160, 9804-9823, 10718-10734 или 15743-15762.

В некоторых вариантах воплощения последовательности нуклеиновых оснований, перечисленные в следующих SEQ ID NOs, проявляют по меньшей мере 70% ингибирование нуклеиновой кислоты GCGR: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,30, 31, 32, 33, 34,35, 36,37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 81, 83, 84, 85, 86, 87, 88, 90, 91, 92, 93, 95, 96, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114 и 115.

В некоторых вариантах воплощения последовательности нуклеиновых оснований, перечисленные в следующих SEQ ID NOs, проявляют по меньшей мере 75% ингибирование нуклеиновой кислоты GCGR: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 81, 84, 85, 86, 87, 88, 90, 91, 92, 93, 95, 96, 98, 99, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114 и 115.

В некоторых вариантах воплощения последовательности нуклеиновых оснований, перечисленные в следующих SEQ ID NOs, проявляют по меньшей мере 80% ингибирование нуклеиновой кислоты GCGR: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 81, 84, 85, 86, 87, 90,91, 92,93, 95, 96, 99, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,115.

В некоторых вариантах воплощения последовательности нуклеиновых оснований, перечисленные в следующих SEQ ID NOs, проявляют по меньшей мере 85% ингибирование нуклеиновой кислоты GCGR: 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 18, 19, 20, 22, 24, 25, 26, 27, 28, 31, 34, 36, 38, 39, 40, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 57, 58, 61, 62, 66, 67, 68, 71, 73, 74, 75, 76, 77, 85, 86, 87, 90, 91, 92, 93, 95, 96, 102, 103, 104, 107, 108, 109, 110, 111, 112, 113, 114, 115.

В некоторых вариантах воплощения последовательности нуклеиновых оснований, перечисленные в следующих SEQ ID NOs, проявляют по меньшей мере 90% ингибирование нуклеиновой кислоты GCGR: 5, 9, 10, 11, 12, 14, 15, 19, 24, 26, 38, 42, 43, 44, 47, 48, 49, 50, 51, 52, 53, 55, 57, 58, 62, 67, 76, 85, 86, 91, 92, 93, 95, 96, 102, 107, 109, 111, 112, 113, 114 и 115.

В некоторых вариантах воплощения последовательности нуклеиновых оснований, перечисленные в следующих SEQ ID NOs, проявляют по меньшей мере 95% ингибирование нуклеиновой кислоты GCGR: 9, 10, 24, 43, 52, 58, 86, 91, 92, 109, 111 и 112.

В некоторых вариантах воплощения соединения, представленные здесь, обладают большим терапевтическим потенциалом, чем ISIS NOs:315163, 325568 и 310457 (описанные в патенте США №7399853 и опубликованной патентной заявке США №US2007-0087987, включенных в настоящий документ посредством ссылки). В некоторых вариантах воплощения соединения, представленные здесь, обладают лучшим ингибированием in vivo, чем ISIS NOs:315163, 325568 и 310457. В некоторых вариантах воплощения соединения, представленные здесь, обладают лучшим профилем переносимости, чем ISIS NOs:315163, 325568 и 310457.

В некоторых вариантах воплощения соединение, представленное здесь, состоит из одноцепочечного модифицированного олигонуклеотида.

В некоторых вариантах воплощения указанный модифицированный олигонуклеотид состоит из 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 или 35 соединенных нуклеозидов. В некоторых вариантах воплощения указанный модифицированный олигонуклеотид состоит из 21 соединенного нуклеозида. В некоторых вариантах воплощения указанный модифицированный олигонуклеотид состоит из 20 соединенных нуклеозидов. В некоторых вариантах воплощения указанный модифицированный олигонуклеотид состоит из 19 соединенных нуклеозидов. В некоторых вариантах воплощения указанный модифицированный олигонуклеотид состоит из 18 соединенных нуклеозидов. В некоторых вариантах воплощения указанный модифицированный олигонуклеотид состоит из 17 соединенных нуклеозидов. В некоторых вариантах воплощения указанный модифицированный олигонуклеотид состоит из 16 соединенных нуклеозидов.

В некоторых вариантах воплощения по меньшей мере одна межнуклеозидная связь модифицированного олигонуклеотида является модифицированной межнуклеозидной связью. В некоторых вариантах воплощения каждая межнуклеозидная связь является фосфоротиоатной межнуклеозидной связью.

В некоторых вариантах воплощения по меньшей мере один нуклеозид указанного модифицированного олигонуклеотида включает модифицированное нуклеиновое основание. В некоторых вариантах воплощения указанное модифицированное нуклеиновое основание является 5-метилцитозином.

В некоторых вариантах воплощения модифицированный олигонуклеотид включает:

а) сегмент разрыва, состоящий из соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, и каждый нуклеозид каждого сегмента крыла включает модифицированную сахарозу.

В некоторых вариантах воплощения модифицированный олигонуклеотид состоит из 20 соединенных нуклеозидов, сегмент разрыва состоит из десяти соединенных дезоксинуклеозидов, сегмент 5′-крыла состоит из пяти соединенных нуклеозидов, сегмент 3′-крыла состоит из пяти соединенных нуклеозидов, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый цитозин является 5-метилцитозином.

В некоторых вариантах воплощения модифицированный олигонуклеотид состоит из 17 соединенных нуклеозидов, сегмент разрыва состоит из десяти соединенных дезоксинуклеозидов, сегмент 5′-крыла состоит из трех соединенных нуклеозидов, сегмент 3′-крыла состоит из четырех соединенных нуклеозидов, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый цитозин является 5-метилцитозином.

В некоторых вариантах воплощения модифицированный олигонуклеотид состоит из 21 соединенных нуклеозидов, сегмент разрыва состоит из десяти соединенных дезоксинуклеозидов, сегмент 5′-крыла состоит из пяти соединенных нуклеозидов, сегмент 3′-крыла состоит из шести соединенных нуклеозидов, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый цитозин является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 20 соединенных нуклеозидов, обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 8 смежных нуклеиновых оснований, комплементарных фрагменту равной длины любой из SEQ ID NOs:1-3, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из пяти соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из пяти соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 20 соединенных нуклеозидов, обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 8 смежных нуклеиновых оснований, комплементарных фрагменту равной длины любой из SEQ ID NO:2, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из пяти соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из пяти соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 20 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 19 смежных нуклеиновых оснований SEQ ID NOs:4, 17, 24, 30, 31, 35, 37, 39, 40, 43, 48, 52, 56, 58, 60, 62, 63, 65, 68, 69, 70, 71, 72, 79, 79, 79, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114 и 115, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из пяти соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из пяти соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 20 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 19 смежных нуклеиновых оснований SEQ ID NOs:17 или 31, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из пяти соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из пяти соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 16 смежных нуклеиновых оснований SEQ ID NO:17, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из четырех соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из четырех соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 16 смежных нуклеиновых оснований SEQ ID NO:31, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из трех соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из четырех соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 8 смежных нуклеиновых оснований, комплементарных фрагменту равной длины любой из SEQ ID NOs:1-3, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из трех соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из четырех соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 8 смежных нуклеиновых оснований, комплементарных фрагменту равной длины любой из SEQ ID NO:2, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из трех соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из четырех соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 16 смежных нуклеиновых оснований SEQ ID NOs:5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 25, 26, 27, 28, 29, 32, 33, 34, 36, 38, 41, 42, 44, 45, 46, 47, 49, 50, 51, 53, 54, 55, 57, 59, 61, 64, 66, 67, 73, 74, 75, 76, 77, 78, 80, 81, 82, 83, 84, 88, 89 и 97, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из трех соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из четырех соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 16 смежных нуклеиновых оснований SEQ ID NOs:11 или 80, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из трех соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из четырех соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 16 смежных нуклеиновых оснований SEQ ID NO:11, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из четырех соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из четырех соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 16 смежных нуклеиновых оснований SEQ ID NO:80, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из трех соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из четырех соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 21 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 20 смежных нуклеиновых оснований SEQ ID NOs:85 и 96, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из пяти соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из шести соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают модифицированный олигонуклеотид, состоящий из 21 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 20 смежных нуклеиновых оснований SEQ ID NO:85, причем указанный модифицированный олигонуклеотид включает: а) сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов; б) сегмент 5′-крыла, состоящий из пяти соединенных нуклеозидов; и в) сегмент 3′-крыла, состоящий из шести соединенных нуклеозидов. Сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь является фосфоротиоатной связью, а каждый остаток цитозина является 5-метилцитозином.

Некоторые варианты воплощения обеспечивают способы, соединения и композиции для ингибирования экспрессии GCGR.

Некоторые варианты воплощения обеспечивают способ снижения экспрессии GCGR у животного, включающий введение указанному животному соединения, как описано здесь. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 12 до 30 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 15 до 30 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 18 до 21 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 17 до 35 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 17 до 25 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 17 до 24 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 17 до 23 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 17 до 22 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 17 до 21 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной 17 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной 20 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной 21 соединенных нуклеозидов, мишенью которого является GCGR.

Некоторые варианты воплощения обеспечивают способ профилактики, облегчения или лечения метаболического заболевания у животного, включающий введение указанному животному соединения, как описано здесь. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 12 до 30 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной 17 соединенных нуклеозидов, мишенью которого является GCGR. Примеры метаболических заболеваний или расстройств включают диабет, гипергликемию, преддиабет, ожирение, неалкогольную жировую дистрофию печени (НАЖДП), метаболический синдром, инсулинорезистентность, диабетическую дислипидемию или гипертриглицеридемию, или их комбинацию, но не ограничиваются ими.

Некоторые варианты воплощения обеспечивают способ профилактики, облегчения или лечения ожирения у животного, включающий введение указанному животному соединения, как описано здесь. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 12 до 30 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной 17 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной

20 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной

21 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение или композиция включает соединение ISIS NOs:449884, 459014, 398471, 448766 или 459157. В некоторых вариантах воплощения указанное соединение или композиция включает соединение ISIS NO:449884. В некоторых вариантах воплощения указанное соединение или композиция включает соединение ISIS NO:459014.

Некоторые варианты воплощения обеспечивают способ профилактики, облегчения или лечения диабета у животного, включающий введение указанному животному соединения, как описано здесь. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 12 до 30 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной 17 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной 20 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной 21 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение или композиция включает соединение ISIS NOs:449884, 459014, 398471, 448766 или 459157. В некоторых вариантах воплощения указанное соединение или композиция включает соединение ISIS NO:449884. В некоторых вариантах воплощения указанное соединение или композиция включает соединение ISIS NO:459014.

Некоторые варианты воплощения обеспечивают способ снижения массы тела у животного, включающий введение указанному животному соединения, как описано здесь. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 12 до 30 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной 17 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения снижение массы тела у животного предотвращает, облегчает или лечит метаболическое заболевание. В некоторых вариантах воплощения снижение массы тела у животного предотвращает, облегчает или лечит диабет. В некоторых вариантах воплощения снижение массы тела у животного предотвращает, облегчает или лечит ожирение. В некоторых вариантах воплощения снижение массы тела у животного предотвращает, облегчает или лечит метаболический синдром. В некоторых вариантах воплощения снижение массы тела у животного предотвращает, облегчает или лечит инсулинорезистентность. В некоторых вариантах воплощения снижение массы тела у животного предотвращает, облегчает или лечит гипергликемию. В некоторых вариантах воплощения снижение массы тела у животного предотвращает, облегчает или лечит НАЖДП. В некоторых вариантах воплощения снижение массы тела у животного предотвращает, облегчает или лечит диабетическую дислипидемию. В некоторых вариантах воплощения уровни глюкозы снижаются по меньшей мере на 5, 10, 20, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 или 100%.

Некоторые варианты воплощения обеспечивают способ снижения уровня глюкозы у животного, включающий введение указанному животному соединения, как описано здесь. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной от 12 до 30 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения указанное соединение включает модифицированный олигонуклеотид длиной 17 соединенных нуклеозидов, мишенью которого является GCGR. В некоторых вариантах воплощения снижение уровня глюкозы у животного предотвращает, облегчает или лечит метаболическое заболевание. В некоторых вариантах воплощения снижение уровня глюкозы у животного предотвращает, облегчает или лечит диабет. В некоторых вариантах воплощения снижение уровня глюкозы у животного предотвращает, облегчает или лечит ожирение. В некоторых вариантах воплощения снижение уровня глюкозы у животного предотвращает, облегчает или лечит метаболический синдром. В некоторых вариантах воплощения снижение уровня глюкозы у животного предотвращает, облегчает или лечит инсулинорезистентность. В некоторых вариантах воплощения снижение уровня глюкозы у животного предотвращает, облегчает или лечит гипергликемию. В некоторых вариантах воплощения снижение уровня глюкозы у животного предотвращает, облегчает или лечит НАЖДП. В некоторых вариантах воплощения снижение уровня глюкозы у животного предотвращает, облегчает или лечит диабетическую дислипидемию. В некоторых вариантах воплощения уровень глюкозы снижается по меньшей мере на 5, 10, 20, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 или 100%.

В некоторых вариантах воплощения GCGR обладает последовательностью человека, представленной в любой из последовательностей с учетными номерами GENBANK: учетным номером GENBANK NM_000160.3 (включенной в настоящий документ как SEQ ID NO:1) или учетным номером GENBANK NW_926918.1, обрезанной от нуклеотида 16865000 до 16885000 (включенной в настоящий документ как SEQ ID NO:2). В некоторых вариантах воплощения GCGR обладает последовательностью макака-резуса, представленной в SEQ ID NO:3.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают соль вышеприведенных соединений и фармацевтически приемлемый носитель или разбавитель. В некоторых вариантах воплощения указанная композиция включает модифицированный олигонуклеотид, состоящий из 17-35 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 17 смежных нуклеиновых оснований последовательности нуклеиновых оснований, приведенной в SEQ ID NOs:11, 17, 31, 80 или 85, или его соль и фармацевтически приемлемый носитель или разбавитель. В некоторых вариантах воплощения указанная композиция включает модифицированный олигонуклеотид, состоящий из 2O-25 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 20 смежных нуклеиновых оснований последовательности нуклеиновых оснований, приведенной в SEQ ID NOs:11, 17, 31, 80 или 85, или его соль и фармацевтически приемлемый носитель или разбавитель. В некоторых вариантах воплощения указанная композиция включает модифицированный олигонуклеотид, состоящий из 20 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 20 смежных нуклеиновых оснований последовательности нуклеиновых оснований, приведенной в SEQ ID NOs:11, 17, 31, 80 или 85, или его соль и фармацевтически приемлемый носитель или разбавитель.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают соль вышеприведенных соединений и фармацевтически приемлемый носитель или разбавитель. В некоторых вариантах воплощения указанная композиция включает модифицированный олигонуклеотид, состоящий из 17-35 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 17 смежных нуклеиновых оснований последовательности нуклеиновых оснований, приведенной в SEQ ID NO:11, или его соль и фармацевтически приемлемый носитель или разбавитель. В некоторых вариантах воплощения указанная композиция включает модифицированный олигонуклеотид, состоящий из 17-25 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 17 смежных нуклеиновых оснований последовательности нуклеиновых оснований, приведенной в SEQ ID NO:16, или его соль и фармацевтически приемлемый носитель или разбавитель. В некоторых вариантах воплощения указанная композиция включает модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 17 смежных нуклеиновых оснований последовательности нуклеиновых оснований, приведенной в SEQ ID NO:16, или его соль и фармацевтически приемлемый носитель или разбавитель.

В некоторых вариантах воплощения соединения или композиции, представленные здесь, включают соль вышеприведенных соединений и фармацевтически приемлемый носитель или разбавитель. В некоторых вариантах воплощения указанная композиция включает модифицированный олигонуклеотид, состоящий из 17-35 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 17 смежных нуклеиновых оснований последовательности нуклеиновых оснований, приведенной в SEQ ID NO:80, или его соль и фармацевтически приемлемый носитель или разбавитель. В некоторых вариантах воплощения указанная композиция включает модифицированный олигонуклеотид, состоящий из 17-25 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 17 смежных нуклеиновых оснований последовательности нуклеиновых оснований, приведенной в SEQ ID NO:45, или его соль и фармацевтически приемлемый носитель или разбавитель. В некоторых вариантах воплощения указанная композиция включает модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей по меньшей мере 17 смежных нуклеиновых оснований последовательности нуклеиновых оснований, приведенной в SEQ ID NO:45, или его соль и фармацевтически приемлемый носитель или разбавитель.

Некоторые варианты воплощения обеспечивают способ лечения животных с заболеванием или состоянием, связанным с GCGR, включающий: а) выявление указанного животного с заболеванием или состоянием, связанным с GCGR, и б) введение указанному животному терапевтически эффективного количества соединения, включающего модифицированный олигонуклеотид, состоящий из 12-30 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, по меньшей мере на 90% комплементарной любой из SEQ ID NOs:1-3, согласно измерению на всем протяжении указанного модифицированного олигонуклеотида. В некоторых вариантах воплощения терапевтически эффективное количество соединения, введенное животному, лечит или ослабляет заболевание или состояние, связанное с GCGR, или его симптом у животного. В некоторых вариантах воплощения заболевание или состояние, связанное с GCGR, является ожирением. В некоторых вариантах воплощения заболевание или состояние, связанное с GCGR, является диабетом.

Некоторые варианты воплощения обеспечивают способ лечения животных с заболеванием или состоянием, связанным с GCGR, включающий: а) выявление указанного животного с заболеванием или состоянием, связанным с GCGR, и б) введение указанному животному терапевтически эффективного количества соединения, включающего модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, по меньшей мере на 100% комплементарной любой из SEQ ID NOs:1-3, согласно измерению на всем протяжении указанного модифицированного олигонуклеотида. В некоторых вариантах воплощения терапевтически эффективное количество соединения, введенное животному, лечит или ослабляет заболевание или состояние, связанное с GCGR, или его симптом у животного. В некоторых вариантах воплощения заболевание или состояние, связанное с GCGR, является ожирением. В некоторых вариантах воплощения заболевание или состояние, связанное с GCGR, является диабетом.

Некоторые варианты воплощения обеспечивают способы лечения, профилактики или облегчения метаболического заболевания. В некоторых вариантах воплощения указанное метаболическое заболевание является ожирением, диабетом, гипергликемией, преддиабетом, неалкогольной жировой дистрофией печени (НАЖДП), метаболическим синдромом, инсулинорезистентностью, диабетической дислипидемией или гипертриглицеридемией, или их комбинацией.

Некоторые варианты воплощения обеспечивают способы, включающие введение соединения, как описано здесь, в организм животного. В некоторых вариантах воплощения указанный способ включает введение в организм животного модифицированного олигонуклеотида, состоящего из 17-35 соединенных нуклеозидов и обладающего последовательностью нуклеиновых оснований, включающей по меньшей мере 20 смежных нуклеиновых оснований последовательности нуклеиновых оснований, приведенной в SEQ ID NOs:11, 17, 31, 80 или 85.

Некоторые варианты воплощения обеспечивают способы, включающие введение соединения, как описано здесь, в организм животного. В некоторых вариантах воплощения указанный способ включает введение в организм животного модифицированного олигонуклеотида, состоящего из 17-35 соединенных нуклеозидов и обладающего последовательностью нуклеиновых оснований, включающей по меньшей мере 17 смежных нуклеиновых оснований последовательности нуклеиновых оснований, приведенной в SEQ ID NO:1, 17, 31, 80 или 85.

Некоторые варианты воплощения обеспечивают способы, включающие введение соединения, как описано здесь, в организм животного. В некоторых вариантах воплощения указанный способ включает введение в организм животного модифицированного олигонуклеотида, состоящего из 17-35 соединенных нуклеозидов и обладающего последовательностью нуклеиновых оснований, включающей по меньшей мере 17 смежных нуклеиновых оснований последовательности нуклеиновых оснований, выбранной из последовательностей нуклеиновых оснований, приведенных в SEQ ID NO:11.

Некоторые варианты воплощения обеспечивают способы, включающие введение соединения, как описано здесь, в организм животного. В некоторых вариантах воплощения указанный способ включает введение в организм животного модифицированного олигонуклеотида, состоящего из 17-35 соединенных нуклеозидов и обладающего последовательностью нуклеиновых оснований, включающей по меньшей мере 17 смежных нуклеиновых оснований последовательности нуклеиновых оснований, выбранной из последовательностей нуклеиновых оснований, приведенных в SEQ ID NO:80.

В некоторых вариантах воплощения указанное животное является человеком.

В некоторых вариантах воплощения указанное введение предотвращает, лечит, облегчает или замедляет прогрессирование метаболического заболевания, как описано здесь.

В некоторых вариантах воплощения указанное введение предотвращает, лечит, облегчает или замедляет прогрессирование ожирения, как описано здесь.

В некоторых вариантах воплощения указанное введение предотвращает, лечит, облегчает или замедляет прогрессирование диабета, как описано здесь.

В некоторых вариантах воплощения указанное соединение вводят совместно со вторым агентом.

В некоторых вариантах воплощения указанное соединение и указанный второй агент вводят сопутствующим образом.

В некоторых вариантах воплощения указанное введение является парентеральным введением.

Некоторые варианты воплощения дополнительно обеспечивают способ снижения экспрессии мРНК или белка GCGR у животного, включающий введение указанному животному соединения или композиции, как описано здесь, с целью снижения экспрессии мРНК или белка GCGR у указанного животного. В некоторых вариантах воплощения указанное животное является человеком. В некоторых вариантах воплощения снижение экспрессии мРНК или белка GCGR предотвращает, лечит, облегчает или замедляет прогрессирование метаболического заболевания. В некоторых вариантах воплощения метаболическое заболевание или состояние является диабетом. В некоторых вариантах воплощения метаболическое заболевание или состояние является ожирением.

Некоторые варианты воплощения обеспечивают способ лечения человека с метаболическим заболеванием, включающий выявление человека с указанным заболеванием и введение указанному человеку терапевтически эффективного количества соединения или композиции, как описано здесь. В некоторых вариантах воплощения указанное лечение ослабляет симптом, выбранный из группы, состоящей из метаболического синдрома, гипергликемии, гипертриглицеридемии, гипертензии, повышения уровня глюкозы, повышения инсулинорезистентности, снижения чувствительности к инсулину, чрезмерной массы тела и/или чрезмерного количества жира, или любой их комбинации.

Некоторые варианты воплощения обеспечивают способ лечения человека с ожирением, включающий выявление человека с указанным заболеванием и введение указанному человеку терапевтически эффективного количества соединения или композиции, как описано здесь. В некоторых вариантах воплощения указанное лечение ослабляет симптом, выбранный из группы, состоящей из метаболического синдрома, гипергликемии, гипертриглицеридемии, гипертензии, повышения уровня глюкозы, повышения инсулинорезистентности, снижения чувствительности к инсулину, чрезмерной массы тела и/или чрезмерного количества жира, или любой их комбинации

Некоторые варианты воплощения обеспечивают способ лечения человека с диабетом, включающий выявление человека с указанным заболеванием и введение указанному человеку терапевтически эффективного количества соединения или композиции, как описано здесь. В некоторых вариантах воплощения указанное лечение ослабляет симптом, выбранный из группы, состоящей из метаболического синдрома, гипергликемии, гипертриглицеридемии, гипертензии, повышения уровня глюкозы, повышения инсулинорезистентности, снижения чувствительности к инсулину, чрезмерной массы тела и/или чрезмерного количества жира, или любой их комбинации

Кроме того, настоящее изобретение обеспечивает способ ослабления или профилактики метаболического заболевания, включающий введение в организм человека терапевтически эффективного количества соединения или композиции, как описано здесь, тем самым ослабляя или предотвращая метаболическое заболевание.

Кроме того, настоящее изобретение обеспечивает способ ослабления или профилактики ожирения, включающий введение в организм человека терапевтически эффективного количества соединения или композиции, как описано здесь, тем самым ослабляя или предотвращая диабет.

Кроме того, настоящее изобретение обеспечивает способ ослабления или профилактики диабета, включающий введение в организм человека терапевтически эффективного количества соединения или композиции, как описано здесь, тем самым ослабляя или предотвращая диабет.

Кроме того, настоящее изобретение обеспечивает способ облегчения симптома метаболического заболевания, включающий введение в организм человека, нуждающегося в этом, соединения, включающего модифицированный олигонуклеотид, состоящий из 17-35 соединенных нуклеозидов, причем указанный модифицированный олигонуклеотид специфически гибридизуется с SEQ ID NO:1, 2 или 3, тем самым ослабляя симптом метаболического заболевания у человека.

Кроме того, настоящее изобретение обеспечивает способ облегчения симптома диабета, включающий введение в организм человека, нуждающегося в этом, соединения, включающего модифицированный олигонуклеотид, состоящий из 17-35 соединенных нуклеозидов, причем указанный модифицированный олигонуклеотид специфически гибридизуется с SEQ ID NO:1, 2 или 3, тем самым ослабляя симптом диабета у человека.

Кроме того, настоящее изобретение обеспечивает способ облегчения симптома метаболического заболевания, включающий введение в организм человека, нуждающегося в этом, соединения, включающего модифицированный олигонуклеотид, состоящий из 12-30 соединенных нуклеозидов, причем указанный модифицированный олигонуклеотид специфически гибридизуется с SEQ ID NO:1, 2 или 3, тем самым ослабляя симптом метаболического заболевания у человека.

Кроме того, настоящее изобретение обеспечивает способ облегчения симптома диабета, включающий введение в организм человека, нуждающегося в этом, соединения, включающего модифицированный олигонуклеотид, состоящий из 12-30 соединенных нуклеозидов, причем указанный модифицированный олигонуклеотид специфически гибридизуется с SEQ ID NO:1, 2 или 3, тем самым ослабляя симптом диабета у человека.

Кроме того, настоящее изобретение обеспечивает способ облегчения симптома метаболического заболевания, включающий введение в организм человека, нуждающегося в этом, соединения, включающего модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, причем указанный модифицированный олигонуклеотид специфически гибридизуется с SEQ ID NO:1, 2 или 3, тем самым ослабляя симптом метаболического заболевания у человека.

Кроме того, настоящее изобретение обеспечивает способ облегчения симптома диабета, включающий введение в организм человека, нуждающегося в этом, соединения, включающего модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, причем указанный модифицированный олигонуклеотид специфически гибридизуется с SEQ ID NO:1, 2 или 3, тем самым ослабляя симптом диабета у человека.

Кроме того, настоящее изобретение обеспечивает способ снижения скорости прогрессирования симптома, ассоциированного с метаболическим заболеванием, включающий введение в организм человека, нуждающегося в этом, соединения, включающего модифицированный олигонуклеотид, состоящий из 17-35 соединенных нуклеозидов, причем указанный модифицированный олигонуклеотид специфически гибридизуется с SEQ ID NO:1, 2 или 3, тем самым снижая скорость прогрессирования симптома метаболического заболевания у человека.

Кроме того, настоящее изобретение обеспечивает способ снижения скорости прогрессирования симптома, ассоциированного с диабетом, включающий введение в организм человека, нуждающегося в этом, соединения, включающего модифицированный олигонуклеотид, состоящий из 17-35 соединенных нуклеозидов, причем указанный модифицированный олигонуклеотид специфически гибридизуется с SEQ ID NO:1, 2 или 3, тем самым снижая скорость прогрессирования симптома диабета у человека.

Кроме того, настоящее изобретение обеспечивает способ снижения скорости прогрессирования симптома, ассоциированного с метаболическим заболеванием, включающий введение в организм человека, нуждающегося в этом, соединения, включающего модифицированный олигонуклеотид, состоящий из 12-30 соединенных нуклеозидов, причем указанный модифицированный олигонуклеотид специфически гибридизуется с SEQ ID NO:1, 2 или 3, тем самым снижая скорость прогрессирования симптома метаболического заболевания у человека.

Кроме того, настоящее изобретение обеспечивает способ снижения скорости прогрессирования симптома, ассоциированного с диабетом, включающий введение в организм человека, нуждающегося в этом, соединения, включающего модифицированный олигонуклеотид, состоящий из 12-30 соединенных нуклеозидов, причем указанный модифицированный олигонуклеотид специфически гибридизуется с SEQ ID NO:1, 2 или 3, тем самым снижая скорость прогрессирования симптома диабета у человека.

Кроме того, настоящее изобретение обеспечивает способ снижения скорости прогрессирования симптома, ассоциированного с метаболическим заболеванием, включающий введение в организм человека, нуждающегося в этом, соединения, включающего модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, причем указанный модифицированный олигонуклеотид специфически гибридизуется с SEQ ID NO:1, 2 или 3, тем самым снижая скорость прогрессирования симптома метаболического заболевания у человека.

Кроме того, настоящее изобретение обеспечивает способ снижения скорости прогрессирования симптома, ассоциированного с диабетом, включающий введение в организм человека, нуждающегося в этом, соединения, включающего модифицированный олигонуклеотид, состоящий из 17 соединенных нуклеозидов, причем указанный модифицированный олигонуклеотид специфически гибридизуется с SEQ ID NO:1, 2 или 3, тем самым снижая скорость прогрессирования симптома диабета у человека.

Кроме того, настоящее изобретение обеспечивает способы и соединения для изготовления медикамента для лечения, профилактики или облегчения метаболического заболевания.

Кроме того, настоящее изобретение обеспечивает способы и соединения для изготовления медикамента для лечения, профилактики или облегчения ожирения.

Кроме того, настоящее изобретение обеспечивает способы и соединения для изготовления медикамента для лечения, профилактики или облегчения диабета.

Кроме того, настоящее изобретение обеспечивает способы и соединения для изготовления медикамента для лечения, профилактики или облегчения метаболического синдрома.

Некоторые варианты воплощения обеспечивают применение соединения, как описано здесь, при производстве медикамента для лечения, облегчения или профилактики метаболического заболевания.

Некоторые варианты воплощения обеспечивают применение соединения, как описано здесь, при производстве медикамента для лечения, облегчения или профилактики ожирения.

Некоторые варианты воплощения обеспечивают применение соединения, как описано здесь, при производстве медикамента для лечения, облегчения или профилактики диабета.

Некоторые варианты воплощения обеспечивают применение соединения, как описано здесь, при производстве медикамента для лечения, облегчения или профилактики метаболического синдрома.

Некоторые варианты воплощения обеспечивают соединение, как описано здесь, для лечения, профилактики или облегчения метаболического заболевания, как описано здесь, путем комбинированной терапии с дополнительным агентом или терапевтическим средством, как описано здесь. Агенты или терапевтические средства можно вводить совместно или сопутствующим образом.

Некоторые варианты воплощения обеспечивают соединение, как описано здесь, для лечения, профилактики или облегчения диабета, как описано здесь, путем комбинированной терапии с дополнительным агентом или терапевтическим средством, как описано здесь. Агенты или терапевтические средства можно вводить совместно или сопутствующим образом.

Некоторые варианты воплощения обеспечивают применение соединения, как описано здесь, при производстве медикамента для лечения, профилактики или облегчения метаболического заболевания, как описано здесь, путем комбинированной терапии с дополнительным агентом или терапевтическим средством, как описано здесь. Агенты или терапевтические средства можно вводить совместно или сопутствующим образом.

Некоторые варианты воплощения обеспечивают применение соединения, как описано здесь, при производстве медикамента для лечения, профилактики или облегчения ожирения, как описано здесь, путем комбинированной терапии с дополнительным агентом или терапевтическим средством, как описано здесь. Агенты или терапевтические средства можно вводить совместно или сопутствующим образом.

Некоторые варианты воплощения обеспечивают применение соединения, как описано здесь, при производстве медикамента для лечения, профилактики или облегчения диабета, как описано здесь, путем комбинированной терапии с дополнительным агентом или терапевтическим средством, как описано здесь. Агенты или терапевтические средства можно вводить совместно или сопутствующим образом.

Некоторые варианты воплощения обеспечивают применение соединения, как описано здесь, при производстве медикамента для лечения, профилактики или облегчения диабета, как описано здесь, путем комбинированной терапии с дополнительным агентом или терапевтическим средством, как описано здесь. Агенты или терапевтические средства можно вводить совместно или сопутствующим образом.

Некоторые варианты воплощения обеспечивают применение соединения, как описано здесь, при производстве медикамента для лечения, профилактики или облегчения метаболического заболевания, как описано здесь, у пациента, впоследствии принимающего дополнительный агент или терапевтическое средство, как описано здесь.

Некоторые варианты воплощения обеспечивают применение соединения, как описано здесь, при производстве медикамента для лечения, профилактики или облегчения ожирения, как описано здесь, у пациента, впоследствии принимающего дополнительный агент или терапевтическое средство, как описано здесь.

Некоторые варианты воплощения обеспечивают применение соединения, как описано здесь, при производстве медикамента для лечения, профилактики или облегчения диабета, как описано здесь, у пациента, впоследствии принимающего дополнительный агент или терапевтическое средство, как описано здесь.

Некоторые варианты воплощения обеспечивают применение соединения, как описано здесь, при производстве медикамента для лечения, профилактики или облегчения метаболического синдрома, как описано здесь, у пациента, впоследствии принимающего дополнительный агент или терапевтическое средство, как описано здесь.

Некоторые варианты воплощения обеспечивают набор для лечения, профилактики или облегчения метаболического заболевания, как описано здесь, причем указанный набор включает:

(i) соединение, как описано здесь; и, в качестве альтернативы,

(ii) дополнительный агент или терапевтическое средство, как описано здесь.

Некоторые варианты воплощения обеспечивают набор для лечения, профилактики или облегчения ожирения, как описано здесь, причем указанный набор включает:

(i) соединение, как описано здесь; и, в качестве альтернативы,

(ii) дополнительный агент или терапевтическое средство, как описано здесь.

Некоторые варианты воплощения обеспечивают набор для лечения, профилактики или облегчения диабета, как описано здесь, причем указанный набор включает:

(i) соединение, как описано здесь; и, в качестве альтернативы,

(ii) дополнительный агент или терапевтическое средство, как описано здесь.

Некоторые варианты воплощения обеспечивают набор для лечения, профилактики или облегчения метаболического синдрома, как описано здесь, причем указанный набор включает:

(i) соединение, как описано здесь; и, в качестве альтернативы,

(ii) дополнительный агент или терапевтическое средство, как описано здесь.

Набор, как описано здесь, может дополнительно включать инструкции по применению указанного набора для лечения, профилактики или облегчения метаболического заболевания, как описано здесь, путем комбинированной терапии, как описано здесь. В некоторых вариантах воплощения указанное метаболическое заболевание является ожирением. В некоторых вариантах воплощения указанное метаболическое заболевание является диабетом.

Антисмысловые соединения

Олигомерные соединения включают олигонуклеотиды, олигонуклеозиды, аналоги олигонуклеотидов, миметики олигонуклеотидов, антисмысловые соединения, антисмысловые олигонуклеотиды и миРНК, но не ограничиваются ими. Олигомерное соединение может быть "антисмысловым" по отношению к нуклеиновой кислоте-мишени, что означает его способность подвергаться гибридизации с нуклеиновой кислотой-мишенью за счет водородных связей.

В некоторых вариантах воплощения антисмысловое соединение обладает последовательностью нуклеиновых оснований, которая при записи в направлении от 5′ к 3′ включает обращенный комплемент сегмента-мишени нуклеиновой кислоты-мишени, на которую он оказывает адресное воздействие. В некоторых из таких вариантов воплощения антисмысловой олигонуклеотид обладает последовательностью нуклеиновых оснований, которая при записи в направлении от 5′ к 3′ включает обращенный комплемент сегмента-мишени нуклеиновой кислоты-мишени, на которую он оказывает адресное воздействие.

В некоторых вариантах воплощения антисмысловое соединение, мишенью которого является нуклеиновая кислота GCGR, обладает длиной от 10 до 30 нуклеотидов. Другими словами, антисмысловые соединения состоят из 1O-30 соединенных нуклеиновых оснований. В других вариантах воплощения антисмысловое соединение включает модифицированный олигонуклеотид, состоящий из 8-80, 10-50, 15-30, 18-21, 20-80, 20-35, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21 или 20 соединенных нуклеиновых оснований. В некоторых из таких вариантов воплощения антисмысловое соединение включает модифицированный олигонуклеотид, состоящий из 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 или 80 соединенных нуклеиновых оснований в длину или диапазона, определенного любыми двумя из вышеприведенных значений.

В некоторых вариантах воплощения антисмысловое соединение включает укороченный или обрезанный модифицированный олигонуклеотид. Указанный укороченный или обрезанный модифицированный олигонуклеотид может иметь делецию одиночного нуклеозида с 5′ конца (5′-укорачивание) или, в качестве альтернативы, с 3′-конца (3′-укорачивание). Укороченный или обрезанный олигонуклеотид может иметь делецию двух нуклеозидов с 5′ конца или, в качестве альтернативы, может иметь делецию двух субъединиц с 3′-конца. В качестве альтернативы делегированные нуклеозиды могут быть распределены по всему протяжению модифицированного олигонуклеотида, например, в антисмысловом соединении, имеющем делецию одного нуклеозида с 5′-конца и делецию одного нуклеозида с 3′-конца.

Если в удлиненном олигонуклеотиде присутствует одиночный дополнительный нуклеозид, указанный дополнительный нуклеозид может быть расположен на 5′- или 3′-конце олигонуклеотида. При наличии двух или более дополнительных нуклеозидов указанные добавленные нуклеозиды могут находиться рядом друг с другом, например, в олигонуклеотиде, имеющем два нуклеозида, добавленных по 5′-концу (5′-добавление) или, в качестве альтернативы, по 3′-концу (3′-добавление) олигонуклеотида. В качестве альтернативы добавленные нуклеозиды могут быть распределены по всему протяжению антисмыслового соединения, например, в олигонуклеотиде, имеющем один нуклеозид, добавленный по 5′-концу, и одну субъединицу, добавленную по 3′-концу.

Можно увеличить или уменьшить длину антисмыслового соединения, например, антисмыслового олигонуклеотида, и/или внедрить несоответствующие основания без устранения активности. Например, в статье Woolfet al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) протестировали способность серии антисмысловых олигонуклеотидов длиной 13-25 нуклеиновых оснований стимулировать расщепление РНК-мишени в модели инъекции в ооцит.Антисмысловые олигонуклеотиды длиной 25 нуклеиновых оснований с 8 или 11 несоответствующими основаниями вблизи концов антисмысловых олигонуклеотидов смогли стимулировать специфическое расщепление мРНК-мишени, хотя и в меньшей степени, чем антисмысловые олигонуклеотиды, не содержавшие несоответствий. Аналогичным образом специфическое расщепление мишени достигалось с помощью антисмысловых олигонуклеотидов размером 13 нуклеиновых оснований, в том числе олигонуклеотидов, содержавших 1 или 3 несоответствия.

Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) продемонстрировали способность олигонуклеотида со 100% комплементарностью к мРНК bcl-2, содержавшего 3 несовпадения с мРНК bcl-xL, снижать экспрессию как bcl-2, так и bcl-xL m vitro и in vivo. Более того, указанный олигонуклеотид продемонстрировал мощную противоопухолевую активность in vivo.

Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358,1988) протестировали способность серии тандемных антисмысловых олигонуклеотидов длиной 14 нуклеиновых оснований и антисмысловых олигонуклеотидов длиной 28 и 42 нуклеиновых основания, включающих последовательность из двух или трех тандемных антисмысловых олигонуклеотидов, соответственно, блокировать трансляцию ДГФР человека в анализе ретикулоцитов кролика. Каждый из трех антисмысловых олигонуклеотидов длиной 14 нуклеиновых оснований по отдельности мог ингибировать трансляцию, хотя и на более скромном уровне, чем антисмысловые олигонуклеотиды длиной 28 или 42 нуклеиновых основания.

Мотивы антисмысловых соединений

В некоторых вариантах воплощения антисмысловые соединения, мишенью которых является нуклеиновая кислота GCGR, имеют химически модифицированные субъединицы, упорядоченные в структуры или мотивы для придания антисмысловым соединениям таких свойств как расширенная ингибиторная активность, повышенное сродство связывания с нуклеиновой кислотой-мишенью или устойчивость к разрушению нуклеазами in vivo.

Химерные антисмысловые соединения обычно содержат по меньшей мере одну область, модифицированную таким образом, что это придает повышенную устойчивость к разрушению нуклеазами, повышенное поглощение клетками, повышенное сродство связывания с нуклеиновой кислотой-мишенью и/или повышенную ингибиторную активность. Вторая область химерного антисмыслового соединения, необязательно, может служить субстратом для клеточной эндонуклеазы РНКазы Н, которая расщепляет цепь РНК в составе двуцепочечной структуры РНК:ДНК.

Антисмысловые соединения, имеющие гэпмерный мотив, считаются химерными антисмысловыми соединениями. Внутренняя область гэпмера, имеющая множество нуклеотидов, поддерживающих расщепление РНКазой Н, расположена между внешними областями, имеющими множество нуклеотидов, химически отличающихся от нуклеозидов внутренней области. В случае антисмыслового олигонуклеотида, имеющего гэпмерный мотив, сегмент разрыва обычно служит в качестве субстрата для эндонуклеазного расщепления, в то время как сегменты крыльев включают модифицированные нуклеозиды. В некоторых вариантах воплощения области в составе гэпмера различаются по типам сахарозных групп, включающих каждую отдельную область. Типы сахарозных групп, используемые для различения областей гэпмера, в некоторых вариантах воплощения включают β-D-рибонуклеозиды, β-D-дезоксирибонуклеозиды, 2′-модифицированные нуклеозиды (например, 2′-модифицированные нуклеозиды могут включать, в числе прочего, 2′-МОЕ и 2′-O-СН3) и нуклеозиды, модифицированные бициклическими сахарозами (например, нуклеозиды, модифицированные бициклическими сахарозами, могут включать нуклеозиды, имеющие ограниченный этил). В некоторых вариантах воплощения крылья могут включать несколько модифицированных сахарозных групп, в том числе, например, 2′-МОЕ и ограниченный этил. В некоторых вариантах воплощения крылья могут включать несколько модифицированных и немодифицированных сахарозных групп. В некоторых вариантах воплощения крылья могут включать различные комбинации 2′-МОЕ-нуклеозидов, нуклеозидов, содержащих ограниченный этил, и 2′-дезоксинуклеозидов.

Каждая отдельная область может включать однородные сахарозные группы, вариантные или чередующиеся сахарозные группы. Мотив "крыло-разрыв-крыло" часто описывается как "X-Y-Z", где "X" представляет длину 5′-крыла, "Y" представляет длину разрыва, a "Z" представляет длину 3′-крыла. "X" и "Z" могут включать однородные, вариантные или чередующиеся сахарозные группы. В некоторых вариантах воплощения "X" и "Y" могут включать один или более 2′-дезоксинуклеозидов. "Y" может включать 2′-дезоксинуклеозиды. Как используется здесь, гэпмер, описанный как "X-Y-Z", имеет такую конфигурацию, что разрыв располагается в непосредственной близости относительно каждого из 5′-крыла и 3′-крыла. Таким образом, промежуточные нуклеотиды между 5′-крылом и разрывом или разрывом и 3′-крылом отсутствуют.Любое из антисмысловых соединений, описанных здесь, может иметь гэпмерный мотив. В некоторых вариантах воплощения "X" и "Z" являются одинаковыми, в других вариантах воплощения они различаются. В некоторых вариантах воплощения "Y" составляет от 8 до 15 нуклеозидов. X, Y или Z могут содержать любое количество из 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 или более нуклеозидов.

В некоторых вариантах воплощения антисмысловые соединения, мишенью которых является нуклеиновая кислота GCGR, содержат гэпмерный мотив 3-10-4. В некоторых вариантах воплощения антисмысловые соединения, мишенью которых является нуклеиновая кислота GCGR, содержат гэпмерный мотив 5-10-5. В некоторых вариантах воплощения антисмысловые соединения, мишенью которых является нуклеиновая кислота GCGR, содержат гэпмерный мотив 5-10-6.

В некоторых вариантах воплощения антисмысловые соединения, мишенью которых является нуклеиновая кислота GCGR, содержат гэпмерный мотив 3-10-3.

В некоторых вариантах воплощения антисмысловые соединения, мишенью которых является нуклеиновая кислота GCGR, содержат гэпмерный мотив 4-10-4.

В некоторых вариантах воплощения антисмысловые соединения, мишенью которых является нуклеиновая кислота GCGR, содержат гэпмерный мотив 4-10-5.

Нуклеиновые кислоты-мишени, области-мишени и нуклеотидные последовательности

В некоторых вариантах воплощения нуклеиновая кислота GCGR является любой из последовательностей, приведенных под учетным номером GENBANK NM_000160.3 (включенной в настоящий документ как SEQ ID NO:1), учетным номером GENBANK NW_926918.1, обрезанной от нуклеотида 16865000 до 16885000 (включенной в настоящий документ как SEQ ID NO:2); и последовательностью макака-резуса, представленной в SEQ ID NO:3.

Понятно, что последовательность, представленная в каждой SEQ ID NO в Примерах, содержащихся здесь, не зависит от каких-либо модификаций сахарозной группы, межнуклеозидной связи или нуклеинового основания. В связи с этим антисмысловые соединения, определяемые SEQ ID NO, могут независимо включать в одну или более модификаций сахарозной группы, межнуклеозидной связи или нуклеинового основания. Антисмысловые соединения, описываемые номером Isis (Isis No), обозначают комбинацию последовательности нуклеиновых оснований и мотива.

В некоторых вариантах воплощения область-мишень является структурно определенной областью нуклеиновой кислоты-мишени. Например, область-мишень может охватывать 3′-UTR, 5′-UTR, экзон, интрон, переход экзон/интрон, кодирующую область, область инициации трансляции, область терминации трансляции или другую определенную область нуклеиновой кислоты. Структурно определенные области GCGR можно получить по учетному номеру из баз данных последовательностей, например, NCBI, и такая информация включена в настоящий документ посредством ссылки. В некоторых вариантах воплощения область-мишень может включать последовательность от 5′-сайта-мишени одного сегмента-мишени в пределах области-мишени до 3′-сайта-мишени другого сегмента-мишени в пределах той же области-мишени.

Воздействие на мишень включает определение по меньшей мере одного сегмента-мишени, с которым гибридизуется антисмысловое соединение, так что возникает желательный эффект. В некоторых вариантах воплощения желательным эффектом является снижение уровня мРНК нуклеиновой кислоты-мишени. В некоторых вариантах воплощения желательным эффектом является снижение уровня белка, кодируемого нуклеиновой кислотой-мишенью, или фенотипическое изменение, ассоциированное с нуклеиновой кислотой-мишенью.

Область-мишень может содержать один или более сегментов-мишеней. Множественные сегменты-мишени в пределах области-мишени могут перекрываться. В качестве альтернативы они могут не перекрываться. В некоторых вариантах воплощения сегменты-мишени в пределах области-мишени отделены друг от друга не более чем приблизительно 300 нуклеотидами. В некоторых вариантах воплощения сегменты-мишени в пределах области-мишени отделены друг от друга количеством нуклеотидов, равным, приблизительно равным, не превышающим или приблизительно не превышающим 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20 или 10 нуклеотидов нуклеиновой кислоты-мишени, или являющимся диапазоном, определяемым любыми двумя из предшествующих значений. В некоторых вариантах воплощения сегменты-мишени в пределах области-мишени отделены друг от друга не более чем или приблизительно не более чем 5 нуклеотидами нуклеиновой кислоты-мишени. В некоторых вариантах воплощения сегменты-мишени являются непрерывными. Рассматриваются области-мишени, определенные диапазоном, имеющим исходную нуклеиновую кислоту, которая является любым из 5′-сайтов-мишеней или 3′-сайтов-мишеней, перечисленных здесь.

Подходящие сегменты-мишени могут находиться в 5′-UTR, в кодирующей области, в 3′-UTR, интроне, экзоне или переходе экзон/интрон. Сегменты-мишени, содержащие стартовый кодон или стоп-кодон, также являются подходящими сегментами-мишенями. Подходящий сегмент-мишень может специфически исключать некоторую структурно определенную область, например, стартовый кодон или стоп-кодон.

Определение подходящих сегментов-мишеней может включать сравнение последовательности нуклеиновой кислоты-мишени с другими последовательностями в пределах генома. Например, для выявления областей сходства между различными нуклеиновыми кислотами можно использовать алгоритм BLAST. Это сравнение может предотвратить выбор последовательностей антисмысловых соединений, способных гибридизоваться неспецифическим образом с последовательностями, отличающимися от выбранной нуклеиновой кислоты-мишени (т.е. последовательностями, не являющимися мишенями, или неспецифическими последовательностями).

Активность (например, определенная по процентному уменьшению уровней нуклеиновой кислоты-мишени) антисмысловых соединений может меняться в пределах активной области-мишени. В некоторых вариантах воплощения снижение уровней мРНК GCGR указывает на ингибирование экспрессии GCGR. Снижение уровней белка GCGR также указывает на ингибирование экспрессии мРНК-мишени. Кроме того, фенотипические изменения указывают на ингибирование экспрессии GCGR. В некоторых вариантах воплощения снижение уровней глюкозы, снижение уровней липидов и снижение массы тела может указывать на ингибирование экспрессии GCGR. В некоторых вариантах воплощения облегчение симптомов, ассоциированных с метаболическим заболеванием, может указывать на ингибирование экспрессии GCGR. В некоторых вариантах воплощения облегчение симптомов, ассоциированных с диабетом, может указывать на ингибирование экспрессии GCGR. В некоторых вариантах воплощения снижение инсулинорезистентности указывает на ингибирование экспрессии GCGR. В некоторых вариантах воплощения снижение биомаркеров диабета может указывать на ингибирование экспрессии GCGR.

Гибридизация

В некоторых вариантах воплощения гибридизация происходит между антисмысловым соединением, описанным здесь, и нуклеиновой кислотой GCGR. Наиболее распространенный механизм гибридизации включает образование водородных связей (например, образование водородных связей по Уотсону-Крику, Хугстену или обратное хугстеновское образование водородных связей) между комплементарными нуклеиновыми основаниями молекул нуклеиновой кислоты.

Гибридизация может происходить в различных условиях. Жесткие условия зависят от последовательности и определяются в зависимости от природы и состава молекул нуклеиновых кислот, подлежащих гибридизации.

Способы определения возможности специфической гибридизации последовательности с нуклеиновой кислотой-мишенью хорошо известны в данной области техники. В некоторых вариантах воплощения антисмысловые соединения, представленные здесь, способны специфически гибридизоваться с нуклеиновой кислотой GCGR.

Комплементарность

Антисмысловое соединение и нуклеиновая кислота-мишень комплементарны друг другу, если достаточное количество нуклеиновых оснований антисмыслового соединения может образовывать водородные связи с соответствующими нуклеиновыми основаниями нуклеиновой кислоты-мишени, так что происходит желательный эффект (например, антисмысловое ингибирование нуклеиновой кислоты-мишени, например, нуклеиновой кислоты GCGR).

Антисмысловое соединение может гибридизоваться с одним или более сегментов нуклеиновой кислоты GCGR таким образом, что промежуточные или смежные сегменты не участвуют в событии гибридизации (например, петлевые структуры, несоответствия или шпилечные структуры).

В некоторых вариантах воплощения антисмысловые соединения, представленные здесь, или их определенный фрагмент являются или являются по меньшей мере на 70, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, или 100% комплементарными нуклеиновой кислоте GCGR, области-мишени, сегменту-мишени или их определенному фрагменту. Процент комплементарности антисмыслового соединения с нуклеиновой кислотой-мишенью можно определить с помощью стандартных рабочих способов.

Например, антисмысловое соединение, в котором 18 из 20 нуклеиновых оснований антисмыслового соединения комплементарны области-мишени и, следовательно, должны специфически гибридизоваться, должно быть на 90 процентов комплементарным. В этом примере оставшиеся некомплементарные нуклеиновые основания могут быть сгруппированы или рассредоточены среди комплементарных нуклеиновых оснований и не обязательно должны примыкать друг к другу или к комплементарным нуклеиновым основаниям. Таким образом, антисмысловое соединение длиной 18 нуклеиновых оснований, имеющее 4 (четыре) некомплементарных нуклеотидных основания, окруженные двумя областями полной комплементарности с нуклеиновой кислотой-мишенью, обладает 77,8% общей комплементарности с нуклеиновой кислотой-мишенью и, таким образом, находится в рамках настоящего изобретения. Процентную комплементарность антисмыслового соединения и области нуклеиновой кислоты-мишени можно определить в рабочем порядке, используя программное обеспечение BLAST (простейшие инструменты поиска локального выравнивания) и программное обеспечение PowerBLAST, известное в данной области техники (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Процент гомологии, идентичности или комплементарности последовательности можно определить, например, с помощью программы Gap (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Мэдисон, штат Висконсин, США), использующей алгоритм Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489), используя настройки по умолчанию.

В некоторых вариантах воплощения антисмысловые соединения, представленные здесь, или их определенные фрагменты, полностью комплементарны (т.е. на 100% комплементарны) нуклеиновой кислоте-мишени или ее определенному фрагменту. Например, антисмысловое соединение может быть полностью комплементарно нуклеиновой кислоте GCGR или области-мишени, или сегменту-мишени, или их последовательности-мишени. Как используется здесь, "полностью комплементарный" означает, что каждое нуклеиновое основание антисмыслового соединения способно к точному спариванию оснований с соответствующими нуклеиновыми основаниями нуклеиновой кислоты-мишени. Например, антисмысловое соединение длиной 20 нуклеиновых оснований полностью комплементарно последовательности-мишени длиной 400 нуклеотидных оснований, при условии, что существует соответствующий фрагмент нуклеиновой кислоты-мишени длиной 20 нуклеиновых оснований, полностью комплементарный антисмысловому соединению. Термин "полностью комплементарный" также можно использовать по отношению к указанному фрагменту первой и/или второй нуклеиновой кислоты. Например, фрагмент из 20 нуклеиновых оснований антисмыслового соединения длиной 30 нуклеиновых оснований может быть "полностью комплементарным" последовательности-мишени длиной 400 нуклеиновых оснований. Фрагмент из 20 нуклеиновых оснований олигонуклеотида длиной 30 нуклеиновых оснований полностью комплементарен последовательности-мишени, если последовательность-мишень имеет соответствующий фрагмент из 20 нуклеиновых оснований, где каждое нуклеиновое основание комплементарно фрагменту из 20 нуклеиновых оснований антисмыслового соединения. В то же время все антисмысловое соединение из 30 нуклеиновых оснований может быть или не быть полностью комплементарно последовательности-мишени, в зависимости от того, являются ли остальные 10 нуклеиновых оснований антисмыслового соединения также комплементарными последовательности-мишени.

Положение некомплементарного нуклеинового основания может находиться на 5′-конце или на 3′-конце антисмыслового соединения. В качестве альтернативы некомплементарное нуклеиновое основание или основания могут находиться внутри антисмыслового соединения. При наличии двух или более некомплементарных нуклеиновых оснований они могут быть смежными (то есть соединенными) или несмежными. В одном варианте воплощения некомплементарное нуклеиновое основание расположено в сегменте крыла гэпмерного антисмыслового олигонуклеотида.

В некоторых вариантах воплощения антисмысловые соединения, длина которых равна или составляет до 12, 13, 14, 15, 16, 17, 18, 19 или 20 нуклеиновых оснований, включают не более 4, не более 3, не более 2 или не более 1 некомплементарного(ых) нуклеинового(ых) основания(й) по отношению к нуклеиновой кислоте-мишени, например, нуклеиновой кислоте GCGR, или ее определенному фрагменту.

В некоторых вариантах воплощения антисмысловые соединения, длина которых равна или составляет до 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеиновых оснований, включают не более 6, не более 5, не более 4, не более 3, не более 2 или не более 1 некомплементарного(ых) нуклеинового(ых) основания(й) по отношению к нуклеиновой кислоте-мишени, например, нуклеиновой кислоте GCGR, или ее определенному фрагменту.

Антисмысловые соединения, представленные здесь, также включают соединения, комплементарные фрагменту нуклеиновой кислоты-мишени. Как используется здесь, "фрагмент" относится к определенному количеству смежных (т.е. соединенных) нуклеиновых оснований в пределах области или сегмента нуклеиновой кислоты-мишени. "Фрагмент" также может относиться к определенному количеству смежных нуклеиновых оснований антисмыслового соединения. В некоторых вариантах воплощения указанные антисмысловые соединения комплементарны фрагменту сегмента-мишени длиной по меньшей мере 8 нуклеиновых оснований. В некоторых вариантах воплощения указанные антисмысловые соединения комплементарны фрагменту сегмента-мишени длиной по меньшей мере 12 нуклеиновых оснований. В некоторых вариантах воплощения указанные антисмысловые соединения комплементарны фрагменту сегмента-мишени длиной по меньшей мере 13 нуклеиновых оснований. В некоторых вариантах воплощения указанные антисмысловые соединения комплементарны фрагменту сегмента-мишени длиной по меньшей мере 14 нуклеиновых оснований. В некоторых вариантах воплощения указанные антисмысловые соединения комплементарны фрагменту сегмента-мишени длиной по меньшей мере 15 нуклеиновых оснований. В некоторых вариантах воплощения указанные антисмысловые соединения комплементарны фрагменту сегмента-мишени длиной по меньшей мере 16 нуклеиновых оснований. В некоторых вариантах воплощения указанные антисмысловые соединения комплементарны фрагменту сегмента-мишени длиной по меньшей мере 17 нуклеиновых оснований. В некоторых вариантах воплощения указанные антисмысловые соединения комплементарны фрагменту сегмента-мишени длиной по меньшей мере 18 нуклеиновых оснований. В некоторых вариантах воплощения указанные антисмысловые соединения комплементарны фрагменту сегмента-мишени длиной по меньшей мере 19 нуклеиновых оснований. В некоторых вариантах воплощения указанные антисмысловые соединения комплементарны фрагменту сегмента-мишени длиной по меньшей мере 20 нуклеиновых оснований. Кроме того, рассматриваются антисмысловые соединения, комплементарные фрагменту сегмента-мишени, длина которого составляет по меньшей мере 9, 10, 11,12, 13, 14, 15, 16, 17, 18, 19, 20 или более нуклеиновых оснований или равна диапазону, определяемому любыми двумя из указанных значений.

Идентичность

Антисмысловые соединения, представленные здесь, также обладают определенной процентной идентичностью конкретной нуклеотидной последовательности, SEQ ID NO, или соединению, представленному определенным номером Isis, или их фрагменту. Как используется здесь, антисмысловое соединение идентично последовательности, описанной здесь, если оно обладает аналогичной способностью к спариванию нуклеиновых оснований. Например, РНК, содержащая урацил вместо тимидина в описанной ДНК-последовательности, считается идентичной указанной последовательности ДНК, так как и урацил, и тимидин спариваются с аденином. Кроме того, рассматриваются укороченные и удлиненные варианты антисмысловых соединений, описанных здесь, а также соединения, имеющие основания, неидентичные по отношению к антисмысловым соединениям, представленным здесь. Неидентичные основания могут располагаться рядом друг с другом или распределяться по всему антисмысловому соединению. Процентную идентичность антисмыслового соединения рассчитывают в соответствии с количеством оснований, обладающих идентичной способностью к спариванию оснований по отношению к последовательности, с которой его сравнивают.

В некоторых вариантах воплощения антисмысловые соединения или их фрагменты по меньшей мере на 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичны одному или более из антисмысловых соединений или SEQ ID NOs, или их фрагменту, описанному здесь.

Модификации

Нуклеозид является комбинацией основание-сахароза. Часть нуклеозида, являющаяся нуклеиновым основанием (также называемая основанием), как правило, является гетероциклической основной группой. Нуклеотиды представляют собой нуклеозиды, дополнительно включающие фосфатную группу, ковалентно присоединенную к сахарозному фрагменту нуклеозида. Для нуклеозидов, включающих пентафуранозильную сахарозу, фосфатная группа может быть связана с 2′-, 3′- или 5′-гидроксильной группой сахарозы. Олигонуклеотиды образуются за счет ковалентного связывания смежных нуклеозидов друг с другом с образованием линейного полимерного олигонуклеотида. В пределах структуры олигонуклеотида фосфатные группы часто называют группами, образующими межнуклеозидные связи олигонуклеотида.

Модификации антисмысловых соединений охватывают замены или изменения межнуклеозидных связей, сахарозных групп или нуклеиновых оснований. Модифицированные антисмысловые соединения часто являются предпочтительными перед природными формами ввиду их желательных свойств, например, повышенного поглощения клетками, повышенного сродства к нуклеиновой кислоте-мишени, повышенной стабильности в присутствии нуклеаз или повышенной ингибиторной активности.

Химически модифицированные нуклеозиды также можно использовать для увеличения сродства связывания укороченного или усеченного антисмыслового олигонуклеотида с его нуклеиновой кислотой-мишенью. Следовательно, часто можно получить сопоставимые результаты с использованием более коротких антисмысловых соединений, которые имеют такие химически модифицированные нуклеозиды.

Модифицированные межнуклеозидные связи

Природная межнуклеозидная связь РНК и ДНК представляет собой 3′-5′-фосфодиэфирную связь. Антисмысловые соединения, имеющие одну или более модифицированных, т.е. неприродных, межнуклеозидных связей, часто являются предпочтительными перед антисмысловыми соединениями, имеющими природные межнуклеозидные связи, ввиду их желательных свойств, например, повышенного поглощения клетками, повышенного сродства к нуклеиновой кислоте-мишени и повышенной стабильности в присутствии нуклеаз.

Олигонуклеотиды с модифицированными межнуклеозидными связями включают межнуклеозидные связи, сохраняющие атом фосфора, а также межнуклеозидные связи, не имеющие атомов фосфора. Типичные фосфоросодержащие межнуклеозидные связи включают фосфодиэфиры, фосфотриэфиры, метилфосфонаты, фосфорамидаты и фосфортиоаты, но не ограничиваются ими. Хорошо известны способы получения фосфоросодержащих и не содержащих фосфора связей.

В некоторых вариантах воплощения антисмысловые соединения, мишенью которых является нуклеиновая кислота GCGR, содержат одну или более модифицированных межнуклеозидных связей. В некоторых вариантах воплощения указанные модифицированные межнуклеозидные связи являются фосфоротиоатными связями. В некоторых вариантах воплощения каждая межнуклеозидная связь антисмыслового соединения является фосфоротиоатной межнуклеозидной связью.

Модифицированные сахарозные группы

Антисмысловые соединения, представленные здесь, могут, необязательно, содержать один или более нуклеозидов с модифицированными сахарозными группами. Такие модифицированные по сахарозе нуклеозиды могут придавать антисмысловым соединениям повышенную устойчивость к нуклеазам, повышенное сродство связывания или какое-либо другое благоприятное биологическое свойство. В некоторых вариантах воплощения указанные нуклеозиды включают химически модифицированную рибофуранозную кольцевую группу. Примеры химически модифицированных рибофуранозных колец включают, без ограничения, добавление групп-заместителей (в том числе 5′- и 2′-групп-заместителей); формирование мостика из негеминальных кольцевых атомов с образованием бициклических нуклеиновых кислот (БНК); замещение атома кислорода в рибозильном кольце S, N(R) или C(R1)(R)2 (R=Н, С112-алкил или защитная группа); и их комбинации. Примеры химически модифицированных сахароз включают 2′-F-5′-метилзамещенный нуклеозид (см. международную заявку РСТ WO 2008/101157, опубликованную 21/08/08 по отношению к другим описанным 5′, 2′-бисзамещенным нуклеозидам), замену атома кислорода рибозильного кольца атомом S с последующим замещением по 2′-положению (см. патентную заявку США US 2005/0130923, опубликованную 16 июня 2005 г.) или, в качестве альтернативы, 5′-замещение БНК (см. международную заявку РСТ WO 2007/134181, опубликованную 22/11/07, где запертая нуклеиновая кислота замещена, например, 5′-метильной или 5′-винильной группой).

Примеры нуклеозидов, имеющих модифицированные сахарозные группы, включают, без ограничения, нуклеозиды, содержащие 5′-винильные, 5′-метильные (R или S), 4′-S, 2′-F, 2′-ОСН3 и 2′-O(СН2)2OCH3-группы-заместители. Заместитель в 2′-положении также можно выбрать из аллила, амино, азидо, тио, O-аллила, O-C1-C1O-алкила, OCF3, O(СН2)2SCH3, O(CH2)2-O-N(Rm)(Rn) и O-CH2-C(=O)-N(Rm)(Rn), где каждая Rm и Rn независимо является Н или замещенным или незамещенным C1-C1O-алкилом.

Как используется здесь, "бициклические нуклеозиды" относится к модифицированным нуклеозидам, включающим бициклическую сахарозную группу. Примеры бициклических нуклеозидов включают, без ограничения, нуклеозиды, содержащие мостик между 4′- и 2′-атомами рибозильного кольца. В некоторых вариантах воплощения антисмысловые соединения, представленные здесь, включают один или более бициклических нуклеозидов, в которых мостик включает 4′-2′-бициклический нуклеозид. Примеры таких 4′-2′-бициклических нуклеозидов включают, не ограничиваясь этим, одну из формул: 4′-(СН2)-O-2′ (LNA); 4′-(CH2)-S-2′; 4′-(CH2)2-O-2′ (ENA); 4′-СН(СН3)-O-2′ и 4′-СН(CH2OCH3)-O-2′, и их аналоги (см. патент США 7399845, опубликованный 15 июля 2008 г.); 4′-С(СН3)(СН3)-O-2′ и его аналоги (см. международную заявку РСТ WO 2009/006478, опубликованную 8 января 2009 г.); 4′-СН2-Н(ОСН3)-2′ и его аналоги (см. международную заявку РСТ WO 2008/150729, опубликованную 11 декабря 2008 г.); 4′-СН2-O-N(СН3)-2′ (см. патентную заявку США US 2004/0171570, опубликованную 2 сентября 2004 г.); 4′-CH2-N(R)-O-2′, где R является Н, С112-алкилом или защитной группой (см. патент США 7427672, опубликованный 23 сентября 2008 г.); 4′-СН2-С(Н)(СН3)-2′ (см. Chattopadhyaya, et ей., J. Org. Chem.,2009, 74, 118-134); и 4′-СН2-С(=СН2)-2′ и его аналоги (см. международную заявку РСТ WO 2008/154401, опубликованную 8 декабря 2008 г.). Также см., например: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumaretal., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; патенты США под номерами США 6670461, 7053207, 6268490, 6770748, 6794499, 7034133, 6525191, 7399845; опубликованные международные заявки РСТ WO 2004/106356, WO 94/14226, WO 2005/021570 и WO 2007/134181; патентные публикации США под номерами US 2004/0171570, US 2007/0287831 и US 2008/0039618; и патенты США под номерами 12/129154, 60/989574, 61/026995, 61/026998, 61/056564, 61/086231, 61/097787 и 61/099844; и международные заявки РСТ под номерами PCT/US 2008/064591, PCT/US2008/066154 и PCT/US 2008/068922. Каждый из вышеуказанных бициклических нуклеозидов можно получить, имея одну или более стереохимических сахарозных конфигураций, в том числе, например, α-L-рибофуранозу и β-D-рибофуранозу (см. международную заявку PCT/DK98/00393, опубликованную 25 марта 1999 г. как WO 99/14226).

В некоторых вариантах воплощения бициклические сахарозные группы БНК-нуклеозидов включают, не ограничиваясь ими, соединения, имеющие по меньшей мере один мостик между 4′- и 2′-положением пентофуранозильной сахарозной группы, причем такие мостики независимо включают 1 или от 2 до 4 связанных групп, независимо выбранных из -[C(Ra)(Rb)]n-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x- и -N(Ra)-;

где:

x равен О, 1 или 2;

правей 1, 2, 3 или 4;

каждая Ra и Rb, независимо, является Н, защитной группой, гидроксилом, C1-C12-алкилом, замещенным С112-алкилом, С212-алкенилом, замещенньш С212-алкенилом, С212-алкинилом, замещенным С212-алкинилом, С5-C2O-арилом, замещенным С5-C2O-арилом, гетероциклическим радикалом, замещенньш гетероциклическим радикалом, гетероарилом, замещенным гетероарилом, С57-алициклическим радикалом, замещенньш С57-алициклическим радикалом, атомом галогена, OJ1, NJ1J2, SJ1, N3, COOJ1, ацилом (С(=O)-Н), замещенным ацилом, CN, сульфонилом (S(=O)2-J1) или сульфоксилом (S(=O)-J1); и

каждая J1 и J2, независимо, является Н, С112-алкилом, замещенным Ci-Сп-алкилом, С212-алкенилом, замещенным С212-алкенилом, С212-алкинилом, замещенньш С212-алкинилом, С5-C2O-арилом, замещенньш С5-C2O-арилом, ацилом (С(=O)-Н), замещенньш ацилом, гетероциклическим радикалом, замещенньш гетероциклическим радикалом, С112-аминоалкилом, замещенньш С112-аминоалкилом или защитной группой.

В некоторых вариантах воплощения мостик бициклической сахарозной группы является -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(RaRb)-N(R)-O- или -C(RaRb)-O-N(R)-. В некоторых вариантах воплощения указанный мостик является 4′-СН2-2′, 4′-(СН2)2-2′, 4′-(СН2)2-2′, 4′-СН2-O-2′, 4′-(СН2)2-O-2′, 4′-CH2-O-N(R)-2′ и 4′-CH2-N(R)-O-2′-, где каждая R, независимо, является Н, защитной группой или С112-алкилом.

В некоторых вариантах воплощения бициклические нуклеозиды дополнительно определяют по изомерной конфигурации. Например, нуклеозид, включающий 4′-2′-метиленокси-мостик, может находиться в конфигурации a-L или в конфигурации β-D. Ранее α-L-метиленокси (4′-СН2-O-2′) БНК включили в антисмысловые олигонуклеотиды, демонстрировавшие антисмысловую активность (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

В некоторых вариантах воплощения бициклические нуклеозиды включают (A) α-L-метиленокси (4′-СН2-O-2′) БНК, (В) β-D-метиленокси (4′-СН2-O-2′) БНК, (С) этиленокси (4′-(СН2)2-O-2′) БНК, (D) аминоокси (4′-CH2-O-N(R)-2′) БНК, (Е) оксиамино (4′-СН2-N(R)-O-2′) БНК, (F) метил(метиленокси) (4′-СН(СН3)-O-2′) БНК, (G) метилентио (4′-СН2-S-2′) БНК, (Н) метиленамино (4′-CH2-N(R)-2′) БНК, (I) метил карбоциклическую (4′-СН2-СН(СН3)-2′) БНК и (J) пропилен карбоциклическую (4′-(СН2)3-2′) БНК, как изображено ниже, но не ограничиваются ими:

где Вх является группой основания, а R независимо является Н, защитной группой или С112-алкилом.

В некоторых вариантах воплощения бициклический нуклеозид имеет Формулу I:

где:

Вх является гетероциклической основной группой;

-Qa-Qb-Qc- является -CH2-N(Rc)-CH2-, -C(=O)-N(Rc)-CH2-, -CH2-O-N(Rc)-, -СН2-N(Rc)-O- или -N(Rc)-O-CH2;

Re является С112-алкилом или аминозащитной группой; и

каждая из Та и Tb независимо является Н, гидрокси-защитной группой, группой конъюгата, реакционноспособной фосфорсодержащей группой, фосфорсодержащей группой или ковалентным присоединением к среде-носителю.

В некоторых вариантах воплощения бициклический нуклеозид имеет Формулу II:

где:

Вх является гетероциклической основной группой;

каждая из Та и Tb независимо является Н, гидрокси-защитной группой, группой конъюгата, реакционноспособной фосфорсодержащей группой, фосфорсодержащей группой или ковалентным присоединением к среде-носителю;

Za является C16-алкилом, С26-алкенилом, С26-алкинилом, замещенным C16-алкилом, замещенным С26-алкенилом, замещенным С26-алкинилом, ацилом, замещенным ацилом, замещенным амидом, тиолом или замещенной тиогруппой.

В одном варианте воплощения каждая из замещенных групп независимо является моно- или полизамещенной группой-заместителем, независимо выбранной из галогена, оксо, гидроксила, OJc, NJcJd, SJc, N3, OC(=X)Jc и NJeC(=X)NJcJd, где каждая Jc, Jd и Je независимо является Н, C16-алкилом или замещенным C16-алкилом, а Х является О или NJc.

В некоторых вариантах воплощения бициклический нуклеозид имеет Формулу III:

где:

Вх является гетероциклической основной группой;

каждая из Та и Tb независимо является Н, гидрокси-защитной группой, группой конъюгата, реакционноспособной фосфорсодержащей группой, фосфорсодержащей группой или ковалентным присоединением к среде-носителю;

Zb является C16-алкилом, С26-алкенилом, С26-алкинилом, замещенным C16-алкилом, замещенным С26-алкенилом, замещенным С26-алкинилом или замещенным ацилом (С(=O)-).

В некоторых вариантах воплощения бициклический нуклеозид имеет Формулу IV:

где:

Вх является гетероциклической основной группой;

каждая из Та и Tb независимо является Н, гидрокси-защитной группой, группой конъюгата, реакционноспособной фосфорсодержащей группой, фосфорсодержащей группой или ковалентным присоединением к среде-носителю;

Rd является C16-алкилом, замещенным C16-алкилом, С26-алкенилом, замещенным С26-алкенилом, С26-алкинилом или замещенным С26-алкинилом;

каждая из qa, qb, qc и qd независимо является Н, атомом галогена, C16-алкилом, замещенным C16-алкилом, С26-алкенилом, замещенным С26-алкенилом, С26-алкинилом или замещенным С26-алкинилом, C16-алкоксилом, замещенным C16-алкоксилом, ацилом, замещенным ацилом, C16-аминоалкилом или замещенным C16-аминоалкилом.

В некоторых вариантах воплощения бициклический нуклеозид имеет Формулу V:

где:

Вх является гетероциклической основной группой;

каждая из Та и Tb независимо является Н, гидрокси-защитной группой, группой конъюгата, реакционноспособной фосфорсодержащей группой, фосфорсодержащей группой или ковалентным присоединением к среде-носителю;

каждая из qa, qb, qe и qf независимо является атомом водорода, атомом галогена, С1′12-алкилом, замещенным С112-алкилом, С212-алкенилом, замещенным C2-C12-алкенилом, С212-алкинилом, замещенным С212-алкинилом, С112-алкокси, замещенным С112-алкокси, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(=O)OJj, C(=O)NJjJk, C(=O)Jj, O-C(=O)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=O)NJjJk или N(H)C(=S)NJjJk;

или qe и qf совместно являются =C(qg)(qh);

каждая из qg и qh независимо является Н, атомом галогена, С112-алкилом или замещенным С112-алкилом.

Описан синтез и получение метиленокси (4′-СН2-O-2′) БНК-мономеров аденина, цитозина, гуанина, 5-метилцитозина, тимина, урацила наряду с их олигомеризацией, а также их свойства распознавания нуклеиновых кислот (см., например, Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). БНК и их получение также описаны в WO 98/39352 и WO 99/14226.

Кроме того, получены аналоги метиленокси (4′-СН2-O-2′) БНК, метиленокси (4′-СН2-O-2′) БНК и 2′-тио-БНК (см., например, Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Кроме того, описано получение заблокированных аналогов нуклеозидов, включающее двуцепочечные олигодезоксирибонуклеотидные структуры в качестве субстратов для полимераз нуклеиновых кислот (см., например, Wengel et al., WO 99/14226). Кроме того, в данной области техники описан синтез 2′-амино-БНК, нового конформационно ограниченного олигонуклеотидного аналога с высоким сродством (см., например, Singh et al., J. Org. Chem., 1998, 63, 10035-10039). Кроме того, были получены 2′-амино- и 2′-метиламино-БНК и ранее сообщалось о температурной стабильности их двуцепочечных структур с комплементарными цепями РНК и ДНК.

В некоторых вариантах воплощения бициклический нуклеозид имеет Формулу VI:

где:

Вх является гетероциклической основной группой;

каждая из Та и Tb независимо является Н, гидрокси-защитной группой, группой конъюгата, реакционноспособной фосфорсодержащей группой, фосфорсодержащей группой или ковалентным присоединением к среде-носителю;

каждая из qi, qj, qk и ql независимо является Н, галогеном, C112-алкилом, замещенным С2-С12-алкилом, С212-алкенилом, замещенным С212-алкенилом, C2-C12-алкинилом, замещенным С212-алкинилом, С112-алкоксилом, замещенным C112-алкоксилом, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(=O)OJj, C(=O)NJjJk, C(=O)Jj, O-C(=O)-NJjJk, N(H)C(=NH)NJjJk, N(H)C(=O)NJjJk или N(H)C(=S)NJjJk; и

qi и qj или qi и qk совместно являются =C(qg)(qh), где каждая из qg и qh независимо является Н, атомом галогена, С112-алкилом или замещенным С112-алкилом.

Описан карбоциклический бициклический нуклеозид, имеющий 4′-(СН2)3-2′-мостик, и алкенильный аналог, мостик 4′-СН=СН-СН2-2′ (см., например, Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 и Albaek et al., J. Org. Chem., 2006, 77, 7731-7740). Кроме того, описаны синтез и получение карбоциклических бициклических нуклеозидов наряду с их олигомеризацией и биохимическими исследованиями (см., например, Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

Как используется здесь, "4′-2′-бициклический нуклеозид" или "от 4′- до 2′-бициклический нуклеозид" относится к бициклическому нуклеозиду, включающему фуранозное кольцо, включающее мостик, соединяющий 2′-атом углерода и 4′-атом углерода.

Как используется здесь, термин "моноциклические нуклеозиды" относится к нуклеозидам, включающим модифицированные сахарозные группы, не являющиеся бициклическими сахарозными группами. В некоторых вариантах воплощения сахарозная группа или аналог сахарозной группы нуклеозида может быть модифицирован или замещен по любому положению.

Как используется здесь, "2′-модифицированная сахароза" означает фуранозильную сахарозу, модифицированную по 2′-положению. В некоторых вариантах воплощения такие модификации включают заместители, выбранные из: галогенида, включая замещенный и незамещенный алкокси, замещенный и незамещенный тиоалкил, замещенный и незамещенный аминоалкил, замещенный и незамещенный алкил, замещенный и незамещенный аллил и замещенный и незамещенный алкинил, но не ограничиваясь ими. В некоторых вариантах воплощения 2′-модификации выбраны из заместителей, включающих, но не ограничивающихся этим: O[(СН2)nO]mCH3, O(CH2)nNH2, O(СН2)nCH3, O(CH2)nONH2, ОСН2С(=O)N(Н)СН3 и O(СН2)nON[(СН2)nCH3]2, где пит равны от 1 до приблизительно 10. Другие 2′-заместители также можно выбрать из: С112-алкила; замещенного алкила; алкенила; алкинила; алкарила; аралкила; O-алкарила или O-аралкила; SH; SCH3; OCN; Cl; Br; CN; CF3; OCF3; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; гетероциклоалкила; гетероциклоалкарила; аминоалкиламино; полиалкиламино; замещенного силила; РНК-расщепляющей группы; репортерной группы; интеркалирующего агента; группы для улучшения фармакокинетических свойств и группы для улучшения фармакодинамических свойств антисмыслового соединения, и других заместителей, обладающих сходными свойствами. В некоторых вариантах воплощения модифицированные нуклеозиды включают 2′-МОЕ-боковую цепь (см., например, Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Описано, что такое 2′-МОЕ-замещение обладает улучшенным сродством связывания по сравнению с немодифицированными нуклеозидами и другими модифицированными нуклеозидами, например, 2′-O-метил, O-пропил и O-аминопропил. Кроме того, показано, что олигонуклеотиды, имеющие 2′-МОЕ-заместитель, являются антисмысловыми ингибиторами экспрессии генов с перспективными свойствами для применения in vivo (см., например, Martin, P., Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 63O-637; и Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

Как используется здесь, "модифицированный тетрагидропирановый нуклеозид" или "модифицированный ТНР-нуклеозид" означает нуклеозид, содержащий шестичленную тетрагидропирановую "сахарозу", замещенную аналогично пентофуранозильному остатку в обычных нуклеозидах (суррогат сахарозы). Модифицированные ТНР-нуклеозиды включают, не ограничиваясь ими, то, что в данной области техники называют гекситной нуклеиновой кислотой (HNA), анитной нуклеиновой кислотой (AHA), маннитной нуклеиновой кислотой (MNA) (см. Leumann, CJ. Bioorg. & Med. Chem. (2002) 10:841-854), фторированной HNA (F-HNA) или соединения, имеющие Формулу X:

где независимо для каждого из по меньшей мере одного тетрагидропиранового аналога нуклеозида формулы X:

Вх является гетероциклической основной группой;

каждая из Т3 и Т4 независимо является группой межнуклеозидной связи, соединяющей тетрагидропирановый аналог нуклеозида с антисмысловым соединением, либо одна из Т3 и Т4 является группой межнуклеозидной связи, соединяющей тетрагидропирановый аналог нуклеозида с антисмысловым соединением, а другая из Т3 и Т4 является Н, гидроксил-защитной группой, группой присоединенного конъюгата или 5′-или 3′-концевой группой;

каждая из q1, q2, q3, q4, q5, q6 и q7 независимо является Н, C16-алкилом, замещенным C16-алкилом, С26-алкенилом, замещенным С26-алкенилом, С26-алкинилом или замещенным С26-алкинилом; и

одна из R1 и R2 является атомом водорода, а другая выбрана из атома галогена, замещенного или незамещенного алкокси, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 и CN, где Х является О, S или NJ1, а каждая из J1, J2 и J3 независимо является Н или C16-алкилом.

В некоторых вариантах воплощения представлены модифицированные ТНР-нуклеозиды Формулы X, где каждая из qm, qn, qp, qr, qs, qt и qu является Н. В некоторых вариантах воплощения по меньшей мере одна из qm, qn, qp, qr, qs, qt и qu не является Н. В некоторых вариантах воплощения по меньшей мере одна из qm, qn, qp, qr, qs, qt и qu является метилом. В некоторых вариантах воплощения представлены ТНР-нуклеозиды формулы X, где одна из R1 и R2 является F. В некоторых вариантах воплощения R1 является атомом фтора, a R2 является Н, R1 является метокси, а R2 является Н, и R1 является метоксиэтокси, а R2 является Н.

Как используется здесь, "2′-модифицированный" или "2′-замещенный" относится к нуклеозиду, включающему сахарозу, включающую заместитель по 2′-положению, не являющийся Н или ОН. 2′-модифицированные нуклеозиды включают, не ограничиваясь ими, бициклические нуклеозиды, где мостик, соединяющий два атома углерода сахарозного кольца, соединяет 2′-атом углерода и другой атом углерода сахарозного кольца, и нуклеозиды с 2′-заместителями, не образующими мостика, например, аллилом, амино, азидо, тио, O-аллилом, O-C110-алкилом, -OCF3, O-(СН2)2-O-СН3, 2′-O(СН2)2SCH3, O-(CH2)2-O-N(Rm)(Rn) или O-CH2-C(=O)-N(Rm)(Rn), где каждая из Rm и Rn независимо является Н или замещенным или незамещенным C110-алкилом. 2′-модифицированные нуклеозиды могут дополнительно включать другие модификации, например, по другим положениям сахарозы и/или нуклеинового основания.

Как используется здесь, "2′-F" относится к сахарозе, включающей фторзамещенную группу по 2′-положению.

Как используется здесь, каждый из терминов "2′-ОМе" или "2′-ОСН3" или "2′-O-метил" относится к сахарозе, включающей -ОСН3-группу по 2′-положению сахарозного кольца.

Как используется здесь, "олигонуклеотид" относится к соединению, включающему множество соединенных нуклеозидов. В некоторых вариантах воплощения один или более из указанного множества нуклеозидов модифицированы. В некоторых вариантах воплощения олигонуклеотид включает один или более рибонуклеозидов (РНК) и/или дезоксирибонуклеозидов (ДНК).

В данной области техники известны многие другие суррогаты сахароз на основе бицикло- и трицикло-кольцевых систем, которые можно использовать для модификации нуклеозидов для включения в антисмысловые соединения (см, например, обзорную статью: Leumann, J. С, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854).

Такие кольцевые системы могут подвергаться различным дополнительным заменам для повышения активности.

Специалистам в данной области техники известны многие способы получения модифицированных сахароз.

В нуклеотидах, содержащих модифицированные сахарозные группы, сохраняются группы нуклеиновых оснований (природные, модифицированные или их комбинации) для гибридизации с соответствующей нуклеиновой кислотой-мишенью.

В некоторых вариантах воплощения антисмысловые соединения включают один или более нуклеотидов, содержащих модифицированные сахарозные группы. В некоторых вариантах воплощения указанная модифицированная сахарозная группа является 2′-МОЕ. В некоторых вариантах воплощения 2′-МОЕ-модифицированные нуклеотиды упорядочены в составе гэпмерного мотива. В некоторых вариантах воплощения указанная модифицированная сахарозная группа является cEt. В некоторых вариантах воплощения cEt-модифицированные нуклеотиды упорядочены в составе крыльев гэпмерного мотива.

Модифицированные нуклеиновые основания

Модификации или замены нуклеиновых оснований (или оснований) структурно отличаются, но функционально взаимозаменяемы с природными или синтетическими модифицированными нуклеиновыми основаниями. Как природные, так и модифицированные нуклеиновые основания способны участвовать в образовании водородных связей. Такие модификации по нуклеиновому основанию могут придавать антисмысловому соединению устойчивость к нуклеазам, сродство связывания или какое-либо другое благоприятное биологическое свойство. Модифицированные нуклеиновые основания включают синтетические и природные нуклеиновые основания, например, 5-метилцитозин (5-me-С). Некоторые замены нуклеиновых оснований, включая замену 5-метилцитозином, особенно полезны для усиления сродства связывания антисмыслового соединения с нуклеиновой кислотой-мишенью. Например, показано, что замена на 5-метилцитозин повышает стабильность двуцепочечной структуры нуклеиновой кислоты на 0,6-1,2°С (Sanghvi, Y.S., Crooke, S.T. and Lebleu, В., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp.276-278).

Дополнительные немодифицированные нуклеиновые основания включают 5-гидроксиметилцитозин, ксантин, гипоксантин, 2-аминоаденин, 6-метил- и другие алкильные производные аденина и гуанина, 2-пропил- и другие алкильные производные аденина и гуанина, 2-тиоурацил, 2-тиотимин и 2-тиоцитозин, 5-галоурацил и цитозин, 5-пропинил (-С≡С-СН3) урацил и цитозин и другие алкинильные производные пиримидиновых оснований, 6-азоурацил, цитозин и тимин, 5-урацил (псевдоурацил), 4-тиоурацил, 8-гало, 8-амино, 8-тиол, 8-тиоалкил, 8-гидроксил и другие 8-замещенные производные аденина и гуанина, 5-гало, в частности, 5-бром, 5-трифторметил и другие 5-замещенные производные урацила и цитозина, 7-метилгуанин и 7-метиладенин, 2-F-аденин, 2-аминоаденин, 8-азагуанин и 8-азааденин, 7-деазагуанин и 7-деазааденин и 3-деазагуанин и 3-деазааденин.

Гетероциклические основные группы также включают группы, в которых пуриновое или пиримидиновое основание замещено другими гетероциклами, например, 7-деазааденином, 7-деазагуанозином, 2-аминопиридином и 2-пиридоном. Нуклеиновые основания, особенно полезные для повышения сродства связывания антисмысловых соединений, включают 5-замещенные пиримидины, 6-азапиримидины и N-2, N-6 и O-6-замещенные пурины, включая 2-аминопропиладенин, 5-пропинилурацил и 5-пропинилцитозин.

В некоторых вариантах воплощения антисмысловые соединения, мишенью которых является нуклеиновая кислота GCGR, содержат одно или более модифицированных нуклеиновых оснований. В некоторых вариантах воплощения расширенные за счет разрыва антисмысловые олигонуклеотиды, мишенью которых является нуклеиновая кислота GCGR, содержат одно или более модифицированных нуклеиновых оснований. В некоторых вариантах воплощения указанное модифицированное нуклеиновое основание является 5-метилцитозином. В некоторых вариантах воплощения каждый цитозин является 5-метилцитозином.

Композиции и способы составления фармацевтических композиций

Антисмысловые олигонуклеотиды можно смешать с фармацевтически приемлемым активным или инертным веществом для изготовления фармацевтических композиций или составов. Композиции и способы составления фармацевтических композиций зависят от ряда критериев, включая путь введения, степень развития заболевания или вводимую дозу, не ограничиваясь этим.

Антисмысловые соединения, мишенью которых является нуклеиновая кислота GCGR, можно использовать в фармацевтической композиции путем объединения антисмыслового соединения с подходящим фармацевтически приемлемым разбавителем или носителем. Фармацевтически приемлемый разбавитель включает фосфатно-солевой буфер (PBS). PBS является разбавителем, пригодным для применения в композициях, доставляемых парентеральным путем. Соответственно, в одном варианте воплощения в способах, описанных здесь, применяют фармацевтическую композицию, включающую антисмысловое соединение, мишенью которого является нуклеиновая кислота GCGR, и фармацевтически приемлемый разбавитель. В некоторых вариантах воплощения указанный фармацевтически приемлемый разбавитель является PBS. В некоторых вариантах воплощения указанное антисмысловое соединение является антисмысловым олигонуклеотидом.

Фармацевтические композиции, включающие антисмысловые соединения, охватывают любые фармацевтически приемлемые соли, сложные эфиры или соли таких эфиров, или любой другой олигонуклеотид, который при введении в организм животного, в том числе человека, способен обеспечить (прямо или косвенно) биологически активный метаболит или его остаток. Соответственно, например, настоящее описание также распространяется на фармацевтически приемлемые соли антисмысловых соединений, пролекарства, фармацевтически приемлемые соли таких пролекарств и другие биоэквиваленты. Подходящие фармацевтически приемлемые соли включают соли натрия и калия, но не ограничиваются ими.

Фармацевтически приемлемые соли соединений, описанных здесь, можно получить с помощью способов, известных в данной области техники. Обзор фармацевтически приемлемых солей см. в справочнике Stahl and Wermuth, Handbook of Pharmaceutical Salts: Properties, Selection and Use (Wiley-VCH, Weinheim, Germany, 2002). Натриевые соли антисмысловых олигонуклеотидов полезны и хорошо переносятся при терапевтическом введении в организм человека. Соответственно, в одном варианте воплощения соединения, описанные здесь, представлены в виде соли натрия.

Пролекарство может включать внедрение дополнительных нуклеозидов по одному или обоим концам антисмыслового соединения, отщепляемых эндогенными нуклеазами в организме с образованием активного антисмыслового соединения.

Конъюгированные антисмысловые соединения

Антисмысловые соединения можно ковалентно присоединить к одной или более групп или конъюгатов, усиливающих активность, распределение в клетке или поглощение клеткой полученных антисмысловых олигонуклеотидов. Типичные конъюгатные группы включают группы холестерина и липидов. Дополнительные конъюгатные группы включают углеводы, фосфолипиды, биотин, феназин, фолат, фенантридин, антрахинон, акридин, флуоресцеины, родамины, кумарины и красители.

Антисмысловые соединения также можно модифицировать, включая одну или несколько стабилизирующих групп, которые обычно присоединяют к одному или обоим концам антисмысловых соединений для усиления их свойств, например, устойчивости к нуклеазам. Стабилизирующие группы включают кэп-структуры. Указанные концевые модификации защищают антисмысловое соединение, содержащее концевые структуры нуклеиновых кислот, от разрушения экзонуклеазами, и могут помочь в доставке и/или локализации в клетке. Кэп может присутствовать на 5′-конце (5′-кэп) или на 3′-конце (3′-кэп), или на обоих концах. Кэп-структуры хорошо известны в данной области техники и включают, например, обращенные дезоксиструктуры, лишенные оснований. Кроме того, для кэпирования одного или обоих концов антисмыслового соединения с целью придания устойчивости к нуклеазам можно использовать 3′ и 5′-стабилизирующие группы, в том числе группы, описанные в WO 03/004602, опубликованной 16 января 2003 г.

Культуры клеток и обработка антисмысловыми соединениями

Действие антисмысловых соединений на уровень, активность или экспрессию нуклеиновых кислот GCGR можно протестировать in vitro на различных типах клеток. Типы клеток, используемых для таких анализов, доступны у коммерческих поставщиков (например, в Американской колекции типовых культур, Манассас, штат Виргиния, США; Zen-Bio, Inc., Ресерч-Трайэнгл-Парк, штат Северная Каролина, США; Clonetics Corporation, Уолкерсвилл, штат Мэриленд, США); указанные клетки культивируют согласно инструкциям производителя с использованием доступных для приобретения реагентов (например, Invitrogen Life Technologies, Карлсбад, штат Калифорния, США). Иллюстративные типы клеток включают клетки HepG2 и первичные гепатоциты, но не ограничиваются ими.

Тестирование антисмысловых олигонуклеотидов in vitro

Здесь описаны способы обработки клеток антисмысловыми олигонуклеотидами, которые могут быть модифицированы соответствующим для обработки образом другими антисмысловыми соединениями.

В целом клетки обрабатывают антисмысловыми олигонуклеотидами при достижении культурой приблизительно 60-80% конфлюэнтности.

Один из реагентов, обычно используемых для внедрения антисмысловых олигонуклеотидов в культивируемые клетки, включает катионный липидный реагент для трансфекции LIPOFECTIN® (Invitrogen, Карлсбад, штат Калифорния, США). Антисмысловые олигонуклеотиды смешивают с LIPOFECTIN® в OPTI-MEM® 1 (Invitrogen, Карлсбад, штат Калифорния, США) с целью достижения желательной конечной концентрации антисмыслового олигонуклеотида и концентрации LIPOFECTIN®, обычно находящейся в диапазоне 2-12 мкг/мл на 100 нМ антисмыслового олигонуклеотида.

Еще один из реагентов, используемых для внедрения антисмысловых олигонуклеотидов в культивируемые клетки, включает LIPOFECTAMINE 2000® (Invitrogen, Карлсбад, штат Калифорния, США). Антисмысловой олигонуклеотид смешивают с LIPOFECTAMINE 2000® в среде с ограниченным содержанием сыворотки OPTI-MEM® I (Invitrogen, Карлсбад, штат Калифорния, США) с целью достижения желательной концентрации антисмыслового олигонуклеотида и концентрации LIPOFECTAMINE®, обычно находящейся в диапазоне 2-12 мкг/мл на 100 нМ антисмыслового олигонуклеотида.

Еще один из реагентов, используемых для внедрения антисмысловых олигонуклеотидов в культивируемые клетки, включает Cytofectin® (Invitrogen, Карлсбад, штат Калифорния, США). Антисмысловой олигонуклеотид смешивают с Cytofectin® в среде с ограниченным содержанием сыворотки OPTI-MEM® 1 (Invitrogen, Карлсбад, штат Калифорния, США) с целью достижения желательной концентрации антисмыслового олигонуклеотида и концентрации Cytofectin®, обычно находящейся в диапазоне 2-12 мкг/мл на 100 нМ антисмыслового олигонуклеотида.

Еще одна методика, используемая для внедрения антисмысловых олигонуклеотидов в культивируемые клетки, включает электропорацию.

Клетки обрабатывают антисмысловыми олигонуклеотидами с помощью обычных способов. Клетки обычно собирают через 16-24 ч после обработки антисмысловым олигонуклеотидом, после чего измеряют уровни РНК или белка нуклеиновых кислот-мишеней способами, известными в данной области техники и описанными здесь. В целом при обработке в нескольких повторностях данные представляют в виде среднего значения по повторным обработкам.

Используемая концентрация антисмыслового олигонуклеотида зависит от линии клеток. Способы определения оптимальной концентрации антисмыслового олигонуклеотида для конкретной линии клеток хорошо известны в данной области техники. Антисмысловые олигонуклеотиды обычно используют в концентрациях от 1 нМ до 300 нМ при трансфекции LIPOFECTAMINE2000®, липофектином или цитофектином. Антисмысловые олигонуклеотиды обычно используют в более высоких концентрациях (от 625 нМ до 20000 нМ) при трансфекции с помощью электропорации.

Выделение РНК

Анализ РНК можно выполнить, используя общую РНК клеток или поли(А)+мРНК. Способы выделения РНК хорошо известны в данной области техники. РНК получают с использованием способов, хорошо известных в данной области техники, например, с помощью реагента TRIZOL® (Invitrogen, Карлсбад, штат Калифорния, США) в соответствии с протоколами, рекомендованными изготовителем.

Анализ ингибирования уровней или экспрессии мишени

Ингибирование уровней или экспрессии нуклеиновой кислоты GCGR можно анализировать с помощью разнообразных способов, известных в данной области техники. Например, количественную оценку уровня нуклеиновой кислоты-мишени можно выполнить, например, с помощью нозерн-блоттинга, конкурентной полимеразной цепной реакции (ПЦР) или количественной ПЦР в реальном времени. Анализ РНК можно выполнить, используя общую РНК клеток или поли(А)+мРНК. Способы выделения РНК хорошо известны в данной области техники. Нозерн-блоттинг также является стандартной процедурой, известной в данной области техники. Количественную ПЦР в реальном времени удобно осуществлять с использованием доступной для приобретения системы обнаружения последовательностей ABI PRISM® 7600, 7700 или 7900, PE-Applied Biosystems, Фостер-Сити, штат Калифорния, США, в соответствии с инструкциями производителя.

Количественный ПЦР-анализ в реальном времени уровней мРНК-мишени

Количественную оценку уровня РНК-мишени можно осуществлять путем количественной ПЦР в реальном времени с использованием доступной для приобретения системы обнаружения последовательностей ABI PRISM® 7600, 7700 или 7900 (PE-Applied Biosystems, Фостер-Сити, штат Калифорния, США), в соответствии с инструкциями производителя. Способы осуществления количественной ПЦР в реальном времени хорошо известны в данной области техники.

До осуществления ПЦР в реальном времени выделенную РНК подвергают реакции обратной транскриптазы (ОТ), которая продуцирует комплементарную ДНК (кДНК), которую затем используют в качестве субстрата для ПЦР-амплификации в реальном времени. Реакции ОТ и ПЦР в реальном времени осуществляют последовательно в одной и той же лунке. Реагенты для ОТ и ПЦР в реальном времени получили из Invitrogen (Карлсбад, штат Калифорния, США). Реакции ОТ и ПЦР в реальном времени проводят способами, известными специалистам в данной области техники.

Целевые количества гена (или РНК), полученные путем ПЦР в реальном времени, нормируют либо по уровню экспрессии гена, экспрессия которого является постоянной, например, циклофилина А, либо путем количественной оценки общей РНК с использованием RIBOGREEN® (Invitrogen, Inc. Карлсбад, штат Калифорния, США). Экспрессию циклофилина А измеряют с помощью ПЦР в реальном времени, выполняемой одновременно с мишенью, в многоканальном режиме или раздельно. Количественную оценку общей РНК выполняют, используя реагент для количественной оценки РНК RIBOGREEN® (Invitrogen, Inc. Юджин, штат Орегон, США). Способы количественной оценки РНК с помощью RIBOGREEN® описаны в статье Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). Для измерения флуоресценции RIBOGREEN® используют прибор CYTOFLUOR® 4000 (РЕ Applied Biosystems).

Разработаны зонды и праймеры для гибридизации с нуклеиновой кислотой GCGR. Способы конструирования зондов и праймеров для ПЦР в реальном времени хорошо известны в данной области техники и могут включать использование такого программного обеспечения как PRIMER EXPRESS® (Applied Biosystems, Фостер-Сити, штат Калифорния, США).

Анализ уровней белка

Антисмысловое ингибирование нуклеиновых кислот GCGR можно оценивать путем измерения уровня белка GCGR. Уровни белка GCGR можно оценивать или определять количественно с помощью различных способов, хорошо известных в данной области техники, например, иммунопреципитации, вестерн-блоттинга (иммуноблоттинга), твердофазного иммуноферментного анализа (твердофазного ИФА), количественного анализа белка, анализов активности белков (например, анализов активности каспазы), иммуногистохимии, иммуноцитохимии или флуоресцентной сортировки клеток (FACS). Антитела к мишени можно идентифицировать и получить из различных источников, например, каталога антител MSRS (Aerie Corporation, Бирмингем, штат Мичиган, США), или изготовить с помощью общепринятых способов получения моноклональных или поликлональных антител, хорошо известных в данной области техники. Доступны для приобретения антитела, пригодные для обнаружения GCGR человека и крысы.

Тестирование антисмысловых соединений in vivo

Антисмысловые соединения, например, антисмысловые олигонуклеотиды, тестируют на животных с целью оценки их способности ингибировать экспрессию GCGR и производить фенотипические изменения. Тестирование можно проводить на здоровых животных или на экспериментальных моделях заболеваний. Для введения животным получают состав антисмысловых олигонуклеотидов в фармацевтически приемлемом разбавителе, например, фосфатно-солевом буфере. Введение включает введение парентеральным путем. После периода лечения антисмысловыми олигонуклеотидами из ткани выделяют РНК и измеряют изменения в экспрессии нуклеиновой кислоты GCGR. Кроме того, измеряют изменения уровней белка GCGR.

Некоторые показания

В некоторых вариантах воплощения представлены способы лечения индивида, включающие введение одной или более фармацевтических композиций, как описано здесь. В некоторых вариантах воплощения индивид страдает метаболическим заболеванием.

Как показано в примерах, приведенных ниже, соединения, мишенью которых является GCGR, как описано здесь, снижают тяжесть физиологических симптомов метаболических заболеваний, в том числе метаболического синдрома, сахарного диабета, инсулинорезистентности, диабетической дислипидемии, гипертриглицеридемии, ожирения и увеличения веса. В некоторых экспериментах указанные соединения снижали уровень глюкозы в крови, например, животные продолжали испытывать симптомы, но указанные симптомы были ослаблены по сравнению с животными, не получавшими лечения. Вместе с тем, в других экспериментах, по-видимому, указанные соединения ослабляли симптомы диабета; например, животные, получавшие лечение в течение более длительного периода времени, испытывали менее тяжелые симптомы, чем животные, получавшие указанные соединения в течение более короткого периода времени. Вместе с тем, в других экспериментах, по-видимому, указанные соединения подавляли увеличение массы тела; например, животные, получавшие лечение в течение более длительного периода времени, испытывали менее тяжелые симптомы, чем животные, получавшие указанные соединения в течение более короткого периода времени. Вместе с тем, в других экспериментах, по-видимому, указанные соединения ингибировали гипертриглицеридемию; например, животные, получавшие лечение в течение более длительного периода времени, испытывали менее тяжелые признаки и/или симптомы, чем животные, получавшие указанные соединения в течение более короткого периода времени. Способность соединений, примеры которых приведены ниже, восстанавливать функции организма демонстрирует, что симптомы указанного заболевания можно изменить за счет лечения с применением соединения, как описано здесь.

Сахарный диабет характеризуется многочисленными физическими и физиологическими признаками и/или симптомами. Любой симптом, который, как известно специалисту в данной области техники, связан с сахарным диабетом 2 типа, можно улучшить или иным образом регулировать, как изложено выше в способах, описанных выше. В некоторых вариантах воплощения симптом или признак является физическим симптомом или признаком, например, повышенным уровнем глюкозы, повышенной массой тела, частым мочеиспусканием, необычной жаждой, сильным голодом, сильной утомляемостью, размытым зрением, частыми инфекциями, покалыванием или онемением конечностей, сухой и зудящей кожей, потерей массы тела, медленно заживающими язвами и опухшими деснами. В некоторых вариантах воплощения симптом или признак является физиологическим симптомом или признаком, выбранным из группы, состоящей из повышенной инсулинорезистентности, повышенного уровня глюкозы, увеличения массы жировой ткани, снижения скорости метаболизма, снижения клиренса глюкозы, снижения переносимости глюкозы, снижения чувствительности к инсулину, снижения чувствительности печени к инсулину, увеличения размера и массы жировой ткани, повышенного содержания жира и повышенной массы тела.

В некоторых вариантах воплощения указанный физический симптом или признак является повышенным уровнем глюкозы. В некоторых вариантах воплощения указанный признак или симптом является увеличением массы тела. В некоторых вариантах воплощения указанный симптом является частым мочеиспусканием. В некоторых вариантах воплощения указанный симптом является необычной жаждой. В некоторых вариантах воплощения указанный симптом является сильным голодом. В некоторых вариантах воплощения указанный симптом является сильной утомляемостью. В некоторых вариантах воплощения указанный симптом является размытым зрением. В некоторых вариантах воплощения указанный симптом является частыми инфекциями. В некоторых вариантах воплощения указанный симптом является покалыванием или онемением конечностей. В некоторых вариантах воплощения указанный симптом является сухой и зудящей кожей. В некоторых вариантах воплощения указанный признак или симптом является потерей массы тела. В некоторых вариантах воплощения указанный симптом является медленно заживающими язвами. В некоторых вариантах воплощения указанный симптом является распухшими деснами. В некоторых вариантах воплощения указанный симптом или признак является повышенной инсулинорезистентностью. В некоторых вариантах воплощения указанный симптом или признак является повышенным уровнем глюкозы. В некоторых вариантах воплощения указанный симптом или признак является повышенной массой жира. В некоторых вариантах воплощения указанный симптом или признак является сниженной скоростью метаболизма. В некоторых вариантах воплощения указанный симптом или признак является сниженным клиренсом глюкозы. В некоторых вариантах воплощения указанный симптом или признак является сниженной переносимостью глюкозы. В некоторых вариантах воплощения указанный симптом или признак является сниженной чувствительностью к инсулину. В некоторых вариантах воплощения указанный симптом или признак является сниженной чувствительностью печени к инсулину. В некоторых вариантах воплощения указанный симптом или признак является повышенным размером и массой жировой ткани. В некоторых вариантах воплощения указанный симптом или признак является повышенным количеством жира. В некоторых вариантах воплощения указанный симптом или признак является повышенной массой тела.

В некоторых вариантах воплощения представлены способы лечения индивида, включающие введение одной или более фармацевтических композиций, как описано здесь. В некоторых вариантах воплощения индивид страдает метаболическим заболеванием.

В некоторых вариантах воплощения введение антисмыслового соединения, мишенью которого является нуклеиновая кислота GCGR, приводит к снижению экспрессии GCGR по меньшей мере на приблизительно 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 или 99%, или к снижению, описываемому диапазоном, определяемым любыми двумя из указанных значений.

В некоторых вариантах воплощения фармацевтические композиции, включающие антисмысловое соединение, мишенью которого является GCGR, применяют для изготовления медикамента для лечения пациента, страдающего от или подверженного метаболическому заболеванию.

В некоторых вариантах воплощения способы, описанные здесь, включают введение соединения, включающего модифицированный олигонуклеотид, содержащий фрагмент из смежных нуклеиновых оснований, как описано здесь, последовательности, приведенной в SEQ ID NO:11 (ISIS 449884).

В некоторых вариантах воплощения способы, описанные здесь, включают введение соединения, включающего модифицированный олигонуклеотид, содержащий фрагмент из смежных нуклеиновых оснований, как описано здесь, последовательности, приведенной в SEQ ID NO:80 (ISIS 459014).

Некоторые комбинированные терапевтические средства

В некоторых вариантах воплощения одну или более из фармацевтических композиций, описанных здесь, вводят совместно с одним или более другими фармацевтическими агентами. В некоторых вариантах воплощения такие один или более других фармацевтических агентов предназначены для лечения того же заболевания, расстройства или состояния, что и одна или более фармацевтических композиций, описанных здесь. В некоторых вариантах воплощения такие один или более других фармацевтических агентов предназначены для лечения иного заболевания, расстройства или состояния по сравнению с одной или более фармацевтическими композициями, описанными здесь. В некоторых вариантах воплощения такие один или более других фармацевтических агентов предназначены для лечения нежелательного побочного эффекта одной или более фармацевтических композиций, описанных здесь. В некоторых вариантах воплощения одну или более из фармацевтических композиций вводят совместно с еще одним фармацевтическим агентом для лечения нежелательного эффекта указанного другого фармацевтического агента. В некоторых вариантах воплощения одну или более из фармацевтических композиций вводят совместно с еще одним фармацевтическим агентом для получения комбинированного эффекта. В некоторых вариантах воплощения одну или более из фармацевтических композиций вводят совместно с еще одним фармацевтическим агентом для получения синергического эффекта.

В некоторых вариантах воплощения первый агент и один или более из вторых агентов вводят одновременно. В некоторых вариантах воплощения указанный первый агент и один или более из вторых агентов вводят в разное время. В некоторых вариантах воплощения указанный первый агент и один или более из вторых агентов изготовлены вместе друг с другом в одном фармацевтическом составе. В некоторых вариантах воплощения указанный первый агент и один или более из вторых агентов изготавливают раздельно.

В некоторых вариантах воплощения указанное второе соединение вводят перед введением фармацевтической композиции, описанной здесь. В некоторых вариантах воплощения указанное второе соединение вводят после введения фармацевтической композиции, описанной здесь. В некоторых вариантах воплощения указанное второе соединение вводят одновременно с введением фармацевтической композиции, описанной здесь. В некоторых вариантах воплощения доза совместно вводимого второго соединения аналогична дозе, подлежащей введению при введении второго соединения самого по себе. В некоторых вариантах воплощения доза совместно вводимого второго соединения ниже дозы, подлежащей введению при введении второго соединения самого по себе. В некоторых вариантах воплощения доза совместно вводимого второго соединения выше дозы, подлежащей введению при введении второго соединения самого по себе.

В некоторых вариантах воплощения совместное введение второго соединения усиливает эффект первого соединения, так что совместное введение указанных соединений приводит к эффекту, превышающему эффект от введения первого соединения самого по себе. В некоторых вариантах воплощения совместное введение приводит к эффектам, аддитивным по сравнению с эффектами соединений при их введении по отдельности. В некоторых вариантах воплощения совместное введение приводит к эффектам, превышающим аддитивные по сравнению с эффектами соединений при их введении по отдельности. В некоторых вариантах воплощения указанное первое соединение является антисмысловым соединением. В некоторых вариантах воплощения указанное второе соединение является антисмысловым соединением.

В некоторых вариантах воплощения вторые агенты включают агенты, снижающие уровень глюкозы, но не ограничиваются ими. Агенты, снижающие уровень глюкозы, могут включать терапевтическое изменение образа жизни, агонист PPAR, ингибитор дипептидилпептидазы (IV), аналог GLP-1, инсулин или аналог инсулина, стимулятор секреции инсулина, ингибитор SGLT2, аналог амилина человека, бигуанид, ингибитор альфа-глюкозидазы или их комбинацию, но не ограничиваются ими. Агент, снижающий уровень глюкозы, может включать метформин, сульфонилмочевину, розиглитазон, меглитинид, тиазолидиндион, ингибитор альфа-глюкозидазы или их комбинацию, но не ограничивается ими. Сульфонилмочевина может являться ацетогексамидом, хлорпропамидом, толбутамидом, толазамидом, глимепиридом, глипизидом, глибуридом или гликлазидом. Меглитинид может являться натеглинидом или репаглинидом. Тиазолидиндион может являться пиоглитазоном или розиглитазоном. Альфа-глюкозидаза может являться акарбозой или миглитолом.

В некоторых вариантах воплощения терапевтическое средство, снижающее уровень глюкозы, является аналогом GLP-1. В некоторых вариантах воплощения аналог GLP-1 является эксендином-4 или лираглутидом.

В других вариантах воплощения терапевтическое средство, снижающее уровень глюкозы, является сульфонилмочевиной. В некоторых вариантах воплощения сульфонилмочевина является ацетогексамидом, хлорпропамидом, толбутамидом, толазамидом, глимепиридом, глипизидом, глибуридом или гликлазидом.

В некоторых вариантах воплощения препарат, снижающий уровень глюкозы, является бигуанидом. В некоторых вариантах воплощения бигуанид является метформином, и в некоторых вариантах воплощения уровень глюкозы в крови снижается без усиления молочнокислого ацидоза по сравнению с молочнокислым ацидозом, наблюдаемым после лечения только метформином.

В некоторых вариантах воплощения препарат, снижающий уровень глюкозы, является меглитинидом. В некоторых вариантах воплощения меглитинид является натеглинидом или репаглинидом.

В некоторых вариантах воплощения препарат, снижающий уровень глюкозы, является тиазолидиндионом. В некоторых вариантах воплощения тиазолидиндион является пиоглитазоном, розиглитазоном или троглитазоном. В некоторых вариантах уровень глюкозы в крови снижается без большего увеличения массы тела, чем увеличение массы тела, наблюдаемое при лечении только розиглитазоном.

В некоторых вариантах воплощения препарат, снижающий уровень глюкозы, является ингибитором альфа-глюкозидазы. В некоторых вариантах воплощения ингибитор альфа-глюкозидазы является акарбозой или миглитолом.

В некоторых вариантах воплощения совместно вводимый агент, снижающий уровень глюкозы, является ISIS 113715.

В некоторых вариантах воплощения терапевтическое средство, снижающее уровень глюкозы, является терапевтическим изменением образа жизни.

В некоторых вариантах воплощения вторые агенты включают агенты, снижающие уровень липидов, но не ограничиваются ими. Агент, снижающий уровень липидов, может включать аторвастатин, симвастатин, розувастатин и эзетимиб, но не ограничивается ими. В некоторых из таких вариантов воплощения агент, снижающий уровень липидов, вводят перед введением фармацевтической композиции, описанной здесь. В некоторых из таких вариантов воплощения агент, снижающий уровень липидов, вводят после введения фармацевтической композиции, описанной здесь. В некоторых из таких вариантов воплощения агент, снижающий уровень липидов, вводят одновременно с введением фармацевтической композиции, описанной здесь. В некоторых из таких вариантов воплощения доза совместно вводимого агента, снижающего уровень липидов, аналогична дозе, подлежащей введению при введении агента, снижающего уровень липидов, самого по себе. В некоторых из таких вариантов воплощения доза совместно вводимого агента, снижающего уровень липидов, ниже дозы, подлежащей введению при введении агента, снижающего уровень липидов, самого по себе. В некоторых из таких вариантов воплощения доза совместно вводимого агента, снижающего уровень липидов, выше дозы, подлежащей введению при введении агента, снижающего уровень липидов, самого по себе.

В некоторых вариантах воплощения совместно вводимый агент, снижающий уровень липидов, является ингибитором ГМГ-КоА-редуктазы. В некоторых из таких вариантов воплощения ингибитор ГМГ-КоА-редуктазы является статином. В некоторых из таких вариантов воплощения статин выбран из аторвастатина, симвастатина, правастатина, флувастатина и розувастатина.

В некоторых вариантах воплощения совместно вводимый агент, снижающий уровень липидов, является ингибитором всасывания холестерина. В некоторых из таких вариантов воплощения ингибитор всасывания холестерина является эзетимибом.

В некоторых вариантах воплощения совместно вводимый агент, снижающий уровень липидов, является совместно составленным ингибитором ГМГ-КоА-редуктазы и ингибитором всасывания холестерина. В некоторых из таких вариантов воплощения указанный совместно составленный агент, снижающий уровень липидов, является эзетимибом/симвастатином.

В некоторых вариантах воплощения совместно вводимый агент, снижающий уровень липидов, является ингибитором микросомального транспортного белка триглицеридов (ингибитором МТР).

В некоторых вариантах воплощения совместно вводимый агент, снижающий уровень липидов, является олигонуклеотидом, мишенью которого является АроВ.

В некоторых вариантах воплощения вторые агенты включают агент или препарат против ожирения, но не ограничиваются им. Такие агенты против ожирения включают орлистат, сибутрамин или римонабант, но не ограничиваются ими; их можно вводить, как описано выше, в качестве агентов, снижающих количество жировой ткани или массу тела. В некоторых вариантах воплощения указанное антисмысловое соединение можно совместно вводить с препаратом для подавления аппетита. Такие препараты для подавления аппетита включают диэтилпропиона тенуат, мазиндол, орлистат, фендиметразин, фентермин и сибутрамин, но не ограничиваются ими; их можно вводить, как описано здесь. В некоторых вариантах воплощения агенты против ожирения основаны на действии на ЦНС, например, сибутрамин, но не ограничиваются им, или основаны на GLP-1, например, лираглутид, но не ограничиваются им.

Составы

Соединения, представленные здесь, также можно смешивать, конъюгировать или иным образом связывать с другими молекулами, молекулярными структурами или смесями соединений, например, липосомами, молекулами, мишенями которых являются рецепторы, или другими составами для содействия процессам поглощения, распределения и/или всасывания. Типичные патенты США, содержащие информацию о получении таких составов для содействия процессам поглощения, распределения и/или всасывания, включают патенты США 5108921, 5354844, 5416016, 5459127, 5521291, 5543158, 5547932, 5583020, 5591721, 4426330, 4534899, 5013556, 5108921, 5213804, 5227170, 5264221, 5356633, 5395619, 5416016, 5417978, 5462854, 5469854, 5512295, 5527528, 5534259, 5543152, 5556948, 5580575 и 5595756, каждый из которых включен сюда посредством ссылки, но не ограничиваются ими.

Антисмысловые соединения, представленные здесь, можно включать в фармацевтическую композицию или состав. Фармацевтические композиции могут включать любые фармацевтически приемлемые соли, сложные эфиры или соли таких эфиров, или любое другое соединение, которое при введении в организм животного, в том числе человека, способно обеспечить (прямо или косвенно) биологически активный метаболит или его остаток.

Термин "фармацевтически приемлемые соли" относится к физиологически и фармацевтически приемлемым солям соединений, представленных здесь, т.е. солям, сохраняющим желательную биологическую активность исходного соединения и не придающим ему нежелательного токсического действия. Термин "фармацевтически приемлемая соль" включает соль, полученную из фармацевтически приемлемых нетоксичных кислот или оснований, в том числе неорганических или органических кислот и оснований. Для олигонуклеотидов предпочтительные примеры фармацевтически приемлемых солей и их применение дополнительно описаны в патенте США 6287860, полностью включенном сюда посредством ссылки. Показано, что соли натрия являются подходящими формами олигонуклеотидных препаратов.

Термин "фармацевтически приемлемое производное" охватывает фармацевтически приемлемые соли, сольваты, гидраты, сложные эфиры, пролекарства, полиморфы, изомеры, изотопно меченые варианты соединений, описанных здесь, но не ограничивается ими.

Фармацевтические композиции, описанные здесь, можно вводить различными путями в зависимости от предпочтительности местного или системного применения и от обрабатываемой области. Введение может быть парентеральным. Парентеральное введение включает подкожную, внутривенную или внутримышечную инъекцию или вливание, но не ограничивается ими.

Парентеральное введение предпочтительно для адресного воздействия на экспрессию GCGR в печени и плазме. Считается, что олигонуклеотиды, содержащие по меньшей мере одну 2′-O-метоксиэтил-модификацию, особенно пригодны для парентерального введения.

Фармацевтические составы, описанные здесь, которые можно представить в виде дозированной лекарственной формы, можно получить в соответствии с традиционными методиками, широко известными в фармацевтической промышленности. Такие методики включают этап объединения активных ингредиентов с фармацевтическим(и) носителем(ями) или вспомогательным(и) веществом(ами). В общем случае составы получают путем равномерного и тщательного смешивания активных ингредиентов с жидкими носителями или тонко измельченными твердыми носителями, или и теми и другими.

Композиции, описанные здесь, также можно составить в виде суспензий в водных, неводных или смешанных средах. Суспензии также могут содержать стабилизаторы.

Фармацевтические композиции, описанные здесь, включают растворы, эмульсии и составы, содержащие липосомы, но не ограничиваются ими. Фармацевтические композиции и составы, описанные здесь, могут включать один или более усилителей проницаемости, носителей, вспомогательных веществ или других активных или неактивных ингредиентов.

Составы включают липосомные составы. Для целей настоящего изобретения термин "липосома" означает везикулу, состоящую из амфифильных липидов, упорядоченных в виде сферического бислоя или бислоев. Липосомы являются моноламеллярными или мультиламеллярными везикулами, обладающими мембраной, сформированной из липофильного материала, и водным содержимьм, содержащим доставляемую композицию. Катионные липосомы являются положительно заряженными липосомами, которые, как считается, взаимодействуют с отрицательно заряженными молекулами ДНК, образуя стабильный комплекс. Считается, что липосомы, являющиеся рН-чувствительными или отрицательно заряженными, захватывают ДНК, а не образуют с ней комплекс. Как катионные, так и некатионные липосомы используют для доставки ДНК в клетки.

Липосомы также включают "стерически стабилизированные" липосомы; этот термин в настоящем описании относится к липосомам, включающим один или более специализированных липидов, которые при внедрении в липосомы приводят к улучшению времени жизни в крови по сравнению с липосомами, в которых такие специализированные липиды отсутствуют. Липосомы и их применение дополнительно описаны в патенте США 6287860, полностью включенном сюда посредством ссылки.

В еще одном варианте воплощения составы включают составы на основе физиологического раствора. В некоторых вариантах воплощения состав состоит из соединений, описанных здесь, и физиологического раствора. В некоторых вариантах воплощения состав главным образом состоит из соединений, описанных здесь, и физиологического раствора. В некоторых вариантах воплощения физиологический раствор является фармацевтически приемлемым физиологическим раствором. В некоторых вариантах воплощения физиологический раствор является забуференным физиологическим раствором. В некоторых вариантах воплощения физиологический раствор является фосфатно-солевым буфером (PBS).

В некоторых вариантах воплощения состав не содержит липосом. В некоторых вариантах воплощения состав не содержит стерически стабилизированных липосом. В некоторых вариантах воплощения состав не содержит фосфолипидов. В некоторых вариантах воплощения состав главным образом состоит из соединений, описанных здесь, и физиологического раствора и не содержит липосом.

Фармацевтические составы и композиции также могут включать поверхностно активные вещества. Поверхностно активные вещества и их применение дополнительно описаны в патенте США 6287860, полностью включенном сюда посредством ссылки.

В одном варианте воплощения настоящее изобретение использует различные усилители проницаемости для эффективной доставки нуклеиновых кислот, в частности, олигонуклеотидов. Усилители проницаемости и их применение дополнительно описаны в патенте США 6287860, полностью включенном сюда посредством ссылки.

Специалист в данной области техники должен осознавать, что составы изготавливают с применением стандартных методик в соответствии с их предполагаемым применением, т.е. путем введения.

Композиции и составы для парентерального введения, в том числе подкожной, внутривенной и внутримышечной инъекции или вливания, могут включать стерильные водные растворы, которые также могут содержать буферы, разбавители и другие подходящие добавки, например, усилители проницаемости, соединения-носители и другие фармацевтически приемлемые носители или вспомогательные вещества, не ограничиваясь ими.

В другом родственном варианте воплощения композиции, представленные здесь, могут содержать одно или более антисмысловых соединений, в частности, олигонуклеотидов, мишенью которых является первая нуклеиновая кислота, и одно или более дополнительных антисмысловых соединений, мишенью которых является вторая нуклеиновая кислота-мишень. В качестве альтернативы композиции, представленные здесь, могут содержать два или более антисмысловых соединений, мишенями которых являются разные области одной и той же нуклеиновой кислоты-мишени. В данной области техники известно большое количество примеров антисмысловых соединений. Два или более объединенных соединений можно применять совместно или последовательно.

Прием доз

Прием доз зависит от тяжести и реакции заболевания, подлежащего лечению, причем курс лечения продолжается от нескольких дней до нескольких месяцев или пока лечение не подействует, или до ослабления болезненного состояния. Оптимальную схему введения можно рассчитать на основании измерений накопления лекарственного средства в организме пациента. Оптимальные дозировки могут варьировать в зависимости от относительной эффективности отдельных олигонуклеотидов; в общем случае их можно оценить на основании значений ЕС50, эффективных in vitro и в животных моделях in vivo. В общем случае дозировка составляет от 0,01 мкг до 100 г на кг массы тела и может вводиться один или несколько раз в сутки, в неделю, в месяц или в год, или с желательным интервалом. После успешного лечения для пациента может быть желательна поддерживающая терапия для предотвращения рецидива болезненного состояния, в ходе которой олигонуклеотид вводят в поддерживающих дозах, в диапазоне от 0,01 мкг до 100 г на кг массы тела один или несколько раз в день.

Хотя настоящее изобретение специфически описано по отношению к некоторым из его предпочтительных вариантов воплощения, следующие примеры служат только для иллюстрирования изобретения и не должны ограничивать его. Каждая из библиографических ссылок, учетных номеров GenBank и т.п., упоминающихся в настоящей заявке, полностью включена сюда посредством ссылки.

Некоторые соединения

Протестировано влияние приблизительно семисот семидесяти семи вновь сконструированных и ранее описанных антисмысловых соединений различной длины, содержащих различные мотивы и каркасные структуры, на мРНК GCGR человека in vitro в нескольких типах клеток (Пример 1). Новые соединения сравнивали с ранее сконструированными соединениями, в том числе ISIS 310457, ISIS 315163 и ISIS 325568, которые, как определили ранее, являются одними из самых мощных антисмысловых соединений in vitro (см., например, патентную публикацию США №патент США №7399853 и опубликованную патентную заявку США №US2007-0087987). Из указанных приблизительно семисот семидесяти семи вновь сконструированных и ранее описанных антисмысловых соединений представлены только соединения, выбранные для дальнейшего исследования на основании их эффективности in vitro. Дозозависимое ингибирование с помощью выбранных соединений протестировали в первичных гепатоцитах яванского макака и клетках HepG2 (Примеры 5-13). Из 120 соединений, протестированных в анализах зависимости доза-ответ, выбрали 33 антисмысловых олигонуклеотида для анализов переносимости in vivo.

Выбранные в конечном счете 33 олигонуклеотида, ISIS 304538 (SEQ ID NO:112), ISIS 304539 (SEQ ID NO:113), ISIS 325568 (SEQ ID NO:4), ISIS 398457 (SEQ ID NO:9), ISIS 398471 (SEQ ID NO:17), ISIS 398486 (SEQ ID NO:24), ISIS 398491 (SEQ ID NO:105), ISIS 398506 (SEQ ID NO:108), ISIS 398507 (SEQ ID NO:109), ISIS 398508 (SEQ ID NO:110), ISIS 436034 (SEQ ID NO:35), ISIS 436140 (SEQ ID NO:102), ISIS 436141 (SEQ ID NO:114), ISIS 448718 (SEQ ID NO:99), ISSI 448730 (SEQ ID NO:100), ISIS 448754 (SEQ ID NO:98), ISIS 448766 (SEQ ID NO:31), ISIS 448817 (SEQ ID NO:52), ISIS 448818 (SEQ ID NO:56), ISIS 448819 (SEQ ID NO:58), ISIS 448848 (SEQ ID NO:62), ISIS 448860 (SEQ ID NO:65), ISIS 448890 (SEQ ID NO:68), ISIS 449884 (SEQ ID NO:11), ISIS 449954 (SEQ ID NO:51), ISIS 449956 (SEQ ID NO:54), ISIS 459014 (SEQ ID NO:80), ISIS 459024 (SEQ ID NO:89), ISIS 459032 (SEQ ID NO:81), ISIS 459040 (SEQ ID NO:82), ISIS 459046 (SEQ ID NO:83), ISIS 459076 (SEQ ID NO:84) и ISIS 459157 (SEQ ID NO:85), протестировали на переносимость в модели мыши CD1, а также в модели крысы Sprague-Dawley.

Указанные соединения комплементарны областям 548-567, 2016-2035 и 2018-2037 SEQ ID NO:1, и 6682-6698, 7267-7283, 7270-7286, 7292-7308, 7295-7311, 7316-7332, 7317-7333, 7319-7335, 7341-7357, 7344-7360, 7365-7381, 7368-7384, 7389-7405, 7392-7408, 7416-7432, 7437-7453, 7440-7456, 7783-7799, 803O-8049, 8133-8152, 8141-8160, 8144-8160, 9002-9021, 9008-9027, 9245-9264, 9246-9262, 9804-9823, 10676-10695, 10718-10734, 12030-12049, 12031-12050, 12031-12047, 12032-12051, 12033-12052, 12033-12049, 12036-12055, 12175-12194, 12178-12194, 13490-13509, 14138-14157, 15075-15094, 15743-15762, 15744-15763, 15745-15764 и 15746-15765 SEQ ID NO:2.

В моделях in vivo измеряли массу тела и массу органов, маркеры функции печени (например, аланинтрансаминазу, аспартаттрансаминазу и билирубин) и маркеры функции почек (например, АМК и креатинин). В модели мыши ISIS 304538, ISIS 325568, ISIS 398457, ISIS 398471, ISIS 398491, ISIS 436140, ISIS 448754, ISIS 448766, ISIS 448818, ISIS 449884, ISIS 449956, ISIS 459014, ISIS 459024, ISIS 459032, ISIS 459040, ISIS 459046, ISIS 459076 и ISIS 459157 хорошо переносились, согласно уровням трансаминаз (Пример 11). В модели крысы Sprague-Dawley ISIS 325568, ISIS 398457, ISIS 398471, ISIS 398491, ISIS 436140, ISIS 448730, ISIS 448754, ISIS 448817, ISSI 448818, ISIS 448848, ISIS 449884, ISIS 449956, ISIS 459014, ISIS 459032, ISIS 459040, ISIS 459046, ISIS 459076 и ISIS 459157 считались хорошо переносимыми, согласно уровням маркеров функции как печени, так и почек (Пример 12).

Девять соединений, ISIS 325568 (SEQ ID NO:4), ISIS 398471 (SEQ ID NO:17), ISIS 436140 (SEQ ID NO:102), ISIS 448766 (SEQ ID NO:31), ISIS 449884 (SEQ ID NO:11), ISIS 459014 (SEQ ID NO:80), ISIS 459032 (SEQ ID NO:81), ISIS 459040 (SEQ ID NO:82) и ISIS 459157 (SEQ ID NO:85), выбрали на основании моделей переносимости и проанализировали на долгосрочные эффекты переносимости в модели крысы CD/1GS в течение 13 недель (Пример 13). Измеряли массу органов, маркеры функции печени (например, аланинтрансаминазу, аспартаттрансаминазу и билирубин) и маркеры функции почек (например, АМК и креатинин). Кроме того, протестировали вязкость указанных девяти соединений; установлено, что вязкость была оптимальна для всех олигонуклеотидов (Пример 14).

Период полувыведения ISIS 449884, продемонстрировавшего очень хорошую переносимость во всех трех моделях in vivo, протестировали в печени мыши CD1 (Пример 15). Рассчитанный период полувыведения ISIS 449884 составил 15 дней.

Окончательная оценка указанных исследований (Примеры 11-15) привела к выбору восьми олигонуклеотидов, обладающих последовательностью нуклеиновых оснований SEQ ID NO:17 (ISIS 398471), 102 (ISIS 436140), 31 (ISIS 448766), 11 (ISIS 449884), 80 (ISIS 459014), 81 (ISIS 459032), 82 (ISIS 459040) или 85 (ISIS 459157). Указанные соединения комплементарны областям 7267-7283, 727O-7286, 7292-7308, 7295-7311, 7316-7332, 7319-7335, 7341-7357, 7344-7360, 7437-7453, 7365-7381, 7368-7384, 7389-7405, 7392-7408, 7416-7432, 744O-7456, 7783-7799, 8133-8152, 8144-8160, 9804-9823, 10718-10734, 15743-15762 SEQ ID NO:2. В некоторых вариантах воплощения соединения, мишенями которых являются перечисленные области, как дополнительно описано здесь, включают модифицированный олигонуклеотид, содержащий определенный нуклеотидный фрагмент последовательности, упомянутой в SEQ ID NOs, как дополнительно описано здесь. В некоторых вариантах воплощения соединения, мишенями которых являются перечисленные области или содержащие нуклеотидный фрагмент последовательности, упомянутой в перечисленных в SEQ ID NOs, могут быть различной длины, как дополнительно описано здесь, и могут содержать один из различных мотивов, как дополнительно описано здесь. В некоторых вариантах воплощения соединение, мишенью которого является область, или содержащее нуклеотидный фрагмент последовательности, упомянутой в перечисленных SEQ ID NOs, обладает определенной длиной и мотивом, как указано в ISIS NOs:398471, 436140, 448766, 449884, 459014, 459032, 459040 и 459157.

Активность, фармакокинетический профиль и переносимость указанных восьми соединений протестировали на яванских макаках (Пример 16). Лечение с помощью некоторых из указанных соединений вызывало снижение экспрессии мРНК GCGR в ткани печени. Конкретно, лечение с помощью ISIS 449884, ISIS 459157 и ISIS 325568 вызывало значительное снижение экспрессии мРНК GCGR в ткани печени по сравнению с PBS-контролем. Отмечено, что ISIS 449884 вызывало наибольшее снижение экспрессии мРНК GCGR по сравнению с PBS-контролем. Повышенный уровень глюкагона является последствием ингибирования уровней мРНК GCGR. Лечение с помощью ISIS 325568, ISIS 448766, ISIS 459157 и ISIS 449884 вызывало значительное повышение уровней глюкагона в плазме, причем ISIS 449884 вызывало наибольшее повышение. Таким образом, с точки зрения активности, ISIS 449884 являлось наиболее эффективным в исследовании на обезьянах. Лечение указанными соединениями, в частности, лечение ISIS 449884, хорошо переносилось обезьянами.

Соответственно, здесь представлены антисмысловые соединения с улучшенными одной или более характеристиками. В некоторых вариантах воплощения соединения, описанные здесь, являются эффективными в силу того, что они обладают по меньшей мере одним из значений IC50 m vitro менее 0,1 мкМ, менее 0,2 мкМ, менее 0,4 мкМ, менее 0,35 мкМ, менее 0,3 мкМ, менее 2,5 мкм, менее 2,0 мкМ, менее 1,5 мкМ, менее 1,0 мкМ, при доставке в клетки линии HepG2 с использованием электропорации, как описано в Примерах 8-11. В некоторых из таких вариантов воплощения указанные соединения комплементарны одной или более из областей 548-567, 2016-2035 и 2018-2037 SEQ ID NO:1, и 6682-6698, 7267-7283, 7270-7286, 7292-7308, 7295-7311, 7316-7332, 7317-7333, 7319-7335, 7341-7357, 7344-7360, 7365-7381, 7368-7384, 7389-7405, 7392-7408, 7416-7432, 7437-7453, 7440-7456, 7783-7799, 8030-8049, 8133-8152, 8141-8160, 8144-8160, 9002-9021, 9008-9027, 9245-9264, 9246-9262, 9804-9823, 10676-10695, 10718-10734, 12030-12049, 12031-12050, 12031-12047, 12032-12051, 12033-12052, 12033-12049, 12036-12055, 12175-12194, 12178-12194, 13490-13509, 14138-14157, 15075-15094, 15743-15762, 15744-15763, 15745-15764 и 15746-15765 SEQ ID NO:2.

В некоторых вариантах воплощения соединения, описанные здесь, хорошо переносятся, на что указывает по меньшей мере одно из повышения значения АЛТ или ACT не более чем приблизительно в 100 раз, приблизительно в 60 раз, приблизительно в 50 раз, приблизительно в 40 раз, приблизительно в 30 раз, приблизительно в 25 раз, приблизительно в 10 раз, приблизительно в 5 раз, приблизительно в 4 раза, приблизительно в 3 раза или приблизительно в 2 раза по сравнению с животными, получавшими физиологический раствор; или увеличение массы печени, селезенки или почки не более чем приблизительно на 30%, приблизительно на 20%, приблизительно на 15%, приблизительно на 12%, приблизительно на 10%, приблизительно на 5% или приблизительно на 2%, как описано в Примерах. В некоторых из таких вариантов воплощения указанные соединения комплементарны одной или более из областей 7267-7283, 7270-7286, 7292-7308, 7295-7311, 7316-7332, 7319-7335, 7341-7357, 7344-7360, 7437-7453, 7365-7381, 7368-7384, 7389-7405, 7392-7408, 7416-7432, 7440-7456, 7783-7799, 8133-8152, 8144-8160, 9804-9823, 10718-10734, 15743-15762 SEQ ID NO:2.

ПРИМЕРЫ

Неограничивающее описание и включение посредством ссылок Хотя определенные соединения, композиции и способы, описываемые в настоящей заявке, были специфически описаны в рамках определенных вариантов воплощения, следующие примеры служат лишь для иллюстрирования соединений, описанных здесь, и не должны ограничиваться только такими же соединениями. Каждая из библиографических ссылок, упоминающихся в настоящей заявке, полностью включена сюда посредством ссылки.

Пример 1: Антисмысловое ингибирование рецептора глюкагона человека (GCGR) в клетках HepG2

Сконструировали антисмысловые олигонуклеотиды, мишенью которых являлась нуклеиновая кислота GCGR, и протестировали их воздействие на мРНК GCGR in vitro. Кроме того, протестировали ISIS 310457, описанное в более ранней публикации (WO 2007/035771). Культивируемые клетки HepG2 при плотности 40000 клеток на лунку трансфицировали 4000 нМ антисмыслового олигонуклеотида с помощью электропорации. После периода обработки продолжительностью приблизительно 24 часа из клеток выделяли РНК и измеряли уровни мРНК GCGR с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зондов человека RTS1508 (прямая последовательность GACACCCCCGCCAATACC, обозначаемая здесь как SEQ ID NO:116; обратная последовательность CCGCATCTCTTGAACACGAA, обозначаемая здесь как SEQ ID NO:117; последовательность зонда TTGGCACCACAAAGT, обозначаемая здесь как SEQ ID NO:118). Уровни мРНК GCGR корректировали в зависимости от общего содержания РНК, измеренного с помощью RIBOGREEN®. Результаты представлены в виде процентного ингибирования GCGR по сравнению с необработанными контрольными клетками. Всего протестировали 309 олигонуклеотидов. В Таблице 1 показаны только олигонуклеотиды, выбранные для анализов зависимости доза-ответ.

Вновь сконструированные химерные антисмысловые олигонуклеотиды в Таблице 1 были сконструированы в виде 3-10-4 МОЕ-гэпмеров или 5-10-5 МОЕ-гэпмеров. 3-10-4 МОЕ-гэпмеры обладали длиной 17 нуклеозидов, причем центральный сегмент разрыва включал десять 2′-дезоксинуклеозидов и был фланкирован сегментом крыла с 5′-направления, включавшим три нуклеозида, и сегментом крыла с 3′-направления, включавшим четыре нуклеозида. 5-10-5 МОЕ-гэпмеры обладали длиной 20 нуклеозидов, причем центральный сегмент разрыва включал десять 2′-дезоксинуклеозидов и был фланкирован сегментами крыльев с 5′-направления и 3′-направления, включавшими по пять нуклеозидов. Каждый нуклеозид в сегменте 5′-крыла и каждый нуклеозид в сегменте 3′-крыла содержал модификацию 2′-МОЕ. Межнуклеозидные связи на всем протяжении каждого гэпмера являлись фосфоротиоатными (P=S) связями. Все остатки цитозина на всем протяжении каждого гэпмера являлись остатками 5-метилцитозина. "Сайт инициации" означал последний 5′-нуклеозид, являвшийся мишенью гэпмера в последовательности гена человека. "Стоп-сайт" означал последний 3′-нуклеозид, являвшийся мишенью гэпмера в последовательности гена человека. Мишенью каждого гэпмера из перечисленных в Таблице 1 являлась либо мРНК GCGR человека, обозначаемая здесь как SEQ ID NO:1 (учетный номер GENBANK NM_000160.3), либо геномная последовательность GCGR человека, обозначаемая здесь как SEQ ID NO:2 (учетный номер GENBANK NW_926918.1, укороченная с нуклеотида 16865000 до 16885000). "н/д" указывает, что указанная конкретная последовательность гена не являлась мишенью указанного антисмыслового олигонуклеотида.

Таблица 1
Ингибирование уровней мРНК GCGR человека химерными антисмысловыми олигонуклеотидами, мишенями которых являлись SEQ ID NO:1 и SEQ ID NO:2
ISIS NO SEQ ID NO:1 сайт инициации SEQ ID NO:1 стоп-сайт Последовательность % ингибирования Мотив SEQ ID NO:2 сайт инициации SEQ ID NO:2 стоп-сайт SEQ ID NO
310457 548 564 GCACTTTGTGGTGCCAAGGC 88 5-10-5 н/д н/д 4
449823 1098 1114 GCACCCCAGCCGATGCC 91 3-10-4 н/д н/д 5
450035 н/д н/д AGCCCTGGCCGGTCCTT 82 3-10-4 6691 6707 6
449881 н/д н/д TCCCGAGGTGCCCAATG 89 3-10-4 7267 7283 7
7292 7308
7316 7332
7341 7357
7365 7381
7389 7405
7437 7453
449882 н/д н/д TTCCCGAGGTGCCCAAT 87 3-10-4 7268 7284 8
7293 7309
7317 7333
7342 7358
7366 7382
7390 7406
7414 7430
7438 7454
398457 н/д н/д GGGTTCCCGAGGTGCCCAAT 95 3-10-4 7268 7287 9
7293 7312
7317 7336
7342 7361
7366 7385
7390 7409
7414 7433
7438 7457
449883 н/д н/д GTTCCCGAGGTGCCCAA 98 3-10-4 7269 7285 10
7294 7310
7318 7334
7343 7359
7367 7383
7391 7407
7415 7431
7439 7455
449884 н/д н/д GGTTCCCGAGGTGCCCA 94 3-10-4 7270 7286 11
7295 7311
7319 7335
7344 7360
7368 7384
7392 7408
7416 7432
7440 7456
449885 н/д н/д GGGTTCCCGAGGTGCCC 93 3-10-4 7271 7287 12
7296 7312
7320 7336
7345 7361
7369 7385
7393 7409
7417 7433
7441 7457
450039 н/д н/д TGATCTCACCCAGCCCT 88 3-10-4 7740 7756 13
449894 н/д н/д AAGGTGACACCAGCCTG 92 3-10-4 7782 7798 14
449895 н/д н/д CTGAAGGTGACACCAGC 90 3-10-4 7785 7801 15
450040 н/д н/д TTCCAGCTGAGCACCCA 84 3-10-4 7897 7913 16
398471 н/д н/д TCCACAGGCCACAGGTGGGC 80 5-10-5 8133 8152 17
449905 н/д н/д GCATCCACAGGCCACAG 85 3-10-4 8139 8155 18
449906 н/д н/д AGCATCCACAGGCCACA 90 3-10-4 8140 8156 19
449907 н/д н/д CAGCATCCACAGGCCAC 85 3-10-4 8141 8157 20
449908 н/д н/д CTCAGCATCCACAGGCC 84 3-10-4 8143 8159 21
449910 н/д н/д AGCCACTGGGAGCACCC 85 3-10-4 8386 8402 22
449912 н/д н/д GGCTCTGCCCCAACTCT 82 3-10-4 8448 8464 23
398486 н/д н/д GTGAGCAGCCATGCAGGCTT 95 5-10-5 9002 9021 24
449916 н/д н/д GAGCAGCCATGCAGGCT 86 3-10-4 9003 9019 25
449917 н/д н/д TGAGCAGCCATGCAGGC 90 3-10-4 9004 9020 26
449922 н/д н/д GCCAGGTGAGCAGCCAT 86 3-10-4 9010 9026 27
450049 н/д н/д AGGGACAGGCACCTGCG 87 3-10-4 9130 9146 28
450050 н/д н/д GCCTGGATTTTAGCCTC 84 3-10-4 9249 9265 29
448762 н/д н/д CGGGGTGGCAACAGCTACAC 80 5-10-5 9592 9611 30
448766 н/д н/д GCAAGGCTCGGTTGGGCTTC 86 5-10-5 9804 9823 31
450054 н/д н/д TGCAAGGCTCGGTTGGG 82 3-10-4 9808 9824 32
449759 176 192 GCAGAGCAGCAGAGCCT 80 3-10-4 10667 10683 33
449760 177 193 GGCAGAGCAGCAGAGCC 88 3-10-4 10668 10684 34
436034 185 204 GGCAGCTGAGTGGCAGAGCA 72 5-10-5 10676 10695 35
450059 281 297 GCATGCCTCTGGGCAGC 88 3-10-4 10772 10788 36
448799 н/д н/д AGGCACAGGCTGAAAGGCTC 80 5-10-5 11667 11686 37
449938 н/д н/д AGGCCAGGCACAGGCTG 92 3-10-4 11675 11691 38
448802 н/д н/д GCTGAGGCCAGGCACAGGCT 87 5-10-5 11676 11695 39
398585 н/д н/д GGCTGCATAAGCACCCAGGA 87 5-10-5 11724 11743 40
449944 н/д н/д CTGCATAAGCACCCAGG 84 3-10-4 11725 11741 41
449945 н/д н/д CCCAGCTCTGTGGCTCA 90 3-10-4 11819 11835 42
448806 н/д н/д GTCCCCAGCTCTGTGGCTCA 96 5-10-5 11819 11838 43
450061 н/д н/д GCAAGTCCCCAGCTCTG 91 3-10-4 11826 11842 44
449948 н/д н/д CGCCCTGGCACTGTCTG 88 3-10-4 11962 11978 45
449949 н/д н/д GTGTCCAGGCCATGATA 88 3-10-4 12026 12042 46
449951 н/д н/д AAGTGTCCAGGCCATGA 93 3-10-4 12028 12044 47
398504 н/д н/д CCCAAGTGTCCAGGCCATGA 91 5-10-5 12028 12047 48
449952 н/д н/д CAAGTGTCCAGGCCATG 90 3-10-4 12029 12045 49
449953 н/д н/д CCAAGTGTCCAGGCCAT 91 3-10-4 12030 12046 50
449954 н/д н/д CCCAAGTGTCCAGGCCA 92 3-10-4 12031 12047 51
448817 н/д н/д CACCCCAAGTGTCCAGGCCA 98 5-10-5 12031 12050 52
449955 н/д н/д CCCCAAGTGTCCAGGCC 94 3-10-4 12032 12048 53
449956 н/д н/д ACCCCAAGTGTCCAGGC 89 3-10-4 12033 12049 54
449958 н/д н/д GCACCCCAAGTGTCCAG 93 3-10-4 12035 12051 55
448818 н/д н/д CCCTGCACCCCAAGTGTCCA 83 5-10-5 12036 12055 56
449960 н/д н/д AAACCTGTGGCTGCCAC 93 3-10-4 12175 12191 57
448819 н/д н/д GCCAAACCTGTGGCTGCCAC 95 5-10-5 12175 12194 58
449797 733 749 GGACAGGCTGTAGCCCA 83 3-10-4 13034 13050 59
448840 н/д н/д GGCTCACTCCATCACTGAGC 82 5-10-5 13314 13333 60
449967 н/д н/д CCACCTGCCTGGCTGCC 89 3-10-4 13366 13382 61
448848 1024 1043 GTGCAGGTACAGGCCCTCCA 92 5-10-5 13490 13509 62
448850 1049 1068 GGAGGGTGGCCAGGCCCAGC 80 5-10-5 13515 13534 63
449819 1093 1109 CCAGCCGATGCCCAGGT 82 3-10-4 13559 13575 64
448860 н/д н/д GGCCAGTGTCCTGGTGTCCT 79 5-10-5 14138 14157 65
449836 1467 1483 GCCACCAGCAGGCCCTG 87 3-10-4 14779 14795 66
450074 н/д н/д GGGCTGAGGCCAACCTG 91 3-10-4 15007 15023 67
448890 н/д н/д GCCACCCAGCATCGCCACGG 86 5-10-5 15075 15094 68
448897 н/д н/д CCCTGCTGGGCACAGCTATG 83 5-10-5 15094 15113 69
448901 н/д н/д CACAAGCTCCCTGCTGGGCA 82 5-10-5 15102 15121 70
448903 н/д н/д GAGCGACACAAGCTCCCTGC 86 5-10-5 15108 15127 71
448905 н/д н/д GGTGCAGAGCGACACAAGCT 81 5-10-5 15114 15133 72
449851 1646 1662 GGCTGCCACCACCCCTC 88 3-10-4 15374 15390 73
449856 2016 2032 CTTTATTGTTGGAGGAC 85 3-10-4 15744 15760 74
449858 2018 2034 CTCTTTATTGTTGGAGG 85 3-10-4 15746 15762 75
449859 2019 2035 GCTCTTTATTGTTGGAG 91 3-10-4 15747 15763 76
449860 2020 2036 AGCTCTTTATTGTTGGA 88 3-10-4 15748 15764 77
449861 2021 2037 GAGCTCTTTATTGTTGG 81 3-10-4 15749 15765 78

Пример 2: Антисмысловое ингибирование рецептора глюкагона человека (GCGR) в клетках HepG2

Сконструировали дополнительные антисмысловые олигонуклеотиды, мишенью которых являлась нуклеиновая кислота GCGR, и протестировали их воздействие на мРНК GCGR in vitro. Кроме того, протестировали ISIS 315163 (ACCTGGAAGCTGCTGTACAT (SEQ ID NO 79); сайт инициации в SEQ ID NO:1 является 702; сайт инициации в SEQ ID NO:2 является 13003), описанное в более ранней публикации (WO 2004/096016). Культивируемые клетки HepG2 при плотности 40000 клеток на лунку трансфицировали 1000 нМ антисмыслового олигонуклеотида с помощью электропорации. После периода обработки продолжительностью приблизительно 24 часа из клеток выделяли РНК и измеряли уровни мРНК GCGR с помощью количественной ПЦР в реальном времени и набора праймеров и зондов человека RTS1508. Уровни мРНК GCGR корректировали в зависимости от общего содержания РНК, измеренного с помощью RIBOGREEN®. Результаты представлены в виде процентного ингибирования GCGR по сравнению с необработанными контрольными клетками. Всего протестировали 156 антисмысловых олигонуклеотидов. В Таблице 2 показаны только олигонуклеотиды, выбранные для анализов зависимости доза-ответ.

Вновь сконструированные химерные антисмысловые олигонуклеотиды в Таблице 2 были сконструированы в виде 3-10-3 МОЕ, 3-10-4 МОЕ 4-10-4 МОЕ, 4-10-5 МОЕ или 5-10-6 МОЕ-гэпмеров. 3-10-3 МОЕ-гэпмеры обладали длиной 16 нуклеозидов, причем центральный сегмент разрыва включал десять 2′-дезоксинуклеозидов и был фланкирован сегментами крыльев с 5′-направления и 3′-направления, включавшими по три нуклеозида. 3-10-4 МОЕ-гэпмеры обладали длиной 17 нуклеозидов, причем центральный сегмент разрыва включал десять 2′-дезоксинуклеозидов и был фланкирован сегментом крыла с 5′-направления, включавшим три нуклеозида, и сегментом крыла с 3′-направления, включавшим четыре нуклеозида. 4-10-4 МОЕ-гэпмеры обладали длиной 18 нуклеозидов, причем центральный сегмент разрыва включал десять 2′-дезоксинуклеозидов и был фланкирован сегментами крыльев с 5′-направления и 3′-направления, включавшими по четыре нуклеозида. 4-10-5 МОЕ-гэпмеры обладали длиной 19 нуклеозидов, причем центральный сегмент разрыва включал десять 2′-дезоксинуклеозидов и был фланкирован сегментом крыла с 5′-направления, включавшим четыре нуклеозида, и сегментом крыла с 3′-направления, включавшим пять нуклеозидов. 5-10-6 МОЕ-гэпмеры обладали длиной 21 нуклеозидов, причем центральный сегмент разрыва включал десять 2′-дезоксинуклеозидов и был фланкирован сегментом крыла с 5′-направления, включавшим пять нуклеозидов, и сегментом крыла с 3′-направления, включавшим шесть нуклеозидов. Каждый нуклеозид в сегменте 5′-крыла и каждый нуклеозид в сегменте 3′-крыла содержал модификацию 2′-МОЕ. Межнуклеозидные связи на всем протяжении каждого гэпмера являлись фосфоротиоатными (P=S) связями. Все остатки цитозина на всем протяжении каждого гэпмера являлись остатками 5-метилцитозина. "Сайт инициации" означал последний 5′-нуклеозид, являвшийся мишенью гэпмера в последовательности гена человека. "Стоп-сайт" означал последний З′-нуклеозид, являвшийся мишенью гэпмера в последовательности гена человека. Мишенью каждого гэпмера из перечисленных в Таблице 2 являлась либо мРНК GCGR человека, обозначаемая здесь как SEQ ID NO:1 (учетный номер GENBANK NM_000160.3), либо геномная последовательность GCGR человека, обозначаемая здесь как SEQ ID NO:2 (учетный номер GENBANK NW_926918.1, укороченная с нуклеотида 16865000 до 16885000). "н/д" указывает, что указанная конкретная последовательность гена не являлась мишенью указанного антисмыслового олигонуклеотида.

Таблица 2
Ингибирование уровней мРНК GCGR человека химерными антисмысловыми олигонуклеотидами, мишенями которых являлись SEQ ID NO:1 и SEQ ID NO:2
ISIS NO SEQ ID NO:1 сайт инициации SEQ ID NO:1 стоп сайт Последовательность % ингибирования Мотив SEQ ID NO:2 сайт инициации SEQ ID N0:2 стоп-сайт SEQ ID N0
315163 702 721 ACCTGGAAGCTGCTGTACAT 38 5-10-5 13003 13022 79
459014 227 243 GGGCAATGCAGTCCTGG 62 3-10-4 10718 10734 80
459032 н/д н/д GAAGGTGACACCAGCCT 83 3-10-4 7783 7799 81
459040 н/д н/д GCTCAGCATCCACAGGC 63 3-10-4 8144 8160 82
459046 н/д н/д TGGATTTTAGCCTCCTC 73 3-10-4 9246 9262 83
459076 н/д н/д GCCAAACCTGTGGCTGC 84 3-10-4 12178 12194 84
459157 н/д н/д GGGTTCCCGAGGTGCCCAATG 92 5-10-6 7267 7287 85
7292 7312
7316 7336
7341 7361
7365 7385
7389 7409
7437 7457
459010 н/д н/д GGTTCCCGAGGTGCCC 100 3-10-3 7271 7286 86
7296 7311
7320 7335
7345 7360
7369 7384
7393 7408
7417 7432
7441 7456
459011 н/д н/д GGGTTCCCGAGGTGCC 89 3-10-3 7272 7287 87
7297 7312
7321 7336
7346 7361
7370 7385
7394 7409
7418 7433
7442 7457
459058 н/д н/д GAGGCCAGGCACAGGCT 75 3-10-4 11676 11692 88
459024 н/д н/д CGGTCCTTGGAGGATGC 63 3-10-4 6682 6698 89
459088 н/д н/д GTTCCCGAGGTGCCCAATG 89 4-10-5 7267 7285 90
7292 7310
7316 7334
7341 7359
7365 7383
7389 7407
7437 7455
459087 н/д н/д GGTTCCCGAGGTGCCCAAT 95 4-10-5 7268 7286 91
7293 7311
7317 7335
7342 7360
7366 7384
7390 7408
7414 7432
7438 7456
459086 н/д н/д GGGTTCCCGAGGTGCCCAA 96 4-10-5 7269 7287 92
7294 7312
7318 7336
7343 7361
7367 7385
7391 7409
7415 7433
7439 7457
459083 н/д н/д GGTTCCCGAGGTGCCCAA 91 4-10-4 7269 7286 93
7294 7311
7318 7335
7343 7360
7367 7384
7391 7408
7415 7432
7439 7456
459009 н/д н/д GTTCCCGAGGTGCCCA 61 3-10-3 7270 7285 94
7295 7310
7319 7334
7344 7359
7368 7383
7392 7407
7416 7431
7440 7455
459082 н/д н/д GGGTTCCCGAGGTGCCCA 91 4-10-4 7270 7287 95
7295 7312
7319 7336
7344 7361
7368 7385
7392 7409
7416 7433
7440 7457
459158 н/д н/д GGGTTCCCGAGGTGCCCAATA 94 5-10-6 7413 7433 96
459063 н/д н/д CCAGCTCTGTGGCTCAG 62 3-10-4 11818 11834 97

Пример 3: Антисмысловое ингибирование рецептора глюкагона человека (GCGR) в клетках HepG2

Сконструировали дополнительные антисмысловые олигонуклеотиды, мишенью которых являлась нуклеиновая кислота GCGR, и протестировали их воздействие на мРНК GCGR in vitro. Кроме того, протестировали ISIS 315163. Кроме того, протестировали ISIS 325568, описанное в более ранней публикации (WO 2007/035771). Культивируемые клетки HepG2 при плотности 40000 клеток на лунку трансфицировали 2000 нМ антисмыслового олигонуклеотида с помощью электропорации. После периода обработки продолжительностью приблизительно 24 часа из клеток выделяли РНК и измеряли уровни мРНК GCGR с помощью количественной ПЦР в реальном времени и набора праймеров и зондов человека RTS1508. Уровни мРНК GCGR корректировали в зависимости от общего содержания РНК, измеренного с помощью RIBOGREEN®. Результаты представлены в виде процентного ингибирования GCGR по сравнению с необработанными контрольными клетками. Всего протестировали 78 антисмысловых олигонуклеотидов. В Таблице 3 показаны только олигонуклеотиды, выбранные для анализов зависимости доза-ответ.

Вновь сконструированные химерные антисмысловые олигонуклеотиды в Таблице 3 были сконструированы в виде 5-10-5 МОЕ-гэпмеров. Гэпмеры обладали длиной 20 нуклеозидов, причем центральный сегмент разрыва включал десять 2′-дезоксинуклеозидов и был фланкирован сегментами крыльев с 5′-направления и 3′-направления, включавшими по пять нуклеозидов. Каждый нуклеозид в сегменте 5′-крыла и каждый нуклеозид в сегменте 3′-крыла содержал модификацию 2′-МОЕ. Межнуклеозидные связи на всем протяжении каждого гэпмера являлись фосфоротиоатными (P=S) связями. Все остатки цитозина на всем протяжении каждого гэпмера являлись остатками 5-метилцитозина. "Сайт инициации" означал последний 5′-нуклеозид, являвшийся мишенью гэпмера в последовательности гена человека. "Стоп-сайт" означал последний 3′-нуклеозид, являвшийся мишенью гэпмера в последовательности гена человека. Мишенью каждого гэпмера из перечисленных в Таблице 3 являлась либо мРНК GCGR человека, обозначаемая здесь как SEQ ID NO:1 (учетный номер GENBANK NM_000160.3), либо геномная последовательность GCGR человека, обозначаемая здесь как SEQ ID NO:2 (учетный номер GENBANK NW_926918.1, укороченная с нуклеотида 16865000 до 16885000). "н/д" указывает, что указанная конкретная последовательность гена не являлась мишенью указанного антисмыслового олигонуклеотида.

Таблица 3
Ингибирование уровней мРНК GCGR человека химерными антисмысловыми олигонуклеотидами, мишенями которых являлись SEQ ID NO:1 и SEQ ID NO:2
ISIS NO SEQ ID NO:1 сайт инициации SEQ ID NO:1 стоп-сайт Последовательность % ингибирования Мотив SEQ ID NO:2 сайт инициации SEQ ID NO:2 стоп-сайт SEQ ID N0
315163 702 721 ACCTGGAAGCTGCTGTACAT 42 5-10-5 13003 13022 79
325568 548 567 GCACTTTGTGGTGCCAAGGC 58 2-16-2 н/д н/д 4
448754 н/д н/д CCTGGATTTTAGCCTCCTCC 79 5-10-5 9245 9264 98
448718 н/д н/д TGGGTCTCTGATAGTGAGGC 81 5-10-5 8030 8049 99
448730 н/д н/д GCTCAGCATCCACAGGCCAC 74 5-10-5 8141 8160 100
448738 н/д н/д GCCAAGCCTGGCTCTGCCCC 76 5-10-5 8454 8473 101

Пример 4: Антисмысловое ингибирование рецептора глюкагона человека (GCGR) в клетках HepG2

Сконструировали дополнительные антисмысловые олигонуклеотиды, мишенью которых являлась нуклеиновая кислота GCGR, и протестировали их воздействие на мРНК GCGR in vitro. Кроме того, протестировали ISIS 315163 и ISIS 325568. Культивируемые клетки HepG2 при плотности 40000 клеток на лунку трансфицировали 5000 нМ антисмыслового олигонуклеотида с помощью электропорации. После периода обработки продолжительностью приблизительно 24 часа из клеток выделяли РНК и измеряли уровни мРНК GCGR с помощью количественной ПЦР в реальном времени и набора праймеров и зондов человека RTS1508. Уровни мРНК GCGR корректировали в зависимости от общего содержания РНК, измеренного с помощью RIBOGREEN®. Результаты представлены в виде процентного ингибирования GCGR по сравнению с необработанными контрольными клетками. Всего протестировали 234 антисмысловых олигонуклеотида. В Таблице 4 показаны только олигонуклеотиды, выбранные для анализов зависимости доза-ответ.

Вновь сконструированные химерные антисмысловые олигонуклеотиды в Таблице 4 были сконструированы в виде 5-10-5 МОЕ-гэпмеров. Гэпмеры обладали длиной 20 нуклеозидов, причем центральный сегмент разрыва включал десять 2′-дезоксинуклеозидов и был фланкирован сегментами крыльев с 5′-направления и 3′-направления, включавшими по пять нуклеозидов. Каждый нуклеозид в сегменте 5′-крыла и каждый нуклеозид в сегменте 3′-крыла содержал модификацию 2′-МОЕ. Межнуклеозидные связи на всем протяжении каждого гэпмера являлись фосфоротиоатными (P=S) связями. Все остатки цитозина на всем протяжении каждого гэпмера являлись остатками 5-метилцитозина. "Сайт инициации" означал последний 5′-нуклеозид, являвшийся мишенью гэпмера в последовательности гена человека. "Стоп-сайт" означал последний 3′-нуклеозид, являвшийся мишенью гэпмера в последовательности гена человека. Мишенью каждого гэпмера из перечисленных в Таблице 4 являлась либо мРНК GCGR человека, обозначаемая здесь как SEQ ID NO:1 (учетный номер GENBANK NM_000160.3), либо геномная последовательность GCGR человека, обозначаемая здесь как SEQ ID NO:2 (учетный номер GENBANK NW_926918.1, укороченная с нуклеотида 16865000 до 16885000). "н/д" указывает, что указанная конкретная последовательность гена не являлась мишенью указанного антисмыслового олигонуклеотида.

Таблица 4
Ингибирование уровней мРНК GCGR человека химерными антисмысловыми олигонуклеотидами, мишенями которых являлись SEQ ID NO:1 и SEQ ID NO:2
ISIS NO SEQ ID NO:1 сайт инициации SEQ ID N0:1 стоп-сайт Последовательность % ингибирования Мотив SEQ ID NO:2 сайт инициации SEQ ID N0:2 стоп-сайт SEQ ID NO
315163 702 721 ACCTGGAAGCTGCTGTACAT 71 5-10-5 13003 13022 79
325568 548 567 GCACTTTGTGGTGCCAAGGC 79 2-16-2 н/д н/д 4
436140 2015 2034 CTCTTTATTGTTGGAGGACA 93 5-10-5 15743 15762 102
398455 2014 2033 TCTTTATTGTTGGAGGACAT 89 5-10-5 15742 15761 103
398470 н/д н/д CCACAGGCCACAGGTGGGCT 85 5-10-5 8132 8151 104
398491 н/д н/д AGCCAGGTGAGCAGCCATGC 81 5-10-5 9008 9027 105
398501 н/д н/д AAGTGTCCAGGCCATGATAT 84 5-10-5 12025 12044 106
398503 н/д н/д CCAAGTGTCCAGGCCATGAT 92 5-10-5 12027 12046 107
398506 н/д н/д ACCCCAAGTGTCCAGGCCAT 89 5-10-5 12030 12049 108
398507 н/д н/д GCACCCCAAGTGTCCAGGCC 97 5-10-5 12032 12051 109
398508 н/д н/д TGCACCCCAAGTGTCCAGGC 87 5-10-5 12033 12052 110
304535 1988 2007 GCACATGGGACGTGCCGACA 98 5-10-5 15716 15735 111
304538 2016 2035 GCTCTTTATTGTTGGAGGAC 95 5-10-5 15744 15763 112
304539 2018 2037 GAGCTCTTTATTGTTGGAGG 92 5-10-5 15746 15765 113
436141 2017 2036 AGCTCTTTATTGTTGGAGGA 93 5-10-5 15745 15764 114
436164 Н/д Н/д GGTTCCCGAGGTGCCCAATG 92 5-10-5 7267 7286 115
7292 7311
7316 7335
7341 7360
7365 7384
7389 7408
7437 7456

Пример 5: Дозозависимое антисмысловое ингибирование GCGR человека в первичных гепатоцитах яванского макака

Гэпмеры из Примера 1, проявлявшие значительное ингибирование GCGR человека т vitro, протестировали при различных условиях в первичных гепатоцитах яванского макака. Клетки высевали при плотности 24000 клеток на лунку и трансфицировали концентрациями антисмыслового олигонуклеотида 0,4 мкМ, 1,1 мкМ, 3,3 мкМ и 10,0 мкМ с помощью электропорации, как описано в Таблице 5. После периода обработки продолжительностью приблизительно 16 часов из клеток выделяли РНК и измеряли уровни мРНК GCGR с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зондов GCGR человека RTS1508. Уровни мРНК GCGR корректировали в зависимости от общего содержания РНК, измеренного с помощью RIBOGREEN®. Результаты представлены в виде процентного ингибирования GCGR по сравнению с необработанными контрольными клетками.

Кроме того, в Таблице 5 представлена полумаксимальная ингибирующая концентрация (IC50) каждого олигонуклеотида, рассчитанная путем построения графика процента ингибирования экспрессии мРНК GCGR от использованных концентраций олигонуклеотидов и отметки концентрации олигонуклеотида, при которой достигалось 50% ингибирование экспрессии мРНК GCGR по сравнению с контролем. Как показано в Таблице 5, уровни мРНК GCGR в клетках, обработанных антисмысловыми олигонуклеотидами, значительно снижались в зависимости от дозы.

Таблица 5
Дозозависимое антисмысловое ингибирование GCGR человека в первичных гепатоцитах яванского макака с помощью электропорации
ISIS № 0,4 мкМ 1,1 мкМ 3,3 мкМ 10,0 мкМ IC50 (мкМ)
315163 23 39 73 88 2,0
398457 64 69 71 68 <0,3
449759 24 47 75 85 1,3
449760 43 49 77 86 0,7
449797 38 54 69 93 0,8
449819 30 36 56 85 1,7
449823 29 31 43 82 2,5
449836 29 37 62 85 1,6
449851 14 36 73 93 1,6
449856 0 39 70 88 2,1
449858 16 27 65 86 2,1
449859 57 76 92 96 <0,3
449860 41 66 86 91 0,5
449881 27 49 67 70 1,5
449882 33 33 53 71 2,3
449883 63 66 75 76 <0,3
449884 64 77 74 71 <0,3
449885 67 74 71 76 <0,3
449894 55 56 74 78 <0,3
449895 44 60 71 72 0,5
449905 47 59 65 69 0,4
449906 52 66 75 80 <0,3
449907 35 36 62 70 1,8
449908 21 48 67 69 1,8
449910 7 16 51 61 4,8
449912 21 45 66 60 2,3
449916 16 40 55 55 3,9
449917 45 67 72 71 0,3
449922 39 48 60 67 1,3
449938 5 22 44 41 >10,0
449944 6 0 25 62 7,0
449945 22 36 57 64 2,8
449948 0 19 45 60 5,2
449949 0 16 41 52 7,8
449951 26 40 55 61 2,9
449952 21 28 52 62 3,8
449953 15 22 49 59 4,8
449954 0 53 60 58 3,4
449955 30 43 61 66 1,9
449956 10 40 52 64 3,3
449958 17 46 54 67 2,6
449960 10 22 46 63 4,7
449967 0 16 36 49 9,8
450035 0 35 41 60 5,0
450039 18 30 51 60 4,2
450040 0 21 41 66 4,7
450049 22 27 59 68 2,9
450050 28 22 49 61 4,7
450054 0 11 22 25 >10,0
450059 11 41 64 78 2,1
450061 13 29 49 60 4,4
450074 15 27 40 61 5,4

Пример 6: Дозозависимое антисмысловое ингибирование GCGR человека в клетках HepG2

Гэпмеры из Примера 5, проявлявшие значительное ингибирование мРНК GCGR in vitro, отобрали и протестировали при различных дозах в клетках HepG2. Клетки высевали при плотности 40000 клеток на лунку и трансфицировали концентрациями антисмыслового олигонуклеотида 0,12 мкМ, 0,37 мкМ, 1,11 мкМ, 3,33 мкМ и 10,00 мкМ с помощью электропорации, как описано в Таблице 6. После периода обработки продолжительностью приблизительно 16 часов из клеток выделяли РНК и измеряли уровни мРНК GCGR с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зондов GCGR человека RTS1508. Уровни мРНК GCGR корректировали в зависимости от общего содержания РНК, измеренного с помощью RIBOGREEN®. Результаты представлены в виде процентного ингибирования GCGR по сравнению с необработанными контрольными клетками.

Кроме того, в Таблице 6 представлена полумаксимальная ингибирующая концентрация (IC50) каждого олигонуклеотида. Как показано в Таблице 6, уровни мРНК GCGR в клетках, обработанных антисмысловыми олигонуклеотидами, значительно снижались в зависимости от дозы.

Таблица 6
Дозозависимое антисмысловое ингибирование GCGR человека в клетках HepG2 с помощью электропорации
ISIS № 0,12 мкМ 0,37 мкМ 1,11 мкМ 3,33 мкМ 10,00 мкМ IC50 (мкМ)
315163 0 3 26 62 88 2,2
398457 47 81 94 97 97 <0,1
449760 0 26 64 91 97 0,8
449797 0 16 42 84 95 1,2
449819 0 17 40 79 93 1,3
449851 4 28 65 94 97 0,7
449859 36 51 89 95 95 0,2
449860 30 53 77 86 94 0,3
449882 0 19 57 85 97 1,0
449883 7 49 84 92 96 0,5
449884 67 87 95 94 97 <0,1
449885 44 83 77 97 95 <0.1
449894 1 34 78 87 98 0,7
449895 0 31 29 84 95 1,1
449906 12 26 67 93 95 0,7

Пример 7: Дозозависимое антисмысловое ингибирование GCGR человека в клетках HepG2

Гэпмеры из Примера 5, проявлявшие значительное ингибирование мРНК GCGR in vitro, дополнительно отобрали и протестировали при различных дозах в клетках HepG2. Клетки высевали при плотности 40000 клеток на лунку и трансфицировали концентрациями антисмыслового олигонуклеотида 0,04 мкМ, 0,12 мкМ, 0,37 мкМ, 1,11 мкМ, 3,33 мкМ и 10,00 мкМ с помощью электропорации, как описано в Таблице 7. После периода обработки продолжительностью приблизительно 16 часов из клеток выделяли РНК и измеряли уровни мРНК GCGR с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зондов GCGR человека RTS1508. Уровни мРНК GCGR корректировали в зависимости от общего содержания РНК, измеренного с помощью RIBOGREEN®. Результаты представлены в виде процентного ингибирования GCGR по сравнению с необработанными контрольными клетками.

Кроме того, в Таблице 7 представлена полумаксимальная ингибирующая концентрация (IC50) каждого олигонуклеотида. Уровни мРНК GCGR в клетках, обработанных антисмысловыми олигонуклеотидами, значительно снижались в зависимости от дозы. "н/д" означает отсутствие данных для указанного ISIS-олигонуклеотида и указанной конкретной концентрации. Для дальнейших исследований выбрали ISIS 398457, ISIS 449884 и ISIS 449954, вызывавшие значительное снижение уровней мРНК GCGR. Важно, что ISIS 449884 продемонстрировало в десять-пятьдесят раз более низкую IC50, чем стандартное соединение ISIS 315163 в прямых сравнительных исследованиях, представленных в Примерах 5-7.

Таблица 7
Дозозависимое антисмысловое ингибирование GCGR человека в клетках HepG2 с помощью электропорации
ISIS № 0,04 мкМ 0,12 мкМ 0,37 мкМ 1,11 мкМ 3,33 мкМ 10,00 мкМ IC50 (мкМ)
315163 22 9 22 45 67 93 1,5
398457 36 62 88 99 99 100 0,1
449856 8 24 49 73 92 95 0,4
449858 28 27 41 80 93 97 0,3
449859 16 40 72 89 97 98 0,2
449860 32 38 46 78 94 98 0,2
449883 25 27 68 92 98 100 0,2
449884 42 59 93 99 100 н/д <0,04
449885 18 60 84 97 98 н/д 0,1
449894 8 31 44 83 96 99 0,3
449951 0 32 62 86 98 99 0,4
449954 9 40 57 86 99 99 0,2

Пример 8: Дозозависимое антисмысловое ингибирование GCGR человека в первичных гепатоцитах яванского макака

Гэпмеры из исследований, описанных в Примерах 1-7, дополнительно протестировали в различных дозах в первичных гепатоцитах яванского макака. Клетки высевали при плотности 35000 клеток на лунку и трансфицировали концентрациями антисмыслового олигонуклеотида 750 нМ, 1500 нМ, 3000 нМ, 6000 нМ и 12000 нМ с помощью электропорации, как указано в Таблице 8. После периода обработки продолжительностью приблизительно 16 часов из клеток выделяли РНК и измеряли уровни мРНК GCGR с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зондов GCGR человека RTS1508. Уровни мРНК GCGR корректировали в зависимости от общего содержания РНК, измеренного с помощью RIBOGREEN®. Результаты представлены в виде процентного ингибирования GCGR по сравнению с необработанными контрольными клетками. Как показано в Таблице 8, уровни мРНК GCGR значительно снижались в клетках, обработанных антисмысловыми олигонуклеотидами.

Таблица 8
Дозозависимое антисмысловое ингибирование GCGR человека в первичных гепатоцитах яванского макака с помощью электропорации
ISIS № 750,0 нМ 1500,0 нМ 3000,0 нМ 6000,0 нМ 12000,0 нМ
398457 85 89 92 89 85
398471 78 85 87 85 87
436140 81 93 96 97 96
448754 44 59 80 80 81
448766 79 90 88 87 83
448818 19 13 58 64 76
449884 89 92 89 87 90
459014 51 63 79 82 84
459032 78 85 88 88 87
459040 70 77 81 89 83
459046 34 38 65 61 80
459076 31 39 67 79 77
459157 89 87 88 88 86

Пример 9: Дозозависимое антисмысловое ингибирование GCGR человека в первичных гепатоцитах яванского макака

Гэпмеры из Примера 8, проявлявшие значительное ингибирование GCGR человека in vitro, дополнительно отобрали и протестировали при различных дозах в первичных гепатоцитах яванского макака. Кроме того, протестировали ISIS 325568 (GCACTTTGTGGTGCCAAGGC (SEQ ID NO:4); сайт инициации в SEQ ID NO:1-548), описанное в более ранней публикации (BIOL066USL). Клетки высевали при плотности 35000 клеток на лунку и трансфицировали концентрациями антисмыслового олигонуклеотида 0,006 мкМ, 0,020 мкМ, 0,063 мкМ, 0,200 мкМ, 0,632 мкМ, 2,000 мкМ, 6,325 мкМ и 20,000 мкМ с помощью электропорации, как указано в Таблице 9. После периода обработки продолжительностью приблизительно 16 часов из клеток выделяли РНК и измеряли уровни мРНК GCGR с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зондов GCGR человека RTS1508. Уровни мРНК GCGR корректировали в зависимости от общего содержания РНК, измеренного с помощью RIBOGREEN®. Результаты представлены в виде процентного ингибирования GCGR по сравнению с необработанными контрольными клетками.

Кроме того, в Таблице 9 представлена полумаксимальная ингибирующая концентрация (IC50) каждого олигонуклеотида. Уровни мРНК GCGR в клетках, обработанных антисмысловыми олигонуклеотидами, значительно снижались в зависимости от дозы.

Таблица 9
Дозозависимое антисмысловое ингибирование GCGR человека в первичных гепатоцитах яванского макака с помощью электропорации
ISIS № 0,006 мкМ 0,020 мкМ 0,063 мкМ 0,200 мкМ 0,632 мкМ 2,000 мкМ 6,325 мкМ 20,000 мкМ IC50 (мкМ)
325568 0 0 0 0 0 42 75 93 3,1
398471 0 4 7 24 62 65 65 59 0,4
448766 5 0 0 2 28 51 57 34 0,6
449884 0 12 61 59 71 68 72 62 0,1
459014 1 0 2 23 15 47 69 74 2,6
459032 0 6 4 33 55 68 72 61 0,5
459157 0 12 29 69 69 72 73 62 0,1

На основании данных ингибирования, ISIS 398471, ISIS 448766, ISIS 449884, ISIS 459014, ISIS 459032 и ISIS 459157 выбрали для тестирования в модели мыши in vivo.

Пример 10: Дозозависимое антисмысловое ингибирование GCGR человека в клетках HepG2

Гэпмеры из исследований, описанных в Примерах 1, 4 и 9, дополнительно протестировали в различных дозах в клетках HepG2. Клетки высевали при плотности 40000 клеток на лунку и трансфицировали концентрациями антисмыслового олигонуклеотида 0,12 мкМ, 0,37 мкМ, 1,11 мкМ, 3,33 мкМ и 10,00 мкМ с помощью электропорации, как указано в Таблице 10. После периода обработки продолжительностью приблизительно 1 6 часов из клеток выделяли РНК и измеряли уровни мРНК GCGR с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зондов GCGR человека RTS1508. Уровни мРНК GCGR корректировали в зависимости от общего содержания РНК, измеренного с помощью RIBOGREEN. Результаты представлены в виде процентного ингибирования GCGR по сравнению с необработанными контрольными клетками. Как показано в Таблице 10, уровни мРНК GCGR значительно снижались в клетках, обработанных антисмысловыми олигонуклеотидами.

Таблица 10
Дозозависимое антисмысловое ингибирование GCGR человека в клетках HepG2 с помощью электропорации
ISIS № 0,12 мкМ 0,37 мкМ 1,11 мкМ 3,33 мкМ 10,00 мкМ IC50 (мкМ)
398455 35 57 81 94 94 0,2
398457 33 79 91 97 98 0,1
398470 37 48 86 92 96 0,2
398471 33 50 86 92 87 0,2
398486 50 47 85 91 98 0,1
398491 25 61 73 96 92 0,3
398501 35 43 85 98 98 0,3
398503 21 58 80 97 99 0,3
398504 51 57 91 92 98 0,1
398506 40 71 96 98 99 0,1
398507 59 85 97 98 Н/Д <0,1
398508 22 48 90 94 98 0,3
398585 25 57 84 88 93 0,3
436034 34 56 61 81 92 0,3

На основании результатов ингибирования, ISIS 398457, ISIS 398471, ISIS 398486, ISIS 398491, ISIS 398506, ISIS 398507, ISIS 398508 и ISIS 436034 выбрали для тестирования в модели мыши.

Пример 11: Дозозависимое антисмысловое ингибирование GCGR человека в клетках HepG2

Гэпмеры из исследования, описанного в Примере 4, дополнительно протестировали в различных дозах в клетках HepG2. Клетки высевали при плотности 40000 клеток на лунку и трансфицировали концентрациями антисмыслового олигонуклеотида 0,04 мкМ, 0,12 мкМ, 0,37 мкМ, 1,11 мкМ, 3,33 мкМ и 10,00 мкМ с помощью электропорации, как указано в Таблице 11. После периода обработки продолжительностью приблизительно 16 часов из клеток выделяли РНК и измеряли уровни мРНК GCGR с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зондов GCGR человека RTS1508. Уровни мРНК GCGR корректировали в зависимости от общего содержания РНК, измеренного с помощью RIBOGREEN®. Результаты представлены в виде процентного ингибирования GCGR по сравнению с необработанными контрольными клетками. Уровни мРНК GCGR значительно снижались в клетках, обработанных антисмысловыми олигонуклеотидами.

Таблица 11
Дозозависимое антисмысловое ингибирование GCGR человека в клетках HepG2 с помощью электропорации
ISIS № 0,04 мкМ 0,12 мкМ 0,37 мкМ 1,11 мкМ 3,33 мкМ 10,00 мкМ IC50 (мкМ)
304535 21 31 55 90 99 96 0,2
304538 27 42 73 91 100 95 0,1
304539 15 33 56 87 95 93 0,3
436140 4 27 57 85 94 95 0,3
436141 19 27 64 84 92 95 0,3
436164 12 37 75 94 94 96 0,2

На основании результатов ингибирования, ISIS 304538, ISIS 304539, ISIS 436140 и ISIS 436141 выбрали для тестирования в модели мыши.

Пример 12: Дозозависимое антисмысловое ингибирование GCGR человека в клетках HepG2

Гэпмеры из исследования, описанного в Примерах 1, 3, 8 и 9, дополнительно протестировали в различных дозах в клетках HepG2. Клетки высевали при плотности 40000 клеток на лунку и трансфицировали концентрациями антисмыслового олигонуклеотида 0,12 мкМ, 0,37 мкМ, 1,11 мкМ, 3,33 мкМ и 10,00 мкМ с помощью электропорации, как указано в Таблице 12. После периода обработки продолжительностью приблизительно 16 часов из клеток выделяли РНК и измеряли уровни мРНК GCGR с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зондов GCGR человека RTS1508. Уровни мРНК GCGR корректировали в зависимости от общего содержания РНК, измеренного с помощью RIBOGREEN®. Результаты представлены в виде процентного ингибирования GCGR по сравнению с необработанными контрольными клетками. Уровни мРНК GCGR значительно снижались в клетках, обработанных антисмысловыми олигонуклеотидами.

Таблица 12
Дозозависимое антисмысловое ингибирование GCGR человека в клетках HepG2 с помощью электропорации
ISIS № 0,12 мкМ 0,37 мкМ 1,11 мкМ 3,33 мкМ 10,00 мкМ IC50 (мкМ)
448718 35 64 74 90 92 0,2
448730 44 67 87 94 85 0,1
448738 31 52 75 95 97 0,3
448754 40 47 81 95 96 0,3
448762 43 62 75 96 97 0,2
448766 36 59 88 94 85 0,2
448799 42 53 92 96 99 0,2
448802 43 70 88 97 93 0,1
448806 39 60 82 97 96 0,2
448817 35 62 95 88 92 0,2
448818 29 52 74 97 98 0,3
448819 73 89 97 Н/Д 93 <0,1
448840 31 58 80 83 98 0,3
448848 71 92 98 98 99 <0,1
448850 54 60 74 88 94 <0,1
448860 41 58 73 92 98 0,2
448890 49 60 83 94 99 0,1
448897 50 52 80 92 97 0,2
448901 29 58 81 91 99 0,3
448903 32 48 73 91 99 0,3
448905 43 49 76 89 97 0,2

На основании результатов ингибирования, ISIS 448718, ISIS 448730, ISIS 448754, ISIS 448766, ISIS 448817, ISIS 448818, ISIS 448819, ISIS 448848, ISIS 448860 и ISIS 448890 выбрали для тестирования в модели мыши.

Пример 13: Дозозависимое антисмысловое ингибирование GCGR человека в клетках HepG2

Гэпмеры из исследования, описанного в Примерах 1, 2, 8 и 9, дополнительно протестировали в различных дозах в клетках HepG2. Клетки высевали при плотности 40000 клеток на лунку и трансфицировали концентрациями антисмыслового олигонуклеотида 0,12 мкМ, 0,37 мкМ, 1,11 мкМ, 3,33 мкМ и 10,00 мкМ с помощью электропорации, как указано в Таблице 13. После периода обработки продолжительностью приблизительно 16 часов из клеток выделяли РНК и измеряли уровни мРНК GCGR с помощью количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор праймеров и зондов GCGR человека RTS1508. Уровни мРНК GCGR корректировали в зависимости от общего содержания РНК, измеренного с помощью RIBOGREEN®. Результаты представлены в виде процентного ингибирования GCGR по сравнению с необработанными контрольными клетками. Уровни мРНК GCGR значительно снижались в клетках, обработанных антисмысловыми олигонуклеотидами.

Таблица 13
Дозозависимое антисмысловое ингибирование GCGR человека в клетках HepG2 с помощью электропорации
ISIS № 0,12 мкМ 0,37 мкМ 1,11 мкМ 3,33 мкМ 10,00 мкМ IC50 (мкМ)
398457 62 84 95 98 97 <0,1
459009 26 47 80 96 97 0,3
459010 56 90 96 98 97 <0,1
459011 46 81 97 95 96 <0,1
459024 29 56 74 89 95 0,3
459032 40 61 74 97 98 0,2
459040 48 65 84 96 95 0,1
459046 36 54 77 96 98 0,2
459058 21 46 88 95 98 0,3
459063 34 42 79 97 99 0,3
459076 32 72 84 98 99 0,1
459082 46 71 92 97 97 0,1
459083 53 71 90 96 97 <0,1
459086 24 72 92 96 97 0,2
459087 23 67 94 97 98 0,2
459088 34 61 86 95 98 0,2
459157 50 74 92 97 97 <0,1
459158 54 81 94 97 99 <0,1

На основании результатов ингибирования, ISIS 459024, ISIS 459032, ISIS 459040, ISIS 459046, ISIS 459076 и ISIS 459157 выбрали для тестирования в модели мыши.

Пример 14: Переносимость антисмысловых олигонуклеотидов, мишенью которых являлся GCGR человека, у мышей CD1

Мыши CD1® (Чарльз-Ривер, штат Массачусетс, США) являются многоцелевой моделью мыши, часто используемой в исследованиях безопасности и эффективности. Мышей лечили ISIS-антисмысловыми олигонуклеотидами, выбранными из вышеописанных исследований, и оценивали изменения в уровнях различных биохимических маркеров плазмы.

Лечение

Группам самцов мышей CD1 возрастом шесть недель дважды в неделю в течение 6 недель подкожно вводили 50 мг/кг ISIS 304538, ISIS 304539, ISIS 325568, ISIS 398457, ISIS 398471, ISIS 398486, ISIS 398491, ISIS 398506, ISIS 398507, ISIS 398508, ISIS 436034, ISIS 436140, ISIS 436141, ISIS 448718, ISIS 448730, ISIS 448754, ISIS 448766, ISIS 448817, ISIS 448818, ISIS 448819, ISIS 448848, ISIS 448860, ISIS 448890, ISIS 449884, ISIS 449954, ISIS 449956, ISIS 459014, ISIS 459024, ISIS 459032, ISIS 459040, ISIS 459046, ISIS 459076 и ISIS 459157. Одной группе самцов мышей CD1 возрастом шесть недель дважды в неделю в течение 6 недель подкожно вводили PBS. Мышей умерщвляли через 48 часов после введения последней дозы, после чего собирали органы и плазму для дальнейшего анализа.

Биохимические маркеры плазмы

Для оценки действия ISIS-олигонуклеотидов на функцию печени и почек измеряли уровни трансаминаз, билирубина, альбумина и азота мочевины в плазме с помощью автоматизированного клинического биохимического анализатора (Hitachi Olympus AU400e, Мелвилл, штат Нью-Йорк, США). Результаты представлены в Таблице 14. ISIS-олигонуклеотиды, вызывавшие изменения в уровнях любого из маркеров функции печени или почек за пределами ожидаемого для антисмысловых олигонуклеотидов диапазона, исключили из дальнейших исследований.

Таблица 14
Действие лечения антисмысловыми олигонуклеотидами на биохимические маркеры плазмы у мышей CD1 на 6 неделе
АЛТ (МЕ/л) ACT (МЕ/л) Билирубин (мг/дл) Альбумин (мг/дл) АМК (мг/дл)
PBS 26 37 0,20 3,2 24
ISIS 304538 71 93 0,18 3,4 24
ISIS 304539 151 126 0,21 3,4 22
ISIS 325568 47 67 0,20 3,1 18
ISIS 398457 26 45 0,28 3,6 25
ISIS 398471 33 46 0,21 3,6 28
ISIS 398486 447 381 0,22 3,5 28
ISIS 398491 56 54 0,20 3,3 28
ISIS 398506 884 823 0,35 3,4 25
ISIS 398507 2381 895 0,28 3,9 24
ISIS 398508 643 227 0,20 3,4 25
ISIS 436034 1481 696 0,38 3,4 23
ISIS 436140 40 62 0,20 3,0 25
ISIS 436141 232 163 0,20 3,3 21
ISIS 448718 378 221 0,20 2,9 25
ISIS 448730 852 398 1,40 3,5 27
ISIS 448754 71 84 0,20 3,4 28
ISIS 448766 47 46 0,26 3,5 23
ISIS 448817 211 144 0,25 3,6 24
ISIS 448818 33 52 0,17 3,1 23
ISIS 448819 196 188 0,25 3,5 23
ISIS 448848 1677 855 0,61 3,1 17
ISIS 448860 951 536 0,22 3,3 20
ISIS 448890 402 345 0,17 3,0 18
ISIS 449884 38 51 0,23 3,5 23
ISIS 449954 1465 1229 0,28 3,7 23
ISIS 449956 55 63 0,17 2,9 21
ISIS 459014 27 50 0,17 3,2 22
ISIS 459024 52 54 0,23 3,3 22
ISIS 459032 50 55 0,22 3,2 21
ISIS 459040 37 70 0,14 3,1 22
ISIS 459046 41 81 0,19 3,0 20
ISIS 459076 33 50 0,21 3,0 22
ISIS 459157 25 43 0,21 3,2 21

Пример 15: Переносимость антисмысловых олигонуклеотидов, мишенью которых являлся GCGR человека, у крыс Sprague-Dawley

Крысы Sprague-Dawley являются многоцелевой моделью, используемой при оценках безопасности и эффективности. Крыс лечили ISIS-антисмысловыми олигонуклеотидами из исследования, описанного в Примере 14, и оценивали изменения в уровнях различных биохимических маркеров плазмы.

Лечение

Самцов крыс Sprague-Dawley в возрасте семь недель содержали при 12-часовом цикле света/темноты и кормили кормом для здоровых крыс Purina, рацион 5001, вволю. Группам из четырех самцов крыс Sprague-Dawley дважды в неделю в течение 4 недель подкожно вводили 50 мг/кг ISIS 304538, ISIS 304539, ISIS 325568, ISIS 398457, ISIS 398471, ISIS 398486, ISIS 398491, ISIS 398506, ISIS 398507, ISIS 398508, ISIS 436034, ISIS 436140, ISIS 436141, ISIS 448718, ISIS 448730, ISIS 448754, ISIS 448766, ISIS 448817, ISIS 448818, ISIS 448819, ISIS 448848, ISIS 448860, ISIS 448890, ISIS 449884, ISIS 449954, ISIS 449956, ISIS 459014, ISIS 459024, ISIS 459032, ISIS 459040, ISIS 459046, ISIS 459076 и ISIS 459157. Крыс умерщвляли через сорок восемь часов после введения последней дозы, после чего собирали органы и плазму для дальнейшего анализа.

Функция печени

Для оценки действия ISIS-олигонуклеотидов на функцию печени измеряли уровни трансаминаз в плазме с помощью автоматизированного клинического биохимического анализатора (Hitachi Olympus AU400e, Мелвилл, штат Нью-Йорк, США). Измеряли уровни АЛТ (аланинтрансаминазы) и ACT (аспартаттрансаминазы) в плазме; результаты представлены в Таблице 16 и выражены в МЕ/л. Кроме того, с помощью этого же клинического биохимического анализатора измеряли уровни билирубина в плазме;

результаты также представлены в Таблице 16. Значения АЛТ и ACT также выражены в виде кратного увеличения по сравнению с PBS-контролем и представлены в Таблице 17. ISIS-олигонуклеотиды, вызывавшие изменения в уровнях любого из маркеров функции печени за пределами ожидаемого для антисмысловых олигонуклеотидов диапазона, исключили из дальнейших исследований.

Таблица 16
Действие лечения антисмысловыми олигонуклеотидами на функцию печени у крыс Sprague-Dawley
АЛТ (МЕ/л) ACT (МЕ/л) Билирубин (мг/дл)
PBS 49 74 0,13
ISIS 304538 127 206 0,17
ISIS 304539 48 70 0,10
ISIS 325568 66 89 0,13
ISIS 398457 59 98 0,10
ISIS 398471 57 78 0,10
ISIS 398486 778 734 0,28
ISIS 398491 121 211 0,13
ISIS 398506 236 287 0,57
ISIS 398507 424 231 0,25
ISIS 398508 305 302 0,31
ISIS 436034 338 385 0,30
ISIS 436140 58 92 0,13
ISIS 436141 55 108 0,15
ISIS 448718 99 115 0,13
ISIS 448730 92 110 0,13
ISIS 448754 131 79 0,10
ISIS 448766 70 102 0,10
ISIS 448817 102 169 0,16
ISIS 448818 92 188 0,19
ISIS 448819 261 211 0,11
ISIS 448848 105 125 0,14
ISIS 448860 203 248 0,79
ISIS 448890 224 204 0,22
ISIS 449884 134 121 0,15
ISIS 449954 548 706 1,19
ISIS 449956 100 133 0,21
ISIS 459014 64 138 0,16
ISIS 459024 150 182 2,38
ISIS 459032 109 109 0,11
ISIS 459040 67 95 0,11
ISIS 459046 60 127 0,09
ISIS 459076 57 114 0,14
ISIS 459157 52 85 0,15
Таблица 17
Кратное увеличение АЛТ и ACT по сравнению с PBS-контролем в экспериментальных группах крыс Sprague-Dawley
ISIS № АЛТ ACT
304538 4,1 3,6
304539 0,8 0,8
325568 1,2 1,4
398457 0,9 1,1
398471 0,9 0,9
398486 12,2 8,3
398491 1,9 2,4
398506 7,6 5,0
398507 13,6 4,0
398508 9,8 5,3
436034 10,8 6,7
436140 1,9 1,6
436141 1,8 1,9
448718 3,2 2,0
448730 1,4 1,2
448754 2,1 0,9
448766 1,1 1,2
448817 2,0 2,4
448818 1,9 2,4
448819 5,0 3,0
448848 2,0 1,8
448860 4,1 3,2
448890 4,5 2,6
449884 2,6 1,7
449954 11,1 9,0
449956 2,0 1,7
459014 1,3 1,8
459024 3.1 2,3
459032 2,1 1,6
459040 1,3 1,4
459046 1,1 1,8
459076 1,2 1,5
459157 1,0 1,2

Функция почек

Для оценки действия ISIS-олигонуклеотидов на функцию почек измеряли уровни азота мочевины крови (АМК) и креатинина в плазме с помощью автоматизированного клинического биохимического анализатора (Hitachi Olympus AU400e, Мелвилл, штат Нью-Йорк, США). Результаты представлены в Таблице 18 и выражены в мг/дл.

Таблица 18
Действие лечения антисмысловыми олигонуклеотидами на маркеры функции почек (мг/дл) у крыс Sprague-Dawley
АМК (мг/дл) Креатинин (мг/дл)
PBS 16 0,27
ISIS 304538 18 0,35
ISIS 304539 21 0,32
ISIS 325568 15 0,31
ISIS 398457 18 0,32
ISIS 398471 19 0,33
ISIS 398486 20 0,34
ISIS 398491 21 0,32
ISIS 398506 18 0,44
ISIS 398507 16 0,33
ISIS 398508 18 0,41
ISIS 436034 17 0,33
ISIS 436140 16 0,42
ISIS 436141 25 0,42
ISIS 448718 17 0,4
ISIS 448730 21 0,35
ISIS 448754 23 0,36
ISIS 448766 21 0,35
ISIS 448817 17 0,33
ISIS 448818 20 0,52
ISIS 448819 16 0,31
ISIS 448848 19 0,34
ISIS 448860 25 0,38
ISIS 448890 19 0,39
ISIS 449884 16 0,34
ISIS 449954 19 0,45
ISIS 449956 30 0,52
ISIS 459014 20 0,45
ISIS 459024 25 0,59
ISIS 459032 13 0,22
ISIS 459040 21 0,33
ISIS 459046 19 0,3
ISIS 459076 21 0,39
ISIS 459157 17 0,31

Пример 16: Переносимость антисмысловых олигонуклеотидов, мишенью которых являлся GCGR человека, у крыс CD/IGS

Крысы CD/IGS являются многоцелевой моделью, используемой при оценках безопасности и эффективности. Крыс лечили ISIS-антисмысловыми олигонуклеотидами, выбранными в ходе исследования, описанного в Примерах 14 и 15, и оценивали изменения в уровнях различных биохимических маркеров плазмы.

Лечение

Самцов крыс CD/IGS в возрасте десять-двенадцать недель содержали при 12-часовом цикле света/темноты и кормили кормом для здоровых крыс Purina, рацион 5001, вволю. Группам из четырех крыс CD/IGS дважды в неделю в течение 13 недель подкожно вводили 30 мг/кг ISIS 325568, ISIS 398471, ISIS 436140, ISIS 448766, ISIS 449884, ISIS 459014, ISIS 459032, ISIS 459040 и ISIS 459157. Группе из 6 крыс дважды в неделю в течение 13 недель подкожно вводили PBS; данную группу использовали в качестве контрольной. Отбор образцов крови выполняли в различные моменты времени. Через сорок восемь часов после введения последней дозы измеряли массу тела, крыс умерщвляли и собирали органы и плазму для дальнейшего анализа.

Масса органов

Массу печени, сердца, легких, селезенки и почек измеряли в конце исследования;

результаты представлены в Таблице 19. ISIS-олигонуклеотиды, вызывавшие изменения массы органов за пределами ожидаемого для антисмысловых олигонуклеотидов диапазона, исключили из дальнейших исследований.

Таблица 19
Масса органов крыс CD/IGS после лечения антисмысловыми олигонуклеотидами на 13 неделе, выраженная в граммах (г)
Сердце Печень Легкие Селезенка Почки
PBS 1,8 21,3 1,9 1,0 4,1
ISIS 325568 1.3 16,9 2,6 2,1 3,6
ISIS 398471 1,6 19,8 2,1 1,6 3,3
ISIS 436140 1,4 22,7 2,4 2,4 4,9
ISIS 448766 1,5 22,6 2,2 2.3 3,4
ISIS 449884 1,6 19,0 2,0 1,3 3,3
ISIS 459014 1,6 16,4 1,9 1,0 3,2
ISIS 459032 1,6 33,3 2,8 6,1 4,0
ISIS 459040 1,5 18,7 2,7 2,3 4,5
ISIS 459157 1,4 19,4 2,1 1,5 3,3

Функция печени

Для оценки действия ISIS-олигонуклеотидов на функцию печени измеряли уровни различных биохимических маркеров плазмы через 8,5 недель (день 57) и 13 недель (день 90) с помощью автоматизированного клинического биохимического анализатора (Hitachi Olympus AU400e, Мелвилл, штат Нью-Йорк, США). Измеряли уровни АЛТ (аланинтрансаминазы) и ACT (аспартаттрансаминазы) в плазме; результаты представлены в Таблицах 20 и 21 и выражены в МЕ/л. Кроме того, с помощью этого же клинического биохимического анализатора измеряли уровни билирубина и АМК в плазме; результаты также представлены в Таблицах 20 и 21. ISIS-олигонуклеотиды, вызывавшие изменения в уровнях любого из маркеров функции печени за пределами ожидаемого для антисмысловых олигонуклеотидов диапазона, исключили из дальнейших исследований.

Таблица 20
Действие лечения антисмысловыми олигонуклеотидами на маркеры функции печени у крыс CD/IGS в день 57
АЛТ, МЕ/л ACT, МЕ/л Билирубин, мг/дл АМК, мг/дл
Физиологический раствор 28 48 0,12 12,7
325568 38 59 0,09 16,7
398471 29 49 0,10 10,4
436140 28 45 0,08 11,0
448766 31 64 0,08 13,2
449884 45 55 0,11 12,1
459014 27 44 0,13 23,2
459032 98 172 0,23 14,6
459040 25 43 0,08 14,1
459157 26 48 0,09 15,8
Таблица 21
Действие лечения антисмысловыми олигонуклеотидами на маркеры функции печени у крыс CD/IGS в день 80
АЛТ ACT Билирубин АМК
PBS 47 71 0,22 17,9
ISIS 325568 57 102 0,15 19,6
ISIS 398471 59 88 0,18 18,8
ISIS 436140 43 70 0,19 23,3
ISIS 448766 77 168 0,18 22,3
ISIS 449884 95 105 0,23 20,1
ISIS 459014 58 108 0,26 21,4
ISIS 459032 221 422 0,53 18,3
ISIS 459040 56 98 0,16 14,1
ISIS 459157 67 138 0,34 19,4

Функция почек

Для оценки действия ISIS-олигонуклеотидов на функцию почек измеряли уровни общего белка и креатинина в моче и оценивали соотношение общего белка мочи и креатинина. Результаты представлены в Таблице 22.

Таблица 22
Действие лечения антисмысловыми олигонуклеотидами на соотношение белка мочи/креатинина в почках крыс CD/IGS
перед введением дозы неделя 8 неделя12
PBS 1,1 0,7 0,7
ISIS 325568 1,1 3,6 5,2
ISIS 398471 0,8 4,4 4,6
ISIS 436140 1,1 5,4 15,6
ISIS 448766 0,9 5,4 7,0
ISIS 449884 0,9 3,2 3,7
ISIS 459014 1,0 3,6 3,3
ISIS 459032 1,0 4,5 6,0
ISIS 459040 0,8 4,8 5,6
ISIS 459157 1,2 3,3 4,1

Пример 17: Измерение вязкости ISIS-антисмысловых олигонуклеотидов, мишенью которых является GCGR человека

Вязкость антисмысловых олигонуклеотидов, выбранных в ходе исследования, описанного в Примере 16, измеряли с целью отсева антисмысловых олигонуклеотидов с вязкостью более 40 сПз. Олигонуклеотиды с вязкостью выше 40 сПз должны быть слишком вязкими для введения в организм субъектов.

ISIS-олигонуклеотиды (32-35 мг) взвешивали в стеклянном флаконе, добавляли 120 мкл воды и растворяли антисмысловой олигонуклеотид путем нагрева флакона при 50°С. Часть (75 мкл) предварительно нагретого образца переносили пипеткой в микровискозиметр (Cambridge). Температуру микровискозиметра устанавливали на 25°С и измеряли вязкость образца. Другую часть (20 мкл) предварительно нагретого образца переносили пипеткой в 10 мл воды для УФ-считывания при 260 нм и 85°С (прибор Сагу UV). Результаты представлены в Таблице 23 и показывают, что вязкость всех растворов антисмысловых олигонуклеотидов являлась оптимальной и соответствовала вышеуказанному критерию.

Таблица 23
Вязкость и концентрация ISIS-антисмысловых олигонуклеотидов, мишенью которых является GCGR человека
ISIS № Мотив Вязкость (сПз) Концентрация (мг/мл)
398471 5-10-5 27 173
436140 5-10-5 6 162
448766 5-10-5 4 142
449884 3-10-4 4 145
459014 3-10-4 9 167
459032 3-10-4 7 154
459040 3-10-4 11 157
459157 5-10-6 5 144

Пример 18: Фармакокинетика антисмыслового олигонуклеотид а в печени мыши CD1

Мышей CD1 лечили ISIS 449884 и оценивали период полувыведения олигонуклеотида, а также время разрушения и выведения олигонуклеотида из печени.

Лечение

Группе из десяти мышей CD1 дважды в неделю в течение 2 недель подкожно вводили 50 мг/кг ISIS 449884. Группы по пять мышей в каждой умерщвляли через 3 дня и 56 дней после введения последней дозы. Печень собирали для анализа.

Измерение концентрации олигонуклеотида

Измеряли концентрацию полноразмерного олигонуклеотида, а также общую концентрацию олигонуклеотида (в том числе разрушенной формы). Использованный способ являлся модификацией ранее опубликованных способов (Leeds et al., 1996; Geary et al., 1999), заключавшихся в экстракции фенол-хлороформом (жидкость-жидкость) с последующей твердофазной экстракцией. Перед экстракцией добавляли внутренний стандарт (ISIS 355868, 27-членный 2′-O-метоксиэтил-модифицированный фосфортиоатный олигонуклеотид GCGTTTGCTCTTCTTCTTGCGTTTTTT, обозначаемый здесь как SEQ ID NO:119). Концентрации в образце ткани рассчитывали с использованием калибровочных кривых с нижним пределом количественного определения (LLOQ) приблизительно 1,14 мкг/г. Затем рассчитывали период полувыведения с помощью программного обеспечения WinNonlin (PHARSIGHT).

Результаты представлены в Таблице 24 и выражены в мкг/г ткани печени. Рассчитанный период полувыведения ISIS 449884 составил 15,1 дней.

Таблица 24
Концентрация олигонуклеотида ISIS 449884 в печени мышей CD1
Концентрация полноразмерной формы (мкг/г)
День 3 118,7
День 56 10,9

Пример 19: Эффект ISIS-антисмысловых олигонуклеотидов, мишенью которых являлся GCGR человека, у яванских макаков

Яванских макаков лечили ISIS-антисмысловыми олигонуклеотидами, выбранными в ходе исследований, описанных в Примерах 14-18. Оценивали эффективность и переносимость антисмысловых олигонуклеотидов, а также их фармакокинетический профиль в печени и почках. Протестированные антисмысловые олигонуклеотиды человека также обладали перекрестной реакционноспособностью с геномной последовательностью резуса (обозначаемой здесь как SEQ ID NO:3). Чем больше комплементарность между олигонуклеотидом человека и последовательностью макака-резуса, тем больше вероятность перекрестной реакционноспособности олигонуклеотида человека с последовательностью макака-резуса. Сайт инициации и стоп-сайт каждого олигонуклеотида в SEQ ID NO:3 представлены в Таблице 25. "Сайт инициации" означал последний 5′-нуклеотид, являвшийся мишенью гэпмера в последовательности гена макака-резуса.

Таблица 25
Антисмысловые олигонуклеотиды, комплементарные SEQ ID NO.
Сайт инициации Последовательность ISIS № Мотив SEQ ID NO
1495 TCCACAGGCCACAGGTGGGC 398471 5-10-5 17
8857 CTCTTTATTGTTGGAGGACA 436140 5-10-5 102
3196 GCAAGGCTCGGTTGGGCTTC 448766 5-10-5 31
639 GGTTCCCGAGGTGCCCA 449884 3-10-4 11
666
716
744
799
826
4131 GGGCAATGCAGTCCTGG 459014 3-10-4 80
1142 GAAGGTGACACCAGCCT 459032 3-10-4 81
1506 GCTCAGCATCCACAGGC 459040 3-10-4 82
636 GGGTTCCCGAGGTGCCCAATG 459157 5-10-6 85
663
713
741
796
823

Лечение

Перед исследованием обезьян содержали в карантине в течение 5-недельного периода, во время которого животных ежедневно обследовали для оценки общего состояния здоровья. Возраст обезьян составлял 2-3 года, масса тела - от 2 до 5 кг. Девяти группам по пять рандомизированных самцов яванских макаков, каждому, подкожно вводили ISIS-олигонуклеотид или PBS с помощью иглы из нержавеющей стали и шприца соответствующего размера в интракапсулярную область и внешнюю часть бедра. Обезьяны получали 40 мг/кг ISIS 325568, ISIS 398471, ISIS 436140, ISIS 448766, ISIS 449884, ISIS 459014, ISIS 459032, ISIS 459040 или ISIS 459157 четыре раза в неделю в течение первой недели (в дни 1, 3, 5 и 7) в качестве нагрузочных доз, а затем раз в неделю в течение недель 2-13. Контрольной группе из 8 яванских макаков подкожно вводили PBS три раза подряд четырежды в неделю в течение первой недели (дни 1, 3, 5 и 7), а затем раз в неделю в течение недель 2-13.

За период исследования обезьян обследовали два раза в день на наличие признаков заболевания или дистресса. Животных, испытывавших более чем кратковременную или легкую боль или дистресс в связи с лечением, травмой или заболеванием, лечили с привлечением ветеринарного персонала и с применением одобренных анальгетиков или агентов, облегчающих боль, после консультаций с руководителем исследования. Животных с плохим состоянием здоровья или находящихся в предположительно предсмертном состоянии выявляли с целью дальнейшего мониторинга и возможной эвтаназии. Например, одно животное из группы, получавшей ISIS 436140, подвергли эвтаназии в день 86 и одно животное из группы, получавшей ISIS 459040, подвергли эвтаназии в день 71. Запланированную эвтаназию животных проводили в день 93 путем обескровливания после анестезии, вызванной кетамином/ксилазином, и введения пентобарбитала натрия. Протоколы, описанные в настоящем Примере, были одобрены Комитетом учреждения по уходу за животными и их использованию (IACUC).

Снижение уровня мишени в печени

Анализ РНК

В день 93 РНК экстрагировали из ткани печени для анализа GCGR с помощью ПЦР в реальном времени с использованием набора праймеров и зондов человека RTS1508. Кроме того, провели анализы с использованием набора праймеров и зондов человека и макака-резуса RTS1479 (прямая последовательность ATCTCCTGCCCCTGGTACCT, обозначаемая здесь как SEQ ID NO:120; обратная последовательность GGTCCACGCACCCACTGA, обозначаемая здесь как SEQ ID NO:121; последовательность зонда ACCGCTTCGTGTTCAAGAGATGCG, обозначаемая здесь как SEQ ID NO:122). Результаты представлены в виде процентного ингибирования мРНК GCGR по сравнению с PBS-контролем, нормированного по отношению к конститутивному гену циклофилина. Аналогичные результаты получили при нормировании с помощью RIBOGREEN®. Как показано в Таблице 26, лечение с помощью ISIS-антисмысловых олигонуклеотидов привело к значительному снижению мРНК GCGR по сравнению с PBS-контролем. Конкретно, лечение с помощью ISIS 449884 привело к наиболее значительному снижению экспрессии мРНК GCGR.

Таблица 26
Процент ингибирования мРНК GCGR в печени яванского макака по сравнению с PBS-контролем
ISIS № RTS1508/Ribogree n RTS1479/Ribogree n RTS1508/циклофилин RTS 1479/циклофили н
325568 59 49 68 59
398471 27 16 39 30
448766 49 37 55 42
449884 78 75 79 75
459014 25 21 39 32
459157 63 62 72 69

Анализ уровней глюкагона

Уровни глюкагона в плазме измеряли перед введением дозы и на 3, 6, 7 и 10 неделе лечения. Поскольку уровни глюкагона менялись в зависимости от уровня стресса у животных, обезьянам до отбора крови вводили кетамин путем внутримышечной инъекции. Перед пробоотбором животных держали голодными в течение ночи. Приблизительно 1,8-2,0 мл крови отбирали из бедренной вены и помещали в пробирки с K2-ЭДТА, содержащие 10 мкл/мл ингибитора ДПП-IV и 250 тыс. МЕ/мл апротинина. Пробирки переворачивали для смешивания крови с растворами, а затем помещали в воду со льдом. Образцы крови центрифугировали при 3000 g в течение 15 мин при 4-8°С в течение 30 мин после отбора крови.

Повышение уровней глюкагона являлось следствием ингибирования уровней GCGR. Уровни глюкагона измеряли с помощью автоматизированного клинического биохимического анализатора (Hitachi Olympus AU400e, Мелвилл, штат Нью-Йорк, США). Результаты представлены в Таблице 27 и показывают, что ингибирование уровней рецептора глюкагона за счет лечения антисмысловым олигонуклеотидом привело к значительному повышению уровней глюкагона в плазме. Конкретно, лечение с помощью ISIS 449884 привело к повышению уровней глюкагона в зависимости от времени.

Таблица 27
Уровни глюкагона в печени яванского макака после антисмысловой терапии (пг/мл)
Перед введением Неделя3 Неделя 6 Неделя7 Неделя 10
PBS 268 231 248 170 304
ISIS 325568 271 759 726 760 850
ISIS 398471 322 317 279 132 220
ISIS 448766 404 560 572 313 411
ISIS 449884 257 439 631 716 1018
ISIS 459014 348 281 245 122 180
ISIS 459157 369 471 486 538 828

Исследования переносимости

Измерения массы органов и тела

Для оценки влияния ISIS-олигонуклеотидов на общее состояние здоровья животных измеряли массу тела и органов в день 93. Измеренные значения массы тела представлены в Таблице 28. Измеренные значения массы органов также представлены в Таблице 28. Результаты показывают, что влияние лечения антисмысловыми олигонуклеотидами на массу тела и органов находилось в пределах ожидаемого для антисмысловых олигонуклеотидов диапазона. Конкретно, лечение с помощью ISIS 448994 хорошо переносилось с точки зрения массы тела и органов обезьян.

Таблица 28
Конечные значения массы тела и органов яванского макака по сравнению с уровнями до приема препарата
Масса тела (кг) Селезенка (г) Почка (г) Печень (г)
PBS 2,6 4 12 60
ISIS 325568 2,6 8 16 69
ISIS 398471 2,6 5 13 71
ISIS 436140 2,7 13 23 98
ISIS 448766 2,7 9 18 80
ISIS 449884 2,6 5 14 70
ISIS 459014 2,6 5 12 65
ISIS 459032 2,5 5 13 65
ISIS 459040 2,7 5 13 69
ISIS 459157 2,5 7 12 68

Функция печени

Для оценки влияния ISIS-олигонуклеотидов на функцию печени выполняли отбор образцов крови у всех групп, участвующих в исследовании. Образцы крови отбирали из бедренной вены в день 95, через 48 часов после введения дозы. Перед пробоотбором крови обезьян держали голодными в течение ночи. Кровь собирали в пробирки, содержащие антикоагулянт K2-EDTA, которые центрифугировали для получения плазмы. Уровни различных функциональных маркеров печени измеряли с помощью биохимического анализатора Toshiba 200FR NEO (Toshiba Co., Япония). Измеряли уровни АЛТ и ACT в плазме; результаты представлены в Таблице 29 и выражены в МЕ/л. Аналогично измеряли уровень маркера функции печени - билирубина; результаты представлены в Таблице 29 и выражены в мг/дл. Результаты показывают, что лечение антисмысловыми олигонуклеотидами не оказывало влияния на функцию печени за пределами ожидаемого для антисмысловых олигонуклеотидов диапазона. Конкретно, лечение с помощью ISIS 448994 хорошо переносилось с точки зрения функции печени обезьян.

Таблица 29
Влияние лечения антисмысловыми олигонуклеотидами на маркеры функции печени в плазме яванского макака
АЛТ (МЕ/л) ACT (МЕ/л) Билирубин (мг/дл)
PBS 42 42 0,18
ISIS 325568 31 31 0,14
ISIS 398471 56 39 0,16
ISIS 448766 89 43 0,14
ISIS 449884 44 43 0,14
ISIS 459014 24 39 0,16
ISIS 459157 47 34 0,18

Функция почек

Для оценки влияния ISIS-олигонуклеотидов на функцию почек выполняли отбор образцов крови у всех групп, участвующих в исследовании. Образцы крови отбирали из бедренной вены в день 95, через 48 часов после введения дозы. Перед пробоотбором крови обезьян держали голодными в течение ночи. Кровь собирали в пробирки, содержащие антикоагулянт K2-EDTA, которые центрифугировали для получения плазмы. Уровни АМК и креатинина измеряли с помощью биохимического анализатора Toshiba 200FR NEO (Toshiba Co., Япония). Результаты представлены в Таблице 30 и выражены в мг/дл.

Результаты биохимического анализа плазмы показывают, что большинство ISIS-олигонуклеотидов не оказывало влияния на функцию почек за пределами ожидаемого для антисмысловых олигонуклеотидов диапазона. Конкретно, лечение с помощью ISIS 449884 хорошо переносилось с точки зрения функции почек обезьян.

Таблица 30
Влияние лечения антисмысловыми олигонуклеотидами на уровни АМК и креатинина в плазме (мг/дл) у яванских макаков
АМК Креатинин
PBS 17 0,60
ISIS 325568 16 0,52
ISIS 398471 16 0,50
ISIS 448766 13 0,54
ISIS 449884 17 0,59
ISIS 459014 18 0,60
ISIS 459157 17 0,58

Гематология

Для оценки влияния ISIS-олигонуклеотидов на гематологические параметры у яванских макаков на 11 неделе выполняли отбор образцов крови (приблизительно 1,3 мл) в пробирки, содержащие К2-ЭДТА, у каждого из доступных животных, участвовавших в исследовании. В образцах анализировали количество эритроцитов (RBC), количество лейкоцитов (WBC), количество отдельных видов лейкоцитов, например, моноцитов, нейтрофилов, лимфоцитов, а также количество тромбоцитов, содержание гемоглобина и гематокрит, с помощью гематологического анализатора ADVIA120 (Bayer, США). Данные представлены в Таблицах 31 и 32.

Результаты показывают, что олигонуклеотиды не вызывали изменений гематологических параметров за пределами ожидаемого для антисмысловых олигонуклеотидов в указанной дозе диапазона. Конкретно, лечение с помощью ISIS 448994 хорошо переносилось с точки зрения гематологических параметров обезьян.

Таблица 31
Влияние лечения антисмысловыми олигонуклеотидами на различные клетки крови яванских макаков
RBC (×106/мкл) Тромбоциты (×103/мкл) WBC (×103/мкл) Нейтрофилы (×103/мкл) Лимфоциты (×103/мкл) Моноциты (×103/мкл)
PBS 5,4 499 11,5 5,8 5,2 0,28
ISIS 398471 5,4 568 9,1 2,9 5,8 0,21
ISIS 448766 4,9 422 8,6 4,1 3,9 0,34
ISIS 449884 5,2 415 10,0 4.4 5,1 0,25
ISIS 459014 5,1 433 9,8 4,6 4,7 0,26
ISIS 459157 5,3 357 8,0 3,8 3,8 0,26
ISIS 325568 5,1 376 11,7 5,2 5,7 0,55
Таблица 32
Влияние лечения антисмысловыми олигонуклеотидами на гематологические параметры яванских макаков
Гемоглобин (г/дл) Гематокрит (%)
PBS 13,1 43
ISIS 398471 13,1 44
ISIS 448766 12,3 41
ISIS 449884 12,6 41
ISIS 459014 13,2 44
ISIS 459157 13,2 43
ISIS 325568 13,3 44

В целом, результаты исследования показывают, что ISIS 449884 является самым мощным и хорошо переносимым соединением из протестированных по отношению к ингибированию рецептора глюкагона, и является важным кандидатом для лечения метаболических заболеваний, например, диабета, ожирения, инсулинрезистентности и инсулиновой недостаточности.

1. Соединение, способное ингибировать экспрессию GCGR, включающее модифицированный олигонуклеотид, состоящий из 12-30 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований:
а) включающей фрагмент, состоящий из по меньшей мере 12 смежных нуклеиновых оснований, комплементарный фрагменту равной длины нуклеотидов 6691-8473 или 9002-9824 SEQ ID NO: 2,
б) включающей фрагмент, состоящий из 20 смежных нуклеиновых оснований, комплементарный нуклеотидам 15743-15762 SEQ ID NO: 2, или
в) состоящий из 17 смежных нуклеиновых оснований, комплементарных нуклеотидам 10718-10734 SEQ ID NO: 2.

2. Соединение по п. 1, отличающееся тем, что состоит из одноцепочечного модифицированного олигонуклеотида.

3. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид по меньшей мере на 96% комплементарен SEQ ID NO: 2.

4. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид по меньшей мере на 97% комплементарен SEQ ID NO: 2.

5. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид по меньшей мере на 98% комплементарен SEQ ID NO: 2.

6. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид по меньшей мере на 99% комплементарен SEQ ID NO: 2.

7. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид на 100% комплементарен SEQ ID NO: 2.

8. Соединение по п. 1, отличающееся тем, что по меньшей мере одна межнуклеозидная связь является модифицированной межнуклеозидной связью.

9. Соединение по п. 8, отличающееся тем, что каждая межнуклеозидная связь является фосфортиоатной межнуклеозидной связью.

10. Соединение по п. 1, отличающееся тем, что по меньшей мере один нуклеозид указанного модифицированного олигонуклеотида включает модифицированную сахарозу.

11. Соединение по п. 10, отличающееся тем, что по меньшей мере одна модифицированная сахароза является бициклической сахарозой.

12. Соединение по п. 11, отличающееся тем, что каждая из по меньшей мере одной бициклической сахарозы включает мостик 4′-CH2-N(R)-O-2′, где R независимо является Н, С1-С12-алкилом или защитной группой.

13. Соединение по п. 11, отличающееся тем, что каждая из по меньшей мере одной бициклической сахарозы включает мостик 4′-СН(СН3)-O-2′.

14. Соединение по п. 10, отличающееся тем, что по меньшей мере одна модифицированная сахароза включает 2′-O-метоксиэтильную группу.

15. Соединение по п. 1, отличающееся тем, что по меньшей мере один нуклеозид включает модифицированное нуклеиновое основание.

16. Соединение по п. 15, отличающееся тем, что указанное модифицированное нуклеиновое основание является 5-метилцитозином.

17. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид включает:
сегмент разрыва, состоящий из соединенных дезоксинуклеозидов;
сегмент 5′-крыла, состоящий из соединенных нуклеозидов; и
сегмент 3′-крыла, состоящий из соединенных нуклеозидов;
причем сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, и каждый нуклеозид каждого сегмента крыла включает модифицированную сахарозу.

18. Соединение по п. 17, отличающееся тем, что указанный модифицированный олигонуклеотид включает:
сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов;
сегмент 5′-крыла, состоящий из трех соединенных нуклеозидов; и
сегмент 3′-крыла, состоящий из четырех соединенных нуклеозидов;
причем сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла и каждый нуклеозид каждого сегмента крыла включает модифицированную сахарозу.

19. Соединение по п. 17, отличающееся тем, что указанный модифицированный олигонуклеотид включает:
сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов;
сегмент 5′-крыла, состоящий из трех соединенных нуклеозидов; и
сегмент 3′-крыла, состоящий из четырех соединенных нуклеозидов;
причем сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-О-метоксиэтил-модифицированную сахарозу; и каждая межнуклеозидная связь является фосфортиоатной связью.

20. Соединение по п. 1, отличающееся тем, что модифицированный олигонуклеотид состоит из 17 соединенных нуклеозидов.

21. Соединение по п. 17, отличающееся тем, что модифицированный олигонуклеотид состоит из 17 соединенных нуклеозидов.

22. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид состоит из 17-30 соединенных нуклеозидов.

23. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид состоит из 17-25 соединенных нуклеозидов.

24. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид состоит из 17-24 соединенных нуклеозидов.

25. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид состоит из 17-23 соединенных нуклеозидов.

26. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид состоит из 17-22 соединенных нуклеозидов.

27. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид состоит из 17-21 соединенных нуклеозидов.

28. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид включает последовательность нуклеиновых оснований SEQ ID NO: 11, 17, 31, 81, 82, 85 или 102.

29. Соединение по п. 1, отличающееся тем, что указанный модифицированный олигонуклеотид состоит из последовательности нуклеиновых оснований SEQ ID NO: 11, 17, 31, 81, 82, 85 или 102.

30. Соединение по п. 1, отличающееся тем, что модифицированный олигонуклеотид обладает последовательностью нуклеиновых оснований, включающей фрагмент, состоящий из по меньшей мере 17 смежных нуклеиновых оснований, комплементарный фрагменту равной длины, состоящему из нуклеотидов 7267-7283, 7270-7286, 7292-7308, 7295-7311, 7316-7332, 7319-7335, 7341-7357, 7344-7360, 7437-7453, 7365-7381, 7368-7384, 7389-7405, 7392-7408, 7416-7432, 7440-7456, 7783-7799, 8133-8152, 8144-8160 или 9804-9823 SEQ ID NO: 2
и указанный модифицированный олигонуклеотид по меньшей мере на 96% комплементарен SEQ ID NO: 2.

31. Соединение, способное ингибировать экспрессию GCGR, включающее модифицированный одноцепочечный олигонуклеотид, состоящий из последовательности нуклеиновых оснований SEQ ID NO: 11, отличающийся тем, что указанный олигонуклеотид включает:
сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов;
сегмент 5′-крыла, состоящий из трех соединенных нуклеозидов;
сегмент 3′-крыла, состоящий из четырех соединенных нуклеозидов;
причем сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь указанного модифицированного олигонуклеотида является фосфортиоатной связью, а каждый остаток цитозина указанного модифицированного олигонуклеотида является 5-метилцитозином.

32. Соединение, способное ингибировать экспрессию GCGR, включающее модифицированный одноцепочечный олигонуклеотид, состоящий из последовательности нуклеиновых оснований SEQ ID NO: 80, отличающийся тем, что указанный олигонуклеотид включает:
сегмент разрыва, состоящий из десяти соединенных дезоксинуклеозидов;
сегмент 5′-крыла, состоящий из трех соединенных нуклеозидов;
сегмент 3′-крыла, состоящий из четырех соединенных нуклеозидов;
причем сегмент разрыва расположен между сегментом 5′-крыла и сегментом 3′-крыла, каждый нуклеозид каждого сегмента крыла включает 2′-O-метоксиэтил-модифицированную сахарозу, каждая межнуклеозидная связь указанного модифицированного олигонуклеотида является фосфортиоатной связью, а каждый остаток цитозина указанного модифицированного олигонуклеотида является 5-метилцитозином.

33. Соединение, способное ингибировать экспрессию GCGR, включающее модифицированный олигонуклеотид, состоящий из 12-30 соединенных нуклеозидов и обладающий последовательностью нуклеиновых оснований, включающей фрагмент из по меньшей мере 12 смежных нуклеиновых оснований SEQ ID NO: 11, 17, 31, 81, 82 или 85, причем мишенью указанного модифицированного олигонуклеотида является SEQ ID NO: 2.

34. Композиция, снижающая экспрессию GCGR, включающая эффективное количество соединения по любому из пп. 1-33 или его фармацевтически приемлемого производного и по меньшей мере один из фармацевтически приемлемого носителя или разбавителя.

35. Способ предотвращения, лечения, облегчения или замедления прогрессирования метаболического заболевания или состояния, включающий введение животному эффективного количества соединения по любому из пп. 1-33.

36. Способ по п. 35, отличающийся тем, что животное является человеком.

37. Способ по п. 35, отличающийся тем, что заболевание или состояние является диабетом.

38. Способ по п. 35, отличающийся тем, что заболевание или состояние является диабетом 2 типа.

39. Способ снижения уровней глюкозы в крови животного, включающий введение указанному животному эффективного количества соединения по любому из пп. 1-33.

40. Способ по п. 39, отличающийся тем, что животное является человеком.

41. Способ по п. 39, отличающийся тем, что уровни глюкозы в крови являются уровнями глюкозы в плазме или уровнями глюкозы в сыворотке.

42. Способ по п. 39, отличающийся тем, что животное страдает диабетом.

43. Способ профилактики или задержки начала заболевания или состояния, ассоциированного с GCGR, у животного, включающий введение животному терапевтически или профилактически эффективного количества соединения по любому из пп. 1-33.

44. Способ по п. 43, отличающийся тем, что животное является человеком.

45. Способ по п. 43, отличающийся тем, что заболевание или состояние является диабетом.

46. Способ по п. 43, отличающийся тем, что заболевание или состояние является диабетом 2 типа.

47. Способ профилактики или задержки начала повышения уровней глюкозы в крови животного, включающий введение животному терапевтически или профилактически эффективного количества соединения по любому из пп. 1-33.

48. Способ по п. 47, отличающийся тем, что животное является человеком.

49. Способ по п. 47, отличающийся тем, что уровни глюкозы в крови являются уровнями глюкозы в плазме или уровнями глюкозы в сыворотке.

50. Способ по п. 47, отличающийся тем, что животное страдает диабетом.

51. Применение соединения по любому из пп. 1-33 для предотвращения, лечения, облегчения или замедления прогрессирования метаболического заболевания или состояния у животного.

52. Применение соединения по любому из пп. 1-33 для снижения уровней глюкозы в крови животного.

53. Применение соединения по любому из пп. 1-33 для профилактики или задержки начала заболевания или состояния, ассоциированного с GCGR, у животного.

54. Применение соединения по любому из пп. 1-33 для задержки начала повышения уровней глюкозы в крови животного.

55. Применение соединения по любому из пп. 1-33 для приготовления лекарственного средства для предотвращения, лечения, облегчения или замедления прогрессирования метаболического заболевания или состояния у животного.

56. Применение соединения по любому из пп. 1-33 для приготовления лекарственного средства для снижения уровней глюкозы в крови животного.

57. Применение соединения по любому из пп. 1-33 для приготовления лекарственного средства для профилактики или задержки начала заболевания или состояния, ассоциированного с GCGR, у животного.

58. Применение соединения по любому из пп. 1-33 для приготовления лекарственного средства для задержки начала повышения уровней глюкозы в крови животного.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к способу повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA), и может быть использовано в медицине.

Изобретение относится к генной инженерии. Описан способ доставки нуклеиновой кислоты в митохондрию и генетической модификации клетки, включающий воздействие на клетку композицией, содержащей по меньшей мере одну нуклеиновую кислоту и по меньшей мере один органоидно-направленный наноноситель, где наноноситель доставляет по меньшей мере одну нуклеиновую кислоту сквозь клеточную мембрану в митохондрию.

Изобретение относится к области биохимии. Представлен способ ингибирования репликации вируса иммунодефицита человека (ВИЧ), включающий обработку клеток млекопитающего агентом, выбранным из группы пептидов, интерферирующей РНК или антисмыслового олигонуклеотида, разрушающим структуру белков виментина и/или кератина-10 цитоскелетных промежуточных филаментов (IF) в клетке млекопитающего.

Настоящее изобретение относится к биотехнологии и представляет собой фармацевтические составы для перорального введения антисмыслового олигонуклеотида против SMAD7, фармацевтически приемлемые таблетки для перорального применения антисмыслового олигонуклеотида против SMAD7, а также пероральную дозированную форму, содержащие указанный антисмысловой олигонуклеотид и энтеросолюбильное покрытие, содержащее сополимер этилакрилата-метакриловой кислоты.

Изобретение относится к области биохимии, в частности к трансгенному растению осины со следующими признаками повышенной продуктивности - увеличенным выходом биомассы, листьями большего размера, увеличенной активностью глутаминсинтетазы и повышенной эффективностью использования азота, а также с модифицированной древесиной по сравнению с нетрансформированным растением осины, содержащему нуклеиновую кислоту, кодирующую глутаминсинтетазу, а также к способу его получения.

Изобретение относится к области биохимии, в частности к трансгенному растению березы со следующими признаками повышенной продуктивности - увеличенным выходом биомассы, листьями большего размера, увеличенной активностью глутаминсинтетазы и повышенной эффективностью использования азота по сравнению с аналогом дикого типа, содержащему нуклеиновую кислоту, кодирующую глутаминсинтетазу, а также к способу его получения.

Настоящее изобретение относится к биохимии, в частности к одноцепочечным модифицированным олигонуклеотидам, способным ингибировать экспрессию транстиретина в клетке.

Изобретение относится к области биохимии. Представлены варианты молекулы нуклеиновой кислоты, связывающейся с SDF-1.

Изобретение относится к области биотехнологии, в частности к рекомбинантной плазмидной ДНК, созданной при помощи новых праймеров CTTCCATATGGAACGAAGGCGTTTGTG и TGTGGATCCAGCTAGTTAGGCATGAAA. Указанная рекомбинантная плазмидная ДНК используется для получения рекомбинантного белка PRAME-F, состоящего из пептида MGSSHHHHHHSSGLVPRGSH слитого с последовательностью природного белка PRAME, путём её экспрессии в бактериальных клетках.

Изобретение относится к биохимии. Описаны антисмысловые олигонуклеотиды, которые увеличивают экспрессию указанного гена альфа-субъединицы потенциалзависимого натриевого канала (SCNA) in vivo или in vitro по сравнению с нормальным контролем.
Изобретение относится к фармацевтической промышленности и представляет собой композицию, содержащую витамин В9, или фолиевую кислоту, или фолацин, и мио-инозит и альфа-липоевую кислоту для применения в куративном лечении синдрома поликистоза яичников, бесплодия и нарушений менструального цикла.

Изобретение относится к амидным соединениям структурной формулы 1, которые обладают ингибирующей активностью в отношении 11β-HSD1 фермента. В формуле 1 X представляет N или CR, и Y представляет N или СН при условии, что X и Y не являются в одно и то же время углеродом; Z представляет N или СН; R1 и R2 представляют независимо водород, (С3-С10)циклоалкил, норборнил, адамантил или норадамантил, или R1 и R2 могут быть связаны друг с другом вместе с атомами азота, к которым они присоединены, образуя (С5-С10) насыщенный или ненасыщенный гетероцикл или сконденсированный гетероцикл, при условии, что R1 и R2 не являются в одно и то же время водородом; L представляет одинарную связь, -СО-, -SO2-, -(CR21R22)-(СН2)c- (с представляет целое число 0-5), , -СО(CR21R22)d- (d представляет целое число 1-6), (С3-С10)циклоалкилен, (С6-С20)арилен или 5-6-членный гетероарилен, включающий один или два гетероатома, выбранных из N; R21 и R22 представляют независимо водород или (C1-С10)алкил, R представляет водород или гидроксил; R4 и R5 независимо представляют водород или (С1-С10)алкил, или R4 и R5, связанные вместе, образуют 6-членный ненасыщенный карбоцикл; R6 и R7 представляют независимо водород, (С1-С10)алкил или галоген; R31-R38, R41-R43 и R46 представляют независимо водород или (С1-С10)алкил; и m и n независимо представляют целое число 0-3 при условии, что m+n представляют целое число 2 или более.

Изобретение относится к фармацевтике, в частности к фармацевтическим композициям метформина в форме спрессованной таблетки. Композиция также включает карбоксиметилцеллюлозу натрия, гидроксипропилметилцеллюлозу 2208, диоксид кремния или коллоидный диоксид кремния и стеарат магния.

Изобретение относится к соединениям общей формулы I, или их рацемической смеси, или индивидуальным оптическим изомерам, или фармацевтически приемлемым солям, обладающим свойствами агониста рецепторов желчных кислот TGR.
Изобретение относится к медицине и может быть использовано для коррекции ожирения гиноидного типа. Для этого определяют тип нарушения пищевого поведения и проводят его психофизиологическую коррекцию.

Настоящее изобретение относится к новым 4-триметиламмониобутиратам формулы I, где А1, R1, m и n являются такими, как определено в описании и в формуле изобретения, а также к их фармацевтически приемлемым солям.

Изобретение относится к соединению общей формулы IA: или его фармацевтически приемлемой соли. Также изобретение относится к фармацевтическим композициям, содержащим терапевтически эффективное количество указанного соединения или его фармацевтически приемлемой соли.

Изобретение относится к фармацевтической промышленности и представляет собой фармацевтическую композицию для снижения триглицеридов у индивидуума, нуждающегося в этом, где фармацевтическая композиция содержит по меньшей мере 95% ЕРА по массе от всех жирных кислот, присутствующих в композиции, и ингибитор редуктазы HMG-CoA.

Изобретение относится к медицине и фармацевтической промышленности и касается фармацевтического состава, включающего ингибитор дипептидилпептидазы IV (DPP-IV), предпочтительно вилдаглиптин от 1,5 до 20% и метформин от 80 до 98,5%.

Изобретение относится к ингибитору DGAT формулы (I), его N-оксиду, фармацевтически приемлемой соли и сольвату, фармацевтической композиции на его основе и его применению для лечения заболеваний, опосредованных активностью DGAT, таких как ожирение и диабет.

Изобретение относится к области биотехнологии, конкретно к способу повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA), и может быть использовано в медицине.
Наверх