Модифицированный генетически кодируемый фотосенсибилизатор



Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор
Модифицированный генетически кодируемый фотосенсибилизатор

 


Владельцы патента RU 2599443:

Федеральное государственное бюджетное образовательное учреждение высшего образования "Нижегородская государственная медицинская академия" Министерства здравоохранения Российской Федерации (ФГБОУ ВО НижГМА Минздрава России) (RU)

Изобретение относится к области биотехнологии и может быть использовано для рекомбинантного получения мутантов фототоксического флуоресцентного белка. Рекомбинантным путем получают мутанты фототоксического флуоресцентного белка KillerRed. Мутант KillerOrange с SEQ ID NO: 02 содержит замены Y68W, D115G, N147S, F179L, Y223H и E238Q, а KillerGreen с SEQ ID NO: 04 содержит замены V46A, Y68W, А74Т, D115G, N147S, Y223H и E238Q. Изобретение позволяет получить мутанты фототоксического флуоресцентного белка KillerRed, обладающие измененными спектральными характеристиками. 6 н.п. ф-лы, 3 ил., 1 табл., 5 пр.

 

Предлагаемое изобретение относится в основном к области биологии и химии, и направлено, в частности, на флуоресцентные белки.

Флуоресцентные белки, включая зеленый флуоресцентный белок (Green Fluorescent Protein, GFP), его мутанты и гомологи, сегодня широко известны благодаря их интенсивному использованию в качестве флуоресцентных маркеров in vivo в биомедицинских исследованиях, что детально рассмотрено Lippincott-Schwartz и Patterson в Science (2003) 300(5616):87-91.

Флуоресцентные белки - это белки, которые способны к флуоресценции при облучением светом подходящей длины волны. Флуоресцентные свойства этих белков обусловлены взаимодействием двух или более аминокислотных остатков, формирующих хромофор, а не флуоресценцией какого-либо одного аминокислотного остатка.

GFP гидромедузы Aequorea aequorea (синоним A. victoria), был описан Johnson et al. в J Cell Comp Physiol. (1962), 60:85-104, как часть биолюминесцентной системы медузы, где GFP играет роль вторичного эммитера, преобразовывающего синий свет от фотобелка экворина в зеленый свет кДНК, кодирующая A. victoria GFP была клонирована Prasher et al. (Gene (1992), 111(2):229-33). Оказалось, что этот ген может быть гетерологично экспрессирован в практически любом организме благодаря уникальной способности GFP автокаталитически образовывать хромофор (Chalfie et al., Science 263 (1994), 802-805). Эти сведения открыли широкие перспективы для использования GFP в клеточной биологи, в качестве генетически кодируемой флуоресцирующей метки.

GFP был использован в широком спектре приложений, включая исследование экспрессии генов и локализацию белков (Chalfie et al., Science 263 (1994), 802-805, and Heim et al. in Proc. Nat. Acad. Sci. (1994), 91: 12501-12504), как инструмент для визуализации внутриклеточного распределения органелл (Rizzuto et al., Curr. Biology (1995), 5: 635-642), для визуализации транспорта белков по секреторному пути (Kaether and Gerdes, FEBS Letters (1995), 369: 267-271).

Были проведены многочисленные исследования для улучшения свойств avGFP (Aequorea victoria GFP) и для получения вариантов GFP, пригодных и оптимизированных для различных исследовательских целей. Была проведена оптимизация генетического кода avGFP (codon usage) для повышения уровня экспрессии в клетках млекопитающих ("гуманизированный" GFP, Haas, et al., Current Biology (1996), 6: 315-324; Yang, et al., Nucleic Acids Research (1996), 24: 4592-4593). Были получены различные мутанты GFP, в том числе "усиленный зеленый флуоресцентный белок" (EGFP), имеющий две аминокислотные замены: F64L и S65T (Heim et al., Nature 373 (1995), 663-664). Другие мутанты являются синим, голубым и желто-зеленым спектральными вариантами avGFP и содержат замены аминокислотных остатков, формирующих хромофор, и\или остатков, формирующих окружение хромофора.

В 1999 г. гомологи GFP были клонированы из небиолюминесцентных видов Anthozoa (Matz et al., Nature Biotechnol. (1999), 17: 969-973). Это открытие продемонстрировало, что эти белки не являются обязательно компонентом биолюминесцентной системы. GFP-подобные белки из Anthozoa обладали большим спектральным разнообразием и включали циановые, зеленые, желтые, красные флуоресцентные белки и фиолетово-синие нефлуоресцентные хромопротеины (CPs) (Matz et al., Bioessays (2002), 24(10):953-959). В дальнейшем кДНК GFP-подобных белков были клонированы из ряда гидроидных медуз и из копепод (Shagin et al., Mol Biol Evol. (2004), 21(5):841-850). Сегодня семейство GFP-подобных белков включает сотни флуоресцентных и окрашенных гомологов GFP. Сходство этих белков с GFP варьирует от 80-90% до менее чем 25% идентичности аминокислотной последовательности.

Были получены кристаллические структура avGFP дикого типа, GFP S65T мутанта и ряда гомологов GFP (Ormo et al. Science (1996) 273: 1392-1395; Wall et al. Nat Struct Biol (2000), 7: 1133-1138; Yarbrough et al. Proc Natl Acad Sci USA (2001) 98: 462-467; Prescott et al. Structure (Camb) (2003), 11: 275-284; Petersen et al. J Biol Chem (2003), 278: 44626-44631; Wilmann et al. J Biol Chem (2005), 280: 2401-2404; Remington et al. Biochemistry (2005), 44, 202-212; Quillin et al. Biochemistry (2005), 44: 5774-5787). Было постулировано, что все члены семейства обладают общей 3D структурой, представляющей собой так называемый бочонок из 11 бета-слоев, образующих компактную встречно-параллельную структуру, внутри которой располагается альфа-спираль, содержащая хромофор. Хромофор формируется путем окислительной циклизации трех консервативных аминокислотных остатков в центральном регионе альфа-спирали (Cody et al., Biochemistry (1993) 32, 1212-1218). Положения аминокислотных остатков, формирующих хромофор, соответствует Ser65-Tyr66-Gly67 региону avGFP. Эти аминокислотные остатки легко могут быть идентифицированы у любого GFP-подобного белка путем выравнивания его последовательности с последовательностью avGFP.

Процесс автокаталитического формирования хромофора белков с различными спектральными свойствами подробно описан в ряде статей и включает несколько химических реакций (Heim et al. Proc Natl Acad Sci USA. 1994; 91:12501-12504; Ormo et al. Science. 1996;273:1392-1395; Yang et al. Nat Biotechnol. 1996; 14:1246-1251; Brejc et al. J. Proc Natl Acad Sci USA. 1997; 94: 2306-2311; Palm et al. Nat Struct Biol. 1997; 4:361-365; Gurskaya et al., BMC Biochem. 2001; 2:6; Gross et al. Proc Natl Acad Sci USA. 2000; 97:11990-11995; Wall et al. Nat Struct Biol. 2000; 7:1133-1138; Yarbrough et al., J. Proc Natl Acad Sci USA. 2001; 98:462-467; Pakhomov, A.A. and Martynov, V. I. Chem. Biol. 2008, 15, 755- 764; Quillinet al. (2005) Biochemistry 44, 5774- 5787; Yampolsky et al. (2005) Biochemistry 44, 5788-5793; Shu et al. (2006) Biochemistry 45, 9639-9647; Kikuchi et al. (2008) Biochemistry 47, 11573- 11580; Yampolsky et al., Biochemistry, 2009, 48 (33), pp 8077-8082).

Было показано, что флуоресцентный белок KillerRed обладает фототоксическими свойствами, что позволяет использовать его для прицельного уничтожения клеток и биологических молекул (белков, ДНК) непосредственно в живых организмах (Bulina et al., Nat Biotechnol. 2006 Jan; 24(1):95-9; Bulina et al., Nat Protoc. 2006; 1(2):947-53). В неактивном состоянии KillerRed - красный флуоресцентный белок, малотоксический для клеток и белков. Под воздействием зеленого света KillerRed начинает продуцировать активные формы кислорода. Активация фототоксичности белка сопровождается структурной перестройкой хромофора и утратой способности к флуоресценции.

Пространственная организация мономера KillerRed представляет собой типичный для флуоресцентных белков β-бочонок, образованный 11-ю β-сегментами, с центральной δ-спиралью, содержащей хромофор, полученный в результате посттрансляционной модификации хромофор-образующей последовательности Gln65-Ty66-Gly67 (Pletnev et al., J Biol Chem. 2009; 284(46): 32028-32039). В белке KillerRed GFP-подобный домен (β-бочонок) составляют аминокислотные остатки в положениях с 6 по 225, соответствующие положениям с 6 по 229 последовательности avGFP.

Хромофор KillerRed в активной флуоресцентной форме представляет собой планарную бициклическую систему сопряженных двойных связей, состоящую из пятичленного имидазолинонового и фенольного циклов. Фенольный цикл Тук66 принимает цис-ориентацию по отношению к связи Ca-N(66), отвечающую активному флуоресцентному состоянию белка. Эта ориентация стабилизируется двумя водородными связями с Asn145 и через молекулу воды с Thr201. В процессе формирования хромофора Сα атом первого остатка Gln65 принимает sp2 гибридизацию, характеризующуюся плоским тригональным расположением примыкающих связей. При этом, образующаяся частично двойная N-ацилиминная связь N=Cα(Gln65) приводит к расширению сопряженной л-электронной системы, вызывающему сдвиг максимумов длин волн возбуждения и эмиссии в красную область спектра. Ближайшее окружение хромофора сформировано из боковых цепей 17-ти остатков, включая каталитические Arg94 и Glu218. Большинство этих остатков вовлечено в развитую систему водородных связей, как непосредственно, так и через молекулы воды.

Уникальной особенностью пространственной структуры KillerRed является наличие заполненного водой канала, идущего от торца β-цилиндрической архитектуры белка к центральной области хромофора. Этот канал может облегчать доступ кислорода к хромофору, способствовать выходу активных форм кислорода из белка наружу, а также служить проводником протонов или электронов при фотовозбуждении хромофора. Эта особенность, по-видимому, является одним из ключевых структурных факторов наблюдаемых фототоксических свойств белка.

Белок KillerRed является единственным на сегодняшний день GFP-подобным флуоресцентным белком, проявляющим выраженные фототоксические свойства. Создание мутантов этого белка, имеющих иные спектральные характеристики, существенно расширяет возможности прицельной инактивации клеточных белков (метод хромофор-зависимой световой инактивации, CALI, от chromophore-assisted light inactivation), так как открывает возможность, меняя длину волны облучения, прицельно инактивировать светом не один клеточный белок, а несколько. Введение в клетку сразу нескольких фототоксических белков, обладающих различными спектральными характеристиками, позволяет также увеличить общую фототоксичность для клеток при облучении белым светом. Кроме того, создание мутантов, фототоксичность которых активируется светом с длиной волны 450-470 нм, позволяет использовать их в двухфотонной микроскопии.

Предлагаемый в настоящей заявке подход направлен на создание таких мутантов и расширение линейки фототоксических GFP-подобных флуоресцентных белков.

Сущность изобретения

Предлагаемое изобретение обеспечивает выделенные молекулы нуклеиновых кислот, кодирующие мутантные формы KillerRed, обладающие иными спектральными характеристиками, чем исходный белок.

В преимущественных воплощениях указанные белки характеризуются аминокислотной последовательностью, которая отличается от последовательности белка KillerRed по крайней мере заменой Y68W (тирозина в положении 68 на триптофан; здесь и далее аминокислотные остатки указаны в однобуквенном коде, нумерация аминокислот соответствует нумерации аминокислот в KillerRed, SEQ ID NO: 6).

В преимущественных воплощениях указанные белки содержат также несколько дополнительных замен, выбранных из группы V46A, А74Т, D115G, N147S, F179L, Y223H, E238Q.

Примеры аминокислотных последовательностей функциональных белков предлагаемого изобретения приведены в SEQ ID NO: 02 и SEQ ID NO: 04. Примеры их нуклеотидных последовательностей приведены в SEQ ID NO: 01 и SEQ ID NO: 03.

Так же обеспечиваются нуклеиновые кислоты, кодирующие белки предлагаемого изобретения, слитые с сигналом внутриклеточной локализации. Будучи экспрессированы в клетках, эти белки направляются в определенные клеточные компартменты или органеллы, чувствительные к окислению активными формами кислорода.

Молекулы нуклеиновых кислот, которые отличаются от представленных нуклеотидных последовательностей вследствие вырожденности генетического кода так же входят в рамки предлагаемого изобретения.

Белки предлагаемого изобретения могут быть экспрессированы в живых клетках и использованы для прицельного уничтожения целевых белков, выбранных клеток или клеточных популяций, как в клеточной культуре, так и в целых организмах.

В других воплощениях также обеспечиваются векторы, включающие нуклеиновую кислоту предлагаемого изобретения. Кроме того, предлагаемое изобретение обеспечивает кассеты экспрессии, включающие нуклеиновую кислоту предлагаемого изобретения и регуляторные элементы, необходимые для экспрессии нуклеиновой кислоты в выбранной клетке-хозяине. Кроме того, также обеспечиваются клетки, стабильные клеточные линии, трансгенные животные и трансгенные растения, включающие нуклеиновые кислоты, векторы или экспрессионные кассеты предлагаемого изобретения.

В других воплощениях обеспечиваются функциональные флуоресцентные белки предлагаемого изобретения, которые кодируются нуклеиновыми кислотами указанными выше (например, выделенные белки имеющие аминокислотные последовательности SEQ ID NO: 02 и SEQ ID NO: 04).

Кроме того, обеспечиваются наборы, содержащие нуклеиновые кислоты или векторы или экспрессионные кассеты, включающие указанные нуклеиновые кислоты предлагаемого изобретения.

Краткое описание представленных фигур

На фиг.1 показано выравнивание белка KillerRed (KillR, SEQ ID NO: 06) и других флуоресцентных белков - хромобелка amn2CP (SEQ ID NO: 7) из антомедузы, на основе которого был получен KillerRed, красного флуоресцентного белка DsRed (SEQ ID NO: 8) из кораллового полипа Discosoma, и зеленого флуоресцентного белка avGFP (SEQ ID NO:9) из медузы Aequorea victoria. Аминокислотные остатки, формирующие хромофор, подчеркнуты. Аминокислотные остатки, чьи боковые цепи погружены внутрь белковой глобулы, показаны на сером фоне.

На фиг.2 представлены спектры возбуждения (1) и эмиссии (2) флуоресценции белка KillerOrange (SEQ ID NO: 1, 2).

На фиг.3 представлены спектры возбуждения (1) и эмиссии (2) флуоресценции белка KillerGreen (SEQ ID NO: 3, 4).

Подробное описание предлагаемого изобретения

Предлагаемое изобретение направлено на молекулы нуклеиновых кислот, которые кодируют мутантные формы KillerRed. Нуклеиновые кислоты настоящего изобретения получены с помощью рекомбинантных технологий. В предпочтительных воплощениях, нуклеиновые кислоты предлагаемого изобретения кодируют белки, обладающие иными спектральными характеристиками, нежели KillerRed. В некоторых воплощениях нуклеиновые кислоты предлагаемого изобретения кодируют мутантные формы KillerRed оперативно слитые с сигналами внутриклеточной локализации.

Также обеспечиваются векторы и кассеты экспрессии, включающие нуклеиновую кислоту предлагаемого изобретения. Кроме того, обеспечиваются клетки, стабильные клеточные линии, трансгенные животные и трансгенные растения, включающие нуклеиновые кислоты, векторы или экспрессионные кассеты предлагаемого изобретения.

В других воплощениях обеспечиваются функциональные флуоресцентные белки предлагаемого изобретения, которые кодируются нуклеиновыми кислотами, указанными выше.

Указанные белковые и нуклеотидные композиции применяются во многих различных приложениях и методах, в частности, в приложениях инактивации целевых белков и прицельного уничтожения клеток с помощью облучения светом определенной длины волны. Наконец, обеспечиваются наборы для их использования в таких методах и приложениях.

Определения

Различные термины, относящиеся к биологическим молекулам предлагаемого изобретения, используются выше и также в описании и в формуле изобретения.

Как здесь используется, термин "флуоресцентный белок" означает белок, относящийся к семейству GFP-подобных белков, который содержит GFP-домен и обладает способностью к флуоресценции; например, он может проявлять низкую, среднюю или интенсивную флуоресценцию при облучении светом с подходящей для возбуждения длиной волны. Флуоресцентное свойство этих белков представляет собой такое свойство, которое является результатом работы хромофора, образующегося путем автокаталитической циклизации трех или более аминокислотных остатков в полипептидной цепи. Как таковые флуоресцентные белки предлагаемого изобретения не включают белки, которые обладают флуоресценцией за счет отдельных флуоресцирующих остатков, таких как триптофан, тирозин и фенилаланин.

Как здесь используется, термин "avGFP" относится к зеленому флуоресцентному белку из медузы Aequorea victoria, включая варианты avGFP, известные из уровня техники, сконструированные для обеспечения большей флуоресценции или флуоресценции в других цветовых областях. Последовательность дикого типа avGFP была раскрыта в Prasher et al. (1992, Gene 111:229-33).

Термин "гуманизированный" относится к изменению нуклеотидной последовательности флуоресцентного белка, сделанной для оптимизации генетического кода кодонов для экспрессии в клетках млекопитающих (Yang et al., 1996, Nucleic Acids Research 24:4592-4593).

Как здесь используется, термин "выделенный" означает молекулу или клетку, которые находятся в среде, отличной от среды, в которой молекула или клетка находятся в естественных условиях.

Как здесь используется, термин "мутант" или "производное" относятся к белку, раскрытому в предлагаемом изобретении, в котором одна или более аминокислот добавлены и/или замещены и/или удалены (делетированы) и/или вставлены (инсертированы) в N-конец и/или С-конец, и/или в пределах нативных аминокислотных последовательностей белков настоящего изобретения. Как здесь используется, термин "мутант" относится к молекуле нуклеиновой кислоты, которая кодирует мутантный белок. Кроме того, термин "мутант" здесь относится к любому варианту, который короче или длиннее белка или нуклеиновой кислоты.

Как здесь используется, "гомология" - это термин, использующийся для описания взаимосвязи последовательностей нуклеотидов или аминокислот с другими последовательностями нуклеотидов или аминокислот, которая определена степенью идентичности и/или сходства между указанными сравниваемыми последовательностями.

[001] Как здесь используется, аминокислотная или нуклеотидная последовательности "по существу сходны" или "по существу такие же как референсная последовательность, если аминокислотная или нуклеотидная последовательности имеют, по крайней мере, 85% идентичности с указанной последовательностью внутри выбранного для сравнения региона. Таким образом, по существу сходные последовательности включают те, которые имеют, например, по крайней мере, 85% идентичности, по крайней мере, 90% идентичности, по крайней мере, 95% идентичности или, по крайней мере, 96%, 97%б 98% или 99% идентичности. Две последовательности, которые идентичны одна другой, так же по существу сходны.

Для целей предлагаемого изобретения длина сравниваемых последовательностей флуоресцентных белков соответствует длине GFP-домена. GFP-домен может быть идентифицирован с помощью анализа кристаллической структуры флуоресцентного белка или с помощью выравнивания аминокислотной последовательности белка с avGFP. GFP-домен может быть идентифицирован так же с помощью программ для анализа доменной организации белков, таких как Conserved Domain Database (CDD) и SMART (a Simple Modular Architecture Research Tool). Было показано, что в состав домена, формирующего "бочонок" входят аминокислотные остатки, соответствующие положениям с 6 по 229 последовательности avGFP, где позиции соответствующих аминокислотных остатков определяются с помощью выравнивания аминокислотной последовательности белка с avGFP (рис.1). Для белка KillerRed в состав домена входят аминокислотные остатки, соответствующие положениям с 6 по 225. Было показано, что аминоксилотные фрагменты, не входящие в состав GFP-домена, могут содержать делеции, инсерции и замены аминокислотных остатков; при этом не происходит существенного изменения спектральных свойств флуоресцентного белка (Shimozono et al., Biochemistry 2006, 45, 6267-6271; Crameri et al., Nat. Biotechnol. 1996, 14:315-319).

Процент идентичности последовательностей определяется на основании референсной последовательности. Алгоритмы для анализа последовательности известны в данной области, такие как BLAST, описанный в Altschul et al., J. Mol. Biol., 215, pp.403-10 (1990). Для целей предлагаемого изобретения сравнение нуклеотидных и аминокислотных последовательностей производимое с помощью пакета программ Blast, предоставляемого National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/blast) с использованием содержащего разрывы выравнивания со стандартными параметрами, может быть использовано для определения уровня идентичности и сходства между нуклеотидными последовательностями и аминокислотными последовательностями.

Как здесь используется, термин "подобные флуоресцентные белки" или "по существу сходные флуоресцентные белки" относится к флуоресцентным белкам, которые имеют GFP-домены, идентичные по крайней мере на 85%, как правило идентичные на 90% или более, чаще всего идентичные, по крайней мере, на 95% или более (например на 96% и более, 97% и более, 98% и более, 99% и более, 100%).

В некоторых воплощениях, термин "подобные флуоресцентные белки" или "по существу сходные флуоресцентные белки" относится к флуоресцентным белкам, которые имеют аминокислотные последовательности целого белка, идентичные, по крайней мере, на 85%, как правило, идентичные на 90% или более, чаще всего идентичные, по крайней мере, на 95% или более (например на 96% и более, 97% и более, 98% и более, 99% и более, 100%).

Как здесь используется, термин "функциональный" означает, что нуклеотидная или аминокислотная последовательность может функционировать для указанного испытания или задачи. Термин "функциональный", используемый для описания KillerRed и химерного белка предлагаемого изобретения, означает, что белок имеет фототоксические свойства.

Как здесь используется, "биохимические свойства" относятся к белковому фолдингу (сворачиванию) и скорости созревания, времени полужизни, способности к агрегации, способности к олигомеризации, pH и температурной стабильности, и другим подобным свойствам.

Как здесь используется, "флуоресцентные свойства" или "спектральные свойства " относятся к коэффициенту молярной экстинкции при подходящей длине волны, к квантовому выходу флуоресцентции, форме спектра возбуждения флуоресценции или спектра испускания, длине волны, соответствующей максимуму возбуждения флуоресценции, и длине волны, соответствующей максимуму испускания, отношению амплитуды возбуждения флуоресценции при двух разных длинах волн, отношению амплитуды испускания при двух разных длинах волн, времени жизни возбужденного состояния, и анизотропии оптических свойств. Измеряемая разница может быть определена как количество любого количественного флуоресцентного свойства, например, интенсивность флуоресцентции при определенной длине волны, или интегральная флуоресценция на всем спектре испускания.

Как здесь используется, термины "фототоксические свойства" или "фототоксичность" относятся к способности белка вызывать повреждение близлежащих молекул, например близлежащих белков, нуклеиновых кислот, и/или липидов, что в свою очередь может вызывать гибель клеток, остановку клеточных делений или нарушение клеточной дифференцировки и/или пролиферации. Для сравнения фототоксических свойств может быть использована бактериальная система. Например, белки могут быть экспрессированы в клетках бактерий (например, Е. coli) путем трансфекции подходящими экспрессирующими векторами, кодирующими указанные белки под контролем промотора, обеспечивающего экспрессию белка в данных бактериальных клетках. Колонии выращивают в течение ночи при 37°C и далее чашки инкубируют при 4°С до полного созревания белков. Для каждого белка отбирают единичную колонию, которую суспендируют в 0.1 мл буфера PBS, после чего половину объема 30 мин облучают активирующим светом определенной интенсивности, а половину оставляют в темноте в качестве контроля. Полученные суспензии клеток высеивают на чашки Петри в различных разведениях и после ночного роста при 37°C подсчитывают число выросших колоний. Чем сильнее фототоксические свойства белка, тем меньше колоний вырастает после облучения.

Ссылка на нуклеотидную последовательность "кодирующую" полипептид означает, что с нуклеотидной последовательности в ходе трансляции и транскрипции мРНК продуцируется этот полипептид. При этом может быть указана как кодирующая цепь, идентичная мРНК и обычно используемая в списке последовательностей, так и комплементарная цепь, которая используется как матрица при транскрипции. Как очевидно для любого специалиста в данной области техники, термин так же включает любые вырожденные нуклеотидные последовательности кодирующие одинаковую аминокислотную последовательность. Нуклеотидные последовательности кодирующие полипептид включают последовательности, содержащие интроны.

Термин "оперативно связанный" или ему подобный при описании химерных белков относится к полипептидным последовательностям, которые находятся в физической и функциональной связи одна с другой. В наиболее предпочтительных воплощениях, функции полипептидных компонентов химерной молекулы не изменены по сравнению с функциональными свойствами выделенных полипептидных компонентов. Например, белок настоящего изобретения может быть сшит с представляющим интерес партнером слияния. В этом случае химерный белок сохраняет фототоксические свойства белка предлагаемого изобретения, а представляющий интерес полипептид (например, сигнал определенной внутриклеточной локализации) сохраняет его оригинальную биологическую активность. Например, когда белок предлагаемое изобретения сшит с представляющим интерес сигналом внутриклеточной локализации, химерный белок сохраняет флуоресценцию и фототоксичность, но локализуется в определенном клеточном компартменте. Как очевидно для любого специалиста в данной области техники, нуклеотидные последовательности, кодирующие химерный белок, включающий "оперативно связанные" компоненты (белки, полипептиды, линкерные последовательности, белковые домены и т.д.), состоят из фрагментов, кодирующих указанные компоненты, где эти фрагменты ковалентно связаны таким образом, что в ходе трансляции и транскрипции нуклеотидной последовательности продуцируется полноразмерный химерный белок. Иными словами, фрагменты соединены таким образом, что в местах их соединения отсутствуют 'сбойки' рамки считывания и стоп-кодоны.

Молекулы нуклеиновых кислот

Предлагаемое изобретение обеспечивает выделенные молекулы нуклеиновых кислот, кодирующие мутант белка KillerRed, имеющий измененные спектральные характеристики. В частности, предлагаемое изобретение обеспечивает выделенные молекулы нуклеиновых кислот, кодирующие белок, имеющий аминокислотную последовательность, выбранную из SEQ ID NO: 02, 04 и подобную ей. Примеры нуклеотидных последовательностей, обеспечиваемых предлагаемым изобретением, показаны в SEQ ID NO: 01 и SEQ ID NO: 03.

Как здесь используется, молекула нуклеиновой кислоты это молекула ДНК, такая как геномная ДНК или кДНК молекула, или молекула РНК, такая как молекула мРНК. Как здесь используется, термин "кДНК" относится к нуклеиновым кислотам, которые обладают размещением элементов последовательности найденным в нативных зрелых видах мРНК, где элементы последовательности - это экзоны и 5′ и 3′ некодирующие области.

[002] Молекула нуклеиновой кислоты, кодирующая белок согласно данному изобретению может быть синтезирована из подходящих нуклеозидтрифосфатов. Метод хорошо описан в известных в данной области протоколах. Например, доступность информации о последовательности аминокислот (например, SEQ ID NO: 02 или SEQ ID NO: 04) или информации о нуклеотидной последовательности (например, SEQ ID NO: 01 или SEQ ID NO: 03) дает возможность изготовить выделенные молекулы нуклеиновых кислот настоящего изобретении с помощью олигонуклеотидного синтеза. В случае информации о последовательности аминокислот, несколько нуклеиновых кислот отличающихся друг от друга вследствие вырожденности генетического кода может быть синтезировано. Методы выбора вариантов кодонов для требуемого хозяина хорошо известны в данной области.

Синтетические олигонуклеотиды могут быть приготовлены с помощью фосфорамидитного метода, и полученные конструкты могут быть очищены с помощью методов хорошо известных в данной области, таких как высокоэффективная жидкостная хроматография (ВЭЖХ) или других методов как описано, например, в Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., (1989) Cold Spring Harbor Press, Cold Spring Harbor, NY, и по инструкции, описанной в, например, United States Dept. of HHS, National Institute of Health (NIH) Guidelines for Recombinant DNA Research. Длинные двухцепочечные молекулы ДНК настоящего изобретения могут быть синтезированы за следующие стадии: несколько меньших фрагментов с необходимой комплементарностью, которые содержат подходящие концы способные к когезии с соседним фрагментом, могут быть. Соседние фргменты могут быть сшиты с помощью ДНК-лигазы или метода, основанного на ПЦР.

[003] В некоторых воплощениях, молекула нуклеиновой кислоты настоящего изобретения - это ДНК (или кДНК) молекула, содержащая открытую рамку считывания, которая кодирует химерный белок настоящего изобретения и способна в подходящих условиях (например, экспрессии белка в клетке-хозяине. Настоящее изобретение так же охватывает нуклеиновые кислоты, которые гомологичны, по существу сходны, идентичны, или получены из нуклеиновых кислот, кодирующих белки настоящего изобретения. Указанные нуклеиновые кислоты находятся в среде, отличной от среды, в которой они находятся в естественных условиях, например, они выделены, представлены в увеличенном количестве, находятся или экспрессированы в системах in vitro или в клетках или организмах, отличных от тех, в которых они находятся в естественных условиях.

Изменения или различия в нуклеотидной последовательности между высоко сходными нуклеотидными последовательностями могут представлять нуклеотидные замены в последовательности, которые возникают в процессе нормальной репликации или дупликации. Другие замены могут быть специально рассчитаны и вставлены в последовательность для определенных целей таких, как изменение кодонов определенных аминокислот или нуклеотидной последовательности регуляторного региона. Такие специальные замены могут быть произведены in vitro с помощью различных технологий мутагенеза или получены в организмах-хозяевах, находящихся в специфических селекционных условиях, которые индуцируют или отбирают эти изменения. Такие специально полученные варианты последовательности могут быть названы "мутантами" или "производными" исходной последовательности.

Нуклеотидные последовательности предлагаемого изобретения кодируют мутанты белка KillerRed, имеющие GFP-домен, который по крайней мере на 85% идентичен (чаще по крайней мере на 90% идентичен, как правило по крайней мере на 95% идентичен) GFP-домену белка KillerRed.

Например, указанный GFP-домен может быть по крайней мере на 96%, 97%, 98%, 99%, или 100% идентичен GFP-домену белка KillerRed. Мутантные или производные нуклеиновые кислоты могут быть получены на матричной нуклеиновой кислоте, выбранной из вышеописанных нуклеиновых кислот, путем модификации, делеции или добавления одного или более нуклеотидов в матричной последовательности или их комбинации, для получения варианта матричной нуклеиновой кислоты. Модификации, добавления или делеции могут быть выполнены любым способом, известным в данной области (см. например Gustin et al., Biotechniques (1993) 14: 22; Barany, Gene (1985) 37: 111-123; и Colicelli et al., Mol. Gen. Genet. (1985) 199:537-539, Sambrook et al., Molecular Cloning: A Laboratory Manual, (1989), CSH Press, pp.15.3-15.108), включая подверженный ошибкам ГЩР (error-prone PCR), shuffling, олигонуклеотид-направленный мутагенез, ПЦР со сборкой, парный ГШР мутагенез, мутагенез in vivo, кассетный мутагенез, рекурсивный множественный мутагенез, экспоненциальный множественный мутагенез, сайт-специфический мутагенез, случайный мутагенез, генная реассемблирование (gene reassembly), генный сайт-насыщающий мутагенез (GSSM), искусственное перестройку с лигированием (SLR) или их комбинации. Модификации, добавления или делеции могут быть также выполнены методом, включающим рекомбинацию, рекурсивную рекомбинацию последовательностей, фосфотиоат-модифицированный мутагенез ДНК, мутагенез на урацил-содержащей матрице, мутагенез с двойным пропуском, точечный восстановительный по рассогласованию мутагенез, мутагенез штамма, дефицитного по восстановлениям, химический мутагенез, радоактивный мутагенез, делетационный мутагенез, рестрикционно-избирательный мутагенез, рестрикционный мутагенез с очисткой, синтез искусственных генов, множественный мутагенез, создание химерных множественных нуклеиновых кислот и их комбинации. В некоторых воплощениях флуоресцентные белки, кодируемые мутантными или производными нуклеиновыми кислотами, имеют те же самые флуоресцентные или биохимические свойства как флуоресцентный белок дикого типа. В других воплощениях, мутантные или производные нуклеиновые кислоты кодируют флуоресцентные белки с измененными свойствами.

Кроме того, также обеспечиваются вырожденные варианты нуклеиновых кислот, которые кодируют белки настоящего изобретения. Вырожденные варианты нуклеиновых кислот включают замены кодонов нуклеиновой кислоты на другие кодоны, кодирующие те же самые аминокислоты. В частности вырожденные варианты нуклеиновых кислот создаются, чтобы увеличить экспрессию в клетке-хозяине. В этом воплощении, кодоны нуклеиновой кислоты, которые не являются предпочтительными или являются менее предпочтительными в генах клетки-хозяина, заменены кодонами, которые обильно представлены в кодирующих последовательностях генов в клетке-хозяине, где указанные замененные кодоны кодируют ту же самую аминокислоту. Особенный интерес представляют гуманизированные версии нуклеиновых кислот настоящего изобретения. Как здесь используется, термин "гуманизированный" относится к заменам, сделанным в последовательности нуклеиновой кислоты для оптимизации кодонов для экспрессии белка в клетках млекопитающих (человека) (Yang et al., Nucleic Acids Research (1996) 24: 4592-4593). См. также патент США №5795737, который описывает гуманизацию белков, и раскрытие которого здесь включено ссылкой. Примеры вырожденных вариантов, представляющих интерес, описаны более подробно в экспериментальной части, ниже.

Нуклеиновые кислоты, кодирующие укороченные и удлиненные варианты белков предлагаемого изобретения так же входят в рамки предлагаемого изобретения. Как здесь используется, эти варианты белков содержат аминокислотные последовательности с измененными С-, N-, или обоими концами. В удлиненных вариантах, С- или N-конец белка может содержать дополнительные аминокислотные остатки. В укороченных вариантах одна или более (обычно до 11, чаще до 7 и преимущественно до 5) аминокислотных остатков могут быть удалены из последовательности или заменены на любые другие аминокислотные остатки. Такие модификации не изменяют по существу свойства белков, но могут облегчать белковый фолдинг в клетке-хозяине, снижать способность к агрегации или модулировать другие биохимические свойства белков, например, полупериод распада. В некоторых воплощениях, эти модификации не изменяют биохимические свойства белка. Все виды модификаций и мутаций, указанные выше, осуществляются на уровне нуклеиновой кислоты.

Также обеспечиваются нуклеиновые кислоты, кодирующие химерные белки, состоящие из белка настоящего изобретения и сигнала определенной внутриклеточной локализации. Такие химерные белки могут быть получены путем оперативного соединения нуклеиновой кислоты настоящего изобретения, кодирующей мутант KillerRed, и нуклеиновой кислоты, кодирующей сигнал внутриклеточной локализации. Методы получения таких нуклеиновых кислот хорошо известны специалистам в данной области.

Заявленные нуклеиновые кислоты могут быть выделены и получены по существу в очищенной форме. По существу очищенная форма означает, что нуклеиновые кислоты являются, по меньшей мере, на 50% чистыми, обычно, по меньшей мере, на 90% чистыми и обычно являются "рекомбинантными", то есть, фланкированы одним или более нуклеотидов, - с которыми она обычно не связана в хромосоме, встречающейся в природе в ее естественном организме-хозяине.

Также обеспечиваются вектор и другие конструкции нуклеиновой кислоты, содержащие заявленные нуклеиновые кислоты. Подходящие векторы включают вирусные и невирусные векторы, плазмиды, космиды, фаги и т.д., предпочтительно плазмиды, и используются для клонирования, амплификации, экспрессии, переноса и т.д., последовательности нуклеиновой кислоты предлагаемого изобретения в подходящего хозяина. Выбор подходящего вектора является понятным для квалифицированного специалиста в данной области, и много таких векторов доступны коммерчески. Для приготовления конструкции, полноразмерная нуклеиновая кислота или ее часть обычно вставляются в вектор посредством прикрепления ДНК-лигазой к расщепленному ферментами рестрикции сайту в векторе. Альтернативно, желательная нуклеотидная последовательность может быть вставлена гомологичной рекомбинацией in vivo, обычно, присоединением гомологичных участков к вектору на флангах желательной нуклеотидной последовательности. Гомологичные участки добавляются лигированием олигонуклеотидов или полимеразной цепной реакцией, с использованием праймеров, включающих, например, как гомологичные участки, так и часть желательной нуклеотидной последовательности.

Также обеспечиваются кассеты экспрессии или системы, использованные inter alia для получения заявленных флуоресцентных белков или химерных белков на их основе или для репликации заявленных молекул нуклеиновой кислоты. Кассета экспрессии может существовать как внехромосомный элемент или может быть включена в геном клетки в результате введения указанной кассеты экспрессии в клетку. Для экспрессии генный продукт, кодируемый нуклеиновой кислотой изобретения, экспрессируется в любой удобной системе экспрессии, включая, например, бактериальные системы, дрожжевые, насекомых, земноводных или клетки млекопитающих. В экспрессионном векторе, указанная нуклеиновая кислота является функционально связанной с регуляторной последовательностью, которая может включить промоторы, энхансеры, терминаторы, операторы, репрессоры и индукторы. Методы изготовления кассет экспрессии или систем для экспрессии желаемого продукта известны специалистом, квалифицированным в данной области.

Клеточные линии, которые устойчиво экспрессируют белки настоящего изобретения, могут быть выбраны способами, известными в данной области (например ко-трансфекция с селектируемым маркером, таким как dhfr, gpt, неомицин, гигромицин, что делает возможным выявление и выделение транфецированных клеток, которые содержат ген, включенный в геном).

Вышеописанные системы экспрессии могут использоваться в прокариотических или эукариотических хозяевах. Для получения белка могут использоваться клетки-хозяева, такие как Е. coli, В. subtilis, S. cerevisiae, клетки насекомого в комбинации с бакуловирусными векторами, или клетки высшего организма, такого как позвоночные, например, COS 7 клетки, НЕК 293, СНО, ооциты Xenopus и т.д.

Если используется любая вышеупомянутая клетка-хозяин или другие подходящие клетки-хозяева или организмы для репликации и/или экспрессии нуклеиновых кислот изобретения, то полученная реплицированная нуклеиновая кислота, экспрессированный белок или полипептид находятся в рамках притязания изобретения как продукт клетки-хозяина или организма. Продукт может быть выделен подходящим способом, известным в данной области.

Молекулы нуклеиновых кислот предлагаемого изобретения могут применяться для продукции белка (экспрессии гена) в клетке-хозяине. Способ, в котором исследуются клетки на наличие специфических нуклеотидных последовательностей, таких как геномная ДНК или РНК, хорошо отработан в данной области. Кратко, выделяют ДНК или мРНК из образца клетки. мРНК может быть амплифицирована ОТ-ГЩР, с использованием обратной транскриптазы для формирования комплементарной цепочки ДНК, с последующей амплификацией с помощью полимеразной цепной реакцией с использованием праймеров, специфических для заявленных последовательностей ДНК. Альтернативно, образец мРНК отделяют с помощью гель-электрофореза, переносят на подходящий носитель, например, нитроцеллюлозу, нейлон и т.д., и затем тестируют фрагментом заявленной ДНК в качестве пробы. Могут также использоваться другие способы, такие как анализы сшивания олигонуклеотидов, гибридизация in situ и гибридизация ДНК-пробами, иммобилизованными на твердый чип. Обнаружение мРНК, гибридизующейся с заявленной последовательностью, указывает на экспрессию гена в образце.

Белки

Нуклеиновые кислоты по предлагаемому изобретению кодируют мутанты белка KillerRed. В преимущественных воплощениях указанные белки содержат замену Y68W. Указанная аминокислота находится в позиции, которая соответствует Y66 у avGFP и входит в состав хромофора. В преимущественных воплощениях указанные белки содержат также несколько дополнительных замен, выбранных из группы V46A, А74Т, D115G, N147S, F179L, Y223H, E238Q. Например, в некоторых воплощениях указанные белки содержат указанные комбинации аминокислотных замен V46A+Y68W+А74Т+D115G+N147S+Y223H+E238Q и Y68W+D115G+N147S+F179L+Y223H+E238Q. Примеры аминокислотных последовательностей функциональных белков предлагаемого изобретения приведены в SEQ ID NO: 02 и SEQ ID NO:04. Белки предлагаемого изобретения являются GFP-подобными белками по существу сходными с белком KillerRed и имеющими GFP-домен, аминокислотная последовательность которого имеет по крайней мере 85% идентичности (например, по крайней мере 90% идентичности, по крайней мере 95% идентичности или более, например 96%, 97%, 98% или 100%) с GFP-доменом белка KillerRed.

До перехода в активированное состояние, белки по данному изобретению обладают низкой токсичностью в клетках-хозяевах.

До перехода в активированное состояние, белки по данному изобретению обладают способностью к детектируемой флуоресценции. В некоторых воплощениях, неактивированный (до активации фототоксических свойств) белок имеет максимум возбуждения флуоресценции в диапазоне от приблизительно 400 нм до 550 нм, обычно от приблизительно 420 нм до 500 нм. В некоторых воплощениях белок по данному изобретению имеет максимум эмиссии в диапазоне от приблизительно 450 до 600 нм, обычно от приблизительно 460 нм до 590 нм и чаще всего от приблизительно 470 до 560 нм.

Заявленный белок обычно имеет максимальный коэффициент экстинкции в диапазоне от приблизительно 30,000 до 150,000 и обычно от приблизительно 60,000 до 120,000.

Флуоресценция белка по данному изобретению может быть обнаружена обычными способами (например, визуальный скрининг, спектрофотометрия, спектрофлуориметрия, флуоресцентная микроскопия, FACS приборами, и т.д.)

Белок по данному изобретению переходит в активированное состояние под действием света определенной длины волны (активирующего света). В некоторых воплощениях, длина волны активирующего света находится в диапазоне приблизительно от 350 до 550 нм, обычно приблизительно от 400 до 500 нм, и чаще всего приблизительно от 430 до 480 нм, например, при 440-470 нм.

В активированном состоянии белок по данному изобретению обладает выраженной токсичностью по отношению к клеткам. В некоторых воплощениях, в активированном состоянии белок по данному изобретению способен к продукции активных форм кислорода. В некоторых воплощениях, в активированном состоянии белок по данному изобретению меняет спектральные характеристики, например, теряет способность к флуоресценции или меняет спектр возбуждения и/или эмиссии флуоресценции.

В некоторых воплощениях, белок по данному изобретению быстро созревает после экспрессии в клетке-хозяине. Под быстрым созреванием понимается то, что белок достигает своей третичной структуры, которая обеспечивает его спектральные и фототоксические свойства, за короткий период времени. В этих воплощениях, белок укладывается в течение периода времени, который в общем случае не превышает приблизительно 60 ч, обычно не превышает приблизительно 48 ч и чаще не превышает 24 ч (например, полупериод укладки может быть 4-6 часов). Специфические белки, представляющие интерес, включают белки KillerOrange (Seq ID NO: 1, 2) и KillerGreen (SEQ ID No: 03 и 04), описанные подробно в разделе «Примеры» ниже, и их функциональные мутанты.

Мутанты могут сохранять свойства исходного белка или могут иметь биологические свойства, отличные от форм исходного белков. Термин "биологические свойства" белков предлагаемого изобретения относится, но не лимитирован, спектральными свойствами, такими как максимум возбуждения флуоресценции, максимум испускания, максимальный коэффициент экстинкции, яркость (например, по сравнению с референсным белков), фотостабильность и подобные; биохимические свойства, такие как in vivo и/или in vitro стабильность (например, полу период распада); скорость созревания, склонность к агрегации и склонность к олигомеризации и другие подобные свойства (по сравнению с референсным белком). Мутации включают единичные аминокислотные замены, делеции и инсерции одной или более аминокислот, укорочение или удлинение N-конца, укорочение или удлинение С-конца и тому подобное.

Мутанты могут быть получены с использованием стандартных методов молекулярной биологии, как подробно описано в разделе "молекулы нуклеиновых кислот" выше. Примеры обеспечивают общие приемы, и использование стандартных способов, так что специалисты, квалифицированные в данной области, могут легко получить большой ряд дополнительных мутантов и проверить, было ли изменено биологическое (например биохимическое, спектральное, и т.д.) свойство. Например, интенсивность флуоресценции может быть измерена с использованием спектрофлуориметра при различных длинах волн возбуждения. Также обеспечиваются белки, которые по существу сходны с указанными выше специфическими белками, где по существу сходны означает, что эти белки имеют аминокислотную последовательность, идентичную последовательности исходного белка, по крайней мере, на 85% идентичности, обычно, по крайней мере, 90% и чаще, по крайней мере, 95%, (например 95% и выше; 96% и выше, 97% и выше; 98% и выше: 99% и выше или 100% идентичности последовательности).

Белки предлагаемого изобретения присутствуют в среде, отличной от их естественной среды; например, они рекомбинантны. Белки предлагаемого изобретения могут находиться в выделенном состоянии, что означает, что белки по существу свободны от других белков и других биологических молекул, присутствующих в естественной среде, таких как олигосахариды, нуклеиновые кислоты и их фрагменты и т.п., где термин "по существу свободны" в этом случае означает, что меньше чем 70%, обычно меньше чем 60% и чаще меньше чем 50% композиции, содержащей выделенный белок, представляет собой некоторые другие биологические молекулы, чем встречающиеся в природе. В некоторых воплощениях, белки присутствуют в по существу очищенной форме, где "по существу очищенная форма" означает очищенная по меньшей мере на 95%, обычно по меньшей мере на 97% и чаще по меньшей мере на 99%.

Заявленные белки могут быть получены искусственным путем, например, экспрессией рекомбинантной нуклеиновой кислоты, кодирующей последовательность, белка, представляющего интерес, в соответствующем хозяине, как описано выше. Для очистки белка могут применяться любые обычные методики, где подходящие методы очистки белка описаны в Guide to Protein Purification, (Deuthser ed., Academic Press, 1990). Например, лизат может быть приготовлен из исходного источника и очищен с использованием ВЭЖХ, вытеснительной хроматографии, гель-электрофореза, афинной хроматографии и т.п.

Также обеспечиваются белки слияния, включающие белки предлагаемого изобретения, слитые с последовательностью внутриклеточной локализации (например, с сигналом локализации в ядре, в пероксисомах, аппарате Гольджи, митохондрии и т.д.). Полипептид, обеспечивающий определенную внутриклеточную локализацию, может быть оперативно присоединен к N-концу и/или С-концу биосенсора. Сигналы внутриклеточной локализации хорошо известны специалистам в данной области и описаны, например, Nakai K. (Advances in Protein Chemistry, Vol.54, 2000, p.277-344).

Трансформанты

Нуклеиновые кислоты предлагаемого изобретения могут использованы для получения трансформантов, включая трансгенных организмов или сайт-специфичных генных изменений в клеточных линиях. Трансгенные клетки заявленные в изобретении, содержат одну или более нуклеиновых кислот, заявленных по предлагаемому изобретению, в качестве трансгена. Для целей изобретения любая приемлемая клетка-хозяин может быть использована, включая прокариотические (например, Escherichia coli, Streptomyces sp., Bacillus subtilis, Lactobacillus acidophilus, и т.д.) или эукариотические клетки-хозяева. Трансгенный организм, заявленный по изобретению, может быть прокариотическим или эукариотическим организмом, включая бактерии, цианобактирии, грибы, растения и животные, в которых одна или больше клеток организма содержат гетерогенную нуклеиновую кислоту, заявленную по изобретению, введенную посредством вмешательства человека, такими способами как технологии трансгеноза, которые известны в данной области. Выделенная нуклеиновая кислота предлагаемого изобретения может быть введена в хозяина способами, известными в данной области, например инфицированием, трансфекцией, трансформацией или трансконъюгацией. Способы переноса молекулы нуклеиновой кислоты (то есть. ДНК) в такие организмы широко известны и обеспечивается в ссылках, таких как Sambrook et al. (Molecular Cloning: A Laboratory Manual, 3nd Ed., (2001) Cold Spring Harbor Press, Cold Spring Harbor, NY).

В одном воплощении, трансгенный организм может быть прокариотическим организмом. Способы трансформации прокариотических хозяев хорошо описаны в данной области (например, см. Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd edition (1989) Cold Spring Harbor Laboratory Press и Ausubel et al., Current Protocols in Molecular Biology (1995) John Wiley & Sons, Inc).

В другом воплощении, трансгенными организмами могут быть грибы, например дрожжами. Дрожжи широко используются как носители для экспрессии гетерогенного гена (например см. Goodey et al Yeast biotechnology, D R Berry et al, eds, (1987) Allen and Unwin, London, pp 401-429) и King et al Molecular and Cell Biology of Yeasts, E F Walton and G T Yarronton, eds, Blackie, Glasgow (1989) pp 107-133). Несколько типов дрожжевых векторов доступны, включая интегративные векторы, которые требуют рекомбинации с геномом хозяина для их поддержки, и автономно реплицирующиеся плазмидные векторых.

Другой организм хозяина является животным. Трансгенные животные могут быть получены способами трансгеноза, известными в данной области и обеспечиваются в ссылках, таких как Pinkert, Transgenic Animal Technology: a Laboratory Handbook, 2nd edition (2203) San Diego: Academic Press; Gersenstein and Vintersten, Manipulating the Mouse Embryo: A Laboratory Manual, 3rd ed, (2002) Nagy A. (Ed), Cold Spring Harbor Laboratory; Blau et al., Laboratory Animal Medicine, 2nd Ed., (2002) Fox J.G., Anderson L.C., Loew F.M., Quimby F.W. (Eds), American Medical Association, American Psychological Association; Gene Targeting: A Practical Approach by Alexandra L. Joyner (Ed.) Oxford University Press; 2nd edition (2000). Например, трансгенные животные могут быть получены гомологичной рекомбинацией, где изменяется эндогенный локус. Альтернативно, конструкция нуклеиновой кислоты включается случайным образом в геном. Векторы для устойчивого включения включают плазмиды, ретровирусы и другие животные вирусы, YAC, и т.п.

Нуклеиновые кислоты могут быть введены в клетку непосредственно или опосредованно, введением в прекурсор клетки, путем намеренной генетической манипуляции, такой как микроинъекция или инфицирование рекомбинантным вирусом или рекомбинантным вирусным вектором и т.п.

Термин «генетическая манипуляция» не включает классическое скрещивание или оплодотворение in vitro, а предпочтительно является направленным на введение рекомбинантных молекул нуклеиновых кислот. Эти молекулы нуклеиновой кислоты могут быть включены в хромосому или они являться внехромосомными реплицирующими ДНК.

Конструкции ДНК для гомологичной рекомбинации будут содержать по меньшей мере часть нуклеиновой кислоты настоящего изобретения, где ген имеет желательную генетическую модификацую(ции) и включает области гомологии с целевым локусом. Конструкциям ДНК для произвольного включения не обязательно содержать область гомологии с медиатором рекомбинации. Легко могут быть включены маркеры для положительной и отрицательной селекции. Способы получения клеток, имеющих целевые генные модификации, через гомологическую комбинацию известны в данной области. Для различных способов трансфекции клеток млекопитающих, см. Keown et al., Meth. Enzymol. (1990) 185:527-537.

Для эмбриональных стволовых (ЭС) клеток могут быть использованы ЭС клеточные линии или эмбриональные клетки могут быть получены непосредственно от хозяина, такого как мышь, крыса, морская свинка и т.д. Такие клетки выращиваются на подходящем фибропласт-питающем слое или в присутствии фактора ингибирования лейкемии (LIF). Трансформированные ЭС или эмбриональные клетки могут быть использованы для получения трансгенных животных, с помощью подходящего способа, описанного в данной области.

Трансгенные животные могут быть любыми животными, не относящимися к человеку, включая млекопитающее, не относящееся к человеку, (например мышь, крыса), птица или амфибия и т.д., и использованы в функциональном исследовании, скрининге лекарственного средства и т.п.Характерные примеры использования трансгенных животных включают те, которые описанные ниже.

Также могут быть получены трансгенные растения. Способы получения трансгенных растительных клеток и растений описаны в патентах США №№5767367; 5750870; 5739409; 5689049; 5689045; 5674731; 5656466; 5633155; 5629470; 5595896; 5576198; 5538879; 5484956; раскрытия которых включены сюда ссылкой. Способы получения трансгенных растений также рассмотрены в Plant Biochemistry and Molecular Biology (eds. Lea and Leegood, John Wiley & Sons) (1993) pp.275-295 и в Plant Biotechnology and Transgenic Plants (eds. Oksman-Caldentey and Barz), (2002) 719 p.

Например, эмбриогенные эксплантаты, содержащие соматические клетки, могут использоваться для получения трансгенного хозяина. После сбора клеток или тканей, экзогенная ДНК, представляющая интерес, вводится в растительные клетки, при этом известен для такого введения ряд различных способов. При наличии выделенных протопластов, возникает возможность для введения через ДНК-опосредованные протоколы передачи гена, включая инкубацию протопластов с очищенной ДНК, такой как плазмида, содержащая целевую экзогенную последовательность, представляющую интерес, в присутствии поливалентных катионов (например, PEG или PLO); или электропорацию протопластов в присутствии выделенной ДНК, включающей целевую экзогенную последовательность. Протопласты, которые успешно включили экзогенную ДНК, затем отбираются, выращиваются в каллус, и в конечном счете в трансгенное растение при контакте с подходящими количествами и отношениями стимулирующих факторов, таких как ауксины и цитокины. Другие подходящие способы получения растения могут использоваться, такие, как применение "генной пушки", или Agrobacterium-опосредованная трансформация, которые доступны для квалифицированных специалистов в данной области.

Способы применения

Белки предлагаемого изобретения являются генетически кодируемыми флуоресцентными белками - фотосенсибилизаторами, проявляющими фототоксические свойства при облучении светом, более чем в 1000 раз превышающую токсичность других известных зеленых и красных флуоресцентных белков, включая avGFP. Они могут быть использованы для селективной инактивации интересующих белков и селективного подавления клеточных делений или убийства клеток с адресной доставкой с помощью вирусных векторов и других методов.

Для осуществления селективной инактивации интересующих белков, должна быть получена нуклеиновая кислота, кодирующая белок по данному изобретению, оперативно связанный с интересующим белком (партнером слияния). Получение таких конструкций очевидно для любого специалиста в данной области. Например, части нуклеиновой кислоты, кодирующие различные элементы, могут быть встроены в полилинкер вектора, таким образом, что между различными частями не будет стоп-кодонов в рамке считывания и не будет сбоек рамки считывания. Альтернативно, желательная нуклеотидная последовательность может быть собрана из фрагментов с помощью ДНК-лигазы или ГЩР с праймерами, содержащими части, комплементарные концевым последовательностям соединяемых фрагментов.

Полученная конструкция должна быть встроена в вектор, обеспечивающий временную или постоянную экспрессию этой нуклеиновой кислоты в клетках-хозяевах. Вектор может содержать элементы, обеспечивающие адресную доставку конструкции в интересующие клетки, или находится в составе частиц, обеспечивающих адресную доставку. После трансфекции клеток вектором и по истечении времени, необходимого для наработки в клетках продукта экспрессии (химерного белка), может быть осуществлена инактивация интересующего белка путем облучения клеток или клеточных компартментов активирующим светом.

Для осуществления селективного убийства клеток, должна быть получена нуклеиновая кислота, кодирующая белок предлагаемого изобретения, или нуклеиновая кислота, кодирующая белок предлагаемого изобретения, оперативно связанный с полипептидом, обеспечивающим доставку химерного белка в определенные клеточные компартменты (ядра клеток, лизосомы, митохондрии, плазматическую мембрану). Полученная конструкция должна быть введена в клетку (например, в составе экспрессионного вектора). По истечении времени, необходимого для наработки в клетках продукта экспрессии, клетки облучают активирующим светом достаточной интенсивности, чтобы вызвать гибель клеток путем апоптоза или некроза. Примеры подобного использования описаны в экспериментальной части ниже.

Наборы

Также обеспечиваются в соответствии с предлагаемым изобретением наборы для использования при осуществлении одного или более вышеописанных применений. В предпочтительных воплощениях наборы обычно включают нуклеиновую кислоту, кодирующую белок по данному изобретению, предпочтительно с элементами для экспрессии этого белка в клетке-хозяине. Например, наборы могут включать вектор, включающий нуклеиновую кислоту, кодирующую заявленный белок. Компоненты наборов обычно присутствуют в соответствующей среде для хранения, такой как водный или буферный раствор, обычно в соответствующей емкости. В отдельных воплощениях набор включает множество различных векторов, каждый их которых кодирует заявленный белок, где векторы предназначены для экспрессии в различных средах и/или при различных условиях. Например, для конститутивной экспрессии, набор включает вектор, имеющий сильный промотор для экспрессии в клетках млекопитающих, и вектор с ослабленным промотором. Могут быть так же включены векторы с множественными клонированными сайтами для выборочной вставки промотора и/или векторы для экспрессии в различных организмах, и т.д.

В дополнение к описанным выше компонентам, заявленные наборы будут дополнительно включать инструкции для осуществления заявленных способов. Эти инструкции могут присутствовать в заявленных наборах в различных формах (например, в печатном варианте или на электронном носителе в виде текстового и\или графического файла) в количестве, одна или более.

Следующие примеры предлагается в качестве иллюстративных, но не ограничивающих.

ПРИМЕРЫ

Пример 1.

Мутагенез белка KillerRed.

Для направленного мутагенеза использовали нуклеиновую кислоту, кодирующую белок KillerRed, из коммерчески доступного вектора pKillerRed-C (Евроген, Россия). Для получения конструкций с содержанием нужных мутаций проводили сайт-направленный мутагенез с использованием "overlap extention" продуктов ПЦР как описано Wurch et al., Methods in Molecular Biology. 12 (9), 653-657 (2004). Для ПЦР использовали набор для ПЦР Tersus PCR kit (Евроген), согласно рекомендациям производителя.

После амплификации полученные фрагменты очищали при помощи электофореза в 1% агарозном геле и дальнейшей экстракцией. Выделенные из геля фрагменты ДНК, содержащие требуемую мутацию, объединяли в целую конструкцию, содержащую точечную замену методом «overlap extention» ПЦР (денатурация 95°С - 12 сек; отжиг 55°С - 2 мин; элонгация 72°С - 1 мин, 8 циклов ПЦР). Этот метод подразумевает, что в качестве матрицы и затравки применяют присутствующие в реакционной смеси фрагменты с комплементарными друг другу участками.

Далее амплификацию всей конструкции, полученной на предыдущем этапе, производили методом стандартной ПЦР с добавлением праймеров, комплементарным концам амплифицируемого фрагмента KillerRed.

Полученные нуклеиновые кислоты клонировали в вектор pQE30 по стандартному протоколу, соответствие структуры вставки проверяли секвенированием с использованием стандартных плазмидных праймеров.

В ходе направленного мутагенеза заменяли тирозин фромофора, в 68 положении аминокислотной последовательности KillerRed, на триптофан (Y68W), фенилаланин (Y68F), гистидин (Y68H). Из полученных мутантов только мутант, содержащий замену Y68W, сохранял способность к флуоресценции. Мутанты с заменами Y68F и Y68H не обладали видимой флуоресценцией даже после нескольких раундов случайного мутагенеза.

Мутант KilerRed, содержащий замену Y68W и обладающий слабой оранжевой флуоресценцией, был подвергнут случайному мутагенезу с помощью набора для случайного мутагенеза (Клонтех, США) с использованием методики, прилагаемой фирмой-производителем. После раунда случайного мутагенеза отбирали клоны, обладающие наиболее яркой флуоресценцией и наиболее скорым ее появлением. В результате было отобрано два клона, один из которых содержал замены А33Т, Y68W, F88L и E238Q, а второй - Y68W, D115G, Y223H и E238Q.

Смесь нуклеиновых кислот, кодирующих отобранные клоны, использовали для второго раунда случайного мутагенеза, который осуществляли, как описано выше. Отбирали клоны, обладающие наибольшим сдвигом флуоресценции в зеленую область спектра и/или повышенной яркостью флуоресценции.

Были отобраны шесть мутантных клона, которые были протестированы на фототоксичность в бактериальной системе при облучении активирующим светом.

Для сравнения фототоксичности мутантов KillerRed нуклеиновые кислоты, кодирующие мутантные варианты были клонированы в вектор рОЕЗО (Qiagen) и трансформированы в компетентные клетки Е. coli. Колонии выращивали в течение ночи при 37°С и далее чашки инкубировали 3 дня при 4°С для полного созревания белков. По одной колонии каждого мутанта разбалтывали в 0.1 мл буфера PBS, после чего половину объема 30 мин облучали белым светом интенсивностью 1 Вт/см2, а половину оставляли в темноте в качестве контроля. Полученные суспензии клеток высевали на чашки Петри в различных разведениях и после ночного роста при 37°С подсчитывали число выросших колоний. Сравнение количества колоний в облученном и необлученном образцах позволяло оценить количество клеток, погибших от облучения светом и отобрать два мутанта KillerRed, проявляющих высокую токсичность для бактериальных клеток. С помощью секвенирования по методу Сэнгера были определены нуклеотидные последовательности этих мутантов, названных KillerOrange (SEQ ID NO: 01) и KillerGreen (SEQ ID NO: 03).

Аминокислотные последовательности этих мутантов показаны, соответственно, в SEQ ID NO: 02 и SEQ ID NO: 04. Белок KillerOrange содержит замены Y68W, D115G, N147S, F179L, Y223H и E238Q, а белок KillerGreen - V46A, Y68W, А74Т, D115G, N147S, Y223H и E238Q. Белки KillerOrange и KillerGreen были выделены с использованием металл-афинной хроматографии. Клетки E. coli, экспрессирующие указанные белки осаждали 20 минут при скорости 4000 об/мин на холоду (4 С0) и суспендировали в буфере I (125 мМ NaCl, 40 мМ Tris-HCl, 5 мМ 2-меркаптоэтанола, pH 7,5) из расчета 1,5 мл буфера I на осадок, полученный из 50 мл клеток в жидкой LB. Затем клетки разрушали ультразвуком с помощью прибора Sonic Dismembrator (Fisher Scientific), мощность 10 Вт, центрифугировали 10 мин при скорости 12000 об/мин и температуре 4 С0. Супернатант переносили в пробирки с предварительно уравновешенной буфером I металл-афинной смолой TALON (Clontech) из расчета 500 мкл смолы на 1000-1200 мкл супернатанта. Пробирки помещали в шейкер (скорость 40 об/мин) и инкубировали 20-25 мин. После этого смолу промывали 3-4 раза 1000 мкл буфера I. Для элюции использовали буфер II (125 мМ NaCl, 40 мМ Tris-HCl, 5 мМ 2-меркаптоэтанола, 200 мМ имидазола, pH 7,5). Элюцию проводили 20-25 мин в шейкере, белок с 500 мкл смолы элюировали 300-350 мкл буфера II. Все манипуляции осуществляли на холоду, все буферы и смолу предварительно охлаждали. Спектры флуоресценции выделенных белков KillerOrange и KillerGreen были получены с использованием спектрофлуориметра Varian Сагу Eclipse Fluorescence Spectrophotometer. Активацию белков производили с помощью синего света длиной волны 440-470 нм и интенсивностью 1 Вт/см2 с использованием флуоресцентного бинокуляра Olympus SZX12

Было показано, что белок KillerOrange до активации фототоксических свойств имеет максимумы возбуждения флуоресценции при 510 и 490 нм с плечом при 463 нм и максимум эмиссии при 551 нм со слабо выраженным плечом при 585 нм (рис.2), а белок KillerGreen - максимумы возбуждения флуоресценции при 452 и 508 нм и максимум эмиссии при 483-507 нм (фиг.3).

После активации белок KillerOrange имеет максимум возбуждения флуоресценции при 460 нм (плечи при 490 и 510 нм) и максимум эмиссии при 547 нм. При этом наблюдается общее падение уровня флуоресценции раствора, содержащего KillerOrange.

После активации белка KillerGreen так же наблюдали падение уровня флуоресценции раствора, однако изменения положения максимумов возбуждения и эмиссии флуоресценции не детектировалось.

Пример 2.

Сравнение фотоксических свойств KillerOrange, KillerGreen и KillerRed. Нуклеиновые кислоты, кодирующие белки KillerOrange, KillerGreen, KillerRed были получены, как описано выше в примере 1. Нуклеиновая кислота, кодирующая нефотоксический белок DsRed2 (SEQ ID NO: 10, 11) была получена из коммерчески доступного вектора (Clontech). Нуклеиновые кислоты были клонированы в вектор pQE30 (Qiagen) и трансформированы в компетентные клетки Е. coli. Колонии выращивали в течение ночи при 37°C и далее чашки инкубировали 3 дня при 4°C для полного созревания белков.

По одной колонии каждого мутанта разбалтывали в 0,15 мл буфера PBS, после чего одну треть объема суспензии облучали в течение 30 мин синим светом (длина волны 440-470 нм), одну треть - зеленым светом (длина волны 540-580 нм), а остаток оставляли в темноте в качестве контроля. После этого приготавливали несколько разведений суспензий клеток и высевали на чашки Петри. После ночного роста при 37°C подсчитывали число выросших колоний. Результаты измерений представлены в таблице.

Результаты измерения фототоксичности флуоресцентных белков при активации синим и зеленым светом.

Таблица

Полученные данные указывают на высокую фототоксичность белков KillerOrange и KillerGreen при активации синим светом и сравнимый с нефототоксическим белком DsRed2 уровень токсичности при активации зеленым светом. Общий уровень фототоксичности KillerOrange и KillerGreen при активации синим светом близок к уровню фототоксичности белка KillerRed при его активации зеленым светом.

Пример 3.

Экспрессия KillerOrange и KillerGreen в клетках млекопитающих.

Для экспрессии KillerOrange и KillerGreen в клетках млекопитающих нуклеиновые кислоты, кодирующие эти белки, были клонированы в коммерчески доступные векторы pKillerRed-C, pKillerRed-dMito и pKillerRed-mem (Евроген) вместо последовательности KillerRed. В векторе pKillerRed-dMito указанные белки оказывались оперативно слиты с сигналом локализации в митохондриях, а в векторе pKillerRed-mem - с сигналом локализации на плазматической мембране.

Полученные конструкции были использованы для временной трансфекции клеток млекопитающих (линии НЕК293, HeLa, HeLa Kyoto). Флуоресцентная микроскопия клеток млекопитающих через трое суток после трансфекции показала появление флуоресценции в ожидаемых клеточных компартментах: в цитоплазме в случае использования вектора pKillerRed-C, на мембране - в случае вектора pKillerRed-dMito и в митохондриях - в случае вектора pKillerRed-dMito. Подсчет количества митозов за определенный промежуток времени (с помощью флуоресцентной микроскопии) показал, что трансфицированные клетки делятся приблизительно с той же частотой, что и нетрансфицированные. Таким образом, тестируемые белки не проявляли существенной цитотоксичностью (в неактивированном состоянии).

Пример 4.

Приготовление стабильно трансфецированных линий клеток млекопитающих.

Линии клеток HeLa Kyoto, стабильно экспрессирующие белки KillerOrange и KillerGreen были получены с помощью лентивирусной трансдукции. Для этого открытые рамки считывания KillerOrange и KillerGreen были клонированы в лентивирусный вектор pRRLSIN.EFl.WPRE. Трансдукция была проведена согласно стандартным протоколам. Для каждого белка с помощью проточного флуоресцентного клеточного сортера MoFlo (Dako) была отобрана популяция клеток с наибольшей интенсивностью флуоресценции. Полученные линии стабильно экспрессировали KillerOrange и KillerGreen в цитоплазме. Анализ распределения клеток по стадиям клеточного цикла (G1, S и G2/M) с помощью окраски ДНК йодидом пропидия и проточной цитофлуориметрии показал нормальное количество делящихся клеток в полученных клеточных линиях, сходное с таковым в исходной линии HeLa Kyoto.

Пример 5.

Анализ фототоксичности KillerOrange и KillerGreen в клетках млекопитающих.

Фототоксический эффект KillerOrange и KillerGreen изучали при помощи флуоресцентной микроскопии. В первой серии экспериментов клетки линии HeLa Kyoto, временно экспрессирующие KillerOrange и KillerGreen в различной клеточной локализации и полученные как описано в примере 3, облучали зеленым или синим светом с помощью флуоресцентного микроскопа (540-580 нм, 0,5 Вт/см2, 2 мин и 450-490 нм, 0,5 Вт/см2, 2 мин, соответственно). Затем продолжали наблюдение за облученными клетками с помощью флуоресцентного микроскопа в течение 24 часов. В случае облучения синим светом клетки с локализацией тестируемых белков на плазматической мембране и в митохондриях проявляли признаки клеточной гибели (открепления от субстрата, сжатия цитоплазмы, блеббинга (пузырения) и разрушения мембраны). Фототоксический эффект на клетки с локализацией белков в цитоплазме был менее выраженным и проявлялся только у отдельных клеток. В случае облучения зеленым светом выраженного фототоксического эффекта не наблюдалось.

1. Нуклеиновая кислота, кодирующая функциональный фототоксический флуоресцентный белок, аминокислотная последовательность которого выбрана из группы SEQ ID NO: 02 и SEQ ID NO: 04.

2. Кассета экспрессии, которая будучи интегрирована в геном клетки или введена в клетку в виде внехромосомного элемента обеспечивает экспрессию фототоксического флуоресцентного белка и содержит (а) регион инициации транскрипции, функциональный в клетке-хозяине; (б) нуклеиновую кислоту по п. 1; и (в) регион терминации транскрипции, функциональный в клетке-хозяине.

3. Кассета экспрессии, которая будучи интегрирована в геном клетки или введена в клетку в виде внехромосомного элемента обеспечивает экспрессию фототоксического флуоресцентного белка в определенном клеточном компартменте и содержит нуклеиновую кислоту по п. 1, оперативно слитую с нуклеиновой кислотой, кодирующей сигнал внутриклеточной локализации, и регионами инициации и терминации транскрипции, функциональными в клетке-хозяине.

4. Клетка, не являющаяся эмбриональной клеткой человека и содержащая кассету экспрессии по п. 2 как часть экстрахромосомного элемента или интегрированную в геном клетки как результат внедрения указанной кассеты в указанную клетку, где указанная клетка экспрессирует фототоксический флуоресцентный белок.

5. Клетка, не являющаяся эмбриональной клеткой человека и содержащая кассету экспрессии по п. 3 как часть экстрахромосомного элемента или интегрированную в геном клетки как результат внедрения указанной кассеты в указанную клетку, где указанная клетка экспрессирует фототоксический флуоресцентный белок в определенном клеточном компартменте.

6. Выделенный функциональный фототоксический флуоресцентный белок, имеющий аминокислотную последовательность, выбранную из группы SEQ ID NO: 02 и SEQ ID NO: 04.



 

Похожие патенты:

Изобретение относится к области иммунологии. Предложен способ скрининга молекулы, способной связываться с Ig-подобным доменом С2-типа 1 CD4 человека, а именно с аминокислотными остатками в положениях 148-154, 164-168 и 185-192.

Изобретение относится к биохимии. Описан способ получения интересующего белка, включающий введение по меньшей мере одного экспрессионного вектора, который содержит генный фрагмент, содержащий ДНК, кодирующую интересующий белок, и также пару транспозонных последовательностей Tol1 или Tol2 на обоих концах генного фрагмента, в суспензионную клетку млекопитающего СНО и суспензионное культивирование клетки млекопитающего, где суспензионная клетка млекопитающего представляет собой суспензионную клетку СНО, которая способна выживать и пролиферировать в бессывороточной среде.

Изобретение относится к области биотехнологии, конкретно к иммунологии, и может быть использовано в медицине. Композицию, основанную на совместном применении ApoA, интерлейкина 15 и домена Sushi альфа цепи рецептора IL15, используют для стимулирования противоопухолевого иммунного ответа у субъекта.

Изобретение относится к области биотехнологии и иммунологии. Описаны новые антитела или антиген-связывающие фрагменты, которые специфично связываются с сиглеком-15.

Настоящее изобретение относится к области иммунологии. Предложено выделенное антитело и его антигенсвязывающий фрагмент, которые специфически связываются с индуцируемым глюкокортикоидами рецептором TNF (GITR) человека; а также композиции, в том числе фармацевтическая композиция, и способ усиления иммунного ответа у человека.

Изобретение относится к области биотехнологии и иммунологии Описаны выделенные антитела и их фрагменты, которые связываются с опухолевыми антигенами. Также описаны композиции и агенты для доставки, которые включают раскрываемые антитела; клетки, которые продуцируют эти антитела; способы продуцирования этих антител; способы применения этих антител, нацеливания на опухоли и/или метастатические клетки, образуемые ими, и/или опухолевые стволовые клетки, и лечение опухолей и/или метастатических клеток, образуемых ими, и/или опухолевых стволовых клеток; и способы прогнозирования рецидива рака у субъекта.

Изобретение относится к области биотехнологии и клеточной инженерии. Предложен способ получения выделенного терапевтического рекомбинантного биологического полипептида или белка для лечения заболевания.

Настоящие изобретения относятся к области ветеринарных вакцин, в частности к области векторных вакцин для домашних птиц, основанных на рекомбинантном непатогенном вирусе болезни Марека (npMDV).

Изобретение относится к области биотехнологии, конкретно к антагонистам Wnt, и может быть использовано в медицине. С использованием сигнальной последовательности получают Wnt-связывающие полипептиды на основе домена Fri из FZD8 человека и Fc-фрагмента.

Изобретение относится к области биохимии. Заявлено антитело, связывающееся с рецептором клеточной поверхности DR5.

Изобретение относится к области иммунологии. Предложен способ скрининга молекулы, способной связываться с Ig-подобным доменом С2-типа 1 CD4 человека, а именно с аминокислотными остатками в положениях 148-154, 164-168 и 185-192.

Изобретение относится к области биотехнологии, конкретно к иммунологии, и может быть использовано в медицине. Композицию, основанную на совместном применении ApoA, интерлейкина 15 и домена Sushi альфа цепи рецептора IL15, используют для стимулирования противоопухолевого иммунного ответа у субъекта.

Изобретение относится к области биохимии, в частности к биспецифическому двухвалентному антителу, которое специфично связывается с фактором роста эндотелия сосудов человека (VEGF) и с ангиопоэтина-2 человека (ANG-2).

Настоящее изобретение относится к области биохимии. Предложен рекомбинантный полипептид, имеющий мутацию с заменой цистеина на серин в С-концевой области и обладающий целлюлазной активностью и улучшенной термостойкостью.

Изобретение относится к области биотехнологии и иммунологии. Описаны новые антитела или антиген-связывающие фрагменты, которые специфично связываются с сиглеком-15.

Настоящее изобретение относится к области иммунологии. Предложено выделенное антитело и его антигенсвязывающий фрагмент, которые специфически связываются с индуцируемым глюкокортикоидами рецептором TNF (GITR) человека; а также композиции, в том числе фармацевтическая композиция, и способ усиления иммунного ответа у человека.

Настоящее изобретение относится к биотехнологии, конкретно к новым аллергенам собаки, и может быть использовано в медицине. Рекомбинантным путем получают аллерген Can f 4.

Изобретение относится к области биохимии. Заявлено антитело, связывающееся с рецептором клеточной поверхности DR5.

Изобретение относится к области биотехнологии, в частности к рекомбинантной плазмидной ДНК, созданной при помощи новых праймеров CTTCCATATGGAACGAAGGCGTTTGTG и TGTGGATCCAGCTAGTTAGGCATGAAA. Указанная рекомбинантная плазмидная ДНК используется для получения рекомбинантного белка PRAME-F, состоящего из пептида MGSSHHHHHHSSGLVPRGSH слитого с последовательностью природного белка PRAME, путём её экспрессии в бактериальных клетках.

Изобретение относится к биотехнологии и касается способа производства препарата «Мобилан (M-VM3)». Изобретение оптимизирует стадии производства, повышая его рентабельность, делая оптимальным соотношение время производства/количество полученного препарата/количество средств, затраченных на производство.

Данное изобретение относится к области биотехнологии и медицины. Предложено применение гантелеподобной линейной, ковалентно замкнутой экспрессионной конструкции ДНК с двухцепочечной основой и одноцепочечными петлями, расположенными на обоих концах основы, где основа комплементарных дезоксирибонуклеиновых кислот кольцевой цепочки ДНК включает промоторную последовательность, кодирующую последовательность и сигнал терминации, где конструкция ДНК кодирует TNF-α, для лечения меланомы, причем указанная конструкция ДНК вводится путем безыгольной инъекции и указанная конструкция вводится одновременно или последовательно с виндесином.
Наверх