Вращающаяся платформа для проведения секвенирования нуклеиновых кислот



Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот
Вращающаяся платформа для проведения секвенирования нуклеиновых кислот

 


Владельцы патента RU 2601139:

ПИРОБЕТТ ПТИ ЛТД (SG)

Изобретение относится к биохимии. Описан способ для проведения пиросеквенирования нуклеиновых кислот. Способ включает этапы обеспечения вращающейся платформы, имеющей по меньшей мере одну открытую ячейку, предназначенную для содержания по меньшей мере одной несущей поверхности, причем указанная ячейка имеет такие форму или размеры, чтобы реагент, находящийся в ней, можно было удалить центрифугированием из указанной открытой ячейки и из указанной платформы при достаточном вращении указанной платформы; обеспечения по меньшей мере одной указанной несущей поверхности в форме магнитной частицы в каждой указанной открытой ячейке, где указанная несущая поверхность приспособлена для иммобилизации полинуклеотидной молекулы или на которой полинуклеотидная молекула была иммобилизирована; отжига олигонуклеотидного праймера с отдельной цепью указанной полинуклеотидной молекулы; количественного внесения в каждую указанную открытую ячейку из точки, расположенной за пределами платформы, серии реагентов для пиросеквенирования, при этом после внесения платформу вращают со скоростью, достаточной для того, чтобы любой остаточный или непрореагировавший указанный реагент был практически удален центрифугированием из каждой открытой ячейки и из платформы, при этом во время вращения каждую указанную магнитную частицу удерживают в указанной открытой ячейке за счет сил магнитного взаимодействия; анализа на присутствие пирофосфатной группы в каждой указанной ячейке; и повторения указанных этапов количественного внесения и анализа, таким образом секвенируя указанную полинуклеотидную молекулу. 22 з.п. ф-лы, 15 ил., 1 пр.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к способу и устройству для проведения анализа. В частности, настоящее изобретение относится к вращающейся платформе, которая может применяться для проведения анализа, в частности многоэтапных видов анализа. Тогда как настоящее изобретение было разработано прежде всего для секвенирования нуклеиновых кислот путем пиросеквенирования, и будет описываться далее в настоящем документе со ссылкой на данную заявку, следует понимать, что настоящее изобретение не ограничивается данной конкретной областью применения.

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

Нижеследующее обсуждение известного уровня техники приведено для того, чтобы разместить настоящее изобретение в надлежащем техническом контексте и обеспечить лучшее понимание его преимуществ. Следует понимать, однако, что любое обсуждение известного уровня техники в тексте всего описания изобретения не следует рассматривать в качестве явного или подразумеваемого признания того, что такой известный уровень техники является широко известным или составляет часть общего знания в данной области техники.

В последнее время возможность определять нуклеотидные последовательности ДНК приобретает все большее значение. Ранее двумя наиболее часто применяемыми способами ДНК-секвенирования являлись способ ферментативного обрыва цепи и способ химического расщепления, которые оба основываются на гель-электрофорезе для растворения, в соответствии с их размером, фрагментов ДНК, полученных из более крупного сегмента ДНК. Этап электрофореза и детектирование разделенных фрагментов ДНК представляют собой трудоемкие процедуры. Однако, хотя автоматизированные установки для электрофореза имеются в продаже, электрофорез не очень хорошо подходит для крупномасштабных геномных проектов или клинического секвенирования, где необходимы относительно экономически эффективные установки с высокой производительностью. Таким образом, имеется высокая потребность в разработке способов секвенирования, отличных от электрофореза.

Способы секвенирования, основывающиеся на концепции обнаружения неорганического пирофосфата (PPi), который выделяется при полимеразной цепной реакции, были описаны ранее (см. международные публикации PCT №№ WO 93/23564 и WO 89/09283) и обычно называются пиросеквенированием. По мере того как каждый нуклеотид присоединяется к растущей цепи нуклеиновой кислоты в ходе полимеразной цепной реакции, высвобождается молекула пирофосфата. Было обнаружено, что пирофосфат, который высвобождается в этих условиях, может детектироваться ферментативно, например, по генерации света в реакции люциферазы-люциферина. Такие способы позволяют идентифицировать основание в целевом положении и легко и быстро секвенировать ДНК, избегая необходимости применения электрофореза и использования вредных радиоактивных меток

В ранних из известных в данной области техники способов проведения пиросеквенирования использовали микроцентрифужную пробирку объемом 0,2 мл (или аналогичную), в которую последовательно вносились реагенты чтобы детектировать последовательность ДНК, присутствующей в пробирке. Хотя этот способ является относительно простым, его недостатком являются короткие длины результатов считывания, поскольку реакционная смесь разбавляется при каждом добавлении реагента-нуклеотида и/или накапливаются побочные продукты реакции и условия реакции достигают точки, в которой реакция больше не идет. Например, обычно только приблизительно 80 оснований могут быть гарантировано секвенированы с применением этого способа.

Также было разработано коммерческое оборудование, которое использует пиросеквенирование. Эти системы используют проточные ячейки для проведения гибридизации целевой молекулы ДНК/РНК. Вкратце, одноцепочечную ДНК иммобилизуют на стационарной грануле, которая расположена в проточной ячейке, обычно путем иммобилизации двухцепочечной ДНК и денатурации комплементарной цепи. Реагенты, в том числе нуклеотиды (A, G, С или Т), текут мимо гранулы, и световой луч детектирует встраивание нуклеотида в цепь ДНК. Сила светового сигнала пропорциональна количеству нуклеотидов, встроившихся в течение одной реакции. Между этапами воздействия на гранулу различных нуклеотидов, выполняют также этап отмывания, и процесс повторяют чтобы детектировать встраивание следующего нуклеотида.

Также известны другие способы секвенирования путем синтеза, например, с помощью флуоресцентно-меченых нуклеотидов. При таком способе образцы ДНК сначала фрагментируют, а двойную спираль ДНК расплавляют на отдельные нити. Отдельные молекулы ДНК захватываются на поверхности в пределах проточной ячейки и служат матрицами для процесса секвенирования посредством синтеза. Флуоресцентно меченные нуклеотиды добавляют по одному и они встраиваются в растущую комплементарную цепь с помощью фермента ДНК-полимеразы. Неиспользованные нуклеотиды вымывают. При облучении лазером, встроившиеся нуклеотиды излучают свет, который детектируют. Флуоресцентную метку удаляют до добавления следующего нуклеотида для продолжения цикла. Отслеживание встраивания нуклеотидов позволяет определить точную последовательность каждой отдельной молекулы ДНК.

Также известно секвенирование лигированием. При таком способе ДНК-секвенирования применяют фермент ДНК-лигазу для идентификации нуклеотидов, присутствующих в данном положении в последовательности ДНК. Чувствительность фермента ДНК-лигазы к нарушению комплементарности используют для того, чтобы определить основную последовательность целевой молекулы ДНК. См., например, патенты США №№5750341 и 4883750.

Существует необходимость в устройстве для проведения различных видов количественного и качественного анализа, которое может применяться для различных химических веществ и способов детектирования, и, в частности, для проведения тех видов анализа, которые включают несколько этапов реакции и отмывания, такие как используемые в секвенировании нуклеиновых кислот. Дополнительно, необходимо устройство, которое может использоваться в качестве удобной замены для тех видов анализа, которые требуют использования проточный среды, или замены видов анализа, использующих фиксированный реакционный сосуд, где, в случае секвенирования нуклеиновых кислот, накопление побочных продуктов может ограничить максимальную длину результата считывания при секвенировании.

Целью настоящего изобретения является преодоление или улучшение по меньшей мере одного из указанных выше недостатков известного уровня техники или обеспечение подходящей альтернативы.

КРАТКОЕ ОПИСАНИЕ НАСТОЯЩЕГО ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к способу применения вращающейся платформы, имеющей по меньшей мере одну ячейку, предназначенную для содержания несущей поверхности, и в каждую ячейку можно помещать по меньшей мере одну несущую поверхность. Несущая поверхность приспособлена для связывания или иммобилизации первого или второго партнера по связыванию в первой и второй паре партнеров по связыванию. Первая и вторая пары партнеров по связыванию являются частью анализа, где анализ предпочтительно представляет собой секвенирование нуклеиновой кислоты, и более предпочтительно пиросеквенирование. Реагенты для анализа количественно вносят в ячейку и приводят в контакт с несущей поверхностью из точки, расположенной за пределами платформы. Использованные или израсходованные реагенты могут быть удалены центрифугированием при достаточном вращении платформы, а несущие поверхности удерживаются в ячейке во время центрифугирования. Любой способ удержания несущих поверхностей попадает в сферу настоящего изобретения, и только в качестве примера, несущие поверхности предпочтительно представляют собой магнитные гранулы, а для удержания магнитных гранул в ячейках во время центрифугирования применяют магнит. В контексте пиросеквенирования, предпочтительно одноцепочечную ДНК (оцДНК) выделяют с применением подхода отмывания центрифугированием. Реагенты можно удалять после каждого нового добавления реагента или после нескольких добавлений. На этапе отмывания центрифугированием несущую поверхность высушивают и готовят к следующему реагенту, а также удаляют нежелательные побочные продукты анализа. Настоящее изобретение также относится к устройству для вращения платформы и удержания несущей поверхности внутри соответствующей ячейки, и к наборам, содержащим платформу и несущую поверхность.

В соответствии с первым аспектом, настоящее изобретение обеспечивает способ для проведения секвенирования нуклеиновых кислот, при этом указанный способ включает этапы:

обеспечения платформы, имеющей по меньшей мере одну ячейку, предназначенную для содержания по меньшей мере одной несущей поверхности;

обеспечения по меньшей мере одной указанной несущей поверхности внутри каждой указанной ячейки, где указанная несущая поверхность приспособлена для иммобилизации первого партнера по связыванию; связывания или иммобилизации указанного первого партнера по связыванию с указанной несущей поверхностью; и

количественного внесения реагента в каждую указанную ячейку из точки, расположенной за пределами платформы, где после указанного этапа количественного внесения указанную платформу вращают со скоростью, достаточной для того, чтобы любой остаточный или непрореагировавший указанный реагент был практически удален центрифугированием из каждой указанной ячейки и/или с каждой указанной несущей поверхности,

при этом во время вращения каждую указанную несущую поверхность удерживают в каждой указанной ячейке.

Предпочтительно секвенирование нуклеиновых кислот представляет собой пиросеквенирование.

Предпочтительно несущая поверхность представлена в форме магнитной частицы, и указанная магнитная частица удерживается в указанной ячейке за счет сил магнитного взаимодействия путем размещения магнита достаточно близко к указанной платформе для удержания за счет сил магнитного взаимодействия указанной магнитной частицы (частиц) в указанной ячейке во время вращения указанной платформы. Предпочтительно магнит представлен в форме пластины или кольца и располагается под платформой. В предпочтительных вариантах осуществления магнитная пластина или магнитное кольцо дополнительно может нагревать указанную ячейку (ячейки) до температуры приблизительно 150°C с нагреванием, таким образом, указанной несущей поверхности. Однако в альтернативном варианте осуществления для удержания за счет сил магнитного взаимодействия указанной магнитной частицы (частиц) в указанной ячейке во время вращения указанной платформы используют электромагнит.

В предпочтительных вариантах осуществления платформа является практически круглой, и указанные ячейки расположены по периферии указанной круглой платформы. Предпочтительно приблизительно от 2 до 500 ячеек расположены по периферии указанной платформы, и диаметр указанной платформы составляет приблизительно от 50 до 500 мм, а толщина указанной платформы составляет приблизительно от 1 до 6 мм. Предпочтительно ячейки содержат объем, составляющий приблизительно от 0,5 до 100 мкл или глубина ячейки составляет приблизительно от 0,5 до 5 мм. Предпочтительно размеры ячеек таковы, что ячейки могут содержать приблизительно от 1 до приблизительно 50 дискретных несущих поверхностей.

В альтернативном варианте осуществления ячейка содержит углубление для размещения в ней указанной несущей поверхности на время вращения указанной платформы, где указанное углубление содержит фильтр, позволяющий удерживать указанную несущую поверхность, и в то же время позволяющий указанному реагенту проходить через него во время вращения указанной платформы, таким образом, чтобы любой остаточный или непрореагировавший реагент был практически удален центрифугированием из каждой указанной ячейки и/или с каждой указанной несущей поверхности.

Предпочтительно платформа изготовлена из пластикового материала, выбранного из группы, состоящей из поликарбоната, полистирола, ударопрочного полистирола, полиэтилена и полипропилена, или изготовлена из стекла или кварца. Предпочтительно на периферии указанной платформы расположен желоб для приема отработанных жидкостей, которые выносят или удаляют под действием центробежных сил с поверхности указанной платформы во время вращения.

Предпочтительно первый партнер по связыванию адсорбируется на указанной несущей поверхности за счет химических свойств или связывается с ней за счет ковалентных, или ионных, или водородных связей, или ван-дер-Ваальсовы силы иммобилизуют указанный первый партнер по связыванию на указанной несущей поверхности.

Предпочтительно серию реагентов количественно вносят в каждую указанную ячейку, и первый реагент из серии включает второй партнер по связыванию к первому партнеру по связыванию, а последующие реагенты выбирают из реагентов для отмывания и/или для промывки реагентов для создания детектируемого сигнала. Предпочтительно способ настоящего изобретения дополнительно включает этап анализа секвенирования нуклеиновых кислот во время и/или после каждого из указанных этапов количественного внесения.

Предпочтительно способ настоящего изобретения дополнительно включает этап вращения вращающейся платформы со скоростью приблизительно от 10 до 200 об./мин во время количественного внесения указанного реагента, и вращение вращающейся платформы со скоростью более 400 об./мин, чтобы практически удалить центрифугированием указанный реагент из указанных ячеек. Предпочтительно платформа вращается с достаточно низкой скоростью на этапах количественного внесения, чтобы избежать удаления реагента центрифугированием из ячеек, и вращается с достаточно высокой скоростью на этапах отмывания или сушки, чтобы удалить реагент центрифугированием из 10 ячеек. Предпочтительно достаточно высокие скорости представляют собой скорости более 400 об./мин и могут составлять 1000, 2000, 3000, 4000 об./мин или выше.

В некоторых предпочтительных вариантах осуществления платформа вибрирует в достаточной степени, чтобы тщательно смешать указанный реагент и указанную несущую поверхность (поверхности).

В соответствии со вторым аспектом настоящее изобретение представляет набор, включающий платформу, имеющую по меньшей мере одну ячейку, которая может содержать одну или несколько несущих поверхностей, и по меньшей мере одну несущую поверхность в составе набора, где указанная несущая поверхность приспособлена для иммобилизации первого партнера по связыванию. Предпочтительно несущая поверхность содержится в указанной ячейке, где съемную одноразовую накладку приклеивают к поверхности указанной платформы для удержания указанной несущей поверхности в указанной ячейке. Предпочтительно набор содержит один или несколько реагентов для проведения секвенирования нуклеиновых кислот, и в частности для пиросеквенирования.

В соответствии с третьим аспектом настоящее изобретение представляет устройство для проведения секвенирования нуклеиновых кислот, при этом указанное устройство включает:

устройство для вращения вращающейся платформы с заданной контролируемой скоростью вращения по выбору пользователя;

устройство для приведения магнита в действие по отношению к указанной вращающейся платформе для удерживания магнитной частицы в ячейке указанной платформы;

факультативное устройство для количественного внесения первого партнера по связыванию в указанную ячейку для иммобилизации указанного первого партнера по связыванию на указанной магнитной частице;

устройство для количественного внесения реагента в указанную ячейку; и

факультативное устройство для количественного внесения реагента для отмывания.

В соответствии с четвертым аспектом настоящее изобретение представляет способ для проведения секвенирования нуклеиновых кислот, при этом указанный способ включает этапы:

обеспечения платформы, имеющей по меньшей мере одну ячейку, предназначенную для содержания по меньшей мере одной несущей поверхности;

обеспечения по меньшей мере одной указанной несущей поверхности внутри каждой указанной ячейки, где указанная несущая поверхность приспособлена для иммобилизации второго партнера по связыванию;

избирательного связывания или избирательной иммобилизации указанного второго партнера по связыванию на указанной области-поверхности; и

количественного внесения реагента в каждую указанную ячейку из точки, расположенной за пределами платформы, где после указанного этапа количественного внесения указанную платформу вращают со скоростью, достаточной для того, чтобы любой остаточный или непрореагировавший указанный реагент был практически удален центрифугированием из каждой указанной ячейки и/или с каждой указанной несущей поверхности,

при этом во время вращения каждую указанную несущую поверхность удерживают в каждой указанной ячейке.

Предпочтительно первый партнер по связыванию уже адсорбировался на указанной несущей поверхности за счет химических свойств или связывается с ней за счет ковалентных, или ионных, или водородных связей, или силы Ван-дер-Ваальса иммобилизуют первого партнера по связыванию на указанной несущей поверхности, а указанный второй партнер по связыванию может связываться или вступать в реакцию с указанным первым партнером по связыванию, который уже связан с указанной несущей поверхностью.

Предпочтительно серию реагентов количественно вносят в каждую указанную ячейку, и первый реагент из серии включает второй партнер по связыванию к первому партнеру по связыванию, а последующие реагенты выбирают из реагентов для отмывания и/или для промывки.

В соответствии с пятым аспектом настоящее изобретение представляет набор, включающий платформу, имеющую по меньшей мере одну ячейку, которая может содержать одну или несколько несущих поверхностей, и по меньшей мере одну несущую поверхность, где указанная несущая поверхность приспособлена к избирательному связыванию или иммобилизации второго партнера по связыванию.

В соответствии с шестым аспектом настоящее изобретение представляет устройство для проведения секвенирования нуклеиновых кислот, такого как пиросеквенирование, при этом указанное устройство включает:

устройство для вращения вращающейся платформы с заданной контролируемой скоростью вращения по выбору пользователя;

устройство для приведения магнита в действие по отношению к указанной вращающейся платформе для удерживания магнитной частицы в ячейке указанной платформы;

факультативное устройство для количественного внесения указанного второго партнера по связыванию в указанную ячейку для избирательной иммобилизации указанного второго партнера по связыванию на указанной магнитной частице;

устройство для количественного внесения реагента в указанную ячейку; и

факультативное устройство для количественного внесения реагента для отмывания.

В соответствии с седьмым аспектом настоящее изобретение представляет способ для проведения секвенирования цепи нуклеиновой кислоты, при этом указанный способ включает этапы:

обеспечения платформы, имеющей по меньшей мере одну ячейку, предназначенную для содержания по меньшей мере одной несущей поверхности;

обеспечения по меньшей мере одной указанной несущей поверхности внутри каждой указанной ячейки, где указанная несущая поверхность приспособлена для иммобилизации партнера по связыванию цепи нуклеиновой кислоты;

связывания или иммобилизации указанного партнера по связыванию цепи нуклеиновой кислоты на указанной несущей поверхности, а затем избирательного связывания или избирательной иммобилизации цепи нуклеиновой кислоты на указанной несущей поверхности;

факультативных денатурации и удаления любой комплементарной цепи нуклеиновой кислоты, отжига праймера для секвенирования с указанной несущей поверхностью; и

количественного внесения последовательно в каждую указанную ячейку из точки, расположенной за пределами платформы, серии реагентов, включающей нуклеотиды А, Т, G и/или С или соответствующие подходящие аналоги нуклеотидов, где после каждого или любого из указанных этапов количественного внесения указанную платформу вращают с достаточной скоростью, такой, чтобы практически любой остаточный или непрореагировавший указанный реагент был практически удален центрифугированием из каждой указанной ячейки и/или с каждой указанной несущей поверхности,

при этом во время вращения каждую указанную несущую поверхность удерживают в каждой указанной ячейке.

Предпочтительно цепь нуклеиновой кислоты является цепью ДНК или РНК или их модифицированной формой. Предпочтительно секвенирование цепи нуклеиновой кислоты представляет собой пиросеквенирование.

Предпочтительно цепь нуклеиновой кислоты является биотинилированной, а партнер по связыванию цепи нуклеиновой кислоты содержит авидин, или стрептавидин, или аналог для связывания с биотинилированной цепью нуклеиновой кислоты.

Предпочтительно каждую указанную несущую поверхность последовательно приводят в контакт с серией реагентов, включающей нуклеотиды А, Т, G и/или С.

Предпочтительно этап последовательного приведения в контакт/количественного внесения включает любое из следующего:

a.) каждый нуклеотид или его аналог добавляют отдельно и последовательно в любом необходимом или заранее заданном порядке,

b.) нуклеотиды A+T+G+C или любую заранее заданную или необходимую подгруппу этих нуклеотидов добавляют в виде смеси, и смесь добавляют снова и т.д.

Предпочтительно дополнительно включают этап анализа указанной цепи нуклеиновой кислоты во время и/или после каждого из указанных этапов количественного внесения. Предпочтительно анализ включает детектирование следующей пары оснований в указанной цепи нуклеиновой кислоты путем сопоставления исходящего светового сигнала с числом нуклеотидов, которые связались с цепью нуклеиновой кислоты.

Предпочтительно этап денатурации включает нагревание цепи нуклеиновой кислоты для осуществления денатурации, или воздействие на цепь нуклеиновой кислоты среды с повышенным pH.

Предпочтительно способ включает этап, на котором после того как указанную цепь нуклеиновой кислоты денатурируют комплементарную цепь удаляют с помощью этапа промывки реагентом для промывки.

Предпочтительно каждую указанную несущую поверхность готовят для каждого указанного последующего реагента путем достаточного высушивания указанной несущей поверхности вращением указанной платформы для того, чтобы практически удалить центрифугированием любые остаточные реагенты, таким образом, чтобы практически отсутствовало загрязнение указанной несущей поверхности реагентом.

В соответствии с восьмым аспектом настоящее изобретение представляет набор для проведения секвенирования цепи нуклеиновой кислоты; указанный набор включает вращающуюся платформу, имеющую по меньшей мере одну ячейку, предназначенную для содержания одной или нескольких несущих поверхностей, и по меньшей мере одну несущую поверхность, где указанная несущая поверхность приспособлена для иммобилизации партнера по связыванию цепи нуклеиновой кислоты.

В соответствии с девятым аспектом настоящее изобретение представляет применение набора в соответствии с восьмым аспектом для проведения секвенирования цепи нуклеиновой кислоты. Предпочтительно анализ представляет собой пиросеквенирование.

В соответствии с десятым аспектом настоящее изобретение представляет устройство для секвенирования цепи нуклеиновой кислоты, при этом указанное устройство включает:

устройство для вращения вращающейся платформы с заданной контролируемой скоростью вращения по выбору пользователя;

устройство для приведения магнита в действие по отношению к указанной вращающейся платформе для удерживания магнитной частицы в ячейке указанной вращающейся платформы;

факультативное устройство для количественного внесения партнера по связыванию цепи нуклеиновой кислоты в указанную ячейку для иммобилизации указанного партнера по связыванию цепи нуклеиновой кислоты на указанной магнитной частице;

факультативное устройство для количественного внесения цепи нуклеиновой кислоты в указанную ячейку для избирательной иммобилизации указанной цепи нуклеиновой кислоты на указанной магнитной частице;

факультативное устройство для денатурации и факультативного удаления любой комплементарной цепи нуклеиновой кислоты;

устройство для количественного внесения нуклеотидов А, Т, G и/или С или их соответствующих аналогов или их комбинаций в указанную ячейку;

устройство для количественного внесения реагента для отмывания; и

факультативное устройство для количественного внесения одного или нескольких ферментных растворов.

В соответствии с одиннадцатым аспектом настоящее изобретение представляет способ проведения секвенирования цепи нуклеиновой кислоты, при этом указанный способ включает этапы:

обеспечения платформы, имеющей по меньшей мере одну ячейку, предназначенную для содержания по меньшей мере одной несущей поверхности;

обеспечения по меньшей мере одной указанной несущей поверхности внутри каждой указанной ячейки, где указанная несущая поверхность приспособлена к избирательной иммобилизации цепи нуклеиновой кислоты;

избирательного связывания или избирательной иммобилизации цепи нуклеиновой кислоты на указанной несущей поверхности;

факультативных денатурации и удаления любой комплементарной цепи нуклеиновой кислоты, отжига праймера для секвенирования с указанной несущей поверхностью; и

количественного внесения последовательно в каждую указанную ячейку из точки, расположенной за пределами указанной платформы, серии реагентов, включающей нуклеотиды А, Т, G и/или С или соответствующие подходящие аналоги нуклеотидов, при этом после каждого или любого из указанных этапов количественного внесения указанную платформу вращают со скоростью, достаточной для того, чтобы любой остаточный или непрореагировавший указанный реагент был практически удален центрифугированием из каждой указанной ячейки и/или с каждой указанной несущей поверхности,

при этом во время вращения каждую указанную несущую поверхность удерживают в каждой указанной ячейке.

Предпочтительно на несущей поверхности уже имеется иммобилизованный партнер по связыванию цепи нуклеиновой кислоты, и при этом указанная цепь нуклеиновой кислоты избирательно связывается с указанным партнером по связыванию цепи нуклеиновой кислоты. Предпочтительно цепь нуклеиновой кислоты представляет собой ДНК или РНК или их модифицированную форму. Предпочтительно цепь нуклеиновой кислоты является биотинилированной, и первый партнер по связыванию содержит авидин, или стрептавидин, или аналог для связывания с биотинилированной цепью нуклеиновой кислоты.

В соответствии с двенадцатым аспектом настоящее изобретение представляет набор, включающий вращающуюся платформу, имеющую по меньшей мере одну ячейку, предназначенную для содержания одной или нескольких несущих поверхностей, и по меньшей мере одну несущую поверхность, где указанная несущая поверхность приспособлена для избирательной иммобилизации цепи нуклеиновой кислоты.

В соответствии с тринадцатым аспектом настоящее изобретение представляет применение набора в соответствии с двенадцатым аспектом для проведения секвенирования цепи нуклеиновой кислоты.

B соответствии с четырнадцатым аспектом настоящее изобретение представляет устройство для секвенирования цепи нуклеиновой кислоты, при этом указанное устройство включает:

устройство для вращения вращающейся платформы с заданной контролируемой, скоростью вращения по выбору пользователя;

устройство для приведения магнита в действие по отношению к указанной вращающейся платформе для удерживания магнитной частицы в ячейке указанной вращающейся платформы;

факультативное устройство для количественного внесения цепи нуклеиновой кислоты в указанную ячейку для иммобилизации указанной цепи нуклеиновой кислоты на указанной несущей поверхности;

факультативное устройство для денатурации и факультативного удаления любой комплементарной цепи нуклеиновой кислоты;

устройство для количественного внесения нуклеотидов А, Т, G и/или С или их соответствующих аналогов или их комбинаций для приведения их в контакт с указанной несущей поверхностью;

устройство для количественного внесения реагента для отмывания; и факультативное устройство для количественного внесения одного или нескольких ферментных растворов.

В некоторых вариантах осуществления вращающаяся платформа содержит множество относительно неглубоких ячеек, которые содержат объем, составляющий от приблизительно 0,5 до 100 мкл или имеют глубину ячейки приблизительно от 0,5 до 3 мм. В других вариантах осуществления, ячейки являются относительно глубокими, с глубиной приблизительно от 5 до 8 мм для того, чтобы содержать магнитные гранулы, которые сами приспособлены для иммобилизации первого партнера по связыванию или приспособлены для избирательной иммобилизации второго партнера по связыванию. В данном примере, гранулы считаются дискретными областями, и одна или несколько гранул могут содержаться в каждой ячейке.

Первый или второй партнеры по связыванию предпочтительно обладают способностью связываться с гранулами, которые предпочтительно представляют собой магнитные гранулы. Следует понимать, что если используют магнитные гранулы, то ячейка имеет достаточную глубину и объем для того, чтобы содержать гранулы таким образом, чтобы они не смещались под действием центробежных сил во время вращения диска/платформы. В предпочтительных вариантах осуществления система способна удерживать магнитные гранулы внутри каждой ячейки при поднятии магнитного кольцевидного диска к нижней стороне диска/платформы с образцами или при активировании электромагнита. В данном примере магнитные гранулы могут содержаться в ячейках, и можно применять достаточную центробежную силу при вращении платформы для того, чтобы практически высушить гранулы от любого окружающего их реагента. Также следует понимать, что платформа может содержать множество концентрически расположенных круглых рядов ячеек. В некоторых вариантах осуществления первый партнер по связыванию адсорбирован за счет химических свойств на поверхности гранулы или частицы. В других вариантах осуществления первый партнер по связыванию связан ковалентной, или ионной, или водородной связью с поверхностью гранулы или частицы, и в еще других вариантах осуществления силы Ван-дер-Ваальса удерживают первый партнер по связыванию на поверхности гранулы или частицы. Следует понимать, что второй партнер по связыванию может связываться или вступать в реакцию с первым партнером по связыванию, который уже связан с поверхностью гранулы или частицы.

Настоящее изобретение прежде всего касается способов и видов анализа, таких как способы секвенирования нуклеиновых кислот, например, пиросеквенирование. Например, первый и второй партнеры по связыванию представляют собой пары партнеров по связыванию (факультативно один из которых может быть меченным для детектирования), которые предпочтительно выбраны из авидина, или стрептавидина, или стрептацина, или аналогов и биотина, или аналогов.

Однако, и как дополнительно обсуждают ниже, преимущество настоящего изобретения заключается в обеспечении относительно быстрых и относительно простых этапов отмывания, и связанных с ними малых объемов отходов раствора для отмывания и реагентов для отмывания.

Настоящее изобретение будет далее поясняться в контексте пиросеквенирования, однако, следует понимать, что настоящее изобретение не ограничивается этим анализом.

Следует понимать, что в первом варианте осуществления несущая поверхность, удерживаемая внутри ячейки, приспособлена для иммобилизации первого партнера по связыванию, которым может быть, например, авидин, или стрептавидин, или стрептацин, или аналоги, а затем авидин, или стрептавидин, или стрептацин, или аналоги могут быть впоследствии введены в реакцию с, например, биотинилированными молекулами ДНК, на последующем этапе обработки. Дополнительно следует понимать, что во втором варианте осуществления несущая поверхность уже содержит первый партнер по связыванию, и эта поверхность приспособлена для избирательной иммобилизации второго партнера по связыванию. Поэтому следует понимать, что несущая поверхность в соответствии с первым вариантом осуществления может считаться «нефункционализированной», а несущая поверхность в соответствии со вторым вариантом осуществления может считаться «функционализированной» или «префункционализированной».

Предпочтительно первый из серии реагентов включает второй, или комплементарный, партнер по связыванию к первому партнеру по связыванию, а затем последующие реагенты выбраны из, например, реагентов для отмывания или для промывки, которые дополнительно обсуждаются ниже.

Предпочтительно способ настоящего изобретения дополнительно включает этап анализа секвенирования нуклеиновых кислот во время и/или после каждого из указанных этапов приведения в контакт или количественного внесения. В предпочтительных вариантах осуществления, перед приведением в контакт несущей поверхности с последующим реагентом, каждая указанная несущая поверхность проходит этап отмывания или промывки реагентом для отмывания. Реагентом для отмывания может быть любой реагент, который может в достаточной мере вымыть любые остатки раствора после предыдущего этапа приведения в контакт или уменьшить количество остатков раствора и компонентов, присутствующих в указанном растворе (активные средства, как, например, апираза или другие подходящие ферменты, которые вызывают расщепление побочных продуктов или другим образом снижают концентрацию побочных продуктов).

Хотя реагентом для отмывания может быть любой реагент, который способен в достаточной мере вымыть любые остатки раствора от предыдущего этапа приведения в контакт/количественного внесения или уменьшить количество любого остаточного раствора и компонентов, присутствующих в указанном растворе, и может представлять собой активное средство, такое как апираза, в других вариантах осуществления предпочтительно этап отмывания для удаления излишков нуклеотида не содержит апиразы, как подробно описано в публикации Mashayekhi F., and Ronaghi M., Analysis of read-length limiting factors in pyrosequensing chemistry, Anal. Biochem. (2007), 363(2): 275-287, которая включена в настоящий документ в полном объеме посредством ссылки. Как подробно 5 описано в публикации Mashayekhi et al, показано, что замена этапа отмывания на этап отмывания без апиразы, повышает длину результата считывания при пиросеквенировании.

Предпочтительно вращающаяся платформа вращается с низкой скоростью во время количественного внесения реагентов, например, со скоростью от приблизительно 10 до 200 об./мин, чтобы избежать удаления реагентов, добавленных в целевой участок; и платформа вращается с высокой скоростью во время количественного внесения реагентов, например, со скоростью от приблизительно 400 до 2000 об./мин. Однако следует понимать, что возможны и другие скорости вращения.

В предпочтительных вариантах осуществления, каждую указанную несущую поверхность готовят для каждого указанного последующего реагента путем достаточного «высушивания» указанной несущей поверхности за счет вращения указанной платформы для того, чтобы удалить центрифугированием любые остатки реагентов, таким образом, чтобы загрязнение указанной поверхности реагентом с предыдущего этапа была в достаточной мере снижено, предпочтительно практически отсутствовало.

В соответствии с другим аспектом настоящее изобретение представляет применение комбинации платформы и несущей поверхности для проведения анализа. В соответствии с дополнительным аспектом настоящее изобретение представляет набор, включающий платформу, которая обсуждается в настоящем документе, и одну или несколько несущих поверхностей и факультативно один или несколько реагентов для указанного анализа.

Предпочтительно устройством для вращения платформы является электродвигатель, а предустановленные скорости вращения выбираются пользователем и составляют приблизительно от 10 до 5000 об./мин. Устройство также предпочтительно снабжают вакуумной системой отсоса для вытягивания отработанных реагентов, которые удаляются при вращении вращающейся платформы.

Настоящее изобретение будет далее поясняться в контексте пиросеквенирования, однако следует понимать, что настоящее изобретение не ограничивается этим анализом.

Пиросеквенирование

Предпочтительно применяемый способ секвенирования нуклеиновых кислот представляет собой пиросеквенирование. Однако следует понимать, что могут использоваться и другие способы секвенирования цепи нуклеиновой кислоты, которые дополнительно обсуждаются ниже.

Предпочтительно указанная цепь нуклеиновой кислоты представляет собой ДНК или РНК или их модифицированную форму (формы), например, после обработки бисульфитом, или содержащие дополнительные основания, которые не присутствуют в природных нуклеиновых кислотах. Следует понимать, что копии цепи нуклеиновой кислоты удерживают на каждой из одной или нескольких дискретных областях.

Предпочтительно вращающаяся платформа является практически круглой, и имеет диаметр приблизительно от 50 до 500 мм. Предпочтительно вращающаяся платформа содержит приблизительно от 2 до 500 ячеек, которые расположены на равном расстоянии от центра вращающейся платформы. Следует понимать, что диаметр может представлять собой любой диаметр и может быть выбран такой диаметр, который позволяет вместить количество ячеек, составляющее 1 или больше. В предпочтительных вариантах осуществления ячейки распределяются или располагаются практически равномерно по периферии вращающейся платформы для формирования практически круглого ряда.

Предпочтительно ячейки содержат несущие поверхности, которые имеют форму гранул, которые предпочтительно являются магнитными гранулами, которые приспособлены для избирательного связывания, захвата или иммобилизации цепи нуклеиновой кислоты (например, матрицы для секвенирования или праймера для секвенирования). Например, в некоторых предпочтительных вариантах осуществления цепь нуклеиновой кислоты является биотинилированной, а дискретные области содержат авидин и предпочтительно стрептавидин или аналог для связывания биотинилированной цепи нуклеиновой кислоты. В качестве альтернативы, несущие поверхности или гранулы приспособлены для связывания, захвата или иммобилизации авидина и предпочтительно стрептавидина, и на последующем этапе биотинилированная цепь нуклеиновой кислоты избирательно иммобилизуется на авидине/стрептавидине, связанном с несущими поверхностями. Однако следует понимать, что доступны другие химические соединения для иммобилизации цепи нуклеиновой кислоты на дискретных областях. Настоящее изобретение не ограничивается химическим соединением, которое может быть использовано для иммобилизации цепи нуклеиновой кислоты на дискретных областях. В других вариантах осуществления, связывание средств с матрицей может осуществляться за счет связывания лиганда, универсального праймера/зонда или антитела.

В одном варианте осуществления ячейки могут представлять неглубокие ячейки, которые могут содержать объем, составляющий приблизительно от 0,5 до 100 мкл. Следует понимать, что неглубокие ячейки могут иметь любую форму, и что ячейки могут иметь любой объем. В некоторых вариантах осуществления ячейки имеют диаметр приблизительно от 1 до 5 мм. Однако следует понимать, что ячейки могут иметь любой диаметр или форму.

Предпочтительно вращающаяся платформа в целях удобства изготовлена из пластикового материала, однако, специалисту будет понятно, что возможно применение и других материалов, таких как стекло или кварц. Предпочтительно пластиковый материал выбран из группы, состоящей из поликарбоната, полистирола или полипропилена. Также предполагается, что вращающаяся платформа также может иметь многослойную структуру. Независимо от материала, из которого изготовлена вращающаяся платформа, платформа должна быть способна выдерживать вращение без деформации и потенциально противостоять тепловым эффектам для денатурации нуклеиновой кислоты, что дополнительно обсуждается ниже.

В некоторых предпочтительных вариантах осуществления вращающаяся платформа, которая может представлять собой практически круглый диск, дополнительный содержит желоб, расположенный на периферии платформы для приема отработанных жидкостей, которые отфуговывают или удаляют центрифугированием с поверхности вращающейся платформы при ее вращении. Следует понимать, что после завершения каждого этапа или ряда этапов реакции пиросеквенирования неиспользованные или отработанные реагенты в ячейках должны быть удалены, чтобы добиться большой длины результатов считывания. Создание центробежной силы за счет вращения вращающейся платформы приводит к тому, что отработанные жидкости будут удаляться при вращении платформы, а для того, чтобы облегчить работу с отработанными жидкостями имеется желоб. В качестве альтернативы отходы реагентов могут удаляться при вращении платформы каждые, например, 20, 30, 40 или 50 циклов добавления нуклеотидов, или непосредственно перед тем как разбавление реагентов достигнет достаточной степени для того, чтобы подавить реакцию.

В этом варианте осуществления следует понимать, что общая масса вращающейся платформы будет увеличиваться по мере того как дополнительные реагенты для пиросеквенирования будут добавляться в ячейки, а затем удаляться при вращении платформы после завершения каждой реакции пиросеквенирования. Таким образом, в альтернативном варианте осуществления может быть необходимым отсутствие желоба во вращающейся платформе, но наличие такой конфигурации корпуса, внутри которого расположена вращающаяся платформа, при которой желоб расположен рядом с наружной границей платформы, так чтобы отработанные жидкости, которые удаляют при вращении вращающейся поверхности платформы, улавливались этим «стационарным» желобом.

Специалисту, знакомому с методиками и химическими процессами, лежащими в основе пиросеквенирования, будет понятно, что цепь нуклеиновой кислоты, иммобилизованная на несущей поверхности, возможно, нужно будет денатурировать для того, чтобы удалить комплементарную цепь нуклеиновой кислоты. Денатурация может достигаться любым способом, однако предпочтительные примеры включают нагревание ячеек и несущей поверхностей или даже всей вращающейся платформы до температуры, достаточной для денатурации, например, от 94 до 99°C, или воздействие на несущие поверхности нагретым до более чем 94°C растворителем, таким как буфер. В качестве альтернативы, несущие поверхности могут подвергаться воздействию денатурирующей композиции (например, композиции, содержащие NaOH). Другие способы включают нагревание за счет инфракрасного или эквивалентного излучения. Следует понимать, что вращающаяся платформа должна быть изготовлена из материалов, которые способны выдерживать такие условия денатурации.

Вращающаяся платформа также может иметь возможность нагреваться или охлаждаться для плавления или гибридизации ДНК с захваченной нуклеиновой кислотой-мишенью или с захваченным праймером для секвенирования. В случае пиросеквенирования, после захвата и денатурации дцДНК-мишени, добавляют праймер для секвенирования для гибридизации с оцДНК, или, в качестве альтернативы, оцДНК гибридизуют с захваченным праймером для секвенирования. В этом случае вращающаяся платформа может нагреваться для удаления любых третичных структур в оцДНК, а затем охлаждаться для гибридизации праймера для секвенирования с иммобилизованной мишенью.

Следует понимать, что нагревание камеры может добавить некоторую сложность устройству, так как при использовании относительно небольших объемов реагентов для закупорки камеры используют подходящие средства. В качестве альтернативы, можно применять слой масла для уменьшения испарения во время фазы нагревания. Другие подходящие средства хорошо известны специалисту в данной области техники. В качестве альтернативы, к захваченной оцДНК и праймеру для секвенирования можно добавлять реагент для денатурации, а затем добавляют буфер с более низким pH для снижения pH и отжига праймера для секвенирования с ДНК-мишенью. После завершения отжига, pH-буфер может быть удален в отходы при вращении.

Специалисту будут понятны множество преимуществ, которые настоящее изобретение, в различных вариантах осуществления, может обеспечить. Например, настоящее изобретение позволяет увеличить длину результата считывания, выраженную в числе оснований, по сравнению с устройствами и методами известного уровня техники. Вкратце, способы известного уровня техники подразумевают выполнение пиросеквенирования в микроцентрифужной пробирке объемом 0,2 мл (или аналогичной), и реагенты вносят с пробирку последовательно, чтобы детектировать последовательность ДНК, присутствующей в пробирке. Нуклеотиды последовательно вносят в реакционную смесь, которая содержит ДНК в реакционном буфере, все ферменты и субстрат (субстраты). Реакцию проводят в 96- или 24-луночном планшете. Планшеты нагревают (28°C) и встряхивают в ходе реакции. Таким образом, объем добавляемых нуклеотидов более или менее эквивалентен тому объему, который испаряется, что не приводит к разбавлению реакционной смеси, но приводит к накоплению побочных продуктов. Недостатком способов, относящихся к известному уровню техники, являются относительно короткие длины результатов считывания, что, скорее всего, связано с накоплением продуктов распада, например, образовавшихся в результате активности апиразы. Настоящее изобретение не имеет недостатков, известных исходя из уровня техники, поскольку иммобилизованная цепь нуклеиновой кислоты контактирует с нуклеотидом, остальные нуклеотиды, также как и все продукты реакции и побочные продукты, впоследствии практически удаляют из ячеек, как описано выше, а несущую поверхность также факультативно отмывают перед контактом со следующим нуклеотидным реагентом. Предполагается, что возможная длина результата считывания, выраженная в числе оснований, составляет более 300 или 400 оснований, а при улучшении химических процессов потенциально может составлять более 1000 оснований.

Дополнительные преимущества будут очевидны специалисту; однако для наглядности, настоящее изобретение представляет относительно более простое устройство, чем проточные ячейки известного уровня техники. Другие дополнительные преимущества касаются потенциально относительно более быстрого секвенирования, чем то, которое может быть обеспечено способами и устройствами известного уровня техники, и потенциально более низких объемов необходимых реагентов по сравнению с теми, которые применяют при известном уровне техники. Дополнительным ограничением некоторых способов известного уровня техники, и в частности способа проведения пиросеквенирования, является очень длительное время, необходимое для одного цикла реакции, т.е. добавления одного нуклеотида. В некоторых случаях, время, необходимое для одного цикла реакции, как правило, составляет приблизительно 60 секунд или даже больше, что основывается на продолжительности времени, необходимого для расщепления всех остальных нуклеотидов предыдущего цикла реакции. Следующий нуклеотид добавляют только после полного расщепления практически всех нуклеотидов, оставшихся после предыдущего цикла реакции. Следует понимать, что устройство, которое описывается в настоящем документе, позволяет удалять оставшиеся нуклеотиды на гораздо более высокой скорости (т.е. посредством этапов центрифугирования, этапов отмывания). Это приводит к гораздо более короткой продолжительности цикла для встраивания одного основания. Не желая ограничивать настоящее изобретение, следует понимать, что время цикла может быть уменьшено до примерно 15 секунд, что тем самым сокращает время его выполнения по меньшей мере приблизительно в четыре раза. Однако предполагается, что время цикла может быть снижено еще больше.

Настоящее изобретение также позволяет улучшить работу с жидкостями по сравнению с устройствами известного уровня техники. Также возможно, что настоящее изобретение может обеспечить более высокую чувствительность по сравнению с устройствами известного уровня техники, при условии, что высокоскоростной фотоэлектронный умножитель может использоваться вместо CCD-матрицы.

Пиросеквенирование представляет собой способ ДНК-секвенирования, который основывается на принципе «секвенирование путем синтеза», который основан на детектировании высвобождения пирофосфата при встраивании нуклеотидов, а не на обрыве цепи с применением дидезоксинуклеотидов. «Секвенирование путем синтеза» включает в себя секвенирование одной нити ДНК, а затем ферментативный синтез комплементарной ей цепи. Способы «секвенирования путем синтеза» основываются на детектировании активности ДНК-полимеразы (ДНК-синтезирующий фермент) путем детектирования побочного продукта реакции в реакции присоединения нуклеотидов, опосредованной ДНК-полимеразой (ДНК+xdNTP->ДНК+1+PPi или другой побочный продукт, зависящий от х. В качестве x может также выступать АТФ). В реакции пиросеквенирования PPi оценивают количественно с применением ферментного каскада, приводящего к генерированию света.

1. Сульфурилаза: APS+PPi->АТФ+SO4

2. Люцифераза: Люциферин+АТФ->Оксолюциферин+PPi+Свет

3. Апираза: расщепление оставшихся dNTP и АТФ

Кроме того, в данной области техники существует несколько видов реакций, которые можно применять для количественного определения побочных продуктов, таких как, например, применение PPDK (фосфоенолпируват дикиназа) которая трансформирует PPi+PEP+АМФ->Пируват+АТФ+Pi. Кроме того, побочные продукты могут детектироваться, например, по изменению pH или другим детектируемым изменениям параметров. Способы «секвенирования путем синтеза» могут в качестве альтернативы основываться на детектировании активности ДНК-лигазы, путем детектирования побочного продукта опосредованной ДНК-лигазой реакции добавления праймера. Подходящие способы хорошо известны специалисту в данной области техники.

По существу, способ позволяет проводить секвенирование одной цепи ДНК путем синтеза комплементарной ей цепи вдоль нее, с присоединением за один раз одной пары оснований, и детектированием того, какое основание фактически присоединилось на каждом этапе. Матричная ДНК или праймер для секвенирования иммобилизуют, и растворы нуклеотидов А, С, G и/или Τ последовательно добавляют и удаляют после реакции. Свет излучается только тогда, когда добавленный нуклеотид является комплементарным первому непарному основанию или основаниям матрицы. Последовательность добавленных нуклеотидов, которые производят детектируемые сигналы, например хемилюминесцентные сигналы, позволяет определить последовательность матрицы. Матричную оцДНК гибридизуют с праймером для секвенирования или наоборот и инкубируют с ферментами ДНК-полимеразой, а факультативно с АТФ-сульфурилазой, люциферазой и/или апиразой, и, в качестве примера, с субстратами аденозин-5′фосфосульфатом (APS) и люциферином. Другие каскады реакций, производящие детектируемый сигнал, хорошо известны специалисту в данной области техники.

В общих чертах, при пиросеквенировании выполняют следующие общие этапы:

1. Добавление одного из четырех дезоксинуклеотидтрифосфатов (dNTP) или их подходящих производных к матрице цепи нуклеиновой кислоты. ДНК-полимераза встраивает правильный, комплементарный dNTP или его производное в матрицу, которая высвобождает пирофосфат (PPi) согласно правилам стехиометрии.

2. АТФ-сульфурилаза количественно конвертирует PPi в АТФ. Эта АТФ запускает опосредованную люциферазой конвертацию люциферина в оксилюциферин, который генерирует видимый свет в количествах, пропорциональных количеству АТФ. Свет, произведенный в ходе реакции, катализируемой люциферазой, детектируют и анализируют.

3. Невстроившиеся нуклеотиды и АТФ впоследствии расщепляются под действием апиразы или других подходящих ферментов.

Несколько модификаций классического протокола пиросеквенирования хорошо известны в данной области техники и хорошо подходят для выполнения на устройстве в соответствии с настоящим изобретением. Поскольку свет, который производится на каждом отдельном этапе встраивания нуклеотида, пропорционален сумме встроившихся нуклеотидов, подходящее программное обеспечение позволяет преобразовать информацию о сгенерированном свете в определенную картину нуклеотидной последовательности. При классическом пиросеквенировании, картина светового излучения называется «пирограмма». Кроме того, указанное программное обеспечение предпочтительно позволяет проводить количественную оценку соотношений встроившихся в определенные положения нуклеотидов из смешанных популяций.

Настоящее изобретение предполагает способы секвенирования, которые включают этапы иммобилизации матричной нуклеиновой кислоты или целевой последовательности, которая должна быть секвенирована, или праймера для секвенирования и циклы поэтапного добавления нуклеотидов. Хотя настоящее изобретение было наглядно описано в отношении пиросеквенирования, следует понимать, что настоящее изобретение также может применяться для других химических процессов секвенирования нуклеиновых кислот, и в частности таких химических процессов, для которых целесообразно применение потока через внешнюю среду и твердую фазу. Настоящее изобретение может также избежать этапов, указанных выше, или по меньшей мере сделать их более удобными. Пиросеквенирование требует присутствия оцДНК-матрицы. Факультативно, несущая поверхность также служит для захвата дцДНК и денатурации указанной дцДНК с получением оцДНК, например, с праймером для секвенирования, прошедшим отжиг и готовым для пиросеквенирования, тем самым устраняя необходимость в выполнении отдельного этапа выделения.

В частности, специалисту в данной области техники будет понятно, что выражение "проточное ДНК-секвенирование" включает, например, способ иммобилизации нуклеиновой кислоты-матрицы или праймера для секвенирования, гибридизацию праймера с матрицей или наоборот и выполнение праймер-опосредованного синтеза поэтапным образом в присутствии нуклеотидов, где нуклеотиды включают, например, факультативно группу, ограничивающую рост цепи, такую как дидезокси-группа, и факультативно детектируемую метку (например, секвенирование по Сэнгеру). Дополнительный вариант осуществления способа секвенирования нуклеиновых кислот включает следующие этапы: встраивание меченного нуклеотида в растущую цепь праймера; идентификация встроившегося нуклеотида; и удаление группы, ограничивающей рост цепи и метки, чтобы подготовить растущую цепь к встраиванию следующего нуклеотида.

Специалисту в данной области техники также будет понятно, что выражение "проточное ДНК-секвенирование" включает, например, секвенирование нуклеиновых кислот лигированием. Следует понимать, что выражение "секвенирование нуклеиновых кислот лигированием" включает иммобилизацию нуклеиновой кислоты-матрицы или праймера для секвенирования, гибридизацию праймера с матрицей или наоборот, а затем последовательные раунды ДНК-лигирования, например, меченных нуклеотидов или коротких меченных зондов.

Специалисту в данной области техники также будет понятно, что настоящее изобретение предполагает любой способ ДНК-секвенирования, который включает этапы иммобилизации нуклеиновой кислоты и поэтапного добавления и детектирования нуклеотидов.

Способ настоящего изобретения может также включать факультативный этап отмывания или ферментативную обработку, которая может облегчить удаление остаточного или непрореагировавшего реагента.

В одном варианте осуществления этап последовательного приведения в контакт или количественного внесения включает одно из следующих действий:

а.) нуклеотиды А, затем Т, затем G, а затем С, после чего снова А и т.д.; или

b.) нуклеотиды A+T+G+C добавляют в виде смеси и смесь добавляют снова и т.д.

В другом варианте осуществления каждая указанная область поверхности контактирует последовательно с серией реагентов, включающей нуклеотиды А, Т, G и/или С. Этап последовательного приведения в контакт может включать одно из следующих действий:

a.) каждый нуклеотид или его аналог добавляют отдельно и последовательно в любом необходимом или заранее заданном порядке,

b.) нуклеотиды A+T+G+C или любую заранее заданную или необходимую подгруппу этих нуклеотидов добавляют в виде смеси и смесь добавляют снова и т.д.

Этап последовательного приведения в контакт а.) особенно целесообразен для методики пиросеквенирования, и этап последовательного приведения в контакт b.) особенно целесообразен, если используют меченные нуклеотиды, такие как флуоресцентно меченные нуклеотиды, где каждый нуклеотид метят отдельным красителем.

Следует понимать, что весь способ является повторяющимся в том, что последовательность нуклеотидов можно добавлять в любом заранее заданном порядке и/или любую заранее заданную комбинацию и последовательность повторяют достаточное количество раз, которое требуется для секвенирования нуклеиновой кислоты-матрицы. Например, А, Τ, G и С можно добавлять только в известный участок мутации. Преимуществом этого варианта осуществления является то, что эта процедура ускоряет детектирование известных мутаций, поскольку требуется добавление меньшего числа оснований.

Предпочтительно способ настоящего изобретения дополнительно включает этап анализа цепи нуклеиновой кислоты во время и/или после каждого из указанных этапов приведения в контакт. Анализ может представлять собой любой анализ, однако следует понимать, что в контексте пиросеквенирования этап анализа включает в каждой этап указанного анализа идентифицирование следующей пары оснований в цепи нуклеиновой кислоты путем сопоставления исходящего светового сигнала с числом нуклеотидов, выстроившихся в цепь нуклеиновой кислоты. Все соответствующие и подходящие технические меры для детектирования включения нуклеотида могут предприниматься специалистом в данной области техники. Например, подходящим детектором для детектирования света, излучаемого в результате реакции, является фотоэлектронный умножитель (PMT). Следует понимать, что по мере вращения вращающейся платформы образец проходит детектор, предпочтительно все образцы проходят детектор.

В предпочтительных вариантах осуществления, перед приведением дискретных областей в контакт с последующим реагентом, каждая указанная несущая поверхность проходит этап отмывания или промывки с реагентом для отмывания. Реагентом для отмывания может быть любой реагент, который подходит для вымывания остатков раствора после предыдущего этапа приведения в контакт, предпочтительно для вымывания практически всех остатков раствора после предыдущего этапа приведения в контакт. Однако в предпочтительных вариантах осуществления реагентом для отмывания является буфер, в котором проводят следующий этап реакции. Реагент для отмывания может также содержать средства, повышающие эффективность отмывания, такие как, в качестве примера, апираза, фосфатаза и т.д. Подходящий реагент для отмывания хорошо известен специалисту в данной области.

Как обсуждалось выше, этап денатурации может включать нагревание цепи нуклеиновой кислоты для осуществления денатурации, или воздействие на цепь нуклеиновой кислоты повышенным pH, или воздействие на цепь нуклеиновой кислоты подходящими ферментами или смеси ферментов.

В предпочтительных вариантах осуществления способ настоящего изобретения включает этап, на котором после денатурации цепи нуклеиновой кислоты комплементарную ей цепь удаляют на этапе промывки с применением реагента для промывки.

Устройство для количественного внесения указанной цепи нуклеиновой кислоты, для количественного внесения нуклеотидов А, Т, G и/или С и для количественного внесения реагента для отмывания может представлять собой любое устройство, однако предпочтительно устройство аналогично технологии типа струйной печати, приводят в движение пьезо-элементом или оно управляется вибрацией воздуха. Устройство также предпочтительно снабжают вакуумной системой отсоса для вытягивания отработанных реагентов, которые удаляют при вращении вращающейся платформы. Устройство также снабжают подходящими средствами детектирования для детектирования света, излучаемого в результате реакции пиросеквенирования. Специалисту известны подходящие детекторы, например, фотоэлектронный умножитель, который может быть установлен выше вращающейся платформы.

Устройство для денатурации и факультативного удаления любой комплементарной цепи нуклеиновой кислоты может включать устройство для нагревания платформы до температуры приблизительно 94°C, или дополнительно шприц-дозатор или перистальтический дозатор, которые количественно вносят нагретые реагенты или другие химические соединения, вызывающие денатурацию.

В альтернативной методике детектирования, один или несколько pH-метров для измерения pH в твердых веществах закрепляют под каждой ячейкой платформы. Платформа таким образом может использоваться многократно, поскольку магнитные гранулы можно применять в качестве носителя для связанной ДНК для детектирования последовательности, и ячейки можно отмывать, как описано выше, между каждыми двумя циклами секвенирования. После завершения секвенирования, гранулы можно высвобождать путем удаления магнита из-под платформы, и платформа может быть тщательно отмыта, а затем загружена новыми образцами для анализа. Заявитель предусматривает, что платформа также может быть одноразовой, так как стоимость ионоселективных полевых транзисторов (ISFET) (51), если они изготовлены под платформу, может быть достаточно низкой (то есть как стоимость полупроводниковых микросхем), чтобы утилизация ISFET-сенсорной платформы после использования была рентабельной.

Специалисту будет понятно, что когда полимераза присоединяет нуклеотид, происходит высвобождение Н+ иона, при котором меняется локальное значение pH, которое может детектироваться, например, pH-метрами для измерения pH в твердых веществах. В качестве примера, мы ссылаемся на патент США 2010/0151479 от DNA Electronics Ltd, который включен в настоящий документ посредством ссылки и который раскрывает сенсорное устройство, включающее ионоселективный полевой транзистор (ISFET), выполненный с возможностью генерировать электрический выходной сигнал в ответ на локализованные колебания ионного заряда на поверхности транзистора или вблизи нее. В этом примере измеряют колебания ионного заряда, а не абсолютные значения. Такой подход упрощает химические процессы, так как природные нуклеотиды можно добавлять последовательно, и при детектировании изменения pH происходит захватывание гранул, промывание ячейки, и добавляют нуклеотиды нового раунда.

Предпочтительно при применении системы детектирования с ISFET на платформе для многоразового использования будут применять магнитные гранулы для захвата оцДНК. В случае одноразовой ISFET-платформы для детектирования, поверхность затвора в ISFET может иметь покрытие для захвата оцДНК, или также можно применять магнитные гранулы.

В соответствии с дополнительным аспектом настоящее изобретение представляет применение ISFET-детектора с вращающейся платформой настоящего изобретения и использование отдельных съемных несущих поверхностей в каждой ячейке. Предпочтительно элементы для ISFET-детектирования формируют основу каждой ячейки.

Специалисту будет понятно, что настоящее изобретение включает раскрываемые в данном документе варианты осуществления и отличительные черты, а также все комбинации и/или взаимосвязи раскрываемых вариантов осуществления и отличительных черт.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

Ниже будут описаны предпочтительные варианты осуществления настоящего изобретения, только в качестве примера, со ссылкой на прилагающиеся графические материалы, в которых:

на фигуре 1А представлен вид сверху вращающейся платформы настоящего изобретения;

на фигуре 1В представлена боковая проекция вращающейся платформы, показанной на фигуре 1А;

на фигуре 1С представлен вид в разрезе по линии 1С-1С, показанной на фигуре 1В;

на фигуре 2А представлен вид в перспективе, а на фигуре 2В представлен разрез в перспективе варианта осуществления вращающейся платформы, изображенной на фигуре 1;

на фигуре 3 представлен вид в разрезе устройства с вращающейся платформой, изображенной на фигуре 1А;

на фигуре 4 изображено устройство для оптического детектирования, в котором используют фокусировочную оптику для мониторинга реакции;

на фигуре 5 изображено устройство для оптического детектирования в котором используют систему прямых изображений для мониторинга реакции;

на фигурах 6А-С изображены высоты пиков, полученных при пиросеквенировании для A) Streptavidin Mag Sepharose, В) MyOne Streptavidin C1 и С) Sera-Mag Magnetic SpeedBeads Neutravidin;

на фигуре 7 изображены пики, полученные при пиросеквенировании для гранул Streptavidin Mag Sepharose с применением более высокой частоты перемешивания;

на фигуре 8 изображен высокий пик, полученный после добавления фермента и смесей субстратов к ПЦР-ампликону, иммобилизованному на Sera-Mag Magnetic SpeedBeads Neutravidin, после отмывания при скорости центрифугирования 1500 об./мин;

на фигуре 9 изображен фазовый сдвиг и сигналы более широких пиков, обнаруженные при пиросеквенировании с применением ДНК-мишени, иммобилизованной на гранулах Dynabeads MyOne Streptavidin С1;

на фигуре 10 представлена фотография выпускающейся в реальности платформы, на которой показано, что магнитные гранулы загружены в ячейки 1-3;

на фигурах 11 и 12 представлены виды в перспективе платформы в соответствии с настоящим изобретением, оснащенной электродвигателем (50) для вращения платформы, и показано кольцеобразное расположенное по периферии магнитное кольцо (20) в первом положении, в котором на платформу воздействуют небольшие магнитные силы или магнитные силы не воздействуют;

на фигурах 13 и 14 представлены виды в разрезе, на которых изображено магнитное кольцо (20) в первом и втором положениях, соответственно; и

на фигуре 15 представлен другой вариант осуществления настоящего изобретения, и изображена платформа с ячейками, имеющими такую конфигурацию и расположение, чтобы при вращении гранулы попадали в полость, а жидкие отходы двигались под действием центробежной силы через фрит или аналогичный фильтр (60).

ОПРЕДЕЛЕНИЯ

В описании и формуле изобретения настоящего изобретения будет использоваться нижеследующая терминология в соответствии с определениями, изложенными ниже. Кроме того, следует понимать, что терминология, используемая в настоящем документе, используют только в целях описания конкретных вариантов осуществления настоящего изобретения и не претендует на внесение ограничений. Если не определено иначе, все технические и научные выражения, используемые в настоящем документе, имеют то же значение, которое обычно понимается обычным специалистам в той области техники, к которой относится настоящее изобретение.

Если контекст определенно не требует иного, то в описании и формуле изобретения слова «включать/содержать», «включающий/содержащий», и т.п. должны толковаться в смысле включающего значения, в отличие от исключающего или исчерпывающего значения; то есть, например, в смысле «включая, но без ограничений».

В дальнейшем, или если не указано иное, «%» будет означать «вес. %», «соотношение» будет означать «весовое соотношение» и «части» будут означать «весовые части».

Несмотря на то, что численные диапазоны и параметры, отражающие широкую сферу настоящего изобретения, являются приблизительными, числовые значения, приведенные в конкретных примерах, представлены как можно более точно. Любое численное значение, однако, по своей природе содержит определенные ошибки, неизбежно вытекающие из стандартных отклонений, обнаруженных при соответствующих тестовых измерениях.

Чтобы представить более лаконичное описание, некоторые количественные выражения, приведенные в данном документе, не имеют оговорки «приблизительно». Следует понимать, что вне зависимости от того, используется ли выражение «приблизительно» однозначно или нет, подразумевают, что каждое количество, указанное в данном документе, относится к фактическому данному значению и также относится к приближению к такой данной величине, которую обоснованно можно предполагать, согласно опыту в данной области техники, включая приближения, связанные с условиями эксперимента и/или измерения для такой данной величины.

Используемые в настоящем документе выражения «преимущественно» и «практически» означают содержание более чем 50% по весу, если не указано иное.

Перечисление численного диапазона с использованием конечных точек включает все числа, входящие в этот диапазон (например, от 1 до 5 включает 1; 1,5; 2; 2,75; 3; 3,80; 4; 5 и т.д.).

Выражения «предпочтительный» и «предпочтительно» относятся к вариантам осуществления настоящего изобретения, которые могут позволить определенные преимущества, при определенных обстоятельствах. Однако другие варианты осуществления также могут быть предпочтительными, в тех же или других обстоятельствах. Кроме того, перечисление одного или нескольких предпочтительных вариантов осуществления не означает, что другие варианты осуществления не являются полезными, и не претендует на исключение других вариантов осуществления из сферы настоящего изобретения.

Пронумерованный список пунктов не означает, что любой или все из этих пунктов являются взаимоисключающими. Пронумерованный список пунктов не означает, что любой или все из этих пунктов в совокупности являются исчерпывающими или что-либо другое, если явно не указано иное. Пронумерованный список пунктов не означает, что элементы расположены в каком-либо определенном порядке в соответствии с порядком, в котором они пронумерованы.

Используемое в настоящем документе выражение «партнер по связыванию» следует понимать как один из пары партнеров по связыванию, которая может быть любой парой лиганд/рецептор. Один из пары партнеров по связыванию называется «первым партнером по связыванию», а второй из пары партнеров по связыванию называется «вторым партнером по связыванию». Например, парами партнеров по связыванию могут быть стрептавидин/авидин и биотин. Пары партнеров по связыванию могут, например, включать стрептавидин и биотинилированную нуклеиновую кислоту.

Используемое в настоящем документе выражение «вращающийся» означает «приспособленный к вращению». Также следует понимать, что выражения «гранула», «частица» и «твердый носитель» используют взаимозаменяемо, как и выражения «платформа» и «диск».

ПРЕДПОЧТИТЕЛЬНЫЙ ВАРИАНТ ОСУЩЕСТВЛЕНИЯ НАСТОЯЩЕГО ИЗОБРЕТЕНИЯ

Многочисленные варианты осуществления описаны в этой заявке на патент и представлены только для наглядности. Описанные варианты осуществления не являются ограничивающими в каком-либо смысле. Настоящее изобретение широко применимо к многочисленным вариантам осуществления, что очевидно из данного описания. Эти варианты осуществления описаны достаточно подробно, чтобы позволить специалистам в данной области техники применить настоящее изобретение на практике, и следует понимать, что можно использовать другие варианты осуществления, и что другие изменения можно вносить без отклонения от сферы настоящего изобретения. Соответственно, специалистам в данной области техники будет понятно, что настоящее изобретение можно применять на практике с различными модификациями и изменениями. Ниже будут приводиться ссылки на графические материалы, где одинаковые номера ссылок относятся к одинаковым частям во всех графических материалах.

Предпочтительный вариант осуществления настоящего изобретения будет описан ниже со ссылкой на пиросеквенирование. Описание предпочтительного варианта осуществления со ссылкой на пиросеквенирование не должно рассматриваться как ограничивающее настоящее изобретение видами анализа, включающими пиросеквенирование.

Ссылаясь на фигуру 1, предлагают вращающуюся платформу (или диск) в форме поликарбонатного диска 1, которая состоит из двух или более ячеек 2, предназначенных для содержания по меньшей мере одной несущей поверхности в виде гранулы для избирательного удерживания цепи нуклеиновой кислоты для проведения секвенирования нуклеиновой кислоты. Ячейки 2 имеют диаметр предпочтительно приблизительно 2-3 мм, и расположены по окружности диска 1 через равномерные интервалы. Например, диск 1, с диаметром 120 мм, имеет окружность 377 мм, и за счет формирования дискретных областей 2 диаметром 3 мм, расположенных на расстоянии 6 мм друг от друга (расстояние между центрами дискретных областей/целевыми участками 2), при радиусе 55 мм от центра диска 1 приводит к получению приблизительно 57 ячеек по всей периферии диска 1. Однако число ячеек может быть меньшим или большим, если используют больший диск 1 или меньшие дискретные области, например, диаметром 0,5 мм с расстоянием между ними, например, 1 мм, или любая комбинация таких условий. Предпочтительно ячейки 2 являются неглубокими ячейками, которые содержат объем приблизительно от 0,5 до 100 мкл.

Другой вариант осуществления можно видеть на фигуре 2, на которой одинаковым позициям присвоены одинаковые номера. В этом примере, вращающиеся платформы имеют диаметр 120 мм и содержат 50 ячеек, равномерно расположенных по периферии. Ячейки имеют диаметр приблизительно 3 мм и могут быть изготовлены из материалов, включающих поликарбонат, прозрачный полистирол и белый ударопрочный полистирол (HIPS). Толщина платформы обычно составляет от 1 мм до 5 мм, а глубина ячеек приблизительно 4 мм.

Предпочтительно применяемым способом секвенирования является пиросеквенирование. Однако следует понимать, что также можно использовать другие способы секвенирования цепи нуклеиновой кислоты, которые обсуждались ранее. Предпочтительно ячейки 2 содержат несущие поверхности, приспособленные для избирательной иммобилизации цепи нуклеиновой кислоты. Например, цепь нуклеиновой кислоты может быть биотинилированной, и несущие поверхности могут содержать стрептавидин для связывания с ними биотинилированной цепи нуклеиновой кислоты. Однако следует понимать, что существуют другие химические соединения для иммобилизации цепи нуклеиновой кислоты на несущих поверхностях.

В соответствии со способом настоящего изобретения для проведения секвенирования цепи нуклеиновой кислоты, предлагается вращающаяся платформа 1, и цепь нуклеиновой кислоты иммобилизуют на несущих поверхностях, которые содержатся в ячейках 2. Любую комплементарная цепь нуклеиновой кислоты затем подвергают денатурации и удаляют, например, путем нагревания платформы 1 и, следовательно, несущих поверхностей до приблизительно/примерно 94°C. Несущие поверхности затем приводят в контакт последовательно с нуклеотидами А, Т, G и С путем количественного внесения подходящего реагента в ячейку 2, где после каждого этапа приведения в контакт платформа 1 вращается, чтобы в достаточной мере удалить центрифугированием любой остаточный или непрореагировавший нуклеотид из ячейки 2.

Способ настоящего изобретения дополнительно включает этап анализа цепи нуклеиновой кислоты во время и/или после каждого из указанных этапов приведения в контакт. Этап анализа включает детектирование следующей пары оснований в цепи нуклеиновой кислоты путем сопоставления исходящего светового сигнала, получаемого в результате встраивания нуклеотида, с числом нуклеотидов, связавшихся с цепью нуклеиновой кислоты. Подходящим детектором для детектирования света, получаемого в результате реакции, является фотоэлектронный умножитель. Следует понимать, что по мере того как вращающаяся платформа 1 вращается, все образцы проходят детектор. Если ни один нуклеотид не встроился, то световой сигнал не будет получен, и реакционная смесь будет удалена при вращении (или в каждом цикле, или через каждые 10-50 циклов (например), но менее чем через каждые 80 циклов) за счет центробежной силы, и следующий раунд начинают со следующим нуклеотидом.

В предпочтительных вариантах осуществления, перед приведением ячейки 2 в контакт с последующим нуклеотидом каждая несущая поверхность 2 проходит этап отмывания или промывки с реагентом для отмывания. Реагентом для отмывания может быть любой реагент, который может в достаточной мере вымыть любые остатки раствора после предыдущего этапа приведения в контакт, и предпочтительно является буфером для ПЦР.

Предпочтительно вращающаяся платформа 1 вращается при низкой скорости при количественном внесении реагентов-нуклеотидов и фермента, например, при скорости приблизительно от 10 до 200 об./мин, и платформа 1 вращается с высокой скоростью при количественном внесении реагента для отмывания, при скорости приблизительно от 400 до 4000 об./мин.

Ссылаясь на фигуру 3, настоящее изобретение также предлагает устройство для применения с вращающейся платформой 1 для секвенирования цепи нуклеиновой кислоты. Устройство включает электродвигатель 50 для вращения платформы 1 при предустановленной контролируемой скорости вращения по выбору пользователя, такой как электродвигатель, способный обеспечивать скорости вращения приблизительно от 10 до 4000 об./мин. Устройство также предлагается для количественного внесения цепи нуклеиновой кислоты в ячейки 2 для иммобилизации цепи нуклеиновой кислоты на несущих поверхностях. Такое устройство может быть создано по технологии, подобной струйной печати или быть в форме подходящего дозатора 7, такого как шприцевой насос. Также предлагается устройство для количественного внесения нуклеотидов А, Т, G и С для приведения в контакт с несущими поверхностями и для количественного внесения реагента для отмывания. И снова, такое устройство может быть создано по технологии, подобной струйной печати. Устройство также предлагается для денатурации и удаления любой комплементарной цепи нуклеиновой кислоты, и такое устройство может быть представлено в форме а нагревательной спирали (не показано на данной фигуре), расположенной внутри корпуса 4.

Также предлагается подходящий детектор 8 для детектирования света, излучаемого в результате реакции пиросеквенирования. Специалисту известны подходящие детекторы, например, фотоэлектронный умножитель, который может быть установлен выше вращающейся платформы 1. Особое внимание необходимо уделить фигурам 4 и 5, на которых показаны различные варианты осуществления детекторов фотоэлектронного умножителя для использования по настоящему изобретению. В одной оптической конфигурации используют фокусирующую оптику (фиг. 4), а во второй используют прямое изображение (фиг. 5). На фигуре 4 подробно изображена фокусирующая линза 10, диафрагма 11, светочувствительная поверхность 12, фотоэлектронный умножитель 13 и электронное устройство для детектирования 14. На фигуре 5 подробно изображена диафрагма 15, светочувствительная поверхность 16, детектор фотоэлектронного умножителя 17 и электронное устройство для детектирования 18.

Вращающаяся платформа 1 может вращаться при низкой скорости, чтобы количественно внести смесь фермента и нуклеотида (нуклеотидов) (т.е. при 200 об./мин или менее), где центробежная сила является достаточно малой для того, чтобы избежать перемещения смеси из ячеек 2 и обеспечить протекание реакции и завершение оптического детектирования. Реагенты для отмывания можно добавлять при высокой скорости вращения ротора, (т.е. 400+ об./мин), таким образом, чтобы при отмывании все реагенты из ячеек 2 были удалены и чтобы в достаточной мере избежать загрязнения между ячейками 2.

ПРИМЕРЫ

Пиросеквенирование с применением магнитных гранул

Применение пиросеквенирования для определения нуклеотидной последовательности ДНК-мишени требует иммобилизации ДНК-мишени на твердом носителе. Простое описание протокола пиросеквенирования приведено ниже:

1) иммобилизация биотинилированной двухцепочечной ДНК на твердом носителе;

2) отделение небиотинилированной цепи путем химической денатурации;

3) удаление небиотинилированной цепи путем отмывания;

4) отжиг олигонуклеотидного праймера для облегчения начала процесса секвенирования;

5) добавление смесей ферментов и субстратов для обеспечения возможности пиросеквенирования;

6) количественное внесение первого дезоксирибонуклеотида (dNTP), который встраивается в целевую молекулу ДНК с помощью ДНК-полимеразы (при условии комплементарности обоих нуклеотидов);

7) после встраивания комплементарного основания высвобождается молекула пирофосфата, что преобразовывается в световой сигнал посредством каскада ферментативных реакций. Интенсивность сигнала используют для определения присутствия одного или нескольких нуклеотидов в ряду;

8) избыточные, невстроившиеся dNTP подвергают расщеплению, чтобы обеспечить, что они не встроятся во время следующей части реакции секвенирования. Это обеспечивает то, что последовательность остается синхронизованной среди всех матриц-мишеней;

9) продолжение реакции секвенирования путем добавления следующего комплементарного основания.

Иммобилизация биотинилированной ДНК, которую используют в реакции пиросеквенирования, может быть достигнута с применением магнитных гранулярных частиц 55, покрытых стрептавидином или нейтравидином. Магнитные частицы 55 обеспечивают большую площадь и обеспечивают мобильность в пределах реакционного раствора, увеличивая связывающую способность и вероятность определения локализации биотинилированной ДНК-мишени.

B данном примере, иммобилизация ДНК-матрицы достигалась путем смешивания магнитных гранулярных частиц 55 с биотинилированной ДНК-мишенью вместе со связывающим буфером в ячейке 2 платформы/диска 1 в течение определенного периода времени (например, 10 мин). После периода иммобилизации несвязанную матрицу и супернатант, содержащий различные другие реагенты, которые являются нежелательными в реакции пиросеквенирования, удаляли при помощи центрифугирования. Перед центрифугированием магнитное кольцо 20 приводили в контакт с платформой, иммобилизуя магнитные частицы на дне ячейки. Магнитное кольцо опускали до высоты менее 1 мм ниже поверхности платформы с обеспечением достаточного магнитного поля для того, чтобы удержать магнитные гранулярные частицы внутри ячейки, позволяя при этом платформе вращаться и центрифугировать супернатант при скоростях, превышающих 2000 об./мин. Этап отмывки с использованием буфера, содержащего моющее средство, применяли, чтобы обеспечить достаточное удаление супернатанта. Те же этапы центрифугирования применяли, чтобы удалить буфер для отмывки.

Денатурация небиотинилированной цепи ДНК достигалась с помощью денатурирующего средства гидроксида натрия, который применяли в течение не более 20 секунд. Денатурирующее средство удаляли центрифугированием и для максимального удаления применяли буфер для отмывки. Снова применяли магнитное кольцо, чтобы обеспечить центрифугирование супернатанта с удержанием при этом магнитных гранулярных частиц внутри ячеек.

Чтобы облегчить осуществление реакции пиросеквенирования, добавляли праймер для секвенирования и гибридизировали его с ДНК-мишенью посредством процесса отжига с нагреванием образца до температуры более 80°C и охлаждением до температуры менее 30°C.

После завершения процесса отжига, смесь ферментов для пиросеквенирования количественно вносили в ячейки вместе со смесью субстратов, содержащей APS и люциферин. Магнитные гранулярные частицы подвергали вибрации в реакционном растворе, чтобы обеспечить, что реакция произошла случайным образом. Вкратце, платформа вибрировала в достаточной мере для того, чтобы гранулы перемешались, и таким образом раствор и гранулярные частицы хорошо смешались между собой.

Наконец, последовательность определяли путем количественного внесения небольшого количества dNTP в реакционную смесь и измерения светового сигнала, если в данной точке в последовательности присутствовало комплементарное основание. Для обеспечения расщепления избытка несвязанного dNTP под действием апиразы отводили период 1 мин. Последовательность определяли путем количественного внесения любого из dNTP. При вращении платформы во время реакции она также вибрирует, чтобы обеспечить, что магнитные гранулы находятся в постоянном движении, и дополнительно предотвратить их агрегацию или слипание.

Магнитные гранулярные частицы

Были оценены характеристики различных типов магнитных гранулярных частиц.

- Dynabeads MyOne Streptavidin C1 (Invitrogen): суперпарамагнитные гранулы диаметром 1 мкм с монослоем стрептавидина, ковалентно связанного с гидрофильной поверхностью гранулы;

- Sera-Mag Magnetic Speedbeads (Thermo Scientific): 1 мкм магнитные карбоксилат-модифицированные базовые частицы, изготовленные с применением процесса по принципу ядро-оболочка, покрытые ковалентно связанным нейтравидином;

- Streptavidin Mag Sepharose (GE Life Sciences): стрептавидин, связанный с магнетит-содержащими сефарозными гранулами.

Магнитные гранулярные частицы оценивали по следующим параметрам:

1) способность к иммобилизации биотинилированной ДНК-мишени;

2) удержание внутри ячейки во время процесса центрифугирования;

3) избегание неспецифического связывания белка в ходе реакции пиросеквенирования.

Результаты

Иммобилизация

Было установлено, что все три типа гранул были способны к иммобилизации биотинилированной ДНК. Самые большие высоты пиков сигналов пиросеквенирования наблюдались для Sera-Mag Magnetic Speedbeads Neutravidin, за чем следовали Dynabeads MyOne Streptavidin C1, а затем Streptavidin Mag Sepharose (см. фигуры 6A-С). Сигнал для гранул Streptavidin Mag Sepharose был значительно ниже по сравнению с таковым других двух типов гранул. Были обнаружены две причины, первая заключалась в том, что в связи с размером и весом гранул они не смешивались настолько же хорошо при стандартных условиях вибрации; вторая заключалась в том, что темный цвет гранул ослаблял световой сигнал путем поглощения. В первом случае решением было использование более высокой частоты вибрации. В самом деле, более высокие частоты вибрации обеспечивали лучшее перемешивание и, следовательно, более высокие пики сигнала (см. фиг. 7).

Центрифугирование

Было установлено, что в целях достижения оптимального удаления нежелательных молекул в реакции от иммобилизованной ДНК скорость вращения при центрифугировании должна была составлять более 2000 об./мин. Результаты, полученные при применении ДНК, выделенной в результате полимеразной цепной реакции, при отмывании центрифугированием со скоростью 1500 об./мин продемонстрировали высокий пик при добавлении смеси ферментов и субстратов (см. фиг. 8). Полученные пики секвенирования были значительно более слабыми. Причиной высокого пика при добавлении ферментов и субстратов могло являться недостаточное удаление компонентов ПЦР на этапах отмывания, следующих за иммобилизацией ДНК на магнитных гранулярных частицах. Остаточные dNTP после ПЦР должны были все встроиться после добавления смеси ферментов и субстратов, мгновенно завершив последовательность, тем самым обеспечив единственный высокий пик с последующим ослаблением оставшейся реакции секвенирования в связи с небольшим количеством оставшейся матрицы, в которой не произошло встраивания. Данные показали, что для достижения полного удаления супернатанта были необходимы скорости вращения более 2000 об./мин.

Применение скоростей центрифугирования более 2000 об./мин приводило к тому, что все гранулы, кроме сефарозных гранул Streptavidin Mag, вытеснялись из ячеек. Благодаря большему размеру эти гранулы оставались внутри ячеек при скоростях более 2000 об./мин.

Неспецифическое связывание

С учетом состава внешней оболочки некоторых гранул неспецифическое связывание ферментов, используемых в реакции пиросеквенирования, может оказывать неблагоприятное воздействие на получаемые пики и последовательность. Одной из характерных черт этого явления является расширение пиков. Это связано со снижением содержания фермента апиразы, которая расщепляет избыточные несвязанные нуклеотиды. Снижение количеств апиразы также приводит к несинхронному встраиванию избыточных нуклеотидов, вызывая фазовый сдвиг последовательности. Полученная последовательность, таким образом, становится непонятной, поскольку наблюдаются пики для таких вводов нуклеотидов, для которых не ожидалось никакого сигнала.

Такие сложности наблюдались для гранул Dynabeads MyOne Streptavidin C1 (см. фиг. 9). На самом деле, как ширина пиков, так и высота неспецифических пиков были самыми большими по сравнению с таковыми других двух гранул. Менее всего такая проблема наблюдалась для гранулярных частиц Streptavidin Mag Sepharose. Не желая привязываться к теории, полагают, что сефарозая оболочка является инертной и таким образом избегает неспецифического связывания. И наоборот, поверхность гранулярных частиц Dynabeads MyOne Streptavidin С1 имеет заряд, который притягивает противоположно заряженную апиразу, тем самым связывая ее с гранулой. Связанная апираза не может больше использоваться для расщепления избыточных нуклеотидов, вызывая фазовый сдвиг в последовательности.

Вывод

Основываясь на наблюдениях в отношении различных типов гранул, был сделан вывод о том, что оптимальными гранулами для использования были гранулы Streptavidin Mag Sepharose, однако следует понимать, что другие гранулы также пригодны для способа по настоящему изобретению. Магнитные частицы были способны к иммобилизации ДНК-мишени с отмыванием центрифугированием, производимом при определенных скоростях для получения более чистых матриц для секвенирования. Инертная наружная оболочка также означала исключение проблемы неспецифического связывания ферментов пиросеквенирования, которая бы могла повлиять на эффективность секвенирования в связи с несинхронным встраиванием dNTP.

На фигурах 6А-С показаны высоты пиков пиросеквенирования для А) Streptavidin Mag Sepharose, В) MyOne Streptavidin C1 и С) Sera-Mag Magnetic Speedbeads Neutravidin. Один пикомоль ДНК-матрицы добавляли к 10 мкл раствора связывающего буфера и инкубировали в течение 10 мин. Иммобилизованные гранулы отмывали в буферном растворе до и после денатурации с помощью NaOH. Праймер для секвенирования добавляли в концентрации 400 нМ и отжигали нагреванием до 80°C в течение 60 секунд, а затем охлаждали до 30°C.Добавляли фермент и субстрат и реакцию пиросеквенирования проводили de novo, используя 15 циклов dATP, dCTP, dGTP и dTTP. Самые высокие пики наблюдались для Sera-Mag Magnetic Speedbeads Neutravidin.

На фигуре 7 показаны пики пиросеквенирования, полученные для гранул Streptavidin Mag Sepharose с применением высокой частоты перемешивания. Пики сигналов увеличивались от средней высоты одного пика 5 до более 40 единиц. Однако в связи с ослаблением сигнала из-за более темного цвета магнитных гранулярных частиц высоты пиков не превышали тех, которые наблюдались для двух других типов гранул.

На фигуре 8 показан высокий пик, полученный после добавления смесей ферментов и субстратов к ПЦР-ампликону, иммобилизованному на гранулах Sera-Mag Magnetic Speedbeads Neutravidin, отмытых при скорости центрифугирования 1500 об./мин. Последующие пики, полученные в результате реакции секвенирования после добавления смеси ферментов и субстратов, были значительно слабее. Те же гранулы не оставались внутри ячейки после центрифугирования со скоростью более 2000 об./мин.

На фигуре 9 показа фазовый сдвиг и более широкие сигналы пиков, наблюдаемые при пиросеквенировании с применением ДНК-мишени, иммобилизованной на гранулах Dynabeads MyOne Streptavidin C1. Фигура 25 представляет собой фотографию производимой в настоящее время платформы, на которой показаны магнитные гранулы, загруженные в ячейки 1-3. На фигурах 26 и 27 показаны виды в перспективе платформы в соответствии с настоящим изобретением, оснащенной электродвигателем для вращения платформы, и показано круглое расположенное по периферии магнитное кольцо в первом положении, в котором на платформу воздействуют небольшие магнитные силы или магнитные силы не воздействуют. На фигурах 28 и 29 представлены виды сбоку в разрезе, показывающие магнитное кольцо в первом и втором положениях, соответственно. Во втором положении кольцо расположено достаточно близко к платформе для того, чтобы оказывать магнитное воздействие на любые магнитные гранулы, содержащиеся в ячейках.

На фигуре 15 представлен другой вариант осуществления настоящего изобретения и показана платформа с ячейками, имеющими такую конфигурацию и расположение, что при вращении гранулы попадают в полость, а жидкие отходы проходят под действием центробежной силы через фрит или аналогичный фильтр.

Как рассматривалось выше, определение последовательности ДНК может быть достигнуто с применением системы пиросеквенирования (см. Agah Α., Aghajan M., Mashayekhi F., Amini S., Davis R., Plummer J.D., Ronaghi M., Griffin P.B., A multi-enzyme model for pyrosequencing, Nucleic Acids Res., 2004; 32: e166). Секвенирование достигается путем детектирования пирофосфата, высвобождающегося после встраивания комплементарного три-штрих-дезоксирибонуклеозид-пять-штрих-трифосфата (dNTP) в одноцепочечную матрицу с участием фермента ДНК-полимеразы. Изначально пирофосфат должен быть преобразован в аденозинтрифосфат (АТФ) под действием фермента сульфурилазы. Именно в реакции АТФ с люциферином посредством фермента люциферазы генерируется световой сигнал, который указывает на встраивание нуклеотида и, следовательно, на последовательность в цепи матрицы. Чтобы обеспечить встраивание и детектирование следующего нуклеотида без вмешательства ранее добавленного нуклеотида, применяют фермент апиразу. Апираза расщепляет избыточный нуклеотид перед добавлением следующего нуклеотида.

В процессе пиросеквенирования происходит накопление побочных продуктов, таких как нуклеотид сульфатов и дифосфатов. Эти побочные продукты подавляют ферменты, что приводит к снижению качества сигнала во время длительного цикла определения последовательности. Например, ингибирование апиразы приводит к уменьшению удаления невстроившихся нуклеотидов, что ведет к несинхронизированному встраиванию оснований и, таким образом, к плохому детектированию сигнала. В результате длина секвенируемой последовательности с применением системы пиросеквенирования в настоящее время ограничивается не более чем 60 нуклеотидами (см. Mashayekhi F., Ronaghi M., Analysis of read-length limiting factors in pyrosequencing chemistry, Anal. Biochem., 2007; 363: 275-287).

Поэтому в целях снижения последствий ингибирования побочными продуктами и для увеличения длины результата считывания настоящее изобретение обеспечивает возможность вымывания компонентов реакции после ряда воздействий нуклеотидов, что позволяет добавлять свежий реагент для продолжения на следующем отрезке последовательности, обеспечивая при этом сохранение связи матрицы с носителем.

Принимая во внимание тот факт, что настоящее изобретение проиллюстрировано и описано со ссылкой на варианты осуществления, которые, как предполагается, являющиеся в настоящее время лучшими способами или способами осуществления такого изобретения на практике, следует понимать, что для адаптации настоящего изобретения к различным вариантам осуществления могут быть внесены различные изменения без отступления от более широких концепций изобретения, раскрытых в настоящем документе и охватываемых нижеприведенной формулой изобретения.

1. Способ пиросеквенирования полинуклеотидной молекулы, при этом указанный способ включает этапы:
обеспечения вращающейся платформы, имеющей по меньшей мере одну открытую ячейку, предназначенную для содержания по меньшей мере одной несущей поверхности, причем указанная ячейка имеет такие форму или размеры, чтобы реагент, находящийся в ней, можно было удалить центрифугированием из указанной открытой ячейки и из указанной платформы при достаточном вращении указанной платформы;
обеспечения по меньшей мере одной указанной несущей поверхности в форме магнитной частицы в каждой указанной открытой ячейке, где указанная несущая поверхность приспособлена для иммобилизации полинуклеотидной молекулы или на которой полинуклеотидная молекула была иммобилизирована;
возможно, иммобилизации полинуклеотидной молекулы на указанной магнитной частице;
отжига олигонуклеотидного праймера с отдельной цепью указанной полинуклеотидной молекулы;
количественного внесения в каждую указанную открытую ячейку из точки, расположенной за пределами указанной платформы, серии реагентов для пиросеквенирования, при этом после одного или нескольких указанных этапов количественного внесения указанную платформу вращают со скоростью, достаточной для того, чтобы любой остаточный или непрореагировавший указанный реагент был практически удален центрифугированием из каждой указанной открытой ячейки и из указанной платформы,
при этом во время вращения каждую указанную магнитную частицу удерживают в указанной открытой ячейке за счет сил магнитного взаимодействия;
анализа на присутствие пирофосфатной группы в каждой указанной ячейке; и повторения указанных этапов количественного внесения и анализа, таким образом секвенируя указанную полинуклеотидную молекулу.

2. Способ по п. 1, дополнительно включающий этап расположения магнита достаточно близко к указанной платформе для удержания за счет сил магнитного взаимодействия указанной магнитной частицы(частиц) в указанных открытых ячейках во время вращения указанной платформы.

3. Способ по п. 2, отличающийся тем, что указанный магнит представлен в форме пластины или кольца.

4. Способ по п. 3, отличающийся тем, что указанные магнитная пластина или магнитное кольцо дополнительно приспособлены для нагрева указанной ячейки(ячеек) до приблизительно 150°C с нагреванием, таким образом, указанной магнитной частицы(частиц).

5. Способ по п. 1, дополнительно включающий этап приведения в действие электромагнита для удержания за счет сил магнитного взаимодействия указанной магнитной частицы(частиц) в указанной ячейке во время вращения указанной платформы.

6. Способ по п. 1, отличающийся тем, что указанная платформа является практически круглой и приблизительно от 2 до 500 открытых ячеек расположены по периферии указанной круглой платформы.

7. Способ по п. 6, отличающийся тем, что диаметр указанной платформы составляет приблизительно от 50 до 500 мм, а толщина указанной платформы составляет приблизительно от 1 до 6 мм.

8. Способ по п. 6, отличающийся тем, что указанные открытые ячейки содержат объем, составляющий от приблизительно 0,5 до 100 мкл, или глубина ячейки составляет приблизительно от 0,5 до 5 мм, или размеры указанных открытых ячеек таковы, что ячейки могут содержать от приблизительно 1 до приблизительно 50 магнитных частиц.

9. Способ по п. 1, отличающийся тем, что указанная платформа изготовлена из пластикового материала, который выбран из группы, состоящей из поликарбоната, полистирола, ударопрочного полистирола, полиэтилена и полипропилена, или изготовлена из стекла или кварца.

10. Способ по п. 1, отличающийся тем, что полинуклеотидная молекула адсорбирована на каждой указанной магнитной частице за счет химических свойств или связана с ней за счет ковалентных, или ионных, или водородных связей, или ван-дер-ваальсовы силы иммобилизуют указанную полинуклеотидную молекулу на каждой указанной магнитной частице.

11. Способ по п. 1, отличающийся тем, что указанные реагенты для пиросеквенирования выбраны из группы, состоящей из одного или нескольких ферментов, субстратов, нуклеотидов А, Т, G и/или С или соответствующих подходящих аналогов нуклеотидов, реагентов для отмывания и реагентов для промывки.

12. Способ по п. 1, отличающийся тем, что этап вращения вращающейся платформы осуществляют со скоростью от приблизительно 400 до 1000 об./мин, чтобы практически удалить центрифугированием указанный реагент из указанных ячеек, и дополнительно включающий этап вращения вращающейся платформы со скоростью от приблизительно 10 до 200 об./мин во время количественного внесения указанного реагента.

13. Способ по п. 1, дополнительно включающий этап вибрации платформы для тщательного смешивания указанного реагента и указанной магнитной частицы(частиц).

14. Способ по п. 1, отличающийся тем, что указанная полинуклеотидная молекула представляет собой ДНК или РНК или их модифицированную форму.

15. Способ по п. 1, отличающийся тем, что указанная полинуклеотидная молекула является биотинилированной и указанная магнитная частица(частицы) содержит авидин, или стрептавидин, или аналог для связывания с биотинилированной полинуклеотидной молекулой.

16. Способ по п. 1, отличающийся тем, что указанное количественное внесение серии реагентов для пиросеквенирования включает любое из:
a) добавления каждого нуклеотида или его аналога отдельно и последовательно в любом необходимом или заранее заданном порядке или
b) добавления нуклеотидов A+T+G+C или любой заранее заданной или необходимой подгруппы этих нуклеотидов в виде смеси и факультативно повторения добавления один или несколько раз.

17. Способ по п. 1, отличающийся тем, что указанный анализ на присутствие пирофосфатной группы в каждой указанной открытой ячейке включает детектирование светового сигнала в каждой указанной открытой ячейке.

18. Способ по п. 1, отличающийся тем, что полинуклеотидная молекула является двухцепочечной полинуклеотидной молекулой и способ дополнительно включает денатурацию двухцепочечной полинуклеотидной молекулы перед отжигом.

19. Способ по п. 18, отличающийся тем, что указанная денатурация включает нагревание указанной двухцепочечной полинуклеотидной молекулы для осуществления денатурации или воздействие на указанную двухцепочечную полинуклеотидную молекулу повышенным рН.

20. Способ по п. 1, дополнительно включающий этап отмывания указанной открытой ячейки(ячеек) реагентом для отмывания и факультативно ферментативную обработку.

21. Способ по п. 20, отличающийся тем, что указанный этап отмывания происходит после одного или нескольких этапов количественного внесения.

22. Способ по п. 11, отличающийся тем, что указанные ферменты включают один или несколько из ДНК-полимеразы, АТФ-сульфурилазы, люциферазы и апиразы.

23. Способ по п. 11, отличающийся тем, что указанные субстраты включают аденозин-5′-фосфосульфат (APS) и/или люциферин.



 

Похожие патенты:
Изобретение относится к биохимии. Описан набор синтетических олигонуклеотидов для выявления маркерных участков генов бактерий кишечника человека, ассоциированных с развитием воспалительных заболеваний кишечника (болезни Крона и неспецифического язвенного колита) методом полимеразной цепной реакции в режиме реального времени.

Изобретение относится к биохимии. Описаны способы количественного определения специфического продукта в реакции амплификации с внесением одноцепочечных разрывов и достройкой и способ контроля в режиме реального времени реакции амплификации с внесением одноцепочечных разрывов и достройкой.

Изобретения относятся к области генетики, молекулярной биологии и медицины и касаются способа для анализа генетического полиморфизма в локусах ДНК ApoE, ApoJ и GAB2 и набора олигонуклеотидных праймеров и зондов.

Изобретение относится к области биотехнологии. В изобретении описан способ идентификации пар фрагментов ДНК или РНК, исходно присутствующих в одних и тех же живых или фиксированных клетках, в частности, способ идентификации нативных пар генов легких и тяжелых цепей антител, а также нативных пар генов альфа- и бета-цепей Т-клеточных рецепторов (ТКР).
Изобретение относится к области медицины и предназначено для диагностики предрасположенности к посттравматическому остеоартрозу коленного сустава. У пациентов существляют генотипирование полиморфизма rs2276109 (A-82G) гена ММР-12.

Изобретение относится к области медицины и предназначено для определения риска развития артериальной гипертензии. Осуществляют забор венозной крови, выделение генетического материала, проведение полимеразной цепной реакции (ПЦР) в режиме реального времени и определение инсерции/делеции (I- и D-аллели) Alu-фрагмента гена ангиотензинпревращающего фермента.

Изобретение относится к области медицины и предназначено для определения степени гетероплазмии мутаций митохондриального генома. Проводят полимеразную цепную реакцию в режиме реального времени, вычисляют значение ΔCt, определяют коэффициент эффективности амплификации и рассчитывают степень гетероплазмии мутаций митохондриального генома по формуле.

Изобретение относится к области медицины, в частности к медицинской генетике и онкогинекологии, и предназначено для прогнозирования риска развития рака яичников.

Изобретение относится к биохимии. Предоставлена композиция для осуществления реакции замещения цепей нуклеиновых кислот, содержащая первый и второй комплексы нуклеиновых кислот, каждый из которых содержит первую, вторую, третью и четвертую цепи нуклеиновых кислот, где каждая из цепей содержит последовательно первый, второй и третий фрагменты.

Изобретение относится к области биотехнологии. Описаны способ и система для определения того, существует ли аномалия генома.

Группа изобретений относится к области биотехнологии. Способ одновременной генодиагностики двух мутантных аллелей, вызывающих CVM и BLAD у крупного рогатого скота, включает выделение ДНК из биологического материала, постановку полимеразной цепной реакции в режиме реального времени с использованием реакционной смеси (тест-системы) с CVM/BLAD, содержащей 50 мМKСl, 50 mMTRIS-HCl, 250 нMdNTP, 2,5 мMMgCl2, праймеры - в концентрации 200 нМ, аллель-специфические зонды - в концентрации 100 Нм, имеющие следующие последовательности: CVM_up - gattctcaagagcttaattctaagga, CVM_low - aagtaaaccccagcaaagccac, CVM_Wt - (FAM) aggtctcatggcagttct-(BHQ1), CVM_m - (R6G) catggcatttctcacagcat-(BHQ2), BLAD_up - ttaggcagttgcgttc, BLAD_low - acgttgacgaggtcatccacca, BLAD_Wt - (ROX) accccatcgacctgtacta-(BHQ1), BLAD_m (Cy5) ccatcggcctgtactacct-(BHQ2), разбавитель, 2,5 ед. Taq ДНК-полимеразы, три положительных и один отрицательный контрольных образца. При подготовке к проведению реакции рассчитывают необходимый объем компонентов, исходя из количества исследуемых образцов плюс 4, реактивы смешивают, затем в подготовленные для ПЦР пробирки вносят по 20 мкл приготовленной ПЦР-смеси, в каждую ПЦР пробирку добавляют по 5 мкл контрольных и исследуемых образцов, пробирки помещают в амплификатор, отжиг праймеров проходит на этапе циклирования при 64°С в течение 30 с при числе циклов амплификации равном 40. Анализ полученных данных проводят путем сравнения амплифицированных участков генов, результаты интерпретируют на основании наличия или отсутствия пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией. Данные изобретения обеспечивают возможность диагностики одновременно двух мутантных аллелей, вызывающих CVM и BLAD у крупного рогатого скота, способствуют сокращению времени выполнения ПЦР-РВ. 2 н.п. ф-лы, 3 ил., 4 табл.
Изобретение относится к медицине, а именно к хирургии, и касается способа прогнозирования эффективности профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза. Сущность способа заключается в том, что из лимфоцитов периферической венозной крови выделяют ДНК, проводят генотипирование полиморфизма *1F(163A/C) гена цитохрома Р450 CYP1A2 методом анализа полиморфизма длин рестрикционных фрагментов продуктов полимеразной цепной реакции синтеза ДНК. При обнаружении генотипа CYP1A2F1*C/C прогнозируют высокую эффективность профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза. Использование изобретения дает возможность прогнозировать эффективность профилактики альбендазолом рецидива цистного эхинококкоза с высокой точностью. 2 пр.
Наверх