Способ одновременной генодиагностики двух мутантных аллелей, вызывающих cvm и blad у крупного рогатого скота, и тест-система для его осуществления

Группа изобретений относится к области биотехнологии. Способ одновременной генодиагностики двух мутантных аллелей, вызывающих CVM и BLAD у крупного рогатого скота, включает выделение ДНК из биологического материала, постановку полимеразной цепной реакции в режиме реального времени с использованием реакционной смеси (тест-системы) с CVM/BLAD, содержащей 50 мМKСl, 50 mMTRIS-HCl, 250 нMdNTP, 2,5 мMMgCl2, праймеры - в концентрации 200 нМ, аллель-специфические зонды - в концентрации 100 Нм, имеющие следующие последовательности: CVM_up - gattctcaagagcttaattctaagga, CVM_low - aagtaaaccccagcaaagccac, CVM_Wt - (FAM) aggtctcatggcagttct-(BHQ1), CVM_m - (R6G) catggcatttctcacagcat-(BHQ2), BLAD_up - ttaggcagttgcgttc, BLAD_low - acgttgacgaggtcatccacca, BLAD_Wt - (ROX) accccatcgacctgtacta-(BHQ1), BLAD_m (Cy5) ccatcggcctgtactacct-(BHQ2), разбавитель, 2,5 ед. Taq ДНК-полимеразы, три положительных и один отрицательный контрольных образца. При подготовке к проведению реакции рассчитывают необходимый объем компонентов, исходя из количества исследуемых образцов плюс 4, реактивы смешивают, затем в подготовленные для ПЦР пробирки вносят по 20 мкл приготовленной ПЦР-смеси, в каждую ПЦР пробирку добавляют по 5 мкл контрольных и исследуемых образцов, пробирки помещают в амплификатор, отжиг праймеров проходит на этапе циклирования при 64°С в течение 30 с при числе циклов амплификации равном 40. Анализ полученных данных проводят путем сравнения амплифицированных участков генов, результаты интерпретируют на основании наличия или отсутствия пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией. Данные изобретения обеспечивают возможность диагностики одновременно двух мутантных аллелей, вызывающих CVM и BLAD у крупного рогатого скота, способствуют сокращению времени выполнения ПЦР-РВ. 2 н.п. ф-лы, 3 ил., 4 табл.


Изобретение относится к области молекулярной биологии и может быть использовано в ветеринарной практике при диагностике мутаций, вызывающих две наследственные болезни: комплекс аномалий позвоночника (CVM - Complex Vertebral Malformation) и дефицит лейкоцитарной адгезии (BLAD - Bovine Leucocyte Adhesion Deficiency) у крупного рогатого скота. Предложенный способ и тест-система для его осуществления позволяют одновременно идентифицировать CV и BL мутации соответственно в локусах SLC35A3 и CD 18 ДНК с помощью ПЦР в режиме реального времени (ПЦР-РВ) на основе праймеров и аллель-специфических зондов.

В настоящее время у крупного рогатого скота описано около 60 наследственных заболеваний, которые выявляются на уровне ДНК (ICAR Guidelines…, 2011). Они вызывают морфологические и функциональные аномалии, негативно влияют на здоровье и продуктивность животного. Поэтому важной задачей ветеринарных врачей является своевременная диагностика и искоренение источника, вызывающего данную болезнь. Знание молекулярной структуры, определение гетерозиготного носителя являются основой для эффективной борьбы с наследственным заболеванием.

Быстрота и точность диагностики комплекса аномалий позвоночника (CVM) и дефицита лейкоцитарной адгезии (BLAD) значительно повысилась благодаря установлению генетической природы данных молекулярных болезней (Kehrli M.E. et al., 1990; Tammen I., 1994; Batt C.A. et al., 1994; Марзанов Н.С. и др., 1997; Амерханов Х.А., Марзанов Н.С., 1999; Agerholm J.S. et al., 2001; Яковлев А.Ф. и др., 2004; Eggen A. et al., 2004; Oguni T. et al., 2004; Rusc A., Kaminski S., 2007; Калашникова Л.А., 2010; Марзанова С.Н. и др., 2011; 2012).

В развитых странах Европы и Северной Америки созданы специальные программы по элиминации мутантных CV и BL аллелей в популяциях черно-пестрой породы (Shuster D.E. etal., 1992 a,b; Czarnik U. et al., 2007; Schutz E. et al., 2008).

В Российской Федерации выдающихся производителей и ремонтный молодняк проверяют на носительство мутантных аллелей, а результаты в обязательном порядке, наряду с группами крови и каппа-казеином, регулярно публикуют в каталогах по племенным быкам (Шапочкин В.В., Ескин Г.В., 2004; Попов Н.А. и др., 2004; Савенко Н.А. и др., 2007; Ескин Г.В., 2010).

В открытой печати предложены ряд методов диагностики CVM и BLAD (Kehrli M.E.et al., 1990; Shuster D.E. et al., 1992a; Tammen I., 1994; Nagahata H. et al., 1997; Kanae Y. et al., 2005; Rusc A., Kaminski S., 2007). Однако диагностика при раздельном их выявлении занимает много времени.

Таким образом, в молекулярной биологии существует очевидная потребность в разработке высокочувствительного, специфичного и быстрого способа диагностики двух мутантных аллелей, вызывающих CVM и BLAD у крупного рогатого скота, а также тест-системы для его осуществления, которая может быть применима в ветеринарной практике.

Из уровня техники известен генетический тест для идентификации носителей рецессивного гена комплексных вертебральных мальформаций у крупного рогатого скота (Патент на изобретение №2276690 опубл. 20.05.2006). Данное изобретение принято в качестве ближайшего аналога. Отличительной особенностью заявленного изобретения от выявленного аналога является возможность определения CVM вместе с BLAD, т.е. идет одновременное определение двух мутаций по методике ПЦР в реальном времени (ПЦР-РВ), с помощью праймеров и аллель-специфических зондов. Точка мутации CV та же, что и в указанном аналоге, однако подход детекции принципиально иной.

В заявленном изобретении осуществляется идентификация полиморфизма в локусе SLC35A3 (G/T) с помощью ПЦР-РВ и использованием TaqMan зондов. Время исследования данного полиморфизма занимает не более 3-х часов. В ближайшем аналоге диагностируют CVM с помощью микросателлитов, с использованием электрофоретического метода детекции, что является принципиально другим методом диагностики данного полиморфизма и занимает больше времени и необходимого оборудования.

Целью изобретения является создание способа одновременной диагностики мутантных CV и BL аллелей с помощью ПЦР в реальном времени (ПЦР-РВ) и разработка тест-системы для его осуществления с использованием наборов олигонуклеотидов-праймеров и зондов, имеющих специфические последовательности.

В изобретении представлен способ одновременной диагностики мутантных CV и BL аллелей у черно-пестрого генеалогического корня, куда относятся такие известные породы, как голштинская, черно-пестрая, холмогорская, ярославская, тагильская и красно-пестрая порода, а также синтетические популяции с примесью голштинской крови. Тест-система разработана для тестирования быков-производителей, быковоспроизводящих групп коров, ремонтного молодняка, а также семени из спермобанка и эмбрионов.

Техническим результатом заявленного изобретения является возможность диагностики одновременно двух мутантных аллелей, вызывающих CVM и BLAD у крупного рогатого скота; сокращение времени выполнения полимеразной цепной реакции в реальном времени (ПЦР-РВ) (через 3 часа получен результат); нетрудоемкость; возможность выполнять повторности; проводить контроль правильности исследования.

Указанный технический результат достигается тем, что проводят выделение ДНК из биологического материала, постановку полимеразной цепной реакции в режиме реального времени с использованием реакционной смеси с CVM/BLAD. Реакционная смесь содержит 50 мМKCl, 50 мMTRIS-HCl, 250 нMdNTP, 2,5 мMMgCl2, праймеры - в концентрации 200 нМ, аллель-специфические зонды - в концентрации 100 нМ, разбавитель, 2,5 ед. Taq ДНК-полимеразы, три положительных и один отрицательный контрольных образца. При подготовке к проведению реакции рассчитывают необходимый объем компонентов, исходя из количества исследуемых образцов плюс 4, где три положительных контрольных образца и один отрицательный контрольный образец. Реактивы смешивают, затем в подготовленные для ПЦР пробирки вносят по 20 мкл приготовленной ПЦР-смеси, в каждую ПЦР пробирку добавляют по 5 мкл контрольных и исследуемых образцов. Пробирки помещают в амплификатор. Отжиг праймеров проходит на этапе циклирования при 64°С в течение 30 с при числе циклов амплификации равном 40. Анализ полученных данных проводят путем сравнения амплифицированных участков генов, результаты интерпретируют на основании наличия или отсутствия пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией.

Тест-система для одновременной генодиагностики двух мутантных аллелей, вызывающих CVM и BLAD у крупного рогатого скота методом постановки полимеразной цепной реакции в режиме реального времени, содержит реакционную смесь с CVM/BLAD (50 мМKСl, 50 мMTRIS-HCl, 250 нMdNTP, 2,5 мMMgCl2, праймеры - в концентрации 200 нМ, аллель-специфические зонды - в концентрации 100 нМ), разбавитель, 2,5 ед. Taq ДНК-полимеразы, 3 положительных контрольных образца, один отрицательный контрольный образец.

Праймеры и зонды для осуществления заявленного изобретения имеют следующие последовательности:

CVM_up - gattctcaagagcttaattctaagga

CVM_low - aagtaaaccccagcaaagccac

CVM_Wt - (FAM) aggtctcatggca(G-LNA)ttct-(BHQ1)

CVM_m - (R6G) catggcatttctcacagcat-(BHQ2),

BLAD_up - ttaggcagttgcgttc

BLAD_low - acgttgacgaggtcatccacca,

BLAD_Wt - (ROX) accccatcgacctgtacta-(BHQ1),

BLAD_m (Cy5) ccatcggcctgtactacct-(BHQ2),

Экспериментально установлен оптимальный состав реакционной смеси для проведения полимеразной цепной реакции в режиме реального времени, подобрано сочетание праймеров, необходимое и достаточное соотношение компонентов реакционной смеси и определен режим постановки ПЦР, что является важным при проведении ПЦР-анализа. Система рассчитана на проведение 100 реакций объемом 25 мкл (20 мкл + 5 мкл исследуемого образца).

Подбор праймеров и аллель-специфических зондов (табл. 1) проводили при помощи пакета прикладных программ «Oligo 6.0» на основании анализа нуклеотидных последовательностей локусов SLC35A3 и CD 18 ДНК, опубликованных в базе NSBI.

Источником для проведения диагностики служит предварительно выделенная ДНК из образцов биологического материала (цельной крови, спермы, эмбрионов, молока или кожи).

Выделение ДНК проводили сорбентным методом (ДНК-сорб-В, ФБУН ЦНИИ эпидемиологии Роспотребнадзора, Москва). Далее выделенную ДНК использовали в реакции: 5 мкл образца добавляли к реакционной смеси ПЦР.

Реакционная смесь для ПЦР-анализа имеет следующий состав: 50 мМKС1, 50 мMTRIS-HCl, 250 нMdNTP, 2,5 мMMgCl2, 2,5 ед. Taq ДНК-полимеразы, праймеры в концентрации 200 нМ, флуоресцентные зонды - в концентрации 100 нМ, при этом праймеры и аллель-специфические зонды имеют определенные специфические последовательности (табл. 1).

Подготовку к проведению реакции осуществляли следующим образом.

Необходимый объем компонентов рассчитывали исходя из количества исследуемых образцов плюс 4 (три положительных контрольных образца и один отрицательный контрольный образец). Набор компонентов для реакции представлен в таблице 2.

Компоненты разморозили, перемешали и центрифугировали. Приготовили смесь компонентов, добавляя их в порядке, указанном в таблице 3, перемешали и центрифугировали.

ПЦР пробирки маркировали. В подготовленные для ПЦР пробирки внесли по 20 мкл смеси компонентов. Затем в каждую ПЦР пробирку внесли по 5 мкл контрольных и исследуемых образцов в соответствии с маркировкой, перемешали многократным пипетированием и плотно закрыли крышку. Пробирки поместили в карусель амплификатора, затем программировали работу прибора.

Профиль реакции:

1. Удержание температуры 94°С - 3 мин, один повтор.

2. Циклирование 1

94°С - 20 с

61°С - 20 с

64°С - 30 с

Цикл повторить 10 раз.

3. Циклирование 2 (с детекцией)

94°С - 20 с

61°С - 20 с

64°С - 30 с - детекция по каналам: Green, Yellow, Orange, Red

Цикл повторить 30 раз.

В процессе циклирования денатурация, отжиг праймеров и синтез новой цепи ДНК происходит при температуре 64°С. При первом циклировании провели 10 повторов - детекции нет, так как данные нерепрезентативны. При втором циклировании провели 30 повторов, в результате получили стабильные данные, которые являются окончательными в плане диагностики.

Создание шаблона ПЦР-РВ, а также анализ результатов исследования проводили при помощи программного обеспечения «Rotor-Gene 6000 1.8» к прибору RotorGene Q (CorbettResearch, Австралия).

Результатом анализа является определение мутантных аллелей, вызывающих комплекс аномалий позвоночника (CVM) и дефицит лейкоцитарной адгезии (BLAD) у крупного рогатого скота.

Интерпретацию результатов анализа исследуемых образцов проводили в соответствии с табл. 4:

1. Результат реакции для ПКО1 (положительный контрольный образец) должен быть положительным по каналам Green и Orange, отрицательным по каналам Yellow и Red.

2. Результат реакции для ПКО2 должен быть положительным по каналам Green, Yellow,Orange, Red.

3. Результат реакции для ПКО3 должен быть положительным по каналам Yellow и Red, отрицательным по каналам Green и Orange.

4. Результат реакции для ОКО (отрицательный контрольный образец) должен быть отрицательным по всем каналам.

В случае получения положительных результатов для ОКО по любому из каналов результаты исследования считаются недействительными. Требуется предпринять меры по выявлению и ликвидации источника контаминации и провести повторный анализ.

Результат анализа для образца считается неопределенным, если результаты реакций по каналам Green, Yellow, Orange, Red отрицательные.

В этом случае необходимо повторное исследование образца.

Прогноз получаемого потомства в зависимости от присутствия или отсутствия мутантных CV и BL аллелей. Наличие CV, как и BL аллеля, является ярким примером носительства мутации с одной стороны, а с другой, проявления однонуклеотидного полиморфизма или SNP (singlenucleotidepolymorphism) в ДНК у крупного рогатого скота.

В заявленном изобретении использована технология аллель-специфических TaqMan зондов. В данном случае флуоресцентным зондом является олигонуклеотид, комплементарный продукту ПЦР.

Зонд метят флуорофором и гасителем флуоресценции, при этом используют концевое мечение олигонуклеотида. При отсутствии мишени, т.е. последовательности, комплементарной зонду, флуорофор и гаситель сближаются, в результате подавляется флуоресценция зонда. При наличии комплементарного зонду фрагмента ДНК зонд гибридизуется с ампликоном, что ведет к его расщеплению в процессе синтеза за счет 5′-экзонуклеазной активности Taq-полимеразы. Интенсивность сигнала возрастает на соответствующем флуорофору канале флуоресценции с каждым циклом ПЦР, пропорционально накоплению ампликонов.

Аллель-специфические зонды эффективны при детекции CV и BL мутаций в исследуемом фрагменте генома. Для локуса с мутацией подбирают пару зондов, так чтобы один из них специфически гибридизовался при температуре проведения синтеза цепей с аллелем нормального (дикого) типа, а второй зонд - с аллелем мутантного типа.

Эти зонды метят разными флуорофорами, а результаты реакций с ними регистрируют на двух различных каналах детекции прибора для ПЦР-РВ. Для определения СТ и CV аллелей используют 2 канала - Green и Yellow. Нормальный СТ аллель дает рост сигнала по каналу Green, детектируемый флуорофором FAM, а мутантный аллель CV - по каналу Yellow, детектируемый флуорофором R6G.

Что касается TL и BL аллелей, то для их определения используют тоже 2 канала, только Orange и Red. Нормальный TL аллель дает рост сигнала по каналу Orange, детектируемый флуорофором ROX, а мутантный аллель BL -по каналу Red, детектируемый флуорофором Су5.

Результаты интерпретируются на основании наличия или отсутствия пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией.

Переход порога - это характеристика количества копий ДНК отдельного гена. При оптимальном количестве копий ДНК кривая располагается между двумя пороговыми значениями 10 и 15 циклами амплификации.

При перемещении кривой влево по оси абсцисс это говорит о высокой концентрации ДНК, если вправо - о ее недостатке в реакции. Все образцы, графики флуоресценции которых пересекают линию порога, будут считаться положительными по определенному каналу, т.е. содержащими соответствующий каналу флуоресценции аллель.

Получаемая картина результатов реакций с использованием указанных зондов на контрольных образцах приведена ниже при определении мутантного CV аллеля. На рис. 1 - результаты исследований гомозиготного дикого типа или здорового животного или неносителя, флуоресценция представлена двумя линиями.

Кривая без маркеров располагается между 10 и 15 циклами над красной пороговой линией. Вторая кривая с окружностями - ниже пороговой линии. Данная ситуация характерна для здорового исследуемого животного.

На рис. 2 представлены результаты исследования гетерозиготного животного или носителя мутантного CV аллеля. Как видно на рис. 2, обе кривые флуоресценции пересекают установленную на соответствующем уровне пороговую линию в обозначенном районе, между 10 и 15 циклами ПЦР-РВ.

В то же время следует отметить, что кривая с окружностями располагается выше кривой без маркеров. Данная картина характерна для гетерозиготного животного или носителя мутации.

При налаживании данного способа не было возможности получения больных телят опытным путем в хозяйственных условиях. В этой связи впервые удалось смоделировать синтетические рецессивные генотипы больных телят по локусам SLC35A3 и CD 18, в лабораторных условиях, на основе знания структур мутантных CV и BL аллелей.

На рис. 3 представлен модельный образец животного, гомозиготного по мутантному CV аллелю. Как видно на рис. 3, модельный образец отражает ситуацию, характерную для больного теленка. В данном случае кривая с окружностями располагается выше порога, кривая флуоресценции без окружностей, характерная для здорового животного, оказывается под пороговой линией.

Что касается принципа определения BL аллеля, то он аналогичен тому, что описано в отношении диагностики CV мутации. Анализ проводится по описанной выше методике, только по каналам Orange и Red и вся процедура осуществляется одновременно.

Основными преимуществами заявляемого изобретения являются:

1. Одновременная аттестация элитных животных черно-пестрого генеалогического корня и красно-пестрой породы по двум мутациям (CV и BL) при помощи заявленной тест-системы позволит направленно формировать аллелофонд быков-производителей, быковоспроизводящих групп коров, ремонтный молодняк, а также накапливать племенной материал (банк семени и эмбрионов) от здоровых животных.

2. Наличие генетического паспорта на CV и BL мутации элитных животных позволит эффективно вести селекционно-племенную работу в племенных стадах черно-пестрого генеалогического корня и красно-пестрой породы.

3. При завозе племенного материала в Российскую Федерацию из-за рубежа обязательно наличие генетического паспорта. С целью купирования двух наследственных болезней закупленные животные после карантина должны пройти повторную аттестацию на наличие мутантных CV и BL аллелей.


1. Амерханов Х.А., Марзанов Н.С. Генетики смотрят в будущее // Племенное дело. - 1999. - №1. - С. 7-9.

2. Калашникова Л.А. Геномная оценка молочного скота // Молочное и мясное скотоводство. - 2010. - N1. - С. 10-12.

3. Каталог быков-производителей ОАО «Головной центр по воспроизводству сельскохозяйственных животных» / под ред. Ескина Г.В. Быково. - 2010. - 36 с.

4. Марзанов Н.С, Попов А.Н., Зиновьева Н.А., Полежаева В.А., Игнатьев В.М., Брем Г. Скрининг BLAD-синдрома у животных черно-пестрого корня // Вестник РАСХН. - 1997. - №4. - С. 59-61.

5. Марзанова С.Н., Алексеев Я.И., Коновалова Н.В., Турбина И.С., Девришов Д.А., Сочивко Д.Г., Марзанов Н.С. Разработка метода диагностики комплексной аномалии позвоночника (CVM) методом ПЦР в реальном времени у черно-пестрого скота. Научно-практическая конференция: «Практическое использование современных научных разработок в воспроизводстве и селекции крупного рогатого скота» // Научно-теоретический журнал: Проблемы биологии продуктивных животных. - 2011. - №4. Спецвыпуск. - С. 79-82.

6. Марзанова С.Н., Алексеев Я.И., Коновалова Н.В., Турбина И.С., Девришов Д.А., Сочивко Д.Г., Марзанов Н.С.Диагностика CVM и BLAD у черно-пестрого скота. Материалы международной научно-практической конференции: «Роль ветеринарной науки и практики в эффективном развитии животноводства». Алматы - 2012. - С. 348-353.

7. Попов Н.А., Червяков Н.А., Белявин Н.А. и др. Каталог быков-производителей ОАО «Кировское». - Киров. - 2004. - 73 с.

8. Савенко Н.А., Бошляков В.Н., Жуков В.Ф. и др. Каталог быков-производителей ОАО «Московское» по племенной работе. - Москва: МСХиП МО. - 2007. - 104 с.

9. Шапочкин В.В., Ескин Г.В. Каталог быков-производителей ФГУП «ЦСИО». Подольск. - 2002. - 51 с.

10. Яковлев А., Терлецкий В., Митрофанова О., Дементьева Н. Определение носителей генетических дефектов среди быков-производителей // Молочное и мясное скотоводство. - 2004. - №7. - С. 31-32.

11. Agerholm J.S., Bendixen С, Arnbjerg J., Anderson О. Complex vertebral malformation in Holstein calves // J. Vet. Diagn. Invest. - 2001. - Vol. 13. - P. 283-289.

12. Batt C.A., Wagner P., Wiedmann M., Luo J., Gilbert R.O. Detection of bovine leukocyte adhesion deficiency by nonisotopic ligase chain reaction // Anim. Genet. - 1994. - Vol. 25. - P. 95-98.

13. Czarnik U., Grzybovski G., Kaminski S., Prusak B, Zabolewicz T. Effectiveness of a program aimed at the elimination of BLAD-carrier bulls from Polish Holstein-Friesian cattle // J. Appl. Genet. - 2007. - Vol. 48. - P. 375-377.

14. Eggen A., Duchesne A., Laurent P., Grohs C, Denis C, Gautier M., Boichard D., Ducos A. Controlling genetic disorders in the French dairy cattle population // 2 International Conference on Animal Genetics. Tokyo. Japan-2004. - P.35.

15. ICARGuidelines approved by the General Assembly held in Riga, Latvia on June 2010. Copyright ICAR. - 2011. - 485p.

16. Kanae Y., Endoh D., Nagahata H., Hayashi M.A method for detecting complex vertebral malformation in Holstein calves using polymerase chain reaction-primer introduced restriction analysis // J. Vet. Diagn. Invest. - 2005. - Vol. 17. - P. 258-262.

17. KehrliM.E., SchmalstiegC, AndersonD.C, VanDerMaatenM.J., HughesB.J., AkermannM.R., WilhemsenC.L., BrownG.B., StevensM.G., WhetstoneC.A. MolecularidentificationofdeficiencyoftheMac-1 (CD11b/CD18) glycoprotein // Am. J. Vet. Res. - 1990. - Vol. 51. - P. 1826-1836.

18. Nagahata H., Miura Т., Tagaki K., Ohtake M., Noda H., Yasuda Т., Nioka K. Prevalence and allele frequency estimation of bovine leukocyte adhesion deficiency (BLAD) in Holstein-Friesian cattle in Japan // J. Vet. Med. Sci - 1997. - Vol. 59. - P. 233-238.

19. Oguni Т., Takeda Ray M., Tsuji Т., Sugimoto Y., Moritomo Y., Matsumoto M., Mishina Y., Kunieda T. Identification and control of a dwarfism gene in Japanese brown cattle // 29th International Conference on Animal Genetics. Tokyo. Japan, 2004. P.35.

20. Rusc A., Kaminski S. Prevalence of complex vertebral malformation carriers among Polish Holstein-Friesian bull // J. Appl. Genet - 2007. - Vol. 48. - P. 247-252.

21. Shuster D.E., KehrliM.E.Jr., Ackermann M.R., Gilbert R.O. Identification and prevalence of a genetic defect that causes leukocyte adhesion deficiency in Holstein cattle // Proc. Nat. Acad. Sci. USA. - 1992a. - Vol. 89. - P.9225-9229.

22. Shuster D.E., Bosworth B.T., KehrliM.E.Jr. Sequence of the bovine CD18-encoding cDNA: comparison with the human and murine glycoproteins // Gene. - 1992b. - Vol. 114. - P. 267-271.

23. Schutz E., Scharfenstein M., Brenig B. Implication of complex vertebral malformation and bovine leukocyte adhesion deficiency DNA-based Testing on disease frequency in the Holstein population // J. Dairy Sci - 2008. - Vol. 91. - P. 4854-4859.

24. Tammen I. Weiterentwicklung des DNA-Tests auf BLAD (Bovine Leukozyten Adhasionsdefizienz) fur den Einsatz in Rinderzucht und klinischer Diagnostik. Hannover. - 1994. - 128s.

1. Способ одновременной генодиагностики двух мутантных аллелей, вызывающих CVM и BLAD у крупного рогатого скота, включает выделение ДНК из биологического материала, постановку полимеразной цепной реакции в режиме реального времени с использованием реакционной смеси с CVM/BLAD, содержащей 50 мМKСl, 50 mMTRIS-HCl, 250 нMdNTP, 2,5 мMMgCl2, праймеры - в концентрации 200 нМ, аллель-специфические зонды - в концентрации 100 Нм, имеющие следующие последовательности:
CVM_up - gattctcaagagcttaattctaagga
CVM_low - aagtaaaccccagcaaagccac
CVM_Wt - (FAM) aggtctcatggcagttct-(BHQ1)
CVM_m - (R6G) catggcatttctcacagcat-(BHQ2),
BLAD_up - ttaggcagttgcgttc
BLAD_low - acgttgacgaggtcatccacca,
BLAD_Wt - (ROX) accccatcgacctgtacta-(BHQ1),
BLAD_m (Cy5) ccatcggcctgtactacct-(BHQ2),
разбавитель, 2,5 ед. Taq ДНК-полимеразы, три положительных и один отрицательный контрольных образца, при подготовке к проведению реакции рассчитывают необходимый объем компонентов, исходя из количества исследуемых образцов плюс 4, реактивы смешивают, затем в подготовленные для ПЦР пробирки вносят по 20 мкл приготовленной ПЦР-смеси, в каждую ПЦР пробирку добавляют по 5 мкл контрольных и исследуемых образцов, пробирки помещают в амплификатор, отжиг праймеров проходит на этапе циклирования при 64°С в течение 30 с при числе циклов амплификации равном 40, анализ полученных данных проводят путем сравнения амплифицированных участков генов, результаты интерпретируют на основании наличия или отсутствия пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией.

2. Тест-система для одновременной генодиагностики двух мутантных аллелей, вызывающих CVM и BLAD у крупного рогатого скота методом постановки полимеразной цепной реакции в режиме реального времени, характеризующаяся тем, что включает реакционную смесь с CVM/BLAD, содержащую все необходимые реагенты для проведения ПЦР РВ, а именно 50 мМKСl, 50 мMTRIS-HCl, 250 нMdNTP, 2,5 мМMgCl2, праймеры - в концентрации 200 нМ, аллель-специфические зонды - в концентрации 100 нМ, имеющие следующие последовательности:
CVM_up - gattctcaagagcttaattctaagga
CVM_low - aagtaaaccccagcaaagccac
CVM_Wt - (FAM) aggtctcatggcagttct-(BHQ1)
CVM_m - (R6G) catggcatttctcacagcat-(BHQ2),
BLAD_up - ttaggcagttgcgttc
BLAD_low - acgttgacgaggtcatccacca,
BLAD_Wt - (ROX) accccatcgacctgtacta-(BHQ1),
BLAD_m (Cy5) ccatcggcctgtactacct-(BHQ2),
разбавитель, 2,5 ед. Taq ДНК-полимеразы, 3 положительных контрольных образца, один отрицательный контрольный образец.


Похожие патенты:

Изобретение относится к биохимии. Описан способ для проведения пиросеквенирования нуклеиновых кислот.
Изобретение относится к биохимии. Описан набор синтетических олигонуклеотидов для выявления маркерных участков генов бактерий кишечника человека, ассоциированных с развитием воспалительных заболеваний кишечника (болезни Крона и неспецифического язвенного колита) методом полимеразной цепной реакции в режиме реального времени.

Изобретение относится к биохимии. Описаны способы количественного определения специфического продукта в реакции амплификации с внесением одноцепочечных разрывов и достройкой и способ контроля в режиме реального времени реакции амплификации с внесением одноцепочечных разрывов и достройкой.

Изобретения относятся к области генетики, молекулярной биологии и медицины и касаются способа для анализа генетического полиморфизма в локусах ДНК ApoE, ApoJ и GAB2 и набора олигонуклеотидных праймеров и зондов.

Изобретение относится к области биотехнологии. В изобретении описан способ идентификации пар фрагментов ДНК или РНК, исходно присутствующих в одних и тех же живых или фиксированных клетках, в частности, способ идентификации нативных пар генов легких и тяжелых цепей антител, а также нативных пар генов альфа- и бета-цепей Т-клеточных рецепторов (ТКР).
Изобретение относится к области медицины и предназначено для диагностики предрасположенности к посттравматическому остеоартрозу коленного сустава. У пациентов существляют генотипирование полиморфизма rs2276109 (A-82G) гена ММР-12.

Изобретение относится к области медицины и предназначено для определения риска развития артериальной гипертензии. Осуществляют забор венозной крови, выделение генетического материала, проведение полимеразной цепной реакции (ПЦР) в режиме реального времени и определение инсерции/делеции (I- и D-аллели) Alu-фрагмента гена ангиотензинпревращающего фермента.

Изобретение относится к области медицины и предназначено для определения степени гетероплазмии мутаций митохондриального генома. Проводят полимеразную цепную реакцию в режиме реального времени, вычисляют значение ΔCt, определяют коэффициент эффективности амплификации и рассчитывают степень гетероплазмии мутаций митохондриального генома по формуле.

Изобретение относится к области медицины, в частности к медицинской генетике и онкогинекологии, и предназначено для прогнозирования риска развития рака яичников.

Изобретение относится к биохимии. Предоставлена композиция для осуществления реакции замещения цепей нуклеиновых кислот, содержащая первый и второй комплексы нуклеиновых кислот, каждый из которых содержит первую, вторую, третью и четвертую цепи нуклеиновых кислот, где каждая из цепей содержит последовательно первый, второй и третий фрагменты.
Изобретение относится к медицине, а именно к хирургии, и касается способа прогнозирования эффективности профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза. Сущность способа заключается в том, что из лимфоцитов периферической венозной крови выделяют ДНК, проводят генотипирование полиморфизма *1F(163A/C) гена цитохрома Р450 CYP1A2 методом анализа полиморфизма длин рестрикционных фрагментов продуктов полимеразной цепной реакции синтеза ДНК. При обнаружении генотипа CYP1A2F1*C/C прогнозируют высокую эффективность профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза. Использование изобретения дает возможность прогнозировать эффективность профилактики альбендазолом рецидива цистного эхинококкоза с высокой точностью. 2 пр.

Предложенная группа изобретений относится к области медицины. Предложен способ получения ДНК-праймеров и зондов для малоинвазивной пренатальной ПЦР-диагностики трисомии 21-й хромосомы у плода по крови беременной женщины, характеризующийся тем, что выбирают сайт дифференциального метилирования фетальной ДНК 21-й хромосомы и ДНК 21-й хромосомы взрослого человека, чувствительный к эндонуклеазам, синтезируют прямой и обратный праймер, соответствующие ампликону длиной от 60 до 300 п.н., а также зонд, соответствующий этому ампликону, проводят ПЦР в реальном времени смеси образцов после их обработки эндонуклеазой рестрикции, отбирают пары праймеров и зонды, обеспечивающие эффективность реакции ПЦР в реальном времени выше 90% и линейность при изменении относительной концентрации образцов выше 90%. Предложены также набор и малоинвазивный способ пренатальной ПЦР-диагностики в реальном времени трисомии 21-й хромосомы у плода по крови беременной женщины. Предложенная группа изобретений обеспечивает эффективные средства и методы определения трисомии хромосомы 21 плода по крови беременной женщины. 3 н. и 13 з.п. ф-лы, 15 ил., 3 табл., 1 пр.

Изобретение относится к области медицины, и касается способа прогнозирования эффективности монотерапии пероральным сахароснижающим препаратом метформином у больных сахарным диабетом 2 типа. Сущность способа заключается в том, что у больных сахарным диабетом 2 типа выделяют ДНК из периферической венозной крови с последующим проведением полимеразной цепной реакции (ПЦР) и проведением анализа на выявление полиморфизма А>С rs 622342 гена ОСТ1. При выявлении генотипа АА в участке rs 622342 гена ОСТ1 прогнозируют эффективность монотерапии метформином в качестве сахароснижающего препарата у больных сахарным диабетом 2 типа, а при выявления генотипа АС или СС в участке rs 622342 гена ОСТ1 прогнозируют неэффективность монотерапии метформином в качестве сахароснижающего препарата у данной категории больных. Испоотзование способа позволяет повысить точность и специфичность прогнозирования эффективности монотерапии пероральным сахароснижающим препаратом метформином у больных сахарным диабетом 2 типа. 2 табл., 3 пр.

Изобретение относится к области молекулярной биологии, вирусологии, ветеринарии и медицине и касается способа идентификации РНК вирусов гриппа А и В с одновременным определением вариантов гемагглютинина и нейраминидазы вируса гриппа А, а также генетических маркеров патогенности и устойчивости к противогриппозным препаратам, на биологических микрочипах. Способ основан на проведении реакции обратной транскрипции для получения кДНК с использованием вирусной РНК в качестве матрицы, полимеразной цепной реакции (ПЦР) и последующей гибридизации полученного одноцепочечного флуоресцентно-меченного ПЦР-продукта на биологическом микрочипе. Биологический микрочип представляет собой подложку с упорядоченно расположенными гидрогелевыми элементами, содержащими ковалентно иммобилизованные олигонуклеотидные зонды, которые обеспечивают гибридизацию со специфическими участками генома вируса гриппа, определяющими его тип, субтип и генетические маркеры, включая детерминанты устойчивости к противовирусным препаратам. 3 н. и 2 з.п. ф-лы, 27 ил., 4 табл., 3 пр.

Изобретение относится к области биохимии, в частности к способу идентификации растения, способного восстанавливать фертильность при цитоплазматической мужской стерильности С-типа, содержащего функциональный ген-восстановитель для цитоплазматической мужской стерильности С-типа кукурузы, включающему выделение молекул нуклеиновой кислоты из растения и скрининг выделенных молекул нуклеиновых кислот с использованием ПЦР в отношении молекулы нуклеиновой кислоты, содержащей нуклеотидную последовательность, выбранную из группы, состоящей из SEQ ID NO: 1-197 и маркеров, обозначаемых как полиморфизмы ID №№1-106 в таблице 3. Изобретение также относится к способу восстановления фертильности в кукурузе, предусматривающему стадии скрещивания, маркер-ассоциированной селекции, а также размножения растения кукурузы. Изобретение позволяет эффективно восстанавливать фертильность в кукурузе. 2 н. и 12 з.п. ф-лы, 11 ил., 4 табл., 6 пр.

Группа изобретений относится к области биотехнологии. В группу изобретений входят нуклеиновая кислота, которая кодирует флуоресцентный биосенсор для регистрации изменения рН, аминокислотная последовательность которого показана в SEQ ID No: 4, а также кассета экспрессии и эукариотическая клетка, продуцирующая биосенсор. Группа изобретений направлена на биосенсоры для регистрации изменения рН в живых клетках, обладающих повышенной яркостью флуоресценции. 3 н.п. ф-лы, 6 ил., 4 пр.

Настоящее изобретение относится к способам и продуктам для локализованной или пространственной детекции нуклеиновой кислоты в образце ткани и, в частности, к способу локализованной детекции нуклеиновой кислоты в образце ткани, включающему: (а) предоставление чипа, содержащего подложку, на которой непосредственно или опосредованно иммобилизованы многочисленные разновидности захватывающих зондов, так что каждая разновидность занимает определенное положение на чипе и ориентирована таким образом, что имеет свободный 3′-конец, позволяющий указанному зонду действовать в качестве праймера в реакции удлинения или лигирования праймера, где каждая разновидность указанного захватывающего зонда содержит молекулу нуклеиновой кислоты, имеющую в направлении от 5′ к 3′: (1) позиционную область, которая соответствует положению захватывающего зонда на чипе, и (2) захватывающую область; (б) приведение указанного чипа в контакт с образцом ткани таким образом, что положение захватывающего зонда на чипе может быть сопоставлено с положением в образце ткани, и предоставление возможности нуклеиновой кислоте образца ткани гибридизоваться с захватывающей областью в указанных захватывающих зондах; (в) синтез молекул ДНК на основе захваченных молекул нуклеиновой кислоты с использованием указанных захватывающих зондов в качестве праймеров удлинения или лигирования, где указанные удлиненные или лигированные молекулы ДНК являются мечеными благодаря позиционной области; (г) возможно синтез комплементарной нити указанной меченой ДНК и/или возможно амплификацию указанной меченой ДНК; (д) высвобождение по меньшей мере части меченых молекул ДНК и/или их комплементов или ампликонов с поверхности чипа, где указанная часть включает позиционную область или ее комплемент; и (е) прямой или опосредованный анализ последовательности высвобожденных молекул ДНК. 3 н. и 52 з.п. ф-лы, 31 ил., 2 табл., 12 пр.

Группа изобретений относится к области биотехнологии и представляет собой варианты способов создания совокупности смежных фрагментов исследуемой области генома. При этом способ включает фрагментацию перекрестно-сшитой ДНК, лигирование фрагментированной перекрестно-сшитой ДНК, реверсию перекрестного сшивания, определение по меньшей мере части последовательностей лигированных фрагментов ДНК, включающих нуклеотидную последовательность-мишень, и использование определенных последовательностей для создания совокупности смежных фрагментов исследуемой области генома. Использование данных способов позволяет получать контиги и детектировать мутации, находящиеся в одной области генома, но отстоящие друг от друга на большие расстояния. 3 н. и 15 з.п. ф-лы, 3 ил., 2 табл., 1 пр.

Изобретение относится к области молекулярной биологии и диагностической медицины. Предложен способ выделения циркулирующих ДНК из плазмы или сыворотки крови. Способ включает обработку образца равным объемом 0,5÷1,5 М гуанидин изотиоцианата, осаждение нецелевых полимеров добавлением равного объема буферного раствора, содержащего 1 М натрия ацетата, рН6,0, и 0,5-2,5% октановую кислоту, и центрифугирование. К полученному супернатанту добавляют 1/5 объема 96% этанола и наносят на колонку со стекловолокнистым сорбентом. Сорбент отмывают от балластных биополимеров, и цДНК элюируют водой. Изобретение обеспечивает повышение выхода цДНК. 2 з.п. ф-лы, 1 ил., 2 табл., 2 пр.

Изобретение относится к области биотехнологии. Описан способ амплификации нуклеиновых кислот, в котором наночастицы в объеме реакционной смеси переносят тепло в окружающую их среду посредством возбуждения. При этом при возбуждении наночастиц среда, окружающая наночастицы, нагревается локально. 15 з.п. ф-лы, 16 ил.

Группа изобретений относится к области биотехнологии. Способ одновременной генодиагностики двух мутантных аллелей, вызывающих CVM и BLAD у крупного рогатого скота, включает выделение ДНК из биологического материала, постановку полимеразной цепной реакции в режиме реального времени с использованием реакционной смеси с CVMBLAD, содержащей 50 мМKСl, 50 mMTRIS-HCl, 250 нMdNTP, 2,5 мMMgCl2, праймеры - в концентрации 200 нМ, аллель-специфические зонды - в концентрации 100 Нм, имеющие следующие последовательности: CVM_up - gattctcaagagcttaattctaagga, CVM_low - aagtaaaccccagcaaagccac, CVM_Wt - aggtctcatggcagttct-, CVM_m - catggcatttctcacagcat-, BLAD_up - ttaggcagttgcgttc, BLAD_low - acgttgacgaggtcatccacca, BLAD_Wt - accccatcgacctgtacta-, BLAD_m ccatcggcctgtactacct-, разбавитель, 2,5 ед. Taq ДНК-полимеразы, три положительных и один отрицательный контрольных образца. При подготовке к проведению реакции рассчитывают необходимый объем компонентов, исходя из количества исследуемых образцов плюс 4, реактивы смешивают, затем в подготовленные для ПЦР пробирки вносят по 20 мкл приготовленной ПЦР-смеси, в каждую ПЦР пробирку добавляют по 5 мкл контрольных и исследуемых образцов, пробирки помещают в амплификатор, отжиг праймеров проходит на этапе циклирования при 64°С в течение 30 с при числе циклов амплификации равном 40. Анализ полученных данных проводят путем сравнения амплифицированных участков генов, результаты интерпретируют на основании наличия или отсутствия пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией. Данные изобретения обеспечивают возможность диагностики одновременно двух мутантных аллелей, вызывающих CVM и BLAD у крупного рогатого скота, способствуют сокращению времени выполнения ПЦР-РВ. 2 н.п. ф-лы, 3 ил., 4 табл.
