Гибридные белки npp1



Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1
Гибридные белки npp1

 


Владельцы патента RU 2601154:

СИНАДЖИВА БАЙОФАРМА КОРП (US)

Изобретение относится к биотехнологии и представляет собой выделенный гибридный белок NPP1, обладающий ферментативной активностью NPP1, содержащий NPP1-компонент и Fc-участок иммуноглобулина. При этом NPP1-компонент содержит богатый цистеином участок и С-концевой каталитический домен NPP1, а Fc-участок расположен на С-конце относительно NPP1-компонента. Указанный NPP1-компонент имеет аминокислотную последовательность P99-D925 из SEQ ID NO: 1, а указанный Fc-участок представляет собой Fc-участок IgG1. Изобретение относится также к нуклеиновой кислоте, кодирующей такой белок, и к векторам экспрессии и репликации, содержащим нуклеиновую кислоту. Изобретение позволяет получить эффективный белок с активностью NPP1. 4 н. и 6 з.п. ф-лы, 29 ил., 1 табл., 5 пр.

 

РОДСТВЕННЫЕ ЗАЯВКИ

Данная заявка испрашивает приоритет на основании международной заявки PCT/US 2011/028233, поданной 11 марта 2011 года, которая испрашивает приоритет на основании предварительной заявки на патент США №61/340066, поданной 12 марта 2010 года. Содержание упомянутых выше заявок включено в данный документ при помощи ссылки во всей их полноте.

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

Эктонуклеотидная пирофосфатаза/фосфодиэстераза 1 (NPP1/ENPP1/PC-1) представляет собой трансмембранный гликопротеин II типа, который образует гомодимер. Белок расщепляет ряд субстратов, включая фосфодиэфирные связи нуклеотидов и нуклеотидных сахаров и пирофосфатные связи нуклеотидов и нуклеотидных сахаров. Белок NPP1 функционирует с осуществлением гидролиза нуклеозид-5′-трифосфата до одного из соответствующих монофосфатов и также гидролизирует диаденозинполифосфаты. Мутации в гене NPP1 ассоциированы с идиопатической инфантильной артериальной кальцификацией (IIAC), инсулинорезистентностью, гипофосфатемическим рахитом и оссификацией задней продольной связки позвоночника.

IIAC - редкое аутосомно рецессивное нарушение, которое почти всегда приводит к смертельному исходу, характеризуется кальцификацией внутренней эластической мембраны мышечных артерий и стенозом вследствие миоинтимальной пролиферации. Во всем мире описано более 160 случаев IIAC. Симптомы заболевания наиболее часто проявляются в раннем младенчестве, и заболевание приводит к летальному исходу в возрасте до 6 месяцев, как правило, вследствие ишемической кардиомиопатии и других осложнений обструктивной артериопатии, в том числе стеноза почечной артерии. В более десяти описанных случаев IIAC периартикулярная кальцификация крупных суставов также развилась в младенчестве. Rutsch et al. (2003) сообщили, что мутации в ENPP1 ассоциированы с IIAC, которая характеризуется спонтанной периартикулярной и аортальной кальцификацией на раннем этапе жизни и системным снижением активности нуклеотидной пирофосфатазы/фосфодиэстеразы у пораженных индивидов.

Хотя дефекты в белке NPP1 связаны с таким серьезным заболеванием как IIAC, не существует лечения, доступного в данной области техники, для тех, кто поражен этим заболеванием. Таким образом, существует крайняя необходимость в эффективной и безопасной композиции, составе и лекарственном препарате для лечения IIAC, инсулинорезистентности, гипофосфатемического рахита и оссификации задней продольной связки позвоночника.

КРАТКОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Настоящее изобретение предусматривает гибридные белки из усеченных доменов NPP1 (т.е. NPP1-компонент), слитых с нацеливающим фрагментом. Нацеливающий фрагмент функционирует с увеличением эффективности при нацеливании гибридного белка NPP1 на участок, имеющий клиническое или биологическое значение (например, участок кальцификации у субъекта, который нуждается в снижении кальцификации). Без ограничения настоящего изобретения любой конкретной теорией или механизмом действия предполагается, что NPP1-компонент функционирует с ингибированием кальцификации путем увеличения образования пирофосфата (PPi), и/или путем расщепления пирофосфата с продуцированием растворимого фосфата (Pi), и/или путем повышения доступности аденозинмонофосфата (AMP) и/или аденозина. Предполагается, что нацеливающий фрагмент можно присоединить к N-концу и/или С-концу NPP1-компонента по любому подходящему положению. Кроме того, гибридный белок NPP1, раскрытый в данном документе, также может включать один или несколько Fc-фрагментов, PEG, полипептидный линкер или другие дополнительные полипептиды для увеличения ферментативной активности, стабильности или нацеливания.

Гибридные белки по настоящему изобретению можно применять для лечения широкого спектра состояний субъекта. Любое состояние, которое можно успешно лечить путем введения гибридного белка по настоящему изобретению, охвачено объемом настоящего изобретения. Например, лечение состояний, которые можно улучшить путем снижения и/или устранения одного или нескольких кальцификатов, и/или предупреждение образования кальцификатов у субъекта, такого как млекопитающее, например пациент-человек, охвачено объемом настоящего изобретения. Предполагается лечение состояний, таких как закупорка артерий, с использованием гибридных белков по настоящему изобретению. В одном особенно подходящем варианте осуществления состояние, которое подлежит лечению, представляет собой генерализованную артериальную кальцификацию у новорожденных, также называемую идиопатической артериальной кальцификацией у новорожденных и кальцификацией средней оболочки артерий у новорожденных. Также предполагается лечение таких состояний, как инсулинорезистентность, гипофосфатемический рахит и оссификация задней продольной связки позвоночника.

Гибридные белки по настоящему изобретению могут продуцироваться в любой пригодной системе экспрессии белков, в том числе без ограничения клеточной культуре (например, клетки СНО, клетки COS, HEK203), бактериях, таких как Escherichia coli (Е.coli), и трансгенных животных, в том числе без ограничения млекопитающих и птицах (например, куры, перепел, утка и индейка).

Получение фармацевтических композиций (или фармацевтических составов) хорошо известно из уровня техники, и предполагается применение таких фармацевтических композиций в соответствии с гибридными белками по настоящему изобретению.

Как правило, дозировка гибридного белка, который вводится субъекту, будет варьировать в зависимости от известных факторов, таких как возраст, состояние здоровья и вес того, кто его получает, тип сопутствующего лечения, частота лечения и т.п. Как правило, дозировка активного ингредиента (например, гибридного белка) может составлять от приблизительно 0,0001 миллиграмма до приблизительно 50 миллиграмм на килограмм веса тела. Точная дозировка, частота введения и продолжительность лечения может определяться врачом, являющимся специалистом в данной области техники, связанной с введением терапевтических белков.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

Фиг.1 иллюстрирует аминокислотную последовательность белка NPP1 дикого типа. Цитоплазматический и трансмембранный участки подчеркнуты. Потенциальные сайты N-гликозилирования выделены жирным шрифтом. PSCAKE, выделенный курсивом, представляет собой начало растворимого NPP1, который включает богатый цистеином участок.

Фиг.2 иллюстрирует аминокислотную последовательность каталитического домена(ов) белка NPP1 без присоединенного нацеливающего фрагмента ("sssNPP1").

Фиг.3 иллюстрирует аминокислотную последовательность TAGsssNPP1. Нацеливающий фрагмент из восьми последовательных остатков аспарагиновой кислоты слит с N-концом sssNPP1. Сигнальный пептид подчеркнут, а нацеливающий фрагмент обозначен жирным шрифтом.

Фиг.4 иллюстрирует аминокислотную последовательность TAGsssNPP1, которая содержит нацеливающий фрагмент из десяти последовательных остатков аспарагиновой кислоты, слитый с С-концом sssNPP1. Сигнальный пептид подчеркнут, а нацеливающий фрагмент обозначен жирным шрифтом.

Фиг.5 иллюстрирует последовательность нуклеиновой кислоты гибридного белка TAGssNPP1. Нацеливающий фрагмент из восьми последовательных остатков аспарагиновой кислоты слит с N-концом sssNPP1.

Фиг.6 иллюстрирует аминокислотную последовательность гибридного белка TAGssNPP1. Нацеливающий фрагмент из восьми последовательных остатков аспарагиновой кислоты слит с N-концом sssNPP1. Сигнальный пептид подчеркнут, а нацеливающий фрагмент обозначен жирным шрифтом.

Фиг.7 иллюстрирует последовательность нуклеиновой кислоты ssNPP1.

Фиг.8 иллюстрирует аминокислотную последовательность ssNPP1. Сигнальный пептид подчеркнут.

Фиг.9 иллюстрирует последовательность нуклеиновой кислоты sNPP1.

Фиг.10 иллюстрирует аминокислотную последовательность sNPP1. Сигнальный пептид подчеркнут.

Фиг.11 иллюстрирует последовательность нуклеиновой кислоты TAGsNPP1. Нацеливающий фрагмент из восьми последовательных остатков аспарагиновой кислоты слит с N-концом sNPP1.

Фиг.12 иллюстрирует аминокислотную последовательность TAGsNPP1. Нацеливающий фрагмент из восьми последовательных остатков аспарагиновой кислоты слит с N-концом ssNPP1. Сигнальный пептид подчеркнут, а нацеливающий фрагмент обозначен жирным шрифтом.

Фиг.13 иллюстрирует последовательность нуклеиновой кислоты TAGsNPP1. Нацеливающий фрагмент из восьми последовательных остатков аспарагиновой кислоты слит с С-концом sNPP1.

Фиг.14 иллюстрирует аминокислотную последовательность TAGsNPP1. Нацеливающий фрагмент из восьми последовательных остатков аспарагиновой кислоты слит c N-концом sNPP1. Сигнальный пептид подчеркнут, а нацеливающий фрагмент обозначен жирным шрифтом.

Фиг.15 иллюстрирует аминокислотную последовательность линкерного пептида.

Фиг.16 иллюстрирует аминокислотную последовательность Fc-сегмента иммуноглобулина.

Фиг.17 иллюстрирует аминокислотную последовательность TAGsssNPP1, который содержит нацеливающий фрагмент из восьми последовательных остатков аспарагиновой кислоты, слитый с N-концом sssNPP1 посредством пептидного линкера. Fc-сегмент слит с N-концом нацеливающего фрагмента. Сигнальный пептид подчеркнут, а нацеливающий фрагмент обозначен жирным шрифтом. Пептидный линкер выделен курсивом.

Фиг.18 иллюстрирует аминокислотную последовательность TAGsssNPP1, который содержит нацеливающий фрагмент из восьми последовательных остатков аспарагиновой кислоты, слитый с С-концом sssNPP1 посредством пептидного линкера. Fc-сегмент слит с N-концом sssNPP1. Сигнальный пептид подчеркнут, а нацеливающий фрагмент обозначен жирным шрифтом. Пептидный линкер выделен курсивом.

Фиг.19 представляет собой схематическое изображение вектора экспрессии (т.е. рТТ22), содержащего конструкт TAGsNPP1. Нацеливающий фрагмент из восьми последовательных остатков аспарагиновой кислоты слит с С-концом sNPP1.

Фиг.20 иллюстрирует вестерн-блоттинг TAGsNPP1. Восстанавливающие условия; NR, невосстанавливающие условия.

На фиг.21 показана ферментативная активность TAGsNPP1, продуцированного и выделенного из клеток НЕК293.

Фиг.22А-22С иллюстрируют схему конструктов для гибридного белка TAGNPP1, описанных в данном документе.

На фиг.23 показаны уровни кальцификации гладких мышечных клеток аорты человека, обработанных растворимым sNPP1 (WT), TAGsNPP1 (D8, слитый с С-концом sNPP1) и sNPP1-Fc.

На фиг.24 представлено схематическое изображение вектора экспрессии (т.е. рТТ22), содержащего конструкт TAGsNPP1. Нацеливающий фрагмент из восьми последовательных остатков аспарагиновой кислоты (D8) слит с С-концом sNPP1.

На фиг.25 представлена последовательность нуклеиновой кислоты гибридного белка TAGsNPP1.

На фиг.26 представлена аминокислотная последовательность гибридного белка TAGsNPP1.

На фиг.27 представлено схематическое изображение вектора экспрессии (т.е. рТТ22), содержащего гибридный конструкт sNPP1-Fc.

На фиг.28 представлена последовательность нуклеиновой кислоты гибридного белка sNPP1-Fc.

На фиг.29 представлена аминокислотная последовательность гибридного белка sNPP1-Fc.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Настоящее изобретение обеспечивает новые человеческие гибридные белки NPP1, которые являются растворимыми и содержат усеченный(ые) и биологически активный(ые) домен(ы) NPP1 (т.е. NPP1-компоненты, которые содержат по меньшей мере один внеклеточный каталитический домен встречающегося в природе NPP1 для пирофосфатазной и/или фосфодиэстеразной активности) и один или несколько нацеливающих фрагментов (т.е. "TAG"). Гибридные белки NPP1 по настоящему изобретению содержат по меньшей мере домен NPP1, необходимый для осуществления пирофосфатазной и/или фосфодиэстеразной активности. Соответственно, настоящее изобретение описывает выделенные гибридные белки, которые содержат аминокислотные остатки A205-L591 из SEQ ID NO: 1, слитые с одним или несколькими нацеливающими фрагментами. Нацеливающий фрагмент может быть рекомбинантно слитым или химически связанным (например, ковалентная связь, ионная связь, гидрофобная связь и сила Ван-дер-Ваальса) с NPP1-компонентом при помощи способов, хорошо известных в данной области техники, и он направляет NPP1-компонент на определенный сайт-мишень, где присоединенный NPP1-компонент окажет желаемый эффект (например, катализ реакции, такой как растворение субстрата, такого как PPi, или предотвращение образования субстрата, такого как PPi) у субъекта, которому вводится гибридный белок по настоящему изобретению.

TAGNPP1s

Во всех гибридных белках NPP1 ("TAGNPP1s") по настоящему изобретению удалены N-концевые цитоплазматические и трансмембранные домены встречающегося в природе человеческого NPP1. Необязательно, гибридные белки TAGNPP1s по настоящему изобретению также могут содержать С-концевое усечение NPP1 дикого типа на различную длину. Аминокислотная последовательность NPP1 дикого типа полной длины приведена в SEQ ID NO: 1.

В одном варианте осуществления гибридный белок содержит полипептид, содержащий аминокислотные остатки A205-L591 из SEQ ID NO: 1 ("sssNPP1"), слитый с TAG либо по N-, либо по С-концу ("TAGsssNPP1"). В одном варианте осуществления гибридный белок содержит полипептид, содержащий аминокислотные остатки A205-D925 SEQ ID NO: 1 ("ssNPP1"), слитые с TAG либо по N-, либо по С-концу ("TAGssNPP1"). В одном варианте осуществления гибридный белок содержит полипептид, содержащий аминокислотные остатки P99-D925 из SEQ ID NO: 1 ("sNPP1"), слитые с TAG либо по N-, либо по С-концу полипептида ("TAGsNPP1"). Также предполагается любой непрерывный фрагмент sNPP1, который содержит по меньшей мере аминокислотные остатки A205-L591 из SEQ ID NO: 1, и полипептидный фрагмент слит с TAG либо по N-, либо по С-концу.

При экспрессии в клеточной культуре или трансгенном животном гибридные белки TAGNPP1 могут дополнительно содержать сигнальный пептид (или лидерную последовательность) на своем N-конце. Сигнальный пептид котрансляционно или посттрансляционно направляет транспорт гибридных белков TAGNPP1 через внутриклеточные органеллы клетки, экспрессирующей гибридные белки TAGNPP1, и, таким образом, определяет посттрансляционную модификацию гибридных белков TAGNPP1. Следует понимать, что по причине того, что сигнальный пептид отщепляется от гибридного белка на котрансляционном или посттрансляционном этапе, гибридные белки TAGNNP1, в случае если они секретированы и выделены, как правило, лишены сигнального пептида. Соответственно, в вариантах осуществления, которые направлены на последовательности нуклеиновой кислоты, кодирующие описанные гибридные белки TAGNPP1, также предполагаются лидерные последовательности, применяемые по настоящему изобретению. Например, нуклеотидная последовательность, приведенная в SEQ ID NO: 2, содержит пример лидерной последовательности для TAGNNP1 на ее 5′-конце.

Каждый из гибридных белков, раскрытых в данном документе, предусматривается с одним или несколькими нацеливающими фрагментом ("TAG"). TAG-компонент согласно настоящему изобретению содержит четыре или более отрицательно заряженных аминокислот, таких как аспарагиновая кислота и глутаминовая кислота. TAG-компонент может представлять собой фрагмент из отрицательно заряженных аминокислотных остатков, например, аспарагиновых кислот и/или глутаминовых кислот, длина которого составляет от приблизительно 4 до приблизительно 20 аминокислотных остатков. TAG может быть слит либо с N-, либо с С-концом NPP1-компонента. Также TAG может быть слит как с N-, так и с С-концом NPP1-компонента. Соответственно, аминокислотная последовательность гибридного белка TAGsNPP1, например, включает NPP1-компонент от PSCAKE до С-концевой области и один или несколько нацеливающих фрагментов (например, метка на основе полиглутаминовой кислоты или метка на основе полиаспарагиновой кислоты) в N- и/или С-концевой области NPP1-компонента. Гибридный белок, содержащий NPP1-компонент с TAG, слитым с С-концом, представляет собой особенно подходящий вариант осуществления. В одном очень специфическом варианте осуществления используется TAG с фрагментом из восьми аспарагиновых кислот, как можно видеть в иллюстративных последовательностях для TAGsNPP1 и TAGssNPP1 на фигурах, хотя может применяться любое подходящее количество отрицательно заряженных аминокислотных остатков (например, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17 или 18) в соответствии с настоящим изобретением. На фигурах TAG-компонент обозначен как "А".

Настоящее изобретение также охватывает полинуклеотиды, которые кодируют различные гибридные белки TAGNPP1, описанные в данном документе. Соответственно, любую последовательность нуклеиновой кислоты, которая кодирует аминокислотную последовательность любого гибридного белка TAGNPP1, можно применять для создания рекомбинантных молекул, которые экспрессируют соответствующий гибридный белок TAGNPP1. В конкретном варианте осуществления настоящее изобретение охватывает полинуклеотид, содержащий последовательность нуклеиновой кислоты из SEQ ID NO: 2., как показано на ФИГ.2.

В определенных специфических вариантах осуществления гибридный белок содержит несколько полипептидов, описанных в данном документе, или он содержит по меньшей мере один полипептид, описанный в данном документе, и неродственную последовательность. Определенный предпочтительный полипептид, например, может способствовать димеризации и стабильности или снижать до минимума агрегацию гибридных белков. Например, дополнительный полипептид может представлять собой Fc-участок иммуноглобулина G1 для повышения стабильности в сыворотке. Применение Fc-сегмента хорошо известно в данной области техники и описано в патенте США №7902151 и патенте США №7858297, содержание которых включено в данный документ при помощи ссылки во всей их полноте. Богатый цистеином участок NPP1 дикого типа (например, от PSCAKE до NEPQCP; аминокислотная последовательность от Р99 до Р204 из SEQ ID NO: 1) можно использовать для обеспечения димеризации гибридных белков TAGNPP1.

В другом варианте осуществления полиэтиленгликоль (PEG) можно конъюгировать с гибридными белками TAGNPP1. Другие полипептиды можно выбрать с тем, чтобы снизить до минимума агрегацию и иммуногенность, увеличить растворимость белка, или чтобы обеспечить нацеливание белка на необходимые участки, имеющие клиническое или биологическое значение.

Также TAGNPP1 можно слить или конъюгировать с соответствующим полипептидным линкером или другой последовательностью для облегчения идентификации, синтеза или очистки гибридного белка, или для лучшего сохранения нативной структуры NPP1-компонента, что может повышать активность и нацеливание TAGNPP1. В частности, последовательность пептидного линкера можно использовать для разделения первого и второго полипептидного компонентов на расстоянии, достаточном для того, чтобы обеспечить укладку каждого полипептида во вторичную и третичную структуры. Такую последовательность пептидного линкера встраивают в гибридный белок между NPP1-компонентом и TAG-компонентом с использованием стандартных методик, хорошо известных в данной области техники. Подходящие последовательности пептидного линкера можно выбрать исходя из их способности принимать гибкую растянутую конформацию и их неспособности принимать вторичную структуру, которая могла бы взаимодействовать с функциональной частью NPP1, TAG или других вторичных полипептидов, описанных в данном документе (например, Fc). Предпочтительные последовательности пептидного линкера содержат остатки Gly, His, Asn и Ser. Пригодные пептидные линкеры без ограничения включают поли-Gly, поли-His, поли-Asn или поли-Ser. Другие почти нейтральные аминокислоты, такие как Thr и Ala, также можно использовать в линкерной последовательности. Аминокислотные последовательности, которые можно успешно использовать в качестве линкеров, включают последовательности, раскрытые в Maratea et al., Gene 40: 39-46, 1985; Murphy et al., Proc. Natl. Acad Sci. USA 83: 8258-8262, 1986; патенте США №4935233 и патенте США №4751180. Линкерная последовательность может иметь длину от 1 до приблизительно 20 аминокислотных остатков. Предпочтительно полипептидный линкер имеет длину от приблизительно 8 до приблизительно 12 аминокислот. В предпочтительном варианте осуществления пептидный линкер, который применяется в настоящем изобретении, представляет собой GGGGSGGGGS (SEQ ID NO: 15), однако, можно использовать любую функциональную комбинацию Gly, Ser, His или Asn.

Гибридные белки также могут содержать TAGNPP1 по настоящему изобретению вместе с неродственным полипептидом. Предпочтительно неродственный полипептид способен улучшить нацеливание гибридного белка на участок, имеющий клиническое или биологическое значение (например, участок кальцификации). Например, пептиды, которые имеют высокое сродство к кости, описаны в патенте США №7323542, содержание которого включено в данный документ при помощи ссылки во всей полноте.

TAGNPP1 можно получить с использованием стандартных способов, включая рекомбинантные методики или химическое конъюгирование, хорошо известные в данной области техники. Методики, пригодные для выделения и характеристики нуклеиновых кислот и белков по настоящему изобретению, хорошо известны специалистам в данной области техники, и для того, чтобы выбрать подходящие протоколы для применения без ненужного экспериментирования, можно обращаться за информацией к стандартным руководствам по молекулярной биологии и биохимии. См., например, Sambrook et al, 1989, "Molecular Cloning: A Laboratory Manual," 2nd ed., Cold Spring Harbor, содержание которого включено в данный документ при помощи ссылки во всей его полноте. Вкратце, последовательности ДНК, кодирующие полипептидные компоненты, можно собрать отдельно и лигировать в соответствующий вектор экспрессии. Например, 3′-конец последовательности ДНК, кодирующей NPP1-компонент, лигирован, с пептидным линкером или без него, с 5′-концом последовательности ДНК, кодирующей второй полипептидный компонент, такой как TAG PEG или Fc, так чтобы рамки считывания последовательностей были в фазе. Это дает возможность трансляции с образованием одного гибридного белка, который сохраняет биологическую активность полипептидов обоих компонентов. Лигированные последовательности ДНК функционально связаны с подходящими регуляторными элементами транскрипции или трансляции, в том числе промотором. Регуляторные элементы, которые отвечают за экспрессию ДНК, расположены только 5′ по отношению к последовательности ДНК, кодирующей первый полипептид, такой как лидерная последовательность, кодирующая сигнальный пептид. Аналогично, стоп-кодоны, необходимые для завершения трансляции, и сигналы терминации транскрипции присутствуют только 3′ по отношению к последовательности ДНК, кодирующей второй полипептид.

Настоящее изобретение также охватывает варианты TAGNPP1. Предпочтительным вариантом TAGNPP1 является вариант, характеризующийся 80%, 85%, 90%, 95% и более предпочтительно 96% идентичностью аминокислотной последовательности с аминокислотной последовательностью A205-L591 из SEQ ID NO: 1. Наиболее предпочтительным вариантом TAGNPP1 является вариант, характеризующийся по меньшей мере 97% идентичностью аминокислотной последовательности с аминокислотной последовательностью A205-L591 из SEQ ID NO: 1.

Настоящее изобретение также относится к полинуклеотидной последовательности, содержащей комплементарную цепь SEQ ID NO: 2 или ее варианты. Кроме того, настоящее изобретение также описывает полинуклеотидные последовательности, которые гибридизируются в жестких условиях с SEQ ID NO: 2 и антисмысловая последовательность которых является на 85%, 90%, 95%, 97%, 98% или 99% идентичной SEQ ID NO: 2. Условия гибридизации основаны на температуре плавления (Tm) связывающего нуклеиновые кислоты комплекса или зонда, как указано в Wahl, G.M. and S.L. Berger (1987; Methods Enzymol. 152: 399-407) и Kimmel, A.R. (1987; Methods Enzymol. 152: 507-511), и их можно использовать при определенной жесткости.

Настоящее изобретение дополнительно предусматривает последовательности нуклеиновой кислоты, кодирующие полипептиды, олигонуклеотиды, пептидные нуклеиновые кислоты (PNA), их фрагменты, части или антисмысловые молекулы.

Хотя нуклеотидные последовательности, которые кодируют TAGNPP1 и его варианты, предпочтительно способны гибридизироваться с нуклеотидной последовательностью TAGNPP1 при соответствующим образом выбранной жесткости условий, может быть преимущественным получить нуклеотидные последовательности, кодирующие TAGNPP1 или его производные, имеющие существенно отличающуюся частоту использования кодонов. Кодоны можно выбрать так, чтобы увеличить скорость, с которой осуществляется экспрессия пептида в определенном прокариотическом или эукариотическом хозяине, в соответствии с частотой, с которой определенные кодоны используются хозяином. Другие причины для существенного изменения нуклеотидной последовательности, кодирующей TAGNPP1 и его производные, без изменения кодируемых аминокислотных последовательностей включают получение РНК-транскриптов, характеризующихся более желательными свойствами, такими как более продолжительное время полужизни.

Измененные последовательности нуклеиновой кислоты, кодирующие TAGNPP1, которые охвачены настоящим изобретением, включают делеции, вставки или замены различных нуклеотидов, что приводит к полинуклеотиду, который кодирует такой же TAGNPP1 или его функциональный эквивалент. Кодируемый белок также может содержать делеции, вставки или замены аминокислотных остатков, что производит "молчащее" изменение и приводит к функциональному эквиваленту TAGNPP1. Преднамеренные замены аминокислот можно осуществлять на основе сходства по полярности, заряду, растворимости, гидрофобности, гидрофильности и/или амфипатической природе остатков при условии, что биологическая активность TAGNPP1 сохраняется. Например, положительно заряженные аминокислотные остатки включают Lys и Arg; отрицательно заряженные аминокислотные остатки включают Asp и Glu; и аминокислоты с незаряженными полярными головными группами, характеризующиеся сходной гидрофильностью, могут включать Leu, Ile и Val; Gly и Ala; Asp и Gln; Ser и Thr; Phe и Tyr.

Вектор экспрессии

Способы, которые хорошо известны специалистам в данной области техники, можно применять для конструирования векторов экспрессии, содержащих последовательности, кодирующие TAGNPP1 и соответствующие регуляторные элементы транскрипции и трансляции. Эти способы включают in vitro методики рекомбинантной ДНК, синтетические методики и генетическую рекомбинацию in vivo. Такие методики описаны, например, в Sambrook, J. et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y., and Ausubel, F.M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., содержание которых включено в данный документ при помощи ссылки во всей их полноте.

Ряд систем вектор экспрессии/хозяин можно использовать для того, чтобы вмещать и экспрессировать последовательности, кодирующие TAGNPP1. Они без ограничения включают микроорганизмы, такие как бактерии, трансформированные рекомбинантным бактериофагом, плазмидными или космидными векторами экспрессии ДНК; дрожжи, трансформированные векторами для экспрессии в дрожжах; система на основе клеток насекомых, инфицированных вирусными векторами экспрессии (например, бакуловирус) или бактериальным вектором экспрессии (например, плазмиды Ti или pBR322); или системы на основе клеток животных (например, вектор рТТ22).

Регуляторные элементы или регуляторные последовательности могут содержать такие нетранслируемые участки вектора - энхансеры, промоторы, 5′- и 3′-нетранслируемые участки, которые взаимодействуют с клеточными белками хозяина для осуществления транскрипции и трансляции. Такие элементы могут варьировать по своей силе и специфичности. В зависимости от используемых векторной системы и хозяина можно использовать любое количество подходящих элементов транскрипции и трансляции, включая тканеспецифические, конститутивные и индуцируемые промоторы. Например, при клонировании в бактериальных системах можно использовать индуцируемые промоторы, такие как гибридный промотор lacZ фагмиды Bluescript™ (Stratagene, Ла-Хойя, Калифорния) или плазмиды pSport1™ (Gibco BRL) и т.п. В системах на основе клеток млекопитающих промоторы из генов млекопитающих или из вирусов млекопитающих являются предпочтительными. Если необходимо создать клеточную линию, которая содержит множество копий последовательности, кодирующей TAGNPP1, можно использовать векторы на основе SV40 или EBV с соответствующим селектируемым маркером. При использовании системы экспрессии на основе клеток птиц подходящие векторы для экспрессии множества конструктов TAGNPP1 описаны в патенте США №6730822; патенте США №6825396; патенте США №6875588; патенте США №7294507; патенте США №7521591; патенте США №7534929 и заявке на патент США сер. №11/376023, содержание которых включено в данный документ при помощи ссылки во всей их полноте. Вкратце, при использовании системы экспрессии на основе клеток птиц для экспрессии TAGNPP1 предусматриваются подходящие яйцевод-специфические промоторы, например и без ограничения, промоторы овомукоида, промоторы овальбумина, промоторы лизоцима, промоторы кональбумина, промоторы овомуцина, промоторы овотрансферрина и функциональные части каждого из этих промоторов. Подходящие неспецифические промоторы могут включать, например и без ограничения, промоторы цитомегаловируса (CMV), промоторы MDOT и промоторы вируса саркомы Рауса (RSV), промоторы вируса лейкемии мышей (MLV), промоторы вируса опухоли молочной железы мышей (MMTV), и промоторы SV40, и функциональные части каждого из этих промоторов. Неограничивающие примеры других промоторов, которые могут быть пригодными по настоящему изобретению, без ограничения включают промоторы Pol III (например, тип 1, тип 2 и тип 3 промоторов Pol III), такие как промоторы H1, промоторы U6, промоторы тРНК, промоторы РНКазы MPR и функциональные части каждого из этих промоторов. Как правило, функциональные терминаторные последовательности выбираются для применения по настоящему изобретению в соответствии с промотором, который используется.

Клетки-хозяева

Настоящее изобретение предусматривает продуцирование растворимого TAGNPP1 в системе на основе клеток трансгенных птиц (например, трансгенных кур), хорошо известной в данной области техники, например, в патенте США №7534929, раскрытие которого включено в данный документ при помощи ссылки во всей его полноте. Продуцирование в системе на основе клеток птиц (например, в яйцеводе птиц) NPP1-компонента с нацеливающим фрагментом или без него (например, ssNPP1, sNPP1, TAGsNPP1 и TAGssNPP1) охвачено объемом настоящего изобретения. Кроме того, TAGNPP1, продуцируемый в любой подходящей системе экспрессии белка, без ограничения включая трансгенных птиц, трансгенное млекопитающее, клеточные культуры (например, клетки СНО, клетки НЕК293 и клетки COS), бактерии, такие как Е.coli, трансгенных животных, таких как млекопитающие и птицы (например, куры, перепел, утка и индейка), и в растительной системе, включая ряску, предусмотрен в данном документе.

Линию клеток-хозяев можно выбрать, основываясь на ее способности необходимым образом регулировать экспрессию вставленных последовательностей или процессировать экспрессируемый TAGNPP1s. Такие модификации полипептида TAGNNP1 без ограничения включают ацетилирование, карбоксилирование, сиалирование, гликозилирование, фосфорилирование, липидизацию и ацилирование. Различные клетки-хозяева, такие как СНО, COS, HeLa, MDCK, НЕК293 и W138, которые обладают специфическим клеточным аппаратом и характерными механизмами для таких посттрансляционных процессов, можно выбрать для обеспечения надлежащей модификации и процессинга гибридного белка по настоящему изобретению. Линия опухолевых клеток птиц также предусматривается в качестве клетки-хозяина для экспрессии полипептида по настоящему изобретению. Примеры подходящих линий клеток птиц (например, линия клеток опухоли яйцевода птиц), которые можно использовать по настоящему изобретению, описаны в публикации патентного документа США №2009/0253176, содержание которого включено в данный документ при помощи ссылки во всей полноте.

Получение TAGNPP1

TAGNPP1 можно получить с применением любой из множества хорошо известных методик. TAGNPP1, кодируемый последовательностями ДНК, описанными выше, можно легко получить исходя из последовательностей ДНК с применением любого из множества векторов экспрессии, описанных в данном документе или хорошо известных специалистам в данной области техники. Экспрессию можно осуществлять в любой подходящей клетке-хозяине, которую трансформировали или трансфицировали вектором экспрессии, содержащим молекулу ДНК, которая кодирует рекомбинантный полипептид по настоящему изобретению. Супернатанты из подходящих систем хозяин/вектор, которые секретируют рекомбинантный гибридный белок или полипептид в культуральную среду, можно сначала концентрировать с использованием коммерчески доступного фильтра. После концентрирования концентрат можно перенести на подходящую матрицу для очистки, такую как афинную матрицу или ионообменную смолу. Можно использовать один или несколько этапов обращенно-фазовой HPLC для дополнительной очистки рекомбинантного полипептида.

Для получения рекомбинантных белков с большим выходом стабильная экспрессия является предпочтительной. Клеточные линии, стабильно экспрессирующие TAGNPP1, можно трансформировать с применением векторов экспрессии, которые содержат вирусные точки начала репликации, и/или эндогенные элементы регуляции экспрессии, и/или селектируемый маркерный ген на одном и том же или на отдельном векторе. После введения вектора можно обеспечить рост клеток в течение 1-2 дней в обогащенной среде перед тем, как перенести их на селективную среду. Назначение селектируемого маркера состоит в том, чтобы придать устойчивость к отбору, и его наличие делает возможным рост и выделение клеток, которые успешно экспрессируют введенные последовательности. Можно обеспечивать пролиферацию устойчивых клонов стабильно трансформированных клеток с применением методик тканевых культур, соответствующих типу клеток. Способы продуцирования экзогенного белка в линиях клеток млекопитающих хорошо известны в данной области техники. Иллюстративные примеры этого и других аспектов и вариантов осуществления настоящего изобретения применительно к продуцированию гетерологичных полипептидов, таких как гибридные белки TAGNPP1, в клетках птиц полностью раскрыты в заявке на патент США, серийный №09/877374, поданной 8 июня 2001 года, опубликованной как патентный документ США 2002/0108132 - А1 8 августа 2002 года, и заявке на патент США, серийный №10/251364, поданной 18 сентября 2002 года, каждая из которых включена в данный документ при помощи ссылки во всей ее полноте. Примеры продуцирования экзогенных белков в линиях опухолевых клеток птиц также описаны в публикации патентного документа США №2009/0253176, содержание которого включено в данный документ при помощи ссылки во всей его полноте.

Настоящее изобретение, в частности, предусматривает продуцирование белков TAGNPP1, раскрытых в данном документе, в трансгенной системе на основе клеток птиц. В одном особенно подходящем варианте осуществления настоящее изобретение сводится к продуцированию TAGNPP1, который может продуцироваться в яйцеводе трансгенных птиц, таких как курица, в соответствии с настоящем изобретением. Примеры продуцирования экзогенных белков в системе экспрессии на основе клеток трансгенных птиц также описаны в патенте США №6730822, содержание которого включено в данный документ при помощи ссылки во всей полноте. Вкратце, подходящий вектор для птиц, описанный выше, который содержит последовательность нуклеиновой кислоты, кодирующую гибридный белок TAGNPP1, функционально связанную с тканеспецифическим или конститутивным промотором, который управляет экспрессией кодирующей последовательности в яйцеводе курицы, вводят в эмбриональные клетки курицы стадии X. Трансформированные эмбриональные клетки инкубируют при условиях, благоприятных для выведения живых цыплят. Живых цыплят выращивают до зрелых химерных кур, которых скрещивают с нетрансгенными курами естественным путем или посредством искусственного оплодотворения. Трансгенных кур выявляют посредством скрининга потомства на предмет включения кодирующей белок последовательности в зародышевую линию. Трансгенное потомство можно скрещивать с другими трансгенными или нетрансгенными курами с получением яиц, содержащих гибридный белок TAGNPP1. Затем TAGNPP1 выделяют и очищают при помощи способов, хорошо известных в данной области техники. Соответственно, настоящее изобретение обеспечивает рекомбинантные гибридные белки TAGNPP1, которые были продуцированы трансгенными птицами.

Фармацевтическая композиция

Настоящее изобретение также описывает фармацевтические композиции, содержащие выделенный и в значительной степени очищенный TAGNPP1 или его фармацевтически приемлемую соль. Фармацевтическая композиция по настоящему изобретению также может включать фармацевтически приемлемый носитель или наполнитель для него. Композиции, содержащие такие носители, в том числе сложные молекулы, составлены с помощью хорошо известных традиционных способов (см., например, Remington′s Pharmaceutical Sciences, 14th Ed., Mack Publishing Co., Easton, Pa.), содержание которого включено в данный документ при помощи ссылки во всей полноте. Носитель может содержать разбавитель. В одном варианте осуществления фармацевтический носитель может представлять собой жидкость и гибридный белок может находиться в форме раствора. Фармацевтический носитель может представлять собой воск, жир или спирт. В другом варианте осуществления фармацевтически приемлемый носитель может представлять собой твердое вещество в форме порошка, лиофилизированного порошка или таблетки. В одном варианте осуществления носитель может состоять из липосом или микрокапсул.

Фармацевтические композиции могут находиться в форме стерильного лиофилизированного порошка для инъекции после растворения в разбавителе. Разбавитель может представлять собой воду для инъекции, бактериостатическую воду для инъекции или стерильный солевой раствор. Лиофилизированный порошок можно получить путем лиофилизации раствора гибридного белка с получением белка в сухой форме. Как известно в данной области техники, лиофилизированный белок, как правило, характеризуется повышенной стабильностью и более длительным сроком хранения, чем жидкий раствор белка.

Определения

Используемое в данном документе выражение "приемлемый" по отношению к составу, композиции или ингредиенту, используемым в данном документе, означает не оказывающий постоянное вредное влияние на общее состояние здоровья субъекта, лечение которого осуществляется.

Используемое в данном документе выражение "введение" или "вводить" относится к доставке гибридного белка по настоящему изобретению субъекту, нуждающемуся в лечении.

"Изменения", как используется в данном документе, охватывают любое изменение в последовательности полинуклеотидов, кодирующих TAGNPP1, включая делеции, вставки и точковые мутации, которые можно обнаружить с применением гибридизационных анализов.

Выражение "животное", используемое в данном документе, включает всех позвоночных животных, в том числе птиц и млекопитающих, таких как крыса, мышь и человек. Оно также включает отдельное животное на всех стадиях развития, включая стадии эмбриона и плода.

"Аминокислотная последовательность" упоминается в данном документе для обозначения аминокислотной последовательности молекулы гибридного белка, при этом "аминокислотная последовательность" и подобные выражения, например "полипептид" или "белок", не предназначены для ограничения аминокислотной последовательности полной аминокислотной последовательностью, ассоциированной с упомянутой молекулой белка или полипептида.

Выражение "птица", используемое в данном документе, относится к любому виду, подвиду или линии организмов таксономического класса птицы, например, но без ограничения, таким организмам как курица, индейка, утка, гусь, перепел, фазаны, попугаи, зяблики, ястребы, вороны и бескилевые, в том числе страус, эму и казуар. Выражение включает различные известные линии Gallus gallus, или кур (например, White Leghorn, Brown Leghorn, Barred-Rock, Sussex, New Hampshire, Rhode Island, Ausstralorp, Minorca, Amrox, California Gray, Italian Partridge-colored), наряду с линиями индеек, фазанов, перепелов, уток, страусов и других домашних птиц, которых обычно разводят в промышленных количествах.

Фраза "на основе" или "полученный из", а именно ретровирусный вектор на основе определенного ретровируса, или полученный из него, или на основе нуклеотидной последовательности определенного ретровируса, означает, что геном ретровирусного вектора содержит значительную часть нуклеотидной последовательности генома определенного ретровируса. Значительная часть может представлять собой определенный ген или нуклеотидную последовательность, такую как нуклеотидная последовательность, кодирующая белки gag, pol и/или env, или другую структурную или функциональную нуклеотидную последовательность вирусного генома, такую как последовательности, кодирующие LTR, или может представлять собой, по существу, полный ретровирусный геном, например, большую часть (например, более 60%, или более 70%, или более 80%, или более 90%) или весь ретровирусный геном, что будет очевидно из контекста описания в силу знания специалиста в данной области техники. Примерами ретровирусных векторов на основе ретровируса или полученных из него являются ретровирусные векторы NL (например, NLB) на основе ретровируса ALV, как раскрыто в Cosset et al., Journal of Virology (1991) vol 65, p 3388-3394.

Выражение "биологически активный", используемое в данном документе, относится к гибридному белку, характеризующемуся структурными, регуляторными или биохимическими функциями пирофосфатазы/фосфодиэстеразы встречающегося в природе белка NPP1.

Выражение ′′конструкт", используемое в данном документе, относится к линейной или кольцевой нуклеотидной последовательности, такой как ДНК, которую собрали из более одного сегмента нуклеотидной последовательности, которую выделили из природного источника или синтезировали химически, или их комбинациям.

Выражение "комплементарный", используемое в данном документе, относится к двум молекулам нуклеиновой кислоты, которые могут образовать специфические взаимодействия друг с другом. При специфических взаимодействиях основание аденин из одной нити нуклеиновой кислоты может образовать две водородные связи с тимином из второй нити нуклеиновой кислоты, когда две нити нуклеиновой кислоты противоположно направлены. Также при специфических взаимодействиях основание гуанин из одной нити нуклеиновой кислоты может образовать три водородные связи с цитозином из второй нити нуклеиновой кислоты, когда две нити нуклеиновой кислоты противоположно направлены. Комплементарные нуклеиновые кислоты, как упоминается в данном документе, могут дополнительно содержать модифицированные основания, причем модифицированный аденин может образовать водородные связи с тимином или модифицированным тимином, а модифицированный цитозин может образовать водородные связи с гуанином или модифицированным гуанином.

"Делеция", как используется в данном документе, относится к изменению либо в аминокислотной, либо в нуклеотидной последовательности, в которой один или несколько аминокислотных или нуклеотидных остатков соответственно отсутствует.

Выражение "экспрессированный" или "экспрессия", используемое в данном документе, относится к транскрипции гена с образованием молекулы нуклеиновой кислоты РНК, по меньшей мере частично комплементарной участку одной из двух нитей нуклеиновой кислоты гена. Выражение "экспрессированный" или "экспрессия", используемое в данном документе, также может относиться к трансляции РНК с образованием белка или пептида.

Выражение "вектор экспрессии", используемое в данном документе, относится к вектору на основе нуклеиновой кислоты, который содержит участок, регулирующий экспрессию гена, такой как промотор или компонент промотора, функционально связанный с нуклеотидной последовательностью, кодирующей по меньшей мере один полипептид.

"Функциональная часть" или "функциональный фрагмент" используются взаимозаменяемо и применительно к данному документу означают часть или фрагмент целого, способные полностью или частично выполнять функцию целого. Например, под биологически функциональной частью молекулы подразумевается часть молекулы, которая выполняет биологическую функцию целой или интактной молекулы. Например, функциональная часть участка, регулирующего экспрессию гена, представляет собой фрагмент или часть указанного участка, регулирующего экспрессию гена, который полностью или частично регулирует или управляет экспрессией гена (например, обеспечивает либо полностью, либо частично) в биологической системе (например, промотор). Функциональные части могут быть любого подходящего размера.

Выражение "участок, регулирующий экспрессию гена", используемое в данном документе, относится к нуклеотидным последовательностям, которые связаны с кодирующей последовательностью и которые полностью или частично регулируют экспрессию кодирующей последовательности, например, полностью или частично регулируют транскрипцию кодирующей последовательности. Участки, регулирующие экспрессию гена, можно выделить из встречающегося в природе источника или можно синтезировать химически и можно встраивать в вектор на основе нуклеиновой кислоты для обеспечения регулируемой транскрипции в соответствующих клетках. "Участки, регулирующие экспрессию гена" могут предшествовать, но без ограничения этим, участку последовательности нуклеиновой кислоты, который расположен в пределах участка 5′ от конца кодирующей последовательности, которая может транскрибироваться в мРНК.

Выражения "гетерологичный", "экзогенный" и "чужеродный" используются взаимозаменяемо в данном документе и, как правило, относятся к биомолекуле, такой как нуклеиновая кислота или белок, которая в норме не обнаруживается в определенном организме или в определенной клетке, ткани или другом компоненте, содержащемся в организме или продуцируемом ним. Например, белок, который является гетерологичным или экзогенным по отношению к яйцу, представляет собой белок, который в норме не обнаруживается в яйце. Используемые в данном документе выражения "гетерологичный", "экзогенный" и "чужеродный" по отношению к нуклеиновым кислотам, таким как ДНК и РНК, используются взаимозаменяемо и относятся к нуклеиновой кислоте, которая не встречается в природе как часть хромосомы, генома или клетки, в которой она присутствует, или которая обнаруживается в местах(е) и/или в количествах, которые отличаются от мест(а) и/или количеств, в которых она встречается в природе. Она может представлять собой нуклеиновую кислоту, которая не является эндогенной по отношению к геному, хромосоме или клетке, и была экзогенно введена в геном, хромосому или клетку. Примеры гетерологичной ДНК без ограничения включают ДНК, содержащую регуляторный участок для экспрессии гена, и ДНК, которая кодирует продукт или продукты, например, РНК или белковый продукт. Примеры гетерологичной ДНК без ограничения включают участки, регулирующие экспрессию гена, или промоторы, раскрытые в данном документе, если они выделены из птицы и используются в дальнейшем, например, после повторного введения в геном птицы.

Выражение "выделенная нуклеиновая кислота", используемое в данном документе, охватывает, например, (а) ДНК, которая имеет последовательность части встречающейся в природе геномной молекулы, но не фланкирована по меньшей мере одной из последовательностей, которые фланкируют эту часть молекулы в геноме вида, у которого она встречается в природных условиях; (b) нуклеиновую кислоту, которую встроили в вектор или в геномную ДНК прокариота или эукариота таким образом, что полученный в результате вектор или геномная ДНК не идентичны встречающейся в природе ДНК, из которой нуклеиновая кислота была получена; (с) отдельную молекулу, такую как кДНК, геномный фрагмент, фрагмент, полученный с помощью полимеразной цепной реакции (ПЦР), лигазной цепной реакции (LCR) или химического синтеза, или рестрикционный фрагмент; (d) рекомбинантную нуклеотидную последовательность, которая представляет собой часть гибридного гена, т.е. гена, кодирующего гибридный белок, и (е) рекомбинантную нуклеотидную последовательность, которая представляет собой часть гибридной последовательности, которая не встречается в природе. Выделенные молекулы нуклеиновой кислоты по настоящему изобретению могут включать, например, природные аллельные варианты наряду с молекулами нуклеиновой кислоты, модифицированными делениями, вставками, инверсиями или заменами нуклеотидов.

"Вставка" или "добавление", как используется в данном документе, относятся к изменению в аминокислотной или нуклеотидной последовательности, которое приводит в результате к добавлению одного или нескольких аминокислотных или нуклеотидных остатков, соответственно, по сравнению с молекулой TAGNPP1.

Выражение "нуклеиновая кислота", используемое в данном документе, относится к любому линейному или непрерывному ряду нуклеотидов и нуклеозидов, например, кДНК, геномная ДНК, мРНК, тРНК, олигонуклеотиды, олигонуклеозиды и их производные. Для удобства обсуждения нуклеиновые кислоты, не встречающиеся в природе, в данном документе могут быть названы конструктами. Нуклеиновые кислоты могут включать векторы на основе бактериальных плазмид, в том числе векторы для экспрессии, клонирования, космидные векторы и векторы для трансформации, например, векторы на основе вирусов животных, таких как, но без ограничения, модифицированный аденовирус, вирус гриппа, вирус полиомиелита, поксвирус, векторы на основе ретровирусов, такие как ретровирусный вектор на основе вируса лейкоза птиц (ALV), ретровирусный вектор на основе вируса лейкемии мышей (MLV), и лентивирусный вектор, и т.п., и их фрагменты. Кроме того, нуклеиновая кислота может представлять собой LTR ретровирусного вектора на основе вируса лейкоза птиц (ALV), ретровирусного вектора на основе вируса лейкемии мышей (MLV) или лентивирусного вектора и их фрагментов. Нуклеиновые кислоты также могут включать векторы NL, такие как NLB, NLD и NLA, и их фрагменты и синтетические олигонуклеотиды, такие как химически синтезированная ДНК или РНК. Нуклеиновые кислоты могут включать модифицированные или дериватизированные нуклеотиды и нуклеозиды, такие как, но без ограничения, галогенированные нуклеотиды, такие как, но не только, 5-бромурацил, и дериватизированные нуклеотиды, такие как нуклеотиды, меченные биотином.

"Последовательность нуклеиновой кислоты", как используется в данном документе, относится к олигонуклеотиду, нуклеотиду или полинуклеотиду, и их фрагментам или частям, и к ДНК или РНК геномного или синтетического происхождения, которые могут быть одно- или двухцепочечными и представлять собой смысловую или антисмысловую нить.

Выражение "функционально связанный" относится к расположению элементов, где описанные таким образом компоненты сконфигурированы так, чтобы выполнять свою обычную функцию. Участки, регулирующие экспрессию гена, или промоторы (например, компоненты промотора), функционально связанные с кодирующей последовательностью, способны оказывать влияние на экспрессию кодирующей последовательности. Регулирующие последовательности могут не быть смежными с кодирующей последовательностью при условии, что они функционируют, управляя ее экспрессией. Таким образом, например, вставочные нетранслируемые, хотя и транскрибируемые последовательности могут находиться между промоторной последовательностью и кодирующей последовательностью, и промоторная последовательность тем не менее может считаться "функционально связанной" с кодирующей последовательностью.

Выражение "яйцевод-специфический промотор", используемое в данном документе, относится к промоторам и компонентам промотора, которые являются функциональными, т.е. обеспечивают транскрипцию кодирующей последовательности в значительной степени, например, преимущественно (т.е. более 50% продукта транскрипции, продуцируемого у животного с помощью определенного типа промотора, продуцируется в клетках яйцевода) или исключительно в клетках яйцевода птицы. Примеры подходящих яйцевод-специфических промоторов без ограничения включают промотор овальбумина, промотор овомукоида, промотор овоингибитора, промотор лизоцима, и промотор овотрансферрина, и функциональные части этих промоторов, например, компоненты промотора.

Выражения "полинуклеотид", "олигонуклеотид", "нуклеотидная последовательность" и "последовательность нуклеиновой кислоты" могут использоваться взаимозаменяемо в данном документе и без ограничения включают кодирующие последовательности, т.е. полинуклеотид(ы) или последовательность(и) нуклеиновой кислоты, которые транскрибируются и транслируются в полипептид in vitro или in vivo, когда находятся под управлением соответствующих регуляторных или управляющих последовательностей; регулирующие последовательности, например, старт- и стоп-кодоны трансляции, промоторные последовательности, сайты связывания рибосом, сигналы полиаденилирования, сайты связывания факторов транскрипции, последовательности терминации транскрипции, регуляторные домены выше и ниже по ходу транскрипции, энхансеры, сайленсеры, последовательности ДНК, с которыми фактор(ы) транскрипции связываются и изменяют активность промотора гена либо положительно (индукция), либо отрицательно (репрессия) и т.п. Выражения, описанные в данном документе, не предполагают никакого ограничения в зависимости от длины или синтетического происхождения.

Используемые в данном документе выражения "полипептид" и "белок" могут использоваться взаимозаменяемо и относятся к полимеру на основе аминокислот из трех или более аминокислот в последовательном ряду, связанных посредством пептидных связей. Выражение "полипептид" включает белки, такие как гибридные белки, фрагменты белков, аналоги белков, олигопептиды и т.п. Выражение "полипептиды" включает полипептиды, как определено выше, которые кодируются нуклеиновыми кислотами, полученными при помощи рекомбинантной технологии (например, выделенные из трансгенной птицы) или синтезированными химически.

Используемое в данном документе выражение "промотор" относится к последовательности ДНК, пригодной для инициации начала транскрипции при помощи РНК-полимеразы в клетке птицы. "Компонент промотора" представляет собой последовательность ДНК, которая сама по себе или в сочетании с другими последовательностями ДНК может оказывать влияние на транскрипцию или обеспечивать ее. Специфические компоненты промотора, такие как компоненты промотора овальбумина, компоненты промотора овомукоида, и компоненты промотора лизоцима, и другие промоторы и компоненты промотора, раскрытые и заявленные в данном документе, не описывают специфическую промоторную последовательность. Скорее они охватывают любую последовательность или фрагмент последовательности соответствующего промотора, которая является пригодной для того, чтобы оказывать влияние на транскрипцию кодирующей последовательности или обеспечивать ее. Например, компонент промотора овомукоида без ограничения включает приблизительно 1,8 т.п.о., приблизительно 3,9 т.п.о. и приблизительно 10 т.п.о. промоторов гена овомукоида, раскрытых в публикации патентного документа США №11/649543, опубликованной 17 мая 2007 года, которая включена в данный документ при помощи ссылки во всей полноте. "Компоненты промотора" также могут охватывать перестроенные участки, регулирующие экспрессию гена, которые функционируют с инициацией транскрипции для образования РНК, и гибридные молекулы ДНК, состоящие из встречающихся в природе последовательностей ДНК, и/или синтетические последовательности ДНК, которые функционируют с инициацией транскрипции для образования РНК.

Выражения "рекомбинантная нуклеиновая кислота" и "рекомбинантная ДНК", используемые в данном документе, относятся к комбинациям по меньшей мере двух последовательностей нуклеиновой кислоты, которые не обнаруживаются в природных условиях в эукариотической или прокариотической клетке. Последовательности нуклеиновой кислоты могут без ограничения включать векторы на основе нуклеиновой кислоты, регуляторные элементы экспрессии гена, точки начала репликации, подходящие последовательности генов, которые при экспрессии обеспечивают устойчивость к антибиотикам, кодирующие белок последовательности и т.п. Выражение "рекомбинантный полипептид" или "рекомбинантный белок" следует понимать как включающее полипептид, полученный с помощью методик рекомбинантной ДНК, так что он отличается от встречающегося в природе полипептида либо по своей локализации, либо чистоте, либо структуре. Как правило, такой рекомбинантный полипептид будет присутствовать в клетке в количестве, отличном от того, которое в норме наблюдается в природе.

Выражение "жесткие условия", используемое в данном документе, относится к "жесткости", которая имеет место в пределах от приблизительно Tm - 5°С (на 5°С ниже температуры плавления (Tm) зонда) до приблизительно 20°С-25°С ниже Tm. Специалистам в данной области техники будет понятно, что жесткость гибридизации можно изменить для распознавания или выявления идентичных или родственных полинуклеотидных последовательностей.

Используемое в данном документе выражение "субъект" или "пациент" охватывает млекопитающих и животных, не относящихся к млекопитающим. Примеры млекопитающих без ограничения включают людей, шимпанзе, человекообразных обезьян, крупный рогатый скот, лошадей, овец, коз, свиней; кроликов, собак, кошек, крыс, мышей, морских свинок и т.п. Примеры животных, не относящихся к млекопитающим, без ограничения включают птиц, рыб и т.п.

"Замена", как используется в данном документе, относится к замещению одной или нескольких аминокислот или нуклеотидов другими аминокислотами или нуклеотидами, соответственно.

Используемое в данном документе выражение "терапевтически эффективное количество" относится к любому количеству соединения, которое приводит к лучшим результатам лечения, излечивания, предупреждения или уменьшения симптомов заболевания, расстройства или побочного эффекта или замедлению темпа прогрессирования заболевания или расстройства по сравнению с соответствующим субъектом, который не получил такого количества. В объем выражения также включены количества, эффективные для улучшения нормальной физиологической функции.

Используемые в данном документе выражения "TAGNPP1", "гибридный белок", "полипептид TAGNPP1" и "NPP1-компонент, слитый с нацеливающим фрагментом" используются взаимозаменяемо.

Используемое в данном документе выражение "лечить", "осуществлять лечение" или "лечение" относится к способам облегчения, ослабления или уменьшения симптомов заболевания или состояния, предупреждения дополнительных симптомов, устранения или предупреждения основных причин симптомов, замедления развития заболевания или состояния, остановки развития заболевания или состояния, облегчения заболевания или состояния, обеспечения регрессии заболевания или состояния, облегчения состояния, вызванного заболеванием или состоянием, или прекращения развития симптомов заболевания или состояния, которые осуществляются и профилактически, и/или терапевтически.

"Вариант" TAGNPP1, как используется в данном документе, относится к аминокислотной последовательности, измененной по одной или нескольким аминокислотам. Предпочтительно вариант содержит консервативные замены. "Консервативной заменой" является та, при которой аминокислота заменена другой аминокислотой, которая характеризуется сходными свойствами, так что специалист в области техники, связанной с химией пептидов, может ожидать, что вторичная структура и гидропатическая природа полипептида существенно не изменится. Как правило, аминокислотные замены могут осуществляться исходя из сходства по полярности, заряду, растворимости, гидрофобности, гидрофильности и/или амфипатической природе остатков. Например, отрицательно заряженные аминокислоты включают Asp и Glu; положительно заряженные аминокислоты включают лизин и аргинин; и аминокислоты с незаряженными полярными головными группами, характеризующиеся сходными значениями гидрофильности, включают Leu, Ile и Val; Gly и Ala; Asp и Gln; и Ser, Thr, Phe и Tyr. Другие группы аминокислот, которые могут представлять консервативные замены, включают: Ala, Pro, Gly, Glu, Asp, Gln, Asn, Ser, Thr; (2) Cys, Ser, Tyr, Thr; (3) Val, Ile, Leu, Met, Ala, Phe; (4) Lys, Arg, His и (5) Phe, Tyr, Trp, His. Также или в альтернативном случае, вариант может содержать неконсервативные замены. В предпочтительном варианте осуществления вариантные полипептиды отличаются от нативной последовательности заменой, делецией или добавлением пяти или менее аминокислот или, например, замещением Gly на Trp. Также (или в альтернативном случае) варианты могут быть модифицированными, например, делецией или добавлением аминокислот, которые оказывают минимальное влияние иммуногенность, вторичную структуру и гидропатическую природу NPP1-компонента. Руководство по определению того, какие аминокислотные остатки можно заменить, вставить или удалить без утраты биологической или иммунологической активности, можно найти с использованием компьютерных программ, хорошо известных в данной области техники.

Выражение "вектор" и "вектор на основе нуклеиновой кислоты", используемое в данном документе, относится к природной или синтетической, одно- или двухцепочечной, плазмидной или вирусной молекуле нуклеиновой кислоты, которую можно трансфицировать или трансформировать в клетки и обеспечить репликацию независимо от генома клетки-хозяина или в его составе. Кольцевой двухцепочечный вектор можно линеаризировать путем обработки соответствующим рестрикционным ферментом, исходя из нуклеотидной последовательности вектора. Нуклеиновую кислоту можно встроить в вектор путем разрезания вектора рестрикционными ферментами и лигирования необходимых частей.

Выражение "часть", используемое в данном документе по отношению к гибридному белку, относится к фрагментам этого белка. Фрагменты могут варьировать по размеру от четырех аминокислотных остатков до всей аминокислотной последовательности минус одна аминокислота. Таким образом, белок, "содержащий по меньшей мере часть аминокислотной последовательности из SEQ ID NO: 1", охватывает TAGNPP1 полной длины и его фрагменты.

"Трансформация" или "трансфекция", как используется в данном документе, описывает процесс, посредством которого экзогенная ДНК попадает в клетку-реципиента и изменяет ее с применением различных способов, хорошо известных в данной области техники. Трансформация может основываться на любом известном способе для вставки чужеродных последовательностей нуклеиновой кислоты в прокариотическую или эукариотическую клетку-хозяина. Осуществляют выбор способа исходя из трансформируемой клетки-хозяина, и он может без ограничения включать электропорацию, бомбардировку частицами, инфекцию вирусом и липофекцию. Такие "трансформированные" клетки включают стабильно трансформированные клетки, в которых вставленная ДНК способна к репликации либо как автономно реплицирующаяся плазмида, либо как часть хромосомы хозяина. Они также включают клетки, которые транзиторно экспрессируют вставленную ДНК или РНК в течение ограниченных периодов времени.

ПРИМЕРЫ

Настоящее изобретение дополнительно иллюстрируется следующими примерами. Примеры имеют только иллюстративное назначение, и не предназначены, и не должны толковаться как ограничивающие настоящее изобретение каким-либо образом.

Пример I

Конструкт TAGsNNP1, содержащий нацеливающий фрагмент, который имеет восемь последовательных аспарагиновых кислот, который слит с sNPP1, лигировали в вектор рТТ22 с использованием сайтов для EcoRI и HindIII (pTT22-sNPP1.D8; фиг.19). pTT22-sNPP1.D8 трансфицировали в клетки НЕК203Е, и трансформанты культивировали с экспрессией TAGsNNP1. TAGsNNP1 выделили из культуральной среды и частично очистили, что является хорошо известным в данной области техники. После очистки измерили активность пирофосфатазы/фосфодиэстеразы TAGsNPP1 по ее способности гидролизировать п-нитрофениловый эфир тимидин-5′-монофосфата. Вкратце, TAGsNPP1 разбавили до 1 нг/мкл в 50 мМ Tris, 250 мМ NaCl, pH 9,5. На планшет, содержащий 50 мкл 1 нг/мкл TAGsNPP1, добавили субстрат 50 мкл 10 мМ п-нитрофенилового эфира тимидин-5′-монофосфата (Sigma™, № в каталоге Т4510). Ферментативную активность TAGsNPP1 измерили при 405 нм (поглощение) в кинетическом режиме в течение 5 минут. Как показано на фиг.21, выявили активность TAGsNPP1 выше уровня, наблюдавшегося в контроле, не содержащем TAGsNPP1. В частности, TAGsNPP1, полученный из HEK203D6, проявил наиболее высокий уровень ферментативной активности. Эти результаты дают веские основания предположить, что усеченный NPP1, слитый с нацеливающим фрагментом (т.е. D8), в достаточной мере сохранил свою нормальную функцию в качестве нуклеазы.

Пример II

Данный неограничивающий пример возможного использования описывает, каким образом осуществлять лечение идиопатической инфантильной артериальной кальцификации при помощи введения состава, содержащего гибридный белок TAGNPP1.

Клиницист использует диагностический тест для подтверждения того, что у пациента имеется высокий уровень кальцификации артерий. Также можно провести генетический тест на наличие дефектов NPP1, как описано в Rutsch et al. (2003), Nature Genetics 34: 379-81.

Фармацевтические композиции по настоящему изобретению предпочтительно вводят внутривенно, хотя при определенных обстоятельствах используют внутрикожное, внутримышечное или пероральное введение.

Клиницист определяет дозу, которая может варьировать в зависимости от пола, возраста, общего состояния здоровья и веса пациента. Квалификации врача достаточно для определения подходящей дозировки или пути введения.

Состав, содержащий TAGNPP1, можно вводить инфузионно, от приблизительно 10 мг/кг до приблизительно 1000 мг/кг в неделю еженедельно. 10-30 мг/кг можно ввести однократно. В течение периода инфузии пациенты находятся под пристальным наблюдением, и в случае нежелательного явления осуществляют необходимое клиническое вмешательство. Лечение продолжается по меньшей мере 1 месяц или на протяжении всей жизни пациента. Может допускаться 48-часовой временной интервал для каждой инфузии. Схема инфузий, при которой частота инфузии увеличивается со временем, уменьшает или устраняет нежелательные явления. Инфузии для детей младшего возраста можно осуществлять согласно следующей схеме: 5-10 см3/ч. в течение 60 минут в каждом интервале.

С другой стороны, когда необходимо непрерывное внутривенное введение, типичный пример систем для медленного высвобождения включает, что 1-100 мг/кг эффективных белков TAGNPP1 может непрерывно высвобождаться на протяжении более 1 дня.

Пример III

Очистка растворимого TAGsNPP1-D8

Растворимую форму TAGsNPP1 (меченный по С-концу D8) (см. SEQ ID NO: 20 и фиг.26) очистили от кондиционированной среды для НЕК293. Кондиционированную среду (500 мл) уравновесили гидроксиапатитом (НА)-буфером А (10 мМ Na3PO4, рН 6,8) и отфильтровали с помощью 0,2 мкм фильтра Sartobran P Size 8 MidiCap (Sartorius Stedim). 20 мл колонку HA-Ultrogel (Pall Life Sciences) уравновесили 5 объемами колонки (CV) буфера А перед загрузкой отфильтрованной кондиционированной среды при 3 мл/мин. Колонку промыли буфером А до исходного уровня UV. Белок поэтапно элюировали с применением 2,5 CV каждого из НА-буфер В (150 мМ Na3PO4, рН 6,8), НА-буфер С (250 мМ Na3PO4, рН 6,8) и НА-буфер D (500 мМ Na3PO4, рН 6,8), при этом собрали 5 мл фракции. Активные фракции из НА-колонки объединили (50 мл) и уравновесили WGA-буфером А (20 мМ Tris, рН 8,0, 150 мМ NaCl, 0,7% CHAPS). После фильтрации 6-7 мг общего белка (15-18 мл) загрузили в 1 мл колонку для самотечной хроматографии с агглютинином из зародышей пшеницы (WGA) (EMD Chemicals), которую уравновесили 5 CV WGA-буфера А. Колонку промыли 7 CV WGA-буфера А, и затем белок элюировали при помощи 5×1 мл WGA-буфера В (20 мМ Tris, рН 8,0, 150 мМ NaCl, 500 мМ N-ацетилглюкозамин, 0,7% буфер CHAPS). Обеспечили инкубирование WGA-буфера В в колонке при комнатной температуре в течение 10 минут, перед тем как собрать 1 мл фракции. Процесс повторили до очистки всего исходного материала при помощи WGA-колонки (всего 4 цикла). Активные фракции (29 мл) объединили и сконцентрировали до 1,2 мл с применением отсечения по молекулярному весу 100000 (MWCO) Vivaspin-15 (Sartorius Stedim), причем одновременно заменили буфер на PBS.

Активный sNPP1-D8 (TAGsNPP1) очистили до 91,5% с использованием HPLC. При анализе полученного в результате пула с помощью SDS-PAGE димерная полоса соответствовала ~210 кДа при невосстанавливающих условиях, и при восстанавливающих условиях мономерная полоса соответствовала ~105 кДа.

Пример IV

Гладкие мышечные клетки аорты человека высеяли при 1×104 клеток на лунку на 48-луночные планшеты и поддерживали в среде Игла, модифицированной Дульбекко (DMEM), при стандартных условиях. Через 2 дня к DMEM добавили NaPO4 и АТР при 3,8 мМ и 50 мкМ, соответственно. sNPP1 (WT; фиг.9), TAGsNPP1, имеющий восемь последовательных остатков аспарагиновой кислоты (D8), которые слиты с С-концом (фиг.26), и sNPP1-Fc (фиг.29) добавили при концентрации 1 мкг/мл. Среду заменяли такой же через день. Через 5 дней среду удалили из культуры, и заменили 100 мкл 0,6N HCl, и инкубировали в течение 16-20 часов при комнатной температуре с растворением фосфатов кальция в растворе. Уровни кальция затем определили количественно при помощи колориметрической реакции кальция с крезолфталеином с применением набора Calcium Assay Kit (№700550) от Cayman Chemical Company, Энн-Арбор, Мичиган.

Как показано на фиг.23, TAGsNPP1 продемонстрировал повышенное ингибирование кальцификации по сравнению с таковым sNPP1 (WT), что указывает на то, что домен D8, содержащийся в TAGsNPP1, обеспечивает повышенную возможность нацеливания на участки кальцификации и/или улучшенный эффект ингибирования.

Пример V

Анализ ферментативной активности sNPP1-Fc

При добавлении 1 мкг sNPP1-Fc (фиг.29) исходили из 70% чистоты (т.е. для анализа использовали ~1,1 мкг sNPP1-Fc). При помощи колонки для эксклюзионной HPLC (SEC) было показано, что sNPP1-Fc является на ~78% чистым. При помощи гель-электрофореза при невосстанавливающих условиях обнаружили димер ожидаемого размера (~250 кДа). При обработке DTT димерная полоса уменьшилась до ожидаемого размера мономера (~125 кДа). Посредством вестерн-блоттинга подтвердили димерную и мономерную полосы. Обработка образца sNPP1-Fc PNGазой F привела к уменьшению мономерной полосы от ~125 кДа до ~100 кДа, что являлось ожидаемым молекулярным весом с учетом того, что sNPP1-Fc содержал 12 участков N-гликанов. При 78% чистоте результат итоговой количественной оценки представлял собой ~0,808 мг sNPP1-Fc (2,2 мкг/мл кондиционированных сред). Ферментативную активность sNPP1-Fc определили, как известно в данной области техники.

Таблица 1
Ферментативная активность sNPP1-Fc
Образец OD405 Конечная OD405
Отриц. контроль (белок, не являющийся NPP1) 0,053 0,000
1 мкг Wt sNPP1 (растворимый sNPP1) 0,296 0,243
1 мкг NPP1-Fc (c-концевой) 0,397 0,344

Каждый пример в вышеприведенном описании предусмотрен в качестве пояснения настоящего изобретения, а не ограничения настоящего изобретения. Фактически, специалистам в данной области техники будет очевидно, что в настоящем изобретении могут быть осуществлены различные модификации, комбинации, добавления, удаления и вариации без отступления от объема или сущности настоящего изобретения. Например, признаки, проиллюстрированные или описанные как часть одного варианта осуществления, можно использовать в другом варианте осуществления, что приводит в результате к еще одному варианту осуществления. Предполагается, что настоящее изобретение охватывает такие модификации, комбинации, добавления, удаления и вариации.

Все публикации, патенты, заявки на патент, интернет-сайты и номера доступа/базы данных последовательностей (в том числе как полинуклеотидных, так и полипептидных последовательностей), упомянутые в данном документе, включены в данный документ при помощи ссылки во всей их полноте для всех целей в той же степени, как если бы специфически и отдельно было указано, что каждая отдельная публикация, патент, заявка на патент, интернет-сайт или номер доступа/база данных последовательностей, таким образом, должна быть включена при помощи ссылки.

1. Выделенный гибридный белок NPP1, содержащий NPP1-компонент и Fc-участок иммуноглобулина, где (a) NPP1-компонент содержит богатый цистеином участок и С-концевой каталитический домен NPP1, (б) Fc-участок расположен на С-конце относительно NPP1-компонента и в) выделенный гибридный белок NPP1 обладает ферментативной активностью NPP1, где указанный NPP1-компонент имеет аминокислотную последовательность P99-D925 из SEQ ID NO: 1 и указанный Fc-участок представляет собой Fc-участок IgG1.

2. Гибридный белок NPP1 по п. 1, где указанная ферментативная активность NPP1 представляет собой пирофосфатазную активность, фосфодиэстеразную активность или пирофосфатазную и фосфодиэстеразную активность.

3. Гибридный белок NPP1 по п. 1, где указанный полипептид представляет собой рекомбинантный белок.

4. Гибридный белок NPP1 по п. 1, где указанный Fc-участок слит с С-концом указанного NPP1-компонента.

5. Гибридный белок NPP1 по п. 1, где указанный гибридный белок дополнительно содержит сигнальный пептид.

6. Гибридный белок NPP1 по п. 1, где указанный гибридный белок образует гомодимер.

7. Гибридный белок NPP1 по п. 1, где указанный гибридный белок представляет собой мономер.

8. Выделенная нуклеиновая кислота, кодирующая гибридный белок NPP1 по п. 1.

9. Вектор экспрессии, содержащий выделенную нуклеиновую кислоту по п. 8.

10. Вектор репликации, содержащий выделенную нуклеиновую кислоту по п. 8.



 

Похожие патенты:

Изобретение относится к области биотехнологии и может быть использовано для рекомбинантного получения мутантов фототоксического флуоресцентного белка. Рекомбинантным путем получают мутанты фототоксического флуоресцентного белка KillerRed.

Изобретение относится к области иммунологии. Предложен способ скрининга молекулы, способной связываться с Ig-подобным доменом С2-типа 1 CD4 человека, а именно с аминокислотными остатками в положениях 148-154, 164-168 и 185-192.

Изобретение относится к области биотехнологии, конкретно к иммунологии, и может быть использовано в медицине. Композицию, основанную на совместном применении ApoA, интерлейкина 15 и домена Sushi альфа цепи рецептора IL15, используют для стимулирования противоопухолевого иммунного ответа у субъекта.

Изобретение относится к области биохимии, в частности к биспецифическому двухвалентному антителу, которое специфично связывается с фактором роста эндотелия сосудов человека (VEGF) и с ангиопоэтина-2 человека (ANG-2).

Настоящее изобретение относится к области биохимии. Предложен рекомбинантный полипептид, имеющий мутацию с заменой цистеина на серин в С-концевой области и обладающий целлюлазной активностью и улучшенной термостойкостью.

Изобретение относится к области биотехнологии и иммунологии. Описаны новые антитела или антиген-связывающие фрагменты, которые специфично связываются с сиглеком-15.

Настоящее изобретение относится к области иммунологии. Предложено выделенное антитело и его антигенсвязывающий фрагмент, которые специфически связываются с индуцируемым глюкокортикоидами рецептором TNF (GITR) человека; а также композиции, в том числе фармацевтическая композиция, и способ усиления иммунного ответа у человека.

Настоящее изобретение относится к биотехнологии, конкретно к новым аллергенам собаки, и может быть использовано в медицине. Рекомбинантным путем получают аллерген Can f 4.

Изобретение относится к области биохимии. Заявлено антитело, связывающееся с рецептором клеточной поверхности DR5.

Изобретение относится к области биотехнологии, в частности к рекомбинантной плазмидной ДНК, созданной при помощи новых праймеров CTTCCATATGGAACGAAGGCGTTTGTG и TGTGGATCCAGCTAGTTAGGCATGAAA. Указанная рекомбинантная плазмидная ДНК используется для получения рекомбинантного белка PRAME-F, состоящего из пептида MGSSHHHHHHSSGLVPRGSH слитого с последовательностью природного белка PRAME, путём её экспрессии в бактериальных клетках.

Изобретение относится к области биотехнологии, конкретно к получению иммуногенных полипептидов против рака молочной железы, и может быть использовано в медицине.

Изобретение относится к области биотехнологии, конкретно к иммунологии, и может быть использовано в медицине. Композицию, основанную на совместном применении ApoA, интерлейкина 15 и домена Sushi альфа цепи рецептора IL15, используют для стимулирования противоопухолевого иммунного ответа у субъекта.

Изобретение относится к биохимии. Получают химерные белки слияния: GST УСД HDAC6 и GST-PSMA3, путем их экспрессии в клетки E.

Представленная группа изобретений касается слитого белка, ДНК, кодирующей такой белок, рекомбинантного вектора и клетки-хозяина. Охарактеризованный слитый белок содержит фактор VII (FVII) и трансферрин, где указанный трансферрин соединен с С-концом указанного FVII, необязательно через линкер.

Изобретение относится к биохимии. Описано одноцепочечное антитело (scFv), связывающееся с TNFα, содержащее домен VH и домен VL, связанные линкером; где линкер включает два цистеина, способных к образованию внутрицепочечной дисульфидной связи, и где аминокислоты между цистеинами в последовательности линкера образуют петлевой фрагмент, когда два цистеина связаны друг с другом дисульфидной связью; и при этом scFv имеет последовательность SEQ ID No.

Изобретение относится к области биотехнологии, конкретно к рекомбинантной продукции белков, и может быть использовано для получения антимикробного пептида аципенсина-1 русского осетра Acipenser gueldenstaedtii.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению модифицированного vWF, и может быть использовано в медицине для лечения гемофилии.

Настоящее изобретение относится к области биотехнологии, конкретно к сконструированным полипептидам со связывающей сывороточный альбумин аффинностью, и может быть использовано в медицине.

Настоящее изобретение относится к биотехнологии и представляет собой способ мониторинга экспрессии представляющего интерес гена полипептида CADM1, Rb, ZMYND10, RASSF5, PTEN, SERPINB5, EPB41L3 или DAPK1 для определения терапевтического эффекта соединения при лечении заболевания, связанного с экспрессией указанного представляющего интерес гена полипептида.

Изобретения касаются векторной конструкции, штамма Escherichia coli, включающего такую векторную конструкцию, и способа получения рекомбинантного анальгетического пептида РТ1.

Изобретение относится к области биохимии, в частности к усовершенствованному рекомбинантному иммунотоксину для клеток, экспрессирующих мезотелин. Заявленный иммунотоксин представляет собой слитый белок, включающий антитело к мезотелину и фрагмент экзотоксина Pseudomonas, который модифицирован так, чтобы снизить его иммуногенность и чувствительность к протеазам.
Наверх