Способ прогнозирования эффективности профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза

Изобретение относится к медицине, а именно к хирургии, и касается способа прогнозирования эффективности профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза. Сущность способа заключается в том, что из лимфоцитов периферической венозной крови выделяют ДНК, проводят генотипирование полиморфизма *1F(163A/C) гена цитохрома Р450 CYP1A2 методом анализа полиморфизма длин рестрикционных фрагментов продуктов полимеразной цепной реакции синтеза ДНК. При обнаружении генотипа CYP1A2F1*C/C прогнозируют высокую эффективность профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза. Использование изобретения дает возможность прогнозировать эффективность профилактики альбендазолом рецидива цистного эхинококкоза с высокой точностью. 2 пр.


Предлагаемое изобретение относится к медицине, а именно к хирургии, и может быть использовано для прогнозирования риска развития рецидивных эхинококковых кист при профилактическом лечении альбендазолом.

Известно, что после операции по поводу цистного эхинококкоза, проведенной даже с применением высокотехнологичной современной хирургической помощи, могут развиться рецидивные кисты. С 1996 года по настоящее время широко применяют препарат «альбендазол» для противорецидивного лечения с эффективностью 40-70% [Назыров Ф.Г., Девятов А.В., Акбаров М.М., Махмудов У.М., Бабаджанов А.Х. Химиотерапия и проблемы рецидивного эхинококкоза печени. Анналы хирургической гепатологии. 2011. - Т. 16. - №4 - С. 19-24; Руководство по хирургии очаговых паразитарных заболеваний печени / Н.В. Мерзликин, Альперович Б.И., Бражникова Н.А. и др.; под ред. Н.В. Мерзликина. - Томск: Изд-во «Печатная мануфактура», 2013. - 468 с]. Абсолютной (100%) результативности химиотерапии цистного эхинококкоза альбендазолом добиться до сих пор не удается.

Большинство лекарственных средств, попадая в организм человека, не оказывают прямого биологического эффекта, а вначале подвергаются биотрансформации. В первой фазе биотрансформации участвуют ферменты суперсемейства цитохромов Р450, локализованных в основном на мембранах клеток печени и легких. Гены, кодирующие синтез цитохромов Р450, отличаются значительным полиморфизмом [Генетический паспорт - основа индивидуальной и предиктивной медицины / под ред. B.C. Баранова. - СПб. : Изд-во Н-Л, 2009. - 528 с].

Почти все аллели генов цитохромов, в зависимости от влияния на метаболизм лекарств, подразделяются на группы: быстрых, промежуточных и медленных метаболайзеров. У медленных метаболайзеров, в отличие от быстрых и промежуточных, часто наблюдается существенно более длительный период полувыведения. Появление «быстрого» аллеля, приводящего к повышению активности фермента, вызывает усиление биотрансформации, быстрое выведение и поэтому слабый терапевтический эффект. В настоящее время известно, что в организме человека альбендазол метаболизируется в альбендазол-сульфоксид, обладающий противогельминтным действием, а затем в альбендазол-сульфон, не имеющий биологической активности. Превращение в альбендазол-сульфон осуществляет изоформа цитохрома Р450 CYP1A2 [Клиническая фармакология по Гудману и Гилману / под ред. А.Г. Гилмана // Изд. «Практика», 2006]. Ген, контролирующий синтез CYP1A2, имеет несколько полиморфизмов, один из наиболее функционально значимых - *1F(163A/C). Генотип CYP1A2F1*A/A этого гена, соответствующий «быстрому» метаболизму, а значит и непродолжительному терапевтическому действию, встречается с частотой 33% (у представителей европейской популяции) и 61% (у представителей азиатской популяции) [Анализ ассоциации полиморфного варианта С-163А гена у больных раком легкого в РС(Я) В.М. Николаев, Ф.Г. Иванова, П.М. Иванова, Е.Н. Александрова и др. // Сибирский онкологический журнал. 2013. - Приложение №2. - С.52].

Таким образом, генетическое тестирование полиморфизма *1F(163A/C) гена CYP1A2 у больных цистным эхинококкозом позволит прогнозировать слабый лечебный эффект альбендазола у носителей «быстрого» аллеля, а значит большую вероятность развития послеоперационной рецидивной кисты.

Авторами в научно-медицинской и патентной литературе не обнаружено сведений об известности способа прогнозирования эффективности химиотерапии альбендазолом для профилактики рецидива у больных цистным эхинококкозом.

Техническим результатом изобретения является получение критериев для прогнозирования повышенного риска рецидива у больных цистным эхинококкозом на основе выявления молекулярно-генетических маркеров.

Указанный технический результат достигается способом прогнозирования эффективности профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза, характеризующимся тем, что из лимфоцитов периферической венозной крови выделяют ДНК, проводят генотипирование полиморфизма *1F(163A/C) гена CYP1A2, кодирующего изоформу цитохрома Р450, методом анализа полиморфизма длин рестрикционных фрагментов продуктов полимеразной цепной реакции синтеза ДНК, и при обнаружении генотипа CYP1A2F1*C/C прогнозируют высокую эффективность профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза у обследуемого, а при обнаружении генотипа CYP1A2F1 *А/А - низкую эффективность профилактики.

Способ доступен по реактивам и оборудованию и осуществляется следующим образом.

Материалом для исследования служат образцы ДНК, выделенные из лимфоцитов периферической венозной крови у больных эхинококкозом методом фенольно-хлороформной экстракции, описанным Mathew С.С. (The isolation of high molecular weight eucariotic DNA // Methods in Molecular Biology / Ed. J.M. Walker.- New York., London. - 1984,- Vol. 2. - P. 31-34).

1. Кровь в пробирке с консервантом тщательно перемешивают и переливают в центрифужный стакан на 100 мл, туда же добавляют 50 мл охлажденного лизирующего буфера, содержащего 320 мМ сахарозы, 1% раствор тритона Х-100, 5 мМ MgCl2, 10 мМ трисНСl (рН 7,6).

2. Смесь центрифугируют 20 мин при 4 000 об./мин.

3. Надосадочную жидкость сливают, к получившемуся осадку приливают 8 мл 25 мМ ЭДТА, рН 8.0 и суспензируют.

4. К суспензии добавляют 0,8 мл 10% SDS и протеиназу К (концентрация - 10 мг/ мл). Смесь для лизиса оставляют на ночь в термостате при температуре 38°С.

Экстракцию ДНК осуществляют в следующем порядке.

1. Для депротеинизации к лизату добавляют 0.5 мл 5 М перхлората натрия и 8 мл фенола, насыщенного 1 М трисНСl до рН 7,8.

2. Смесь центрифугируют при 3000 об./мин в течение 10 мин.

3. Отбирают водную фазу, содержащую ДНК, РНК и неденатурированные белки.

4. Отобранную фазу обрабатывают смесью фенол-хлороформа (1:1), а затем - хлороформом.

5. Препараты осаждают двумя объемами 96% этанола.

6. Образовавшийся осадок ДНК растворяют в 1,5 мл деионизированной H2O; раствор хранят при t -20°C.

В дальнейшем полученную ДНК используют для исследования генного полиморфизма CYP1A2*1F(163A/C) методом ПЦР-ПДРФ анализа (полиморфизма длин рестрикционных фрагментов продуктов полимеразной цепной реакции синтеза ДНК) в стандартных условиях по ранее описанной методике [Sachsa С, Bhambra U., Smith G., Lightfoot T.J. et al. Polymorphisms in the cytochrome P450 CYP1A2 gene in colorectal cancer patients and controls: allele frequencies, linkage diequilibrium and influence on caffeine metabolism/ Br. J. Clin. Pharmacol. 2003. V.55(l). P68-76.]. Для амплификации нужного фрагмента применяют локусспецифические олигонуклеотидные праймеры: F5′ TGAGGCTCCTTTCCAGCTCTCA3′ и R5′AGAAGCTTGTGGCCGAGAAGG3′ с температурой отжига 57°С.

После амплификации ПЦР-продукты подвергают гидролизу эндонуклеазой рестрикции ApaI в стандартных условиях. Для этого 5 мкл амплификата смешивают с 5 ед фермента в соответствующем буфере, смесь инкубируют при температуре согласно инструкциям производителей («Сибэнзим», Новосибирск) на протяжении 12 часов. Фрагменты ДНК разделяют электрофоретически в 7-8% ПААГ, окрашивают раствором бромида этидия и анализируют в проходящем ультрафиолетовом свете на трансиллюминаторе.

При обнаружении фрагментов ДНК размером 265 пн диагностируют генотип CYP1A2F1*A/A «быстрого» метаболайзера альбендазол-сульфоксида; при выявлении фрагментов длиной 265, 211 и 54 пн - генотип CYP1A2F1*A/C «промежуточного»; и при обнаружении фрагментов ДНК размерами 211 и 54 пн - генотип CYP1A2F1*C/C «медленного» метаболайзера.

Изобретение иллюстрируется следующими клиническими примерами.

Пример 1. Пациент А., обратился в клинику с жалобами на боли в области правого подреберья. При УЗИ органов брюшной полости в правой доле печени (сегмента VIII) выявлено объемное образование размерами 71x62 мм неоднородной структуры, смешанной эхогенности, с четкими контурами. При осмотре и физикальном исследовании по системам органов других патологических изменений не выявлено. Больной оперирован, выполнена эхинококкэктомия. Проведено исследование по предложенной методике. Установлено: является носителем генотипа CYP1A2F1*A/A «быстрого» метаболайзера. В отношении эффективности профилактики альбендазолом развития рецидивных эхинококковых кист у обследуемого прогноз неблагоприятный.

Через 2 года пациент обратился с теми же жалобами. При УЗИ в правой доле печени (сегмента VIII) выявлено объемное образование размерами 30×25 мм.

Пример 2. Пациент С., обратился в клинику с жалобами на боли в области правого подреберья. При УЗИ органов брюшной полости в правой доле печени (сегмента VIII) выявлено объемное образование размерами 75×55 мм неоднородной структуры, смешанной эхогенности, с четкими контурами. При осмотре и физикальном исследовании по системам органов других патологических изменений не выявлено. Больной оперирован, выполнена эхинококкэктомия. Проведено исследование по предложенной методике. Установлено: является носителем генотипа CYP1A2F1*C/C «медленного» метаболайзера. В отношении эффективности профилактики альбендазолом рецидивных эхинококковых кист прогноз благоприятный. Через 3 года у пациента при диспансерном наблюдении кист не обнаружено.

Способ прогнозирования эффективности профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза, характеризующийся тем, что из лимфоцитов периферической венозной крови выделяют ДНК, проводят генотипирование полиморфизма *1F(163A/C) гена цитохрома Р450 CYP1A2 методом анализа полиморфизма длин рестрикционных фрагментов продуктов полимеразной цепной реакции синтеза ДНК, и при обнаружении генотипа CYP1A2F1*C/C прогнозируют высокую эффективность профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза у обследуемого, а при обнаружении генотипа CYP1A2F1*A/A - низкую эффективность профилактики.


Похожие патенты:

Изобретение относится к области медицины и представляет собой способ диагностики развития эректильной дисфункции, включающий определение уровня тестостерона и эхокардиографическое исследование с анализом структурно-геометрических показателей левых камер сердца, отличающийся тем, что для мужчин в возрасте до 44 лет включительно, страдающих контролируемой гипертонической болезнью II стадии, дополнительно определяют в сыворотке крови уровень общего холестерина и триглицеридов и используют решающее правило: Z=0,04а+0,93b+0,84с-0,34d-8,38, где: а - индекс массы миокарда левого желудочка по данным ЭхоКГ (г/м2), b - общий холестерин в сыворотке крови (ммоль/л), с - триглицериды в сыворотке крови (ммоль/л), d - уровень тестостерона в сыворотке крови (нмоль/л), при Z>0 заключают, что пациент имеет эректильную дисфункцию, при Z<0 заключают, что пациент не имеет эректильную дисфункцию.

Изобретение относится к области ветеринарии и предназначено для ранней диагностики гибели эмбрионов у коров. На 28-40 дни гестации осуществляют забор венозной крови, в сыворотке которой определяют показатель активности гамма-глутамилтрансферазы (ГГТ).

Изобретение относится к области медицины, а именно к способу прогоноза развития гемморагических форм рожи у больных рожей нижних конечностей. Способ прогноза развития геморрагических форм рожи у больных рожей нижних конечностей (РНК), включающий биохимическое исследование крови, при этом у больных РНК в первые трое суток от появления клинических симптомов заболевания определяют в сыворотке крови уровень лептина, резистина и показателей коагулограммы: АЧТВ и фибриногена; критическим значениям уровней вышеуказанных показателей присваивают баллы: увеличение уровня лептина 51,7 до 57,9 нг/мл соответствует 1 баллу; от 58,0 нг/мл и выше - 2 баллам; повышение уровня резистина до 17,0 нг/мл соответствует 1 баллу, а 17,1-20,0 нг/мл соответствует 2 баллам; повышение параметров коагулограммы: АЧТВ 36 сек и более соответствует 0,5 баллам уровня фибриногена 7 г/л и более соответствует 0, 5 баллам; затем рассчитывают величину суммарного адипокинового коэффициента (Кс), равного сумме баллов для каждого показателя; и при величине Кс, равном 2-2,4 баллов, прогнозируют умеренный риск развития геморрагических форм (ГФ) рожи; при величине Кс, равном 2,5-2,9 баллам, прогнозируют высокий риск развития ГФ рожи; при величине Кс, равном 3,0 и более баллов, прогнозируют очень высокий риск развития ГФ рожи.
Изобретение относится к области медицины и представляет собой способ диагностики степени тяжести атаки у пациентов с язвенным колитом путем оценки эндоскопической картины заболевания, отличающийся тем, что у больного дополнительно исследуют концентрацию васкулоэндотелиального фактора роста в сыворотке, определяют количество десквамированных эндотелиоцитов в плазме крови, и тяжесть атаки рассчитывают по формуле: TA=0,0121+0,0003ВЭФ+0,0338ДЭЦ+0,7476ЭА.

Изобретение относится к медицине и предназначено для оценки состояния печени у больных хроническим вирусным гепатитом С. В цельной крови больного определяют количество тромбоцитов, в сыворотке крови определяют уровень аспартатаминотрансферазы и концентрацию фактора некроза опухоли альфа, рассчитывают по следующей формуле индекс фиброза печени: ИФ=1,52-0,0047*ТР+0,0091*АСТ+0,0429*ФНО-α, и при значении индекса фиброза в интервале от 0 до 0,5 определяют отсутствие фиброза (стадия F0), значение индекса фиброза в интервале от 0,6 до 2,5 соответствует умеренной стадии фиброза (F1-2), значение индекса фиброза более 2,5 соответствует выраженной стадии фиброза печени (F3-4).
Изобретение относится к медицине и предназначено для дифференциальной диагностики механической желтухи опухолевого генеза. В плазме крови больного определяют содержание меди.

Группа изобретений относится к детектированию загрязняющих примесей в биологических образцах. Представлена система для быстрого детектирования присутствия инфекционного агента в биологическом образце, содержащая: a.

Изобретение относится к медицине, а именно к способу прогнозирования тяжести клинического течения красного плоского лишая слизистой оболочки рта (КПЛ СОР). Сущность способа состоит в том, что в ротовой жидкости определяют концентрацию цинка и меди методом атомно-абсорбционной спектрофотометрии.
Изобретение относится к медицине, а именно к акушерству, и может быть использовано для прогнозирования первичной слабости родовой деятельности у первородящих женщин.

Изобретение относится к медицине, а именно к биотехнологии и фармакологии, и может быть использовано для оценки цито- и эмбриотоксических свойств фармакологических соединений.

Группа изобретений относится к области биотехнологии. Способ одновременной генодиагностики двух мутантных аллелей, вызывающих CVM и BLAD у крупного рогатого скота, включает выделение ДНК из биологического материала, постановку полимеразной цепной реакции в режиме реального времени с использованием реакционной смеси (тест-системы) с CVM/BLAD, содержащей 50 мМKСl, 50 mMTRIS-HCl, 250 нMdNTP, 2,5 мMMgCl2, праймеры - в концентрации 200 нМ, аллель-специфические зонды - в концентрации 100 Нм, имеющие следующие последовательности: CVM_up - gattctcaagagcttaattctaagga, CVM_low - aagtaaaccccagcaaagccac, CVM_Wt - (FAM) aggtctcatggcagttct-(BHQ1), CVM_m - (R6G) catggcatttctcacagcat-(BHQ2), BLAD_up - ttaggcagttgcgttc, BLAD_low - acgttgacgaggtcatccacca, BLAD_Wt - (ROX) accccatcgacctgtacta-(BHQ1), BLAD_m (Cy5) ccatcggcctgtactacct-(BHQ2), разбавитель, 2,5 ед.

Изобретение относится к биохимии. Описан способ для проведения пиросеквенирования нуклеиновых кислот.
Изобретение относится к биохимии. Описан набор синтетических олигонуклеотидов для выявления маркерных участков генов бактерий кишечника человека, ассоциированных с развитием воспалительных заболеваний кишечника (болезни Крона и неспецифического язвенного колита) методом полимеразной цепной реакции в режиме реального времени.

Изобретение относится к биохимии. Описаны способы количественного определения специфического продукта в реакции амплификации с внесением одноцепочечных разрывов и достройкой и способ контроля в режиме реального времени реакции амплификации с внесением одноцепочечных разрывов и достройкой.

Изобретения относятся к области генетики, молекулярной биологии и медицины и касаются способа для анализа генетического полиморфизма в локусах ДНК ApoE, ApoJ и GAB2 и набора олигонуклеотидных праймеров и зондов.

Изобретение относится к области биотехнологии. В изобретении описан способ идентификации пар фрагментов ДНК или РНК, исходно присутствующих в одних и тех же живых или фиксированных клетках, в частности, способ идентификации нативных пар генов легких и тяжелых цепей антител, а также нативных пар генов альфа- и бета-цепей Т-клеточных рецепторов (ТКР).
Изобретение относится к области медицины и предназначено для диагностики предрасположенности к посттравматическому остеоартрозу коленного сустава. У пациентов существляют генотипирование полиморфизма rs2276109 (A-82G) гена ММР-12.

Изобретение относится к области медицины и предназначено для определения риска развития артериальной гипертензии. Осуществляют забор венозной крови, выделение генетического материала, проведение полимеразной цепной реакции (ПЦР) в режиме реального времени и определение инсерции/делеции (I- и D-аллели) Alu-фрагмента гена ангиотензинпревращающего фермента.

Изобретение относится к области медицины и предназначено для определения степени гетероплазмии мутаций митохондриального генома. Проводят полимеразную цепную реакцию в режиме реального времени, вычисляют значение ΔCt, определяют коэффициент эффективности амплификации и рассчитывают степень гетероплазмии мутаций митохондриального генома по формуле.

Изобретение относится к области медицины, в частности к медицинской генетике и онкогинекологии, и предназначено для прогнозирования риска развития рака яичников.

Предложенная группа изобретений относится к области медицины. Предложен способ получения ДНК-праймеров и зондов для малоинвазивной пренатальной ПЦР-диагностики трисомии 21-й хромосомы у плода по крови беременной женщины, характеризующийся тем, что выбирают сайт дифференциального метилирования фетальной ДНК 21-й хромосомы и ДНК 21-й хромосомы взрослого человека, чувствительный к эндонуклеазам, синтезируют прямой и обратный праймер, соответствующие ампликону длиной от 60 до 300 п.н., а также зонд, соответствующий этому ампликону, проводят ПЦР в реальном времени смеси образцов после их обработки эндонуклеазой рестрикции, отбирают пары праймеров и зонды, обеспечивающие эффективность реакции ПЦР в реальном времени выше 90% и линейность при изменении относительной концентрации образцов выше 90%. Предложены также набор и малоинвазивный способ пренатальной ПЦР-диагностики в реальном времени трисомии 21-й хромосомы у плода по крови беременной женщины. Предложенная группа изобретений обеспечивает эффективные средства и методы определения трисомии хромосомы 21 плода по крови беременной женщины. 3 н. и 13 з.п. ф-лы, 15 ил., 3 табл., 1 пр.

Изобретение относится к медицине, а именно к хирургии, и касается способа прогнозирования эффективности профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза. Сущность способа заключается в том, что из лимфоцитов периферической венозной крови выделяют ДНК, проводят генотипирование полиморфизма *1F гена цитохрома Р450 CYP1A2 методом анализа полиморфизма длин рестрикционных фрагментов продуктов полимеразной цепной реакции синтеза ДНК. При обнаружении генотипа CYP1A2F1*CC прогнозируют высокую эффективность профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза. Использование изобретения дает возможность прогнозировать эффективность профилактики альбендазолом рецидива цистного эхинококкоза с высокой точностью. 2 пр.
