Высокопроизводительный анализ трансгенных границ



Высокопроизводительный анализ трансгенных границ
Высокопроизводительный анализ трансгенных границ
Высокопроизводительный анализ трансгенных границ
Высокопроизводительный анализ трансгенных границ
Высокопроизводительный анализ трансгенных границ

 


Владельцы патента RU 2603265:

ДАУ АГРОСАЙЕНСИЗ ЭлЭлСи (US)

Настоящее изобретение относится к биохимии, в частности к способу определения и секвенирования неизвестных последовательностей ДНК, которые фланкируют известные последовательности в выделенной ДНК. Для осуществления способа сначала проводят гидролиз выделенной ДНК, содержащую часть или всю известную полинуклеотидную последовательность и прилегающую неизвестную полинуклеотидную последовательность, подходящими рестрикционными ферментами. После чего синтезируют цепь комплементарную гидролизованным полинуклеотидным рестрикционным фрагментам с использованием олигонуклеотидной последовательности праймера, имеющей химическую структуру присоединения, связанную с 5′ концом олигонуклеотидной последовательности праймера. Затем выделяют указанную комплементарную цепь. После чего лигируют одноцепочечный адаптер с выделенной комплементарной цепью. В завершении способа выполняют две последовательные ПЦР амплификации выделенной лигированной комплементарной цепи для установления неизвестной полинуклеотидной последовательности. Настоящее изобретение позволяет улучшить чувствительность детекции неизвестных последовательностей ДНК, которые фланкируют известную последовательность ДНК. 2 н. и 20 з.п. ф-лы, 1 табл., 7 пр.

 

Область техники, к которой относится изобретение

Заявленное изобретение относится, в общем, к областям молекулярной биологии растений и биохимии. Заявленное изобретение касается модифицированного метода Полимеразной Цепной Реакции (ПЦР) для анализирования трансгенной границы и определения хромосомной последовательности, которая фланкирует трансген.

Уровень техники изобретения

Определение положения в геноме и хромосомной фланкирующей последовательности, примыкающей к включенному трансгену, технически затруднительно. Было разработано много методов для преодоления ограничений в определении неизвестных последовательностей ДНК, которые фланкируют известную последовательность ДНК. Однако, эти традиционные методы ПЦР определения геномных хромосомных последовательностей, которые фланкируют известную трансгенную, такие как опосредованная лигированием ПЦР (LM-PCR) (также описанную как Прогулка по Геному), и другие методы, включая: обратную ПЦР (i-PCR), термическую асимметричную чередующуюся ПЦР (TAIL-PCR), заякоренную ПЦР (a-PCR)и ПЦР со случайными праймерами (rm-PCR) затруднены низкой чувствительностью детекции (требующей больших количеств матричной ДНК) или низкой специфичностью из-за потерь ДНК во время подготовки.

Полимеразная цепная реакция (ПЦР) является широко используемым молекулярно-биологическим методом. Метод осуществляется путем денатурирования двухцепочечной матричной ДНК, отжига олигонуклеотидных праймеров на матрице ДНК, и удлинения цепи ДНК посредством ДНК полимеразы. Олигонуклеотидные праймеры сконструированы так, чтобы отжигать к противоположным цепям ДНК, и расположены так, чтобы цепь ДНК, синтезированная ДНК полимеразой, служила матричной цепью для другого праймера. Каждый цикл повторяется, приводя к экспоненциальной амплификации ДНК фрагмента. (Mullis et al., патенты США № 4683195, 4683202 и 4800159). Использование ПЦР для специалистов в данной технике является основополагающим для амплификации и выделения ДНК фрагментов для последующего анализа.

Выделение и анализ матриц ДНК путем полимеразной цепной реакции (ПЦР) требует знаний фланкирующих последовательностей ДНК. К сожалению, это необходимое условие ограничивает ПЦР амплификацию участками известной последовательности ДНК. Использование ПЦР методологий для определения локализации положения трансгена в геноме затрудняется произвольным включением трансгена в неизвестное хромосомное положение в геноме организма. Методы определения неизвестных последовательностей ДНК, которые расположены рядом с известной последовательностью ДНК, необходимы для идентификации положения трансгена в хромосоме организма. Кроме того, такие методы, могут быть использованы для определения новых последовательностей генов, для определения новых признаков, для определения геномной локализации транспозона или вирусной последовательности, которая была встроена в геном организма, или для определения хромосомной локализации полинуклеотидной последовательности, вставленной в геном путем инсерционного мутагенеза.

Разные методы были разработаны для преодоления ограничений неизвестных последовательностей ДНК, которые фланкируют известную последовательность ДНК. Метод опосредования лигированием ПЦР (LM PCR), в котором создается геномная библиотека и адаптеры отжигаются к фрагментам ДНК для ПЦР амплификации, существует на рынке как УНИВЕРСАЛЬНЫЙ КИТ ПРОГУЛКА ПО ГЕНОМУТМ (см. патент США № 5565340 и патент США № 5759822). Другим, широко используемым методом, является метод обратной ПЦР реакции (см. Silver and Keerikatte (1989), J.Virol, 63:1924-1928), в котором ДНК гидролизуется ферментом рестрикции и лигируется сама на себя, образуя сплошное кольцо. ПЦР амплификация, использующая олигонуклеотидные праймеры, которые связываются с известными последовательностями, приводит к амплификации и выяснению неизвестных фланкирующих последовательностей. К сожалению, эти методы неэффективны и времязатратны. Эти и другие традиционные методы ПЦР (включая термическую асимметричную чередующуюся ПЦР [TAIL-PCR], заякоренную ПЦР [a-PCR] и ПЦР со случайными праймерами [rm-PCR] затруднены низкой чувствительностью детекции (требующей большие количества матричной ДНК) или низкой специфичностью из-за потерь ДНК в процессе подготовки.

Разработка метода, который может улучшить чувствительность детекции путем очистки фрагментов хромосомной ДНК, которые содержат одновременно известные и неизвестные последовательности ДНК, может привести к чувствительному способу для детекции и характеристики неизвестных участков ДНК, которые прилегают к известной последовательности ДНК. Разработка метода полимеразной цепной реакции опосредованной линейной амплификацией (LAM ПЦР) достигает этих целей. См. патент США № 6514706. LAM ПЦР метод особенно подходит для амплификации и анализа фрагментов ДНК, последовательность которых известна лишь частично.

Разработка метода, который может улучшить чувствительность детекции путем очистки фрагментов хромосомной ДНК, которая содержит одновременно известные и неизвестные последовательности ДНК, может привести к чувствительному методу детекции и характеристики неизвестных участков ДНК, которые прилегают к известной последовательности ДНК. Создание LAM ПЦР метода достигает этих целей. LAM ПЦР - это модифицированный ПЦР метод, который используется для анализирования неизвестных хромосомных фланкирующих последовательностей, прилегающих к известной последовательности ДНК. LAM ПЦР метод может быть использован для определения и/или секвенирования неизвестной последовательности ДНК или РНК фланкирующей известную область ДНК или РНК.

LAM ПЦР метод состоит из следующих шагов. Реакция удлинения праймеров проводится с использованием хромосомной ДНК в качестве матрицы и олигонуклеотидного праймера, который связывается с известной ДНК последовательностью в хромосомной ДНК. Олигонуклеотидный праймер комплементарен к последовательности длинных концевых повторов (LTR), которая является последовательностью характерной для ретровирусов, и помечен биотином на конце олигонуклеотидного праймера. Одноцепочечная ДНК - продукт линейной ПЦР связывается с магнитными бусами с иммобилизованным стрептавидином. Этот шаг служит для выделения амплифицированного одноцепочечного фрагмента ДНК, содержащего известную LTR последовательность и неизвестную последовательность, выделенную из хромосомы. Одноцепочечная ДНК превращается в двухцепочечную ДНК путем синтеза комплементарной цепи. Двухцепочечная ДНК разрезается рестрикционным ферментом, который узнает последовательность и режет двухцепочечную ДНК в последовательности. Двухцепочечная ДНК, названная линкерной кассетой, лигируется к концу. Последующие ПЦР реакции проводятся с использованием полученного таким образом продукта лигирования в качестве матрицы также как и праймера комплементарного LTR и праймера комплементарного линкерной кассете. Фрагмент ДНК, содержащий LTR, и фланкирующую последовательность хромосомной ДНК, прилегающую к LTR, амплифицируется. В результате неизвестный ранее интеграционный сайт ретровируса может быть определен.

LAM ПЦР метод рассматривается в настоящее время как эффективная система для анализа неизвестных последовательностей ДНК, прилегающих к известной последовательности ДНК. Модификации и усовершенствования метода LAM ПЦР были описаны в технике см. заявка на патент США US 2007/0037139 and Harkey et al., (2007) Stem Cells Dev., June; 16(3):381-392.

LAM ПЦР метод был модифицирован в заявке на патент США 2007.0037139 для улучшения определения в биологическом образце имеющем ретровирус интегрированный в различные сайты. Условия реакции традиционного LAM ПЦР метода дают результаты, которые не отражают подлинного состояния клонов, существующих в клеточной популяции образца. Была разработана модификация, в которой больше интеграционных фрагментов было амплифицировано с помощью ПЦР без смещения в сторону фрагмента амплифицированного из специфического клона. Модификация LAM ПЦР метода позволяет исследователям определять объем клеток в популяции, обладающих интегрированным геном, и определять соотношение специфических клеток в популяции.

Кроме того, Harkey et al., (2007) описывают оптимизированную, многорукую, высокопроизводительную модификацию LAM ПЦР метода, в котором возможность детекции улучшена на 90% с истощающим введением образца. Модифицированный протокол обеспечил точность оценок размера всего пула, таким образом, предоставляя быстрый, экономически эффективный подход для генерирования большого количества данных по инсерционным сайтам предпочтительных геномных локализаций для векторной интеграции.

Заявленное изобретение описывает дальнейшую значительную модификацию и решает ряд традиционных проблем LAM ПЦР путем исключения шагов генерирования фрагмента двухцепочечной ДНК с последующим гидролизом фрагмента двухцепочечной ДНК и денатурацией фрагмента двухцепочечной ДНК.

Краткая сущность изобретения

Заявленное изобретение предоставляет способ нахождения неизвестной полинуклеотидной последовательности, прилегающей к известной полинуклеотидной последовательности, в выделенной ДНК растения, который включает гидролиз выделенной ДНК растения, которая содержит часть или всю известную полинуклеотидную последовательность и прилегающую неизвестную полинуклеотидную последовательность, одним или более подходящими рестрикционными ферментами для создания множественности разрезанных рестрикционных фрагментов полинуклеотидов; синтезирование комплементарной цепи прогидролизованных полинуклеотидных рестрикционных фрагментов с использованием последовательности олигонуклеотидного праймера, имеющего присоединение, химически привязанное к 5' концу олигонуклеотидной последовательности праймера; выделение комплементарной цепи путем связывания химического присоединения с соответствующей выделяющей матрицей, затем денатурирование комплементарной цепи из прогидролизованных рестрикционных полинуклеотидных фрагментов; лигирование одиночной цепи адаптера с изолированной комплементарной цепью, связанной с изолирующей матрицей для получения лигированной изолированной комплементарной цепи; выполнение первой ПЦР амплификации лигированной изолированной комплементарной цепи, используя первый ПЦР праймер, предназначенный для связывания с известной полинуклеотидной последовательностью, и второй ПЦР праймер, предназначенный для связывания с одноцепочечным адаптером для получения первого ПЦР ампликона; проведение второй ПЦР амплификации названного ампликона первой ПЦР, в котором, вторая ПЦР амплификация амплифицирует внутреннюю последовательность упомянутого выше ампликона первой ПЦР для получения второго ампликона; и секвенирования второго ампликона ПЦР для установления сиквенса неизвестной полинуклеотидной последовательности.

Вариантом осуществления заявленного изобретения раскрытого здесь является способ выделения и идентификации трансгенных граничных последовательностей. Вариантом осуществления заявленного изобретения является способ, который легко применим для высокопроизводительных применений для определения числа трансгенных копий и локализации в хромосоме геномного инсерционного сайта. Кроме того, заявленное изобретение может быть использовано для одновременной детекции многих инсерционных сайтов в одной реакции. Заявленное изобретение раскрывает способ, который обладает улучшенной чувствительностью и специфичностью для детекции неизвестных полинуклеотидных фрагментов, которые фланкируют известный полинуклеотидный фрагмент. Кроме того заявленное изобретение может быть развернуто для определения неизвестных последовательностей ДНК, которые прилегают к любым последовательностям мишеням, включая вирусные последовательности и инсерционные мутагенезные сайты, созданные путем транспозонного мутагенеза или мутагенеза, произведенного посредством Т-цепной интеграции.

Вариант осуществления заявленного изобретения частично связан с идентификацией трансгенного события, используя фланкирующие, сочленяющиеся и включенные последовательности. Согласно заявленному изобретению, модифицированный ПЦР анализ и методы анализа ДНК секвенированием, использующие ампликоны, которые покрывают включенную трансгенную ДНК и ее границы, могут быть использованы для детекции или идентификации разнообразия коммерциализованных трансгенных растений или линий производных от линий трансгенных растений частных собственников.

Трансгенная граница и прилегающие хромосомные фланкирующие последовательности заявленного изобретения являются диагностическими для трансгенного события. Основываясь на этих последовательностях, линии трансгенных растений могут быть идентифицированы в различных генотипах растений путем анализа хромосомных фланкирующих и трансгенных последовательностей. Таким образом, вариант осуществления заявленного изобретения описывает метод, который может быть использован для идентификации линий трансгенных растений.

Хромосомные фланкирующие последовательности заявленного изобретения особенно полезны в сочетании с бридингом растений для определения, который из потомков растений содержит данный трансформант, после того как родительское растение, содержащее интересующий трансформант, скрещено с другой линией растения в попытке передать один или более дополнительных интересующих свойств потомству. Вариантом осуществления заявленного изобретения является определение хромосомных фланкирующих/сочленяющихся последовательностей для пользы программ бридинга, а также и качества контроля, особенно для коммерциализованных линий трансгенных растений.

Кроме того, идентификация хромосомных фланкирующих последовательностей может быть использована для специфичного определения локализации в геноме каждой трансгенной вставки. Эта информация может быть использована для развития систем молекулярных маркеров, специфичных для каждой трансформации. Эти системы молекулярных маркеров могут быть использованы для улучшения бридинговых стратегий и для создания связанных данных. Вариантом осуществления заявленного изобретения являются системы молекулярных маркеров.

Более того, информация о хромосомной фланкирующей последовательности может быть использована для изучения и характеристики трансгенных интеграционных процессов, характеристик геномного интеграционного сайта, события сортинга, стабильности трансгенов и их фланкирующих последовательностей, и экспрессии гена (особенно связанной с генным сайленсингом, схемами трансгенного метилирования, эффектами положения, и потенциальными элементами, связанными с экспрессией, такими как, MARS (участки прикрепления к матрице) и подобными).

Методы данного изобретения могут быть использованы для получения и определения последовательности неизвестного полинуклеотида из трансгенного организма. В любом из методов данного изобретения, образцом может быть геномная ДНК и трансгенным организмом может быть трансгенное растение. Трансгенные растения, анализируемые любым из методов данного изобретения, могут быть выбраны из растений, состоящих из ячменя, кукурузы, овса, сорго, рулонного газона, сахарного тростника, пшеницы, люцерны, банана, брокколи, боба, капусты, канолы, моркови, маниоки, цветной капусты, сельдерея, цитрусовых, хлопка, тыквы, эвкалипта, льна, чеснока, винограда, лука, салата, гороха, арахиса, перца, картофеля, тополя, сосны, ржи, риса, подсолнуха, сафлора, сои, клубники, сахарной свеклы, батата, табака, томата, декоративного растения, кустарника, ореха, проса и пастбищной травы.

Методы данного изобретения могут быть использованы для получения и определения последовательности неизвестного полинуклеотида из нетрансгенного организма. В любом из методов данного изобретения образцом может быть геномная ДНК и нетрансгенным организмом может быть растение. Растения, анализируемые любым из методов данного изобретения могут быть выбраны из растений, состоящих из ячменя, кукурузы, овса, сорго, рулонного газона, сахарного тростника, пшеницы, люцерны, банана, брокколи, боба, капусты, канолы, моркови, маниоки, цветной капусты, сельдерея, цитрусовых, хлопка, тыквы, эвкалипта, льна, чеснока, винограда, лука, салата, гороха, арахиса, перца, картофеля, тополя, сосны, ржи, риса, подсолнуха, сафлора, сои, клубники, сахарной свеклы, батата, табака, томата, декоративного растения, кустарника, ореха, проса и пастбищной травы. В любом из методов изобретения неизвестная полинуклеотидная последовательность, примыкающая к известной полинуклеотидной последовательности, может быть природным полинуклеотидом, представляющим агрономический интерес.

Краткое описание последовательностей

SEC ID NO:1 описывает 5' биотинилированный праймер, помеченный как 4468-3PA01-2Btn.

SEC ID NO:2 описывает 5'фосфорилированный адаптер помеченный как ZC-Adp-01.

SEC ID NO:3 описывает праймер, помеченный как PAT-InvPriF.

SEC ID NO:4 описывает праймер, помеченный как Zn_Adt_PCR_01.

Подробное описание изобретения

Как употреблено здесь, выражения «состоит из», «состоящий из», «включает», «включающий», «имеет», «имеющий», «содержит», «содержащий», или любые другие их варианты, предполагаются быть не эксклюзивными или ничем не ограниченными. Например, состав, смесь, процесс, метод, статья, или приспособление, который содержит список элементов, не обязательно ограничен только этими элементами, но может включать другие элементы не определенно перечисленные или свойственные этому составу, смеси, процессу, методу, статье или приспособлению. К тому же, за исключением определенно заявленного противоположного, «или» означает включающий или и не исключающий или. Например, условие А или В удовлетворяет любому из следующих: А является истинным (или данным) и В является неверным (или не данным), А является неверным (или не данным), В является истинным (или данным) или оба А и В являются истинными (или данными).

Также, неопределенные артикли «а» и «an» предшествующие элементу или компоненту изобретения имеют ввиду быть неограничительными относительно количества примеров, т.е. встречаемостей элемента или компонента. Следовательно, «а» или «an» следует читать включающими один или, по крайней мере, один, и единственная форма слова элемент или компонент также включает множественное число за исключением, когда количество безусловно, означает единственное число.

Выражения «нуклеиновая кислота», «полинуклеотид», «полинуклеотидная последовательность» и «нуклеотидная последовательность» использованы для обозначения полимера нуклеотидов (A,C,T,U,G, и т.д. или встречающиеся в природе или искусственные нуклеотидные аналоги), например ДНК или РНК или их представители, например последовательность знаков, и т.д. в зависимости от соответствующего контекста. Выражения «нуклеиновая кислота» и «полинуклеотид» использованы здесь взаимозаменяемо; эти выражения использованы в отношении ДНК, РНК, или других новых молекул нуклеиновых кислот изобретения, за исключением указанного иначе или очевидно опровергнуто контекстом. Данный полинуклеотид или комплементарный полинуклеотид может быть определен из любой установленной нуклеотидной последовательности. Нуклеиновая кислота может быть в одно- или в двухцепочечной форме.

Выражение «выделенный» означает вещество, такое как нуклеиновая кислота или белок, которое: (1) значительно или существенно свободно от компонентов, которые обычно сопровождают или взаимодействуют с веществом как обнаружено в его естественно встречающемся окружении или (2), если вещество находится в его естественном окружении, вещество было испорчено путем обдуманного вмешательства человека в состав и/или помещено в локус в клетке другого, чем локус естественный для вещества.

Выражение «растение» включает растения и части растений, включая, но не ограничены этим, растительные клетки и растительные ткани, такие как листья, стебли, корни, цветы, пыльца, и семена. Класс растений, которые могут быть использованы в данном изобретении, в общем, так широк как класс высших и низших растений, склонных к мутагенезу, включая покрытосемянные (однодольные и двудольные растения), голосеменные, папоротниковые и многоклеточные водоросли.

Выражение «промотор», обычно означает ДНК последовательность, которая управляет транскрипцией структурного гена для производства РНК. Обычно, промотор расположен в районе 500 пар оснований предшествующих гену, близко к сайту старта транскрипции. Если промотор является регулируемым промотором, то скорость транскрипции возрастает или уменьшается в ответ на экзогенный или эндогенный индуцирующий агент. В противоположность, скорость транскрипции регулируется до более низкого уровня индуцирующим агентом, если промотор является конститутивным промотором.

Выражение «трансгенное растение» означает растение или его потомок, полученный из трансформированной клетки растения или протопласта, в котором ДНК растения содержит молекулу введенной экзогенной ДНК, не присутствующей исходно в том же природном, не трансгенном растении.

Выражение «вектор», как использовано здесь, означает любую конструкцию рекомбинантного полинуклеотида, которая может быть использована с целью трансформации, т.е. введения гетерологичной ДНК в клетку хозяина.

Выражение «комплементарная цепь» описывает последовательности нуклеиновых кислот или молекул, в которых каждое основание в одной молекуле спарено с его комплементарным основанием в другой цепи, для образования стабильной спиральной двухцепочечной молекулы. Индивидуальные цепи названы комплементарными цепями.

Выражение «олигонуклеотидный праймер», это последовательность линейных олигонуклеотидов, длиной от около 10 до около 50 нуклеотидов, которая комплементарна нуклеотидным последовательностям 5' или 3', предназначенных для амплификации. Пара олигонуклеотидных праймеров, в которых один из праймеров комплементарен нуклеотидной последовательности 5' полинуклеотидного фрагмента, предназначенного для амплификации, в то время как другой праймер этой пары комплементарен нуклеотидной последовательности, расположенной в 3' полинуклеотидном фрагменте, предназначенном для амплификации, может быть использована для амплификации полинуклеотидной последовательности. Специалист в данной области техники понимает, что пара олигонуклеотидных праймеров означает два олигонуклеотида комплементарных к противоположным цепям нуклеиновой кислоты и фланкирующим полинуклеотидную последовательность, предназначенную для амплификации.

Выражение «адаптер» описывает короткий олигонуклеотид полинуклеотидного сегмента, который может быть присоединен к полинуклеотидной молекуле или к тупому или к липкому концу. Адаптеры могут содержать внутри полинуклеотидного фрагмента последовательности, узнаваемые ферментом рестрикции. Размер адаптера может варьировать от около десяти до около ста пятидесяти нуклеотидов в длину.

Выражение «лигированная изолированная комплементарная цепь» означает полинуклеотидный фрагмент, который включает в себя адаптер, присоединенный ко второму фрагменту ДНК, который содержит часть или всю известную полинуклеотидную последовательность и примыкающую неизвестную полинуклеотидную последовательность путем реакции лигирования. «Лигированная изолированная комплементарная цепь» фланкирована адаптером с одного конца и известной полинуклеотидной последовательностью с другого конца.

Реакция лигирования осуществляется ферментом, обычно обозначаемым лигаза, который катализирует образование фосфодиэфирной связи между примыкающими 3'-OH и 5'-P концами ДНК.

Выделение растительной ДНК может быть осуществлено способами известными в области техники. Обычно, выделение ДНК растения приводит к получению очищенной ДНК растения, которая свободна от липидов, белков и другого клеточного дебриса. Предпочтительные методы выделения ДНК растений включают: лизис, нагревание, преципитацию спиртом, преципитацию солью, органическую экстракцию, твердофазную экстракцию, силикагель-мембранную экстракцию, очистку в градиенте CsCl и их любые комбинации. Наиболее предпочтительным методом выделения ДНК растения является силикагель-мембранная технология, продаваемая как DNeasy кит (Qiagen, Валенсия, Канада) или цетилтриметиламмониум бромид (CTAB) протокол выделения ДНК.

Рестрикционные ферментативные расщепления, называемые также рестрикционными эндонуклеазными расщеплениями, осуществляются, когда фермент нуклеаза используется для разрезания, полинуклеотидных последовательностей. Существует множество рестрикционных ферментов, доступных для специалистов в данной области техники. Как описано в www.neb.com/nebecomm/tech_reference/restriction_enzymes/overview.asp, используется четыре классификации для характеристики ферментов рестрикции. Эти классификации сделаны на основе субъединичного состава, позиции разрезания, специфичности последовательности и потребностей в кофакторе.

Тип I ферментов произвольно режет ДНК в участках, которые отдалены от последовательности узнавания/связывания (>1,000 пн отдаленность). Сайты узнавания, с которыми связывается фермент типа I являются асимметричными. В результате, эти ферменты не используются для генного клонирования, так как эти ферменты не производят дискретные фрагменты рестрикции или отчетливые образцы гель-исчерченности. Тип I ферментов является мультифункциональным и различные субъединицы, которые составляют рестрикционный фермент типа I, ответственны за разные активности (т.е. субъединица HsdR кодирует рестрикцию, субъединица HsdM кодирует метилирование ДНК и субъединица HsdS кодирует специфичность узнаваемой последовательности).

Ферменты типа II гидролизуют ДНК в положениях, расположенных в непосредственной близости от узнаваемых последовательностей. Эти ферменты функционируют в виде димера, в котором одна субъединица связывается со смысловой цепью, и вторая копия субъединицы связывается с антисмысловой цепью в палиндромной последовательности, которая обычно имеет длину между 4-8 нуклеотидами. Тип II димер, который связывается с ДНК, может быть либо гомодимером, который связывается с симметричными последовательностями ДНК, или гетеродимером, который связывается с ассиметричными последовательностями ДНК. Фермент может узнавать либо непрерывные последовательности или прерывистые последовательности. Тип II ферментов коммерчески доступен и широко используется для анализа ДНК и клонирования генов. Широко распространенное использование этих ферментов является результатом продукции определенных фрагментов рестрикции, которые могут быть разрешены на агарозном геле.

Ферменты типа II являются коллекцией неродственных белков, которые высоко дивергентны по сходству аминокислотной последовательности. Ферменты типа II были разделены на подкатегории, которые отмечают, используя буквенный суффикс. Рестрикционные ферменты типа IIB являются мультимерами, которые содержат больше одной субъединицы. Эти ферменты разрезают оба конца узнаваемой последовательности, приводя, таким образом, к удалению узнаваемой последовательности. Рестрикционные ферменты типа IIE и типа IIF разрезают ДНК после взаимодействия с двумя копиями последовательности их узнавания. Рестрикционные ферменты типа IIG состоят из одной субъединицы. N-концевая часть фермента содержит домен разрезания ДНК и домен модификации ДНК. C-концевая часть ДНК содержит домен связывания с ДНК последовательностью. Эти ферменты расщепляют за пределами последовательности их узнавания. Рестрикционные ферменты типа IIM узнают и режут метилированную ДНК. Рестрикционные ферменты типа IIS функционируют в виде димера и расщепляют ДНК в положении за пределами не палиндромных асимметричных сайтов узнавания. Эти ферменты состоят из двух различных доменов, один для связывания с ДНК и другой для расщепления ДНК.

Ферменты типа III являются комбинацией ферментов рестрикции-и-модификации. Эти ферменты узнают две раздельные не палиндромные последовательности и расщепляют за пределами последовательностей их узнавания. Для выполнения расщепления, ферменты типа III требуют две последовательности узнавания в противоположной ориентации в одной ДНК молекуле.

Ферменты типа V узнают метилированную ДНК. Примеры включают MIcrBC и MRrr системы E.coli.

Известны другие методы в области техники для расщепления полинуклеотидов и могут быть использованы вместо гидролиза полинуклеотида рестрикционным ферментом, любой из группы состоящей из: лизиса, последовательность-специфичный фактор расщепления, не последовательность-специфичный фактор расщепления, разрушение ультразвуком, смещающее воздействие, фрэнч-пресс, ультрафиолетовое облучение, ионизационное облучение, и ДНКаза. В добавление к ферментам рестрикции, описанным выше, хоминг-эндонуклеазы или флэп-эндонуклеазы или любые комбинации этих ферментов могут быть использованы для гидролиза выделенной ДНК. Предпочтительным методом гидролиза выделенной растительной ДНК является использование фермента рестрикции типа II, который, известно, режет за пределами трансгенной последовательности трансформированной в растение. Другим предпочтительным методом для гидролиза выделенной растительной ДНК является использование фермента рестрикции типа II, который, известно, режет в участке, который расположен в непосредственной близости от конца трансгенной последовательности.

Реакции достройки праймера используются для получения цепи ДНК или РНК, которая содержит известную полинуклеотидную последовательность и неизвестную прилегающую полинуклеотидную последовательность. Методологии достройки праймера приводят к созданию комплементарной цепи ДНК или РНК, которая содержит неизвестную полинуклеотидную последовательность. Комплементарная цепь ДНК или РНК создается полимеразой, которая протягивается вдоль матричной цепи ДНК или РНК после образования комплекса с олигонуклеотидным праймером, который связан с известной матричной цепью ДНК или РНК. Олигонуклеотидный праймер предназначен для специфичного связывания с известной последовательностью ДНК или РНК внутри матричной цепи ДНК или РНК. Для реакции достройки коммерчески доступны многочисленные типы полимераз; N4 полимераза, TAQ полимераза, PFU полимераза, или обратная транскриптаза являются немногими не лимитирующими примерами обычно использующихся полимераз. Каждая полимераза обладает особенными требованиями к буферу и действует при определенной температуре для оптимальных условий реакции. Предпочтительным для реакции достройки праймера является использование TAQ полимеразы, продаваемой как Platinum Taq кит.

Присоединяемые химические вещества, присоединенные к изолирующей матрице, такой как, системы, основанные на магнитных бусах, используются для выделения одноцепочечной ДНК производимой в реакции достройки праймера. Цепь ДНК, которая произведена в реакции амплификации праймера, может быть очищена из геномной ДНК путем стрептавидин-биотин реакции. Биотинилирование широко используется, позволяя выделение, разделение, концентрирование и дальнейший по ходу процессинг и анализ биомолекул (например, методы, описанные в патенте США № 5948624, патенте США № 5972693 и патенте США № 5512439). Существует множество коммерчески доступных биотинилированных реагентов, которые выявляют различные функциональные группы, такие как первичные амины, сульфгидрилы, карбоксилы, карбогидраты, тирозиновые и гистидиновые боковые цепи и цианидиновые и цитозиновые основания. Использование коротких последовательность-специфичных олигонуклеотидных праймеров функционализированных с биотином (или эквивалентом, например, дигоксигенином) и магнитных бус для выделения специфичных последовательностей ДНК из генома для последующего анализа имеет множественное применение. Выделение с использованием, основанного на бусах метода позволяет обогащать популяцию ДНК определенной последовательностью, позволяя провести последующий анализ, который не может быть проведен в присутствии полного геномного комплекта ДНК. Такие, основанные на бусах, методы подходят для высокопроизводительной автоматизации.

Хотя биотин-стрептавидин взаимодействие является наилучшей описанной связывающейся парой, известны другие молекулы, которые имеют сильную аффинность друг к другу. Присоединяемые химические вещества, которые могут быть включены в олигонуклеотидный праймер, включают: ACRIDITETM химическую структуру присоединения, основанную на акриловом фосфорамидите, который может быть добавлен к олигонуклеотидам как 5”-модификатор, и ковалентно взаимодействует с тиол-модифицированными поверхностями; алкиновые модификации, которые реагируют с меченными азидом функциональными группами с образованием стабильных связей посредством азид-алкинового циклоприсоединения Хьюсгена (также называемого как реакция Клика); и, тиольные модификации, которые могут объединяться и взаимодействовать с высокой аффинностью с соответствующим лигандом или поверхностью (такой как поверхность золота). Такие молекулы могут использоваться для очистки или обогащения ДНК последовательностей. Где праймер мечен первой молекулой и вторая молекула связана с матрицей, которая может иммобилизовать первую молекулу (например, магнитные бусы). Цепь ДНК, полученная из праймера меченного первой молекулой, может быть выделена путем пропускания ДНК через колонку, содержащую иммобилизованную матрицу (например, магнитные бусы), меченную второй молекулой. В результате аффинности ко второй молекуле, выделяются амплифицированные последовательности ДНК, содержащие праймер, меченный первой молекулой. Предпочтительные химические структуры присоединения включают: акрилик-тиол взаимодействия, алкин-азид взаимодействия, тиол-лиганд взаимодействия. Наиболее предпочтительной химической структурой присоединения является стрептавидин-биотин взаимодействие.

Как использовано здесь, выражение изолирующая матрица означает поверхность, к которой молекула любого типа может быть присоединена. Предпочтительно, изолирующая матрица является нерастворимым материалом, к которому может быть присоединена молекула так, что указанная молекула может быть легко отделена от других компонентов реакции. Предпочтительные изолирующие матрицы могут включать, но не ограничены этим, фильтр, хроматографическую смолу, бусинку, магнитную частицу, составы, которые содержат стекло, пластик, металл, один или более полимеры и их комбинации. Наиболее предпочтительной изолирующей матрицей является система, основанная на магнитных бусах.

Адаптеры могут быть лигированы к иммобилизованной одноцепочечной ДНК посредством одноцепочечной лигазы. Традиционно коммерчески доступные лигазы были доступны только для соединения фрагментов двухцепочечной ДНК. Недавно было показано, что РНК лигаза может быть использована для лигирования фрагментов одноцепочечной ДНК (Zhang and Chiang (1995) Nucleic Acids Research, 24 (5); 990-991). Предпочтительные одноцепочечные лигазы коммерчески доступны и продаются как CIRCLIGASETM (Epicentre Biotechnologies, Мэдисон, Висконсин), T4 РНК Лигаза 1 и T4 РНК Лигаза 2 (New England Biolabs, Ипсуич, Массачусетс), и одноцепочечная ДНК лигаза (Wako Chemicals, Ричмонд, Виржиния). Наиболее предпочтительной лигазой одноцепочечной ДНК является термостабильная РНК лигаза (TRL) от Epicentre Biotechnologies, (Мэдисон, Висконсин).

Как описано Brautigma et al., 2010, анализ последовательности ДНК может быть использован для определения нуклеотидной последовательности выделенного и амплифицированного фрагмента. Амплифицированные фрагменты могут быть выделены и субклонированы в вектор и секвенированы с использованием цепь-терминирующего метода (также известного как Сэнгер секвенирование) или Краситель-терминирующего секвенирования. Кроме того, ампликон может быть секвенирован Секвенированием Следующего Поколения. NGS технологии не требуют стадии субклонирования, и множественные прочтения сиквенса могут быть завершены в одной реакции. Три NGS платформы коммерчески доступны, Геномный секвенатор FLX от 454 Life Science/Roche, Анализатор генома Illumina от Solexa и Applied Biosystems'SOLiD (аббревиатура для: «Секвенирование путем олиго лигирования и детекции»). Кроме того, существуют два метода секвенирования одной молекулы, которые разрабатываются в настоящее время. Они включают точное секвенирование одной молекулы (tSMS) от Helicos Bioscience и секвенирование одной молекулы в реальном времени (SMRT) от Pacific Biosciences.

Геномный секвенатор FLX, который продается 454 Life Science/Roche является NGS длинного прочтения, который использует эмульсионную ПЦР и пиросеквенирование для генерирования прочтений последовательностей. ДНК фрагменты 300-800 пн или библиотеки, содержащие фрагменты 3-20 тпн, могут быть использованы. Реакции могут произвести свыше миллиона прочтений от около 250 до 400 оснований за пробег с общим выходом от 250 до 400 мегаоснований. Эта технология производит самое длинное прочтение, но общий выход последовательности за один пробег ниже по сравнению с другими NGS технологиями.

Анализатор генома Illumina, который продается Solexa, является NGS коротких прочтений, который использует секвенирование по принципу синтеза с обратимыми терминирующими нуклеотидами, меченными флуоресцентным красителем, и основанном на твердофазном бридж ПЦР. Может быть использовано создание библиотек последовательностей с парными концами, содержащих фрагменты ДНК вплоть до 10 тпн реакции производят свыше 100 миллионов коротких прочтений длиной в 35-76 оснований. Эти данные могут производить от 3-6 миллиардов пар нуклеотидов за прогон.

Секвенирование системой олиго лигирования и детекции (SOLiD), продающейся Applied Biosystems является технологией короткого прочтения. Эта NGS технология использует фрагментированную двухцепочечную ДНК, которая имеет до 10 тпн в длину. Система использует секвенирование лигированием меченных красителем нуклеотидных праймеров и эмульсионную ПЦР для создания одного биллиона коротких прочтений, что приводит к полной выдачи последовательности вплоть до 30 миллиардов оснований за пробег.

tSMS Helicos Bioscience и SMRT Pacific Biosciences применяют различный подход, который использует единичные молекулы ДНК для реакций секвенирования. tSMS Helicos система производит вплоть до 800 миллионов коротких прочтений, что приводит к 21 миллиарду оснований за прогон. Эти реакции заканчиваются с использованием виртуального терминатора нуклеотидов, меченного флуоресцентным красителем, который описан как подход «секвенирование синтезом».

SMRT система Секвенирования Следующего Поколения, продаваемая Pacific Biosciences использует секвенирование в реальном времени путем синтеза. Эта технология может производить прочтения до 1000 пн в длину вследствие отсутствия ограничений обратимыми терминаторами. Сырое сквозное прочтение, которое эквивалентно однократному покрытию диплоидного человеческого генома, может быть осуществлено с использованием этой технологии за один день.

Следующие примеры описывают способ, разработанный для выделения и идентификации геномных фланкирующих последовательностей трансгенной вставки. Кроме того, способ может быть использован для определения количества трансгенной копии и геномную локализацию трансгена для трансгенного события.

Варианты осуществления данного изобретения также определены в следующих примерах. Следует понимать, что эти примеры представлены только в качестве иллюстрации. Из вышеприведенного обсуждения и этих примеров, специалисты в данной области техники могут установить основные характеристики этого изобретения и без удаления от истинного смысла и границ вышеуказанного, могут делать различные изменения и модификации вариантов осуществления изобретения для приспособления его к различным употреблениям и условиям. Таким образом, различные модификации вариантов изобретения, в дополнение тем, которые показаны и описаны в данном документе, будут очевидны специалистам в данной области техники из вышеизложенного описания. Предполагается также, нахождение таких модификаций в пределах рамок предложенной формы изобретения. Раскрытие каждого набора ссылок в данном документе в дальнейшем включено в данный документ ссылкой в ее полном объеме.

Пример 1

Плазмида, содержащая экспрессионную кассету интересующего гена и экспрессионную кассету гена селективного маркера, была использована для трансформации Zea mays cv Hi-II ткани растения с использованием генной пушки Biorad. Получение трансгенного маиса из обстрелянного каллуса типа II: влияние размера золотых частиц и морфологии каллуса на эффективность трансформации. (In Vitro Cell. Dev. Biol-Plant. 36:21-29). Протокол был модифицирован: компоненты среды, агенты селекции и мониторинг времени были оптимизированы для улучшения эффективности процесса трансформации. Для трансформации был использован линеризованный фрагмент плазмиды Fsp I. Результирующие трансформации продуцировали растения трансгенного маиса, которые содержали экспрессионную кассету интересующего гена, который был связан с экспрессионной кассетой гена селективного маркера растения.

Пример 2

Геномная ДНК была выделена из трех различных маисовых трансформантов (3)-001, (3)-008 и (3)-009 и незатрансформированных маисовых контролей. Ряд методов был использован для выделения геномной ДНК, такие как DNeasy кит (Qiagen, Валенсия, Канада) или традиционный протокол выделения ДНК CTAB. Концентрации ДНК были определены с использованием Nanodrop (Thermo Scientific, Вильмингтон, Германия). Общее количество в 250 нг геномной ДНК было гидролизовано рестрикционным ферментом TaqI. Гидролизат был далее очищен с использованием MinElute Reaction Cleanup кита (Qiagen, Валенсия, Канада).

Пример 3

Были осуществлены реакции удлинения праймера с использованием выделенной и очищенной геномной ДНК. Двойной меченый биотином праймер был синтезирован с использованием Integrated DNA Technologies Inc. (Коралвилл, Йова) и использован для реакции (SEQ ID NO:1 (4468-3PA01-2Btn) 5'-\Dual Biotin\ -GGACAGAGCCACAAACACCACAAGA-3'). Platinum Taq кит (Invitrogen, Карлсбад, Канада) был использован для синтеза цепи ДНК путем удлинения праймера. Следующие реактивы: 2 мкл 10X платинум TAQ буфер; 1,25 мкл, 50 мМ MgCl2; 0,8 мкл, 10 мМ дНТФ; 0,1 мкл, 10 мкМ 4468-3PA01-2Btn; 0,1 мкл Patinum TAQ; 14,75 мкл H2O; 1 мкл геномной ДНК, были смешаны в пробирке. Амплификация была проведена с использованием следующих условий реакции: 1) 94°С 3 минуты; 2) 98°С 10 секунд; 3) 63°С 1 минута; 4) 72°С 5 минут; 5) повторение шагов 2-4 15 раз; 6) 72°С 3 минуты; 7) 4°C удержание.

Пример 4

Реакция захвата была проведена с 2,5 мкл Dynabeads M-280 стрептавидиновыми магнитными бусами (Invitrogen, Карлсбад, Канада). Бусы были отмыты на магните PBST буфером (солевой фосфатный буфер и твин-20) один раз и PBS буфером (солевой фосфатный буфер) два раза. После того как супернатант был удален с магнита, 20 мкл PBS было добавлено к бусам и бусы были перемешаны и ресуспендированы. Этот раствор был добавлен к реакции удлинения одного праймера в концентрации 1:1, 20 мкл бус было смешано с 20 мкл реакции удлинения праймера. Полученный раствор был проинкубирован в течение 1 часа с осторожным пипетированием при комнатной температуре. Затем бусы были промыты на магните два раза PBST, два раза PBS и один раз H2O. Все промывочные растворы были удалены с бус.

Пример 5

Одноцепочечный адаптер был лигирован с одноцепочечной захваченной геномной ДНК мишенью из событий (3)-001, (3)-008 и (3)-009. Одноцепочечный адаптер (SEQ ID NO:2 (ZC-Adp-01)5'/5Phos/ATTGGATTCTCTGACGGTCGGACGC/36-FAM/-3'), который был синтезирован Integrated DNA Technologies. (Коралвилл, Йова), был лигирован термостабильной РНК лигазой (TRL) от Epicentre Technologies (Мэдисон, Висконсин). Следующая реакция была использована для лигирования адаптера с одноцепочечной ДНК: 0,125 мкл 100 мкМ ZC-Adp-01; 5,0 мкл 50% ПЭГ 8000(вес/объем в H2O); 1,0 мкл ДМСО; и 1,875 мкл H2O. Коктейль был перемешан и денатурирован на термоциклире при 94° в течение 5 минут, затем охлажден до комнатной температуры. Затем 1 мкл 10X TRL буфера, 0,5 мкл 1 мМ АТФ и 0,5 мкл TRL было добавлено и смешано с раствором. Результирующий раствор был добавлен к отмытым от реакции захвата бусам и инкубирован в термоциклере при 60°С в течение 1 часа и затем при 4°С. Бусы были промыты несколько раз на магните 0,1X ТЕ буфером и вся жидкость была удалена с бус.

Пример 6

ПЦР реакции были проведены с использованием Takara LA TAQ HS ПЦР кита (Millipor, Биллерика, Массачутес). Следующие праймеры были использованы для амплификации трансформанта и фланкирующей последовательности: специфический праймер трансгена, SEQ ID NO:3 (PAT-InvPriF) 5'- CGCTTACGATTGGACAGTTGAGAGTACTG-3') и праймер адаптера SEQ ID NO:4 (Zn_Adt_PCR_01) 5'GTCCGACCGTCAGAGAATCCAAT-3'). Следующие реагенты были использованы для ПЦР реакции: 5 мкл, 10X LA TAQ HS буфера; 8 мкл, 2,5 мМ дНТФ, 1 мкл 10 мкМ трансгенного специфичного праймера; 1 мкл 10 мкМ специфичного прймера адаптера; 0,5 мкл LA Taq HS полимеразы и 34,5 мкл H2O. Коктейль был добавлен к отмытым после реакции лигирования бусам и амплифицирован с использованием следующих условий в таблице 1.

Таблица 1
Условия ПЦР амплификации
1 цикл 94°С, 2 мин
2 цикла 98°С, 10 сек
66°С, 1 мин
68°С, 5 мин
28 циклов 98°С, 10 сек
64°С, 30 сек
68°С, 2,5 мин
1 цикл 72°С, 4 мин
1 цикл 4°С, ∞

Пример 7

Полученные ПЦР продукты, размером больше чем 850 пн были клонированы в плазмиду pCR2.1 (Invitrogen, Карлсбад, Канада). Колонии были изолированы и было подтверждено, что плазмида pCR2.1 содержит ПЦР ампликон. Векторы были секвенированы с использованием M13 прямым и М13 обратным праймерами. Ожидалось, что результаты секвенирования будут содержать нуклеотидную последовательность 3' геномной фланкирующей последовательности маиса в дополнение к присутствующим из плазмиды генетическим элементам. 3' трансгенная вставка и геномные фланкирующие последовательности трансформантов (3)-001 клон #4, (3)-008 клон #10, (3)-008 клон #13, и (3)-009 были выделены и идентифицированы с использованием техники описанной выше.

Характеристика геномных вставок указывала на то, что трансформант (3)-001 содержит несколько копий трансгена. Несколько уникальных вставок было идентифицировано внутри этого трансформанта. Трансформант (3)-001 клон #4 содержит уникальный фланкирующий участок, кроме того, фланкирующие последовательности второй и третей вставок, которые были перестроены, были выделены (данные не представлены). Уникальные фланкирующие участки указывают на то, что три копии трансгена включены в уникальные положения генома Zea mays.

Трансформант (3)-008 содержит две копии трансгена. Фланкирующие последовательности клона #10 трансформанта (3)-008 и клона #13 трансформанта (3)-008 являются уникальными и непохожими, тем самым, указывая на то, что две копии трансгена включены в уникальные положения генома Zea mays.

Трансформант (3)-009 содержит только одну копию трансгена. Изолированный фланкирующий участок был использован для идентификации положения в хромосоме трансгенной вставки внутри генома Zea mays.

Идентификация маисовых геномных фланкирующих последовательностей была ПОДРЫВНОЙ по отношению к Maize Genome Sequencing Consortium, Zea mays B73 геномной базы данных (Аризона, Genomics Institute, Университет Аризоны) по идентификации расположения в хромосоме трансгенной вставки. Фланкирующая последовательность трансформанта (3)-008 клона #13 была картирована в хромосоме #5. Фланкирующая последовательность трансформанта (3)-009 была картирована в хромосоме #3.

1. Способ определения и секвенирования неизвестной полинуклеотидной последовательности, прилегающей к известной полинуклеотидной последовательности, в выделенной ДНК, который включает:
a) гидролиз выделенной ДНК, которая содержит часть или всю известную полинуклеотидную последовательность и прилегающую неизвестную полинуклеотидную последовательность, одним или более подходящими рестрикционными ферментами для образования множества гидролизованных рестрикционных фрагментов;
b) синтезирование цепи комплементарной гидролизованным полинуклеотидным рестрикционным фрагментам с использованием олигонуклеотидной последовательности праймера, имеющей химическую структуру присоединения, связанную с 5′ концом олигонуклеотидной последовательности праймера;
c) выделение комплементарной цепи путем связывания химической структуры присоединения с соответствующей выделяющей матрицей, с последующей денатурацией комплементарной цепи из гидролизованных полинуклеотидных рестрикционных фрагментов;
d) лигирование одноцепочечного адаптера с выделенной комплементарной цепью, связанной с выделяющей матрицей, для образования лигированной выделенной комплементарной цепи, где указанный одноцепочечный адаптер содержит SEQ ID NO: 2;
e) выполнение первой ПЦР амплификации выделенной лигированной комплементарной цепи с использованием первого праймера ПЦР, предназначенного для связывания с известной полинуклеотидной последовательностью, и второго праймера ПЦР, предназначенного для связывания с одноцепочечным адаптером, для образования первого ампликона ПЦР;
f) выполнение второй ПЦР амплификации указанного первого ампликона ПЦР, где вторая ПЦР амплификация амплифицирует внутреннюю последовательность указанного первого ампликона ПЦР для образования второго ампликона ПЦР; и
g) секвенирование второго ампликона ПЦР для установления неизвестной полинуклеотидной последовательности.

2. Способ по п. 1, в котором выделенная ДНК является геномной ДНК растения.

3. Способ по п. 1, в котором неизвестная полинуклеотидная последовательность является трансгенной краевой последовательностью.

4. Способ по п. 1, в котором неизвестная полинуклеотидная последовательность является хромосомной последовательностью, которая фланкирует известную полинуклеотидную последовательность.

5. Способ по п. 1, в котором неизвестная полинуклеотидная последовательность является последовательностью природного гена, который обуславливает свойство.

6. Способ по п. 1, в котором известная полинуклеотидная последовательность является известной полинуклеотидной последовательностью вируса.

7. Способ по п. 1, в котором известная полинуклеотидная последовательность является известной полинуклеотидной трансгенной последовательностью.

8. Способ по п. 1, в котором известная полинуклеотидная последовательность является известной полинуклеотидной последовательностью транспозона.

9. Способ по п. 1, в котором известная полинуклеотидная последовательность является последовательностью гена, который обуславливает свойство.

10. Способ по п. 1, в котором способ использован для определения хромосомной локализации известной полинуклеотидной последовательности, вставленной в выделенную ДНК растения путем инсерционного мутагенеза.

11. Способ по п. 10, в котором указанный инсерционный мутагенез выбран из группы, состоящей из транспозонного мутагенеза или Т-цепочечного интеграционного мутагенеза.

12. Способ по п. 1, в котором способ используется для характеристики неизвестной полинуклеотидной последовательности, состоящей из хромосомной последовательности, которая фланкирует известную полинуклеотидную последовательность.

13. Способ по п. 12, в котором указанная характеристика полинуклеотидной последовательности трансгенного инсерционного участка определяет полинуклеотидную последовательность, состоящую из перестроек, инсерций, делеций или инверсий внутри неизвестной полинуклеотидной последовательности, состоящей из хромосомной последовательности.

14. Способ по п. 1, в котором способ используется для определения числа трансгенных копий.

15. Способ по п. 1, в котором способ использован для определения линий трансгенных растений.

16. Способ по п. 1, в котором способ использован для развития систем молекулярных маркеров.

17. Способ по п. 16, где указанный один или более подходящий рестрикционный фермент представляет собой TaqI.

18. Способ по п. 1, где указанный одноцепочечный адаптер представляет собой 5′-/5Phos/ATTGGATTCTCTGACGGTCGGACGC/36-FAM/-3′ (SEQ ID NO: 2).

19. Способ по п. 1, где указанный олигонуклеотидный праймер содержит SEQ ID NO: 1.

20. Способ по п. 19, где указанный олигонуклеотидный праймер представляет собой 5′-/Двойной Биотин/-GGACAGAGCCACAAACACCACAAGA-3′ (SEQ ID NO: 1).

21. Способ определения неизвестной полинуклеотидной последовательности, прилегающей к известной полинуклеотидной последовательности, в выделенной ДНК, который включает:
a) гидролиз выделенной ДНК, которая содержит часть или всю известную полинуклеотидную последовательность и прилегающую неизвестную полинуклеотидную последовательность, одним или более подходящими рестрикционными ферментами для образования множества гидролизованных рестрикционных фрагментов;
b) синтезирование цепи комплементарной гидролизованным полинуклеотидным рестрикционным фрагментам с использованием олигонуклеотидной последовательности праймера, имеющей химическую структуру присоединения, связанную с 5′ концом олигонуклеотидной последовательности праймера;
с) выделение комплементарной цепи путем связывания химической структуры присоединения с соответствующей выделяющей матрицей, с последующей денатурацией комплементарной цепи из гидролизованных полинуклеотидных рестрикционных фрагментов;
d) лигирование одноцепочечного адаптера с выделенной комплементарной цепью, связанной с выделяющей матрицей, для образования лигированной выделенной комплементарной цепи;
e) выполнение первой ПЦР амплификации выделенной лигированной комплементарной цепи с использованием первого праймера ПЦР, предназначенного для связывания с известной полинуклеотидной последовательностью, и второго праймера ПЦР, предназначенного для связывания с одноцепочечным адаптером, для образования первого ампликона ПЦР, где указанный первый ПЦР праймер содержит SEQ ID NO: 3, и указанный второй ПЦР содержит SEQ ID NO: 4;
f) выполнение второй ПЦР амплификации указанного первого ампликона ПЦР, где вторая ПЦР амплификация амплифицирует внутреннюю последовательность указанного первого ампликона ПЦР для образования второго ампликона ПЦР; и
g) секвенирование второго ампликона ПЦР для установления неизвестной полинуклеотидной последовательности.

22. Способ по п. 21, в котором выделенная ДНК является геномной ДНК растения.



 

Похожие патенты:

Изобретение относится к области биохимии. Представлен набор синтетических олигодезоксирибонуклеотидов для детекции гена msp1α риккетсии Anaplasma marginale методом полимеразной цепной реакции в режиме «реального времени».

Изобретение относится к области биотехнологии. Описан способ амплификации нуклеиновых кислот, в котором наночастицы в объеме реакционной смеси переносят тепло в окружающую их среду посредством возбуждения.

Изобретение относится к области молекулярной биологии и диагностической медицины. Предложен способ выделения циркулирующих ДНК из плазмы или сыворотки крови.

Группа изобретений относится к области биотехнологии и представляет собой варианты способов создания совокупности смежных фрагментов исследуемой области генома.

Настоящее изобретение относится к способам и продуктам для локализованной или пространственной детекции нуклеиновой кислоты в образце ткани и, в частности, к способу локализованной детекции нуклеиновой кислоты в образце ткани, включающему: (а) предоставление чипа, содержащего подложку, на которой непосредственно или опосредованно иммобилизованы многочисленные разновидности захватывающих зондов, так что каждая разновидность занимает определенное положение на чипе и ориентирована таким образом, что имеет свободный 3′-конец, позволяющий указанному зонду действовать в качестве праймера в реакции удлинения или лигирования праймера, где каждая разновидность указанного захватывающего зонда содержит молекулу нуклеиновой кислоты, имеющую в направлении от 5′ к 3′: (1) позиционную область, которая соответствует положению захватывающего зонда на чипе, и (2) захватывающую область; (б) приведение указанного чипа в контакт с образцом ткани таким образом, что положение захватывающего зонда на чипе может быть сопоставлено с положением в образце ткани, и предоставление возможности нуклеиновой кислоте образца ткани гибридизоваться с захватывающей областью в указанных захватывающих зондах; (в) синтез молекул ДНК на основе захваченных молекул нуклеиновой кислоты с использованием указанных захватывающих зондов в качестве праймеров удлинения или лигирования, где указанные удлиненные или лигированные молекулы ДНК являются мечеными благодаря позиционной области; (г) возможно синтез комплементарной нити указанной меченой ДНК и/или возможно амплификацию указанной меченой ДНК; (д) высвобождение по меньшей мере части меченых молекул ДНК и/или их комплементов или ампликонов с поверхности чипа, где указанная часть включает позиционную область или ее комплемент; и (е) прямой или опосредованный анализ последовательности высвобожденных молекул ДНК.

Группа изобретений относится к области биотехнологии. В группу изобретений входят нуклеиновая кислота, которая кодирует флуоресцентный биосенсор для регистрации изменения рН, аминокислотная последовательность которого показана в SEQ ID No: 4, а также кассета экспрессии и эукариотическая клетка, продуцирующая биосенсор.

Изобретение относится к области биохимии, в частности к способу идентификации растения, способного восстанавливать фертильность при цитоплазматической мужской стерильности С-типа, содержащего функциональный ген-восстановитель для цитоплазматической мужской стерильности С-типа кукурузы, включающему выделение молекул нуклеиновой кислоты из растения и скрининг выделенных молекул нуклеиновых кислот с использованием ПЦР в отношении молекулы нуклеиновой кислоты, содержащей нуклеотидную последовательность, выбранную из группы, состоящей из SEQ ID NO: 1-197 и маркеров, обозначаемых как полиморфизмы ID №№1-106 в таблице 3.

Изобретение относится к области молекулярной биологии, вирусологии, ветеринарии и медицине и касается способа идентификации РНК вирусов гриппа А и В с одновременным определением вариантов гемагглютинина и нейраминидазы вируса гриппа А, а также генетических маркеров патогенности и устойчивости к противогриппозным препаратам, на биологических микрочипах.

Изобретение относится к области медицины, и касается способа прогнозирования эффективности монотерапии пероральным сахароснижающим препаратом метформином у больных сахарным диабетом 2 типа.

Предложенная группа изобретений относится к области медицины. Предложен способ получения ДНК-праймеров и зондов для малоинвазивной пренатальной ПЦР-диагностики трисомии 21-й хромосомы у плода по крови беременной женщины, характеризующийся тем, что выбирают сайт дифференциального метилирования фетальной ДНК 21-й хромосомы и ДНК 21-й хромосомы взрослого человека, чувствительный к эндонуклеазам, синтезируют прямой и обратный праймер, соответствующие ампликону длиной от 60 до 300 п.н., а также зонд, соответствующий этому ампликону, проводят ПЦР в реальном времени смеси образцов после их обработки эндонуклеазой рестрикции, отбирают пары праймеров и зонды, обеспечивающие эффективность реакции ПЦР в реальном времени выше 90% и линейность при изменении относительной концентрации образцов выше 90%.

Предложенная группа изобретений относится к области медицины. Предложен способ получения ДНК-праймеров и зондов для малоинвазивной пренатальной ПЦР-диагностики трисомии 21-й хромосомы у плода по крови беременной женщины, характеризующийся тем, что выбирают сайт дифференциального метилирования фетальной ДНК 21-й хромосомы и ДНК 21-й хромосомы взрослого человека, чувствительный к эндонуклеазам, синтезируют прямой и обратный праймер, соответствующие ампликону длиной от 60 до 300 п.н., а также зонд, соответствующий этому ампликону, проводят ПЦР в реальном времени смеси образцов после их обработки эндонуклеазой рестрикции, отбирают пары праймеров и зонды, обеспечивающие эффективность реакции ПЦР в реальном времени выше 90% и линейность при изменении относительной концентрации образцов выше 90%.

Изобретение относится к области молекулярной биологии. Предложен способ автоматизированного выделения с одновременной очисткой нуклеиновых кислот из двух и более биологических образцов.

Изобретение относится к области биохимии, в частности к способу определения зиготности растения кукурузы, содержащего трансгенную конструкцию, содержащую ген арилоксиалканоатдиоксигеназы, где указанный способ включает: получение образца геномной ДНК от указанного растения кукурузы; получение приведенного в контакт образца посредством контактирования указанного образца ДНК с первым праймером и вторым праймером и флуоресцентным зондом, определение зиготности указанного растения кукурузы, а также к набору для его осуществления.

Изобретение относится к области биохимии, в частности к способу определения зиготности растения сои, включающего арилоксиалканоатдиоксигеназу (AAD-12) с SEQ ID NO: 1, где указанное растение содержит трансгенную конструкцию, включающую ген AAD-12, состоящий из остатков 2731-9121 SEQ ID NO: 1, и указанная трансгенная конструкция фланкирована 5′-фланкирующей геномной ДНК сои и 3′-фланкирующей геномной ДНК сои, где указанная 5′-фланкирующая геномная ДНК содержит остатки 1-2730 SEQ ID NO: 1, указанная 3′-фланкирующая геномная ДНК содержит остатки 9122-10212 SEQ ID NO: 1, а также к комплекту для его выполнения.

Изобретение относится к области биотехнологии. Предложен способ подготовки культур сульфидогенных бактерий для выделения ДНК.

Способ получения двуспиральной рибонуклеиновой кислоты (дсРНК) из клеток штамма Saccharomyces cerevisiae ВКПМ Y-448 включает разрушение клеток дрожжей в буфере с pH 7,4, содержащем 10 мМ Трис, 20 мМ ЭДТА и 0,5 М NaCl, обработку додецилсульфатом натрия в концентрации от 0,5 до 1,0% 20-25 мин при 20°C и хлороформом в концентрации до 25% 20-25 мин при 20°C.

Группа изобретений относится к области биохимии. Заявлены варианты способа скрининга и мониторинга онкологических заболеваний, включающего забор образца ткани, выделение из образца ткани РНК, синтез кДНК, амплификацию методом множественной обратной транскрипции полимеразой цепной реакции с последующим анализом амплифицированных продуктов.
Изобретение относится к фармацевтической промышленности, а именно к способу получения дрожжевого экстракта, содержащего биологически активную высокополимерную РНК.
Изобретение относится к биотехнологии и может быть использовано для получения свободного от белка биологически активного препарата высокополимерной РНК из сухих пекарских дрожжей Saccharomyces cerevisiae.

Изобретение относится к области биотехнологии, а именно к способу и диагностическому набору для диагностики коклюша и определения авирулентных мутантов возбудителя коклюша.

Изобретение относится к области генной инженерии, конкретно к скринингу веществ, оказывающих регулирующее вес действие, и может быть использовано в медицине. Способ скрининга веществ, оказывающих регулирующее вес действие, включает приведение тестируемого вещества в контакт с клетками, экспрессирующими ген синовиолина, и идентификацию того, имеет или нет указанное тестируемое вещество ингибирующее влияние на экспрессию гена синовиолина. Фармацевтические композиции включают нуклеиновую кислоту, которая подавляет экспрессию гена синовиолина, или ингибитор активности убиквитинирования белка синовиолина. Изобретение позволяет воздействовать на снижение веса за счет ингибирования экспрессии гена или активности белка синовиолина. 3 н. и 1 з.п. ф-лы, 5 ил., 1 пр.
Наверх