Способ быстрого отбора вариантов gp-120 вич

Изобретение относится к области биотехнологии, конкретно к новым иммуногенам ВИЧ, и может быть использовано в медицине для лечения или предотвращения заболевания, вызываемого инфекцией ВИЧ. Полипептид - вариант gp120 ВИЧ-1 с SEQ ID NO: 4 отбирают способом быстрого отбора иммуногенов (RIS) на основании связывания библиотеки рекомбинантных вирусов, содержащих рандомизированные варианты gp120 ВИЧ, поверхностного полипептида, находящегося на антителах с нейтрализующей активностью. Изобретение позволяет эффективно индуцировать антитела с нейтрализующей активностью против ВИЧ-1. 6 н. и 1 з.п. ф-лы, 5 ил., 1 табл.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к способу быстрого отбора иммуногенов, которые могут индуцировать антитела с высокой нейтрализующей активностью (nAb). Описано и приведено в качестве примера несколько примеров таких иммуногенов с повышенной активностью nAb. В частности, описаны иммуногены с повышенной аффинностью антитела в отношении эпитопов Env ВИЧ-1.

Уровень техники

По расчетам, с 1982 года более 60 миллионов человек во всем мире было инфицировано вирусом иммунодефицита человека. Приблизительно половина из этих инфицированных индивидуумов умерли в результате синдрома приобретенного иммунодефицита (СПИД) в течение того же периода времени. Несмотря на то, что в последнее время распространение вируса достигло плато, в 2009 годы было опубликовано о 2,5 миллионах новых ВИЧ-инфицированных. ВИЧ все еще представляет собой основную проблему здравоохранения. См. UNAIDS, 2010, Report on the global AIDS epidemic.

ВИЧ-1 представляет собой один из наиболее генетически многообразных вирусных патогенов, описанных на настоящее время. Существует три основных ветви филогенетического дерева ВИЧ-1, группы M (основной), N (новый) и O (посторонний). Вирусы группы M являются наиболее распространенными, насчитывая более 99% случаев инфекции во всем мире. В настоящее время эту группу разделяют на девять отдельных генетических подтипов или типов (от A до K), в основном в зависимости от коротких последовательностей гена env (оболочки). См. McCutchan F, AIDS, 2000, 14(S3):S31-S44 и Robertson D. et al., Science, 2000, 288:55-56.

Env представляет собой наиболее изменчивый ген ВИЧ-1, имеющий изменчивость последовательности до 35% между типами, изменчивость последовательности 20% внутри типа и изменчивость последовательности до 10% у инфицированного индивидуума. См. Kuiken C. et al., AIDS, 1996, 10:31-37 и Shankarappa R. et al., J. Virol., 1999, 73:10489-10502. Clade B is dominant in Europe, the Americas, and Australia. См. Kuiken C. et al., AIDS, 1996, Am. J. Epidemiol., 2000, 152:814-822. Clade C is common in southern Africa, China, and India and presently infects more people worldwide than any other clade. См. McCutchan, 2000, выше. Clades A and D are prominent in central and eastern Africa.

Однако большое число вирусов трудно классифицировать по типам вследствие обычно происходящего смешивания совместно циркулирующих вирусов, которое приводит к образованию рекомбинантных форм внутри типа. См. Heyndrickx L. et al., J. Virol., 200, 74:363-370 и McCutchan F. et al., Virology, 1999, 254:226-234. Некоторые рекомбинантные формы фактически дают важные эпидемиологические линии, называемые циркулирующие рекомбинантные формы (CRF). Две наиболее распространенные формы представляют собой CRF01 (AE), обнаруженный в Таиланде, который изначально классифицировали как тип E, хотя позже было обнаружено, что он является типом E только по env и типом A по другим частям генома, и CRF02, рекомбинантная форма AG, широко распространенная в Западной Африке. См. Robertson, 2000, выше. Во всем мире типы от A до D и рекомбинантые формы AE CRF01 и AG CRF02 насчитывают более 90% случаев инфицирования во всем мире.

Антитела с нейтрализующей активностью (nAb) в отношении белков оболочки вируса (Env) представляют собой первую линию приобретенной иммунной защиты против действия ВИЧ-1, благодаря блокированию инфицирования восприимчивых клеток. См. Kwong P, et al., Nature 1998; 393:648-659, Moore J, et al., J. Virol. 1994; 68:469-484, Moore P, et al., J. Virol. 1996; 70:1863-1872, and Parren P, et al., AIDS 1999; 13:S137-S162. Эффективность вакцин против некоторых вирусов объясняется их способностью индуцировать nAb. См. Burton D., Nat. Rev. Immunol., 2002, 2:706-713 и Zinkerangel R. et al., Adv. Immunol., 2001, 79:1-53. Однако несмотря на огромные усилия прогресс в разработке эффективных иммуногенов ВИЧ-1 крайне ограничен. См. Burton, 2002, выше, McMichael A., Hanke T., Nat. Med., 2003, 9:874-880 и Moore, 1996, выше. Для создания таких иммуногенов необходимо идентифицировать эпитопы, которые способны индуцировать более эффективную продукцию nAb. К сожалению, сделанные до настоящего времени попытки получения иммуногенов, которые вызывают продукцию широкого спектра nAb, были неудачными.

Таким образом, в данной области существует необходимость в новых иммуногенах ВИЧ-1, способных индуцировать более эффективную продукцию nAb.

Сущность изобретения

Настоящее изобретение относится к способу быстрого отбора иммуногенов (RIS), которые могут вызывать высокую активность nAb при использовании их в качестве B-клеточных иммуногенов. Способ включает: i) случайную мутацию нуклеотидной кодирующей последовательности представляющего интерес эпитопа дикого типа с получением библиотеки вариантов указанного эпитопа, ii) тестирование библиотеки с использованием антитела или его частей, в отношении которых известна аффинность к эпитопу дикого типа, и iii) отбор вариантов эпитопа, которые повышают аффинность антитела. Предпочтительно, эпитоп представляет собой эпитоп ВИЧ. Более предпочтительно, эпитоп представляет собой эпитоп Env.

Во втором варианте осуществления изобретение относится к нуклеотидным последовательностям и пептидам, получаемым способом RIS, таким как нуклеотидные последовательности SEQ ID NO:1 и SEQ ID NO:3.

В третьем варианте осуществления изобретение относится к применению нуклеотидных последовательностей и пептидов, получаемых способом RIS, для профилактики и лечения заболеваний, индуцируемых полностью или частично под действием представляющего интерес эпитопа дикого типа. Предпочтительно, заболевание представляет собой СПИД или заболевание, вызываемое инфекцией ВИЧ.

В четвертом варианте осуществления изобретение относится к диагностическому применению способа RIS.

Краткое описание чертежей

Фигура 1. Последовательность мутантов, идентифицированных способом RIS по изобретению. Верхняя последовательность соответствует аминокислотам 121-160 полипептида gp160 AC10. Последовательности соответствующих областей в выделенных клонах показаны в виде точек, где аминокислота является такой же, как аминокислота в gp160 AC10 или соответствует аминокислоте в этих положениях, где последовательность мутанта отличается от последовательности дикого типа.

Фигура 2. Предполагаемое взаимодействие между антителом 4E10 и конкретным мутантом LR1-C1. Показаны одиннадцать замен аминокислот во всем гене env, включая потерю 3 потенциальных N-связанных участков гликозилирования. Мутация C131Y является особенно релевантной, т.к. такая замена устраняет нативную дисульфидную связь между C131 и C157, разрушая структуру петли V1/V2.

Фигура 3. Для вириона LR1-C1, идентифицированного способом RIS по изобретению, показано повышение аффинности к антителу с нейтрализующей активностью широкого спектра действия 4E10. На графике показано титрование связывания вирионов с планшетами, покрытыми антителом 4E10, которое определено добавлением возрастающего количества изолята AC10 дикого типа и изолята LR1-C1 к планшетам, покрытым антителом 4E10 или без обработки. На диаграмме показано 4-кратное повышение аффинности антитела 4E10 к LR1-C1 по сравнению с вариантом дикого типа.

Фигура 4. Для вириона LR1-C1, идентифицированного способом RIS по изобретению с использованием антитела 4E10, не показана повышенная аффинность к другим антителам с нейтрализующей активностью широкого спектра действия. На графике показано титрование связывания вирионов с планшетами, покрытыми антителами 2F5 (панель A), 2G12 (панель B) или b12 (панель C), что определено при добавлении возрастающего количества изолята AC10 дикого типа, изолята LR1-C1 или вирионов, несущих делецию в гене env, к планшетам, покрытым антителами или без обработки.

Фигура 5. Выравнивание SEQ ID NO:31 с последовательностью HXB2 AC10 дикого типа. SEQ ID NO:31 обладает аффинностью к антителу PG16. Модифицированная последовательность содержит две мутации: i) N203S в потенциальном участке гликозилирования и ii) G604E в области антигенной детерминанты gp41.

Подробное описание изобретения

A. Способ быстрого отбора иммуногенов (RIS)

Изобретение относится к новому подходу оптимизации белка оболочки (Env) ВИЧ-1 в качестве иммуногена. В этом подходе учитывают зависимость способности эпитопа индуцировать антитела от его присутствия на вирионе. Способ основан на отборе вариантов с повышенной аффинностью к nAb широкого спектра действия из библиотеки вирионов со случайно мутировавшими белками оболочки.

Согласно изобретению полноразмерный ген env штамма АС10 ВИЧ используют для создания библиотеки случайно мутировавших оболочек с помощью способа ПЦР. Клонирование осуществляли в окружении pNL4-3 и получали вирионы посредством временной трансфекции в клетки 293T. Отбор вирусов с повышенной аффинностью в отношении nAb 4E10 широкого спектра проводили с помощью улучшенного анализа захвата вириона в растворе. РНК экстрагировали из захваченной популяции вируса и проводили ПЦР с обратной транскрипцией с получением гена env из соответствующих вирусов для дальнейшего секвенирования и клонирования обратно в окружение pNL4-3. После одного круга отбора выделяли оболочку с 4-кратной повышенной аффинностью в отношении антитела 4E10. См. примеры.

Таким образом, в первом аспекте изобретение относится к способу идентификации иммуногенов, способных индуцировать антитела с нейтрализующей активностью против полипептида, который включает:

i) приведение в контакт антитела с нейтрализующей активностью, специфичного для указанного полипептида, с библиотекой рекомбинантных вирусов, где каждый из указанных рекомбинантных вирусов содержит рандомизированный ген, кодирующий вариант указанного полипептида и экспрессирующий указанный полипептид,

ii) отделение членов библиотеки рекомбинантных вирусов, которые связываются с антителом с нейтрализующей активностью, от членов, которые не связываются, по их способности связываться с антителом с нейтрализующей активностью и

iii) определение последовательности вариантов полипептидов, обнаруженных среди членов библиотеки рекомбинантных вирусов, отобранных на стадии (ii).

Как используется в настоящем описании термин "иммуноген" обозначает вещество, которое способно индуцировать приобретенный иммунный ответ у индивидуума, где указанный приобретенный иммунный ответ способен индуцировать иммунный ответ, со значительным вовлечением патогенных агентов, которые обладают общими иммунологическими свойствами с иммуногеном.

Термин "индукция", когда относится к иммунному ответу, как используют в настоящем изобретении, относится к специфическому контролю или к влиянию на активность иммунного ответа и включает активацию иммунного ответа, стимуляцию иммунного ответа, усиление иммунного ответа и/или изменение иммунного ответа (например, посредством индукции типа иммунного ответа, который в свою очередь изменяет преобладающий тип иммунного ответа у индивидуума от одного типа иммунного ответа, который является вредным или неэффективным, на другой тип, который является благоприятным и защитным).

Термин "антитело с нейтрализующей активностью" представляет собой любое антитело или его антигенсвязывающий фрагмент, которое связывается с патогеном и нарушает способность патогена инфицировать клетку и/или вызывать заболевания у индивидуума. Как правило, используемые в способе по настоящему изобретению антитела с нейтрализующей активностью связываются с поверхностью патогена и ингибируют или уменьшают инфекцию патогеном по меньшей мере на 99 процентов, по меньшей мере на 95 процентов, по меньшей мере на 90 процентов, по меньшей мере на 85 процентов, по меньшей мере на 80 процентов, по меньшей мере на 75 процентов, по меньшей мере на 70 процентов, по меньшей мере на 60 процентов, по меньшей мере на 50 процентов, по меньшей мере на 45 процентов, по меньшей мере на 40 процентов, по меньшей мере на 35 процентов, по меньшей мере на 30 процентов, по меньшей мере на 25 процентов, по меньшей мере на 20 процентов или по меньшей мере на 10 процентов по сравнению с инфекцией патогеном в отсутствии указанных антител(а) или в присутствии отрицательного контроля. Затем nAb можно тестировать для определения, обладают ли они нейтрализующей активность или активностью BNAb, используя любой из описанных в настоящем описании способов. Если антитела с нейтрализующей активностью или BNAb были индуцированы у животного, кроме человека, то CDR могут быть перенесены из каркаса, не являющегося каркасом человека, в каркас человека с получением антитела, подходящего для введения человеку. Способы определения, является ли антитело антителом nAb, описаны в данной области. См. Li M, et al., J. Virol., 2005, 79:10108-10125, Wei X, et al., Nature 2003, 422:307-312 и Montefiori D., Curr. Protoc. Immunol. 2005, Jan, Chapter 12:Unit 12.11. Эти способы основаны на определении снижения экспрессии репортерного гена после одного круга вирусной инфекции, используя получающую клеточную линию и вирус, который кодирует репортерный ген.

Как используется в настоящем изобретении термин "вирус" обозначает небольшой инфекционный агент, который может реплицироваться только внутри живых клеток различных организмов. Неограничивающие примеры семейств вирусов, которые можно использовать в способе по настоящему изобретению, включают Adenoviridae, вирусы подобные африканской лихорадке свиней, Arenaviridae, Arterivirus, Astroviridae, Baculoviridae, Birnaviridae, Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae, Deltavirus, Filoviridae, Flaviviridae, Hepadnaviridae, Hepeviridae, Herpesviridae, Orthomyxoviridae, Paramyxoviridae, Picomaviridae, Poxyviridae, Reoviridae, Retroviridae и Rhabdoviridae.

A.1 Стадия приведения в контакт

На первой стадии способ по изобретению включает приведение в контакт антитела с нейтрализующей активностью, специфичного в отношении полипептида, находящегося на поверхности указанного вируса, с библиотекой рекомбинантных вирусов, где каждый из указанных рекомбинантных вирусов содержит рандомизированный ген, кодирующий вариант указанного полипептида, находящегося на поверхности вируса.

Как используется в настоящем описании термин "библиотека" относится к различным коллекциям или смесям полинуклеотидов, содержащим полинуклеотиды, кодирующие различные рекомбинантные полипептиды. Размер и сложность библиотеки, которую используют в способах по настоящему изобретению, могут изменяться. Например, способы по изобретению можно использовать для скрининга библиотеки с до 500000 различных членов или библиотеки с 1×106, 1×108 или более членов. Характерные библиотеки вирусов содержат от 1×108 до 1×1013 членов, и такие библиотеки могут быть скринированы способами по изобретению. Безусловно, такие библиотеки являются предпочтительными, хотя понятно, что способы также можно без труда использовать для скрининга гораздо меньших библиотек (например, библиотек с количеством членов от 1000 до 50000, от 50 до 1000 или от 100 до 500, или от 10 до 100, или от 5 до 100). Разнообразие вариантов в библиотеке можно получать посредством мутагенеза генов, кодирующих варианты на уровне триплетов ДНК, таким образом, что отдельные кодоны становятся мозаичными (например, с помощью праймеров частично рандомизированной последовательности в реакции ПЦР).

Когда речь идет о библиотеках молекул в настоящем описании, то этот термин можно использовать для обозначения библиотеки на уровне нуклеиновых кислот или белков (т.е. до или после экспрессии). Однако понятно, что такие библиотеки экспрессии должны быть предоставлены на уровне белков для того, чтобы отобрать взаимодействующих связывающихся партнеров. Таким образом, для того, чтобы стадия приведения в контакт (a) успешно прошла, необходимо, чтобы библиотеки были представлены на уровне белков (хотя исходно они могут быть представлены на уровне нуклеиновых кислот).

В предпочтительном варианте осуществления полипептид, против которого используют антитела с нейтрализующей активностью в стадии (i), экспрессируется в вирусе. В предпочтительном варианте осуществления полипептид находится "на поверхности вируса". В описании настоящего изобретения этот термин относится к любому полипептиду, который является доступным для реагентов, таких как антитела, без необходимости разрушения структуры вируса. Понятно, что расположенный на поверхности полипептид может быть капсидным полипептидом в случае безоболочечных вирусов или полипептидом оболочки в случае оболочечных вирусов. В предпочтительном варианте осуществления находящийся на поверхности вируса полипептид является полипептидом оболочки.

Для получения библиотеки рекомбинантных вирусов можно конструировать любой белок вирусной оболочки, где каждый из указанных рекомбинантных вирусов содержит рандомизированный ген, кодирующий вариант указанного полипептида. Характерные антигены включают антигены, выбранные из гемагглютинина вируса гриппа, гликопротеина G респираторно-синцитиального вируса человека, корового белка, белка матрикса или другого белка вируса денге, гемагглютинина вируса кори, гликопротеина gB вируса простого герпеса 2 типа, полиовируса I VP1, гликопротеинов оболочки или капсида ВИЧ-1 или ВИЧ-II, поверхностного антигена гепатита B, дифтерийного токсина, эпитопа 24M стрептококков, гонококкового пилина, g50 (gpD) вируса псевдобешенства, вируса псевдобешенства II (gpB), вируса псевдобешенства gIII (gpC), гликопротеина H вируса псевдобешенства, гликопротеина E вируса псевдобешенства, гликопротеина 195 трансмиссивного гастроэнтерита, белка матрикса инфекционного гастроэнтерита, гликопротеина 38 ротавируса свиньи, капсидного белка парвовируса свиньи, защитного антигена Serpulinahydodysenteriae, гликопротеина 55 вирусной диареи крупного рогатого скота, гемагглютинин-нейраминидазы вируса болезни Ньюкасла, гемагглютинина свиного грипп, нейраминидазы свиного гриппа, вируса ящура, вируса холеры свиней, вируса инфлюэнца свиней, вируса африканской лихорадки свиней, Mycoplasma liyopneutiioniae, вируса инфекционного ринотрахеита крупного рогатого скота, гликопротеина E вируса инфекционного ринотрахеита крупного рогатого скота, гликопротеина G, вируса инфекционного ларинготрахеита, гликопротеина G или гликопротеина I вируса инфекционного ларинготрахеита, гликопротеина вируса Ла Кросс, вируса диареи новорожденных телят, вируса венесуэльского энцефалита лошадей, вируса Пунта-Торо, вируса лейкоза мышей, вируса опухоли молочной железы мышей, корового белка вируса гепатита B и поверхностного антигена или его фрагмента или производного вируса гепатита B, антигена вируса гриппа лошадей или вируса герпеса лошадей, включая нейраминидазу вируса гриппа лошадей типа A/Alaska 91, нейраминидазу вируса гриппа лошадей типа A/Miami 63, нейраминидазу вируса гриппа лошадей типа A/Kentucky 81, гликопротеина B вируса герпеса лошадей типа 1 и гликопротеина D вируса герпеса лошадей типа 1, антигена респираторно-синцитиального вируса крупного рогатого скота или вируса парагриппа крупного рогатого скота, белка прикрепления (BRSV G) респираторно-синцитиального вируса крупного рогатого скота, слитого белка (BRSV F) респираторно-синцитиального вируса крупного рогатого скота, нуклеокапсидного белка (BRSV N) респираторно-синцитиального вируса крупного рогатого скота, слитого белка вируса парагриппа типа 3 крупного рогатого скота, гемагглютинин-нейраминидазы вируса парагриппа типа 3 крупного рогатого скота, гликопротеина 48 и гликопротеина 53 вируса вирусной диареи крупного рогатого скота.

Предпочтительно, библиотека рекомбинантных вирусов представляет собой библиотеку ретровируса. Термин "ретровирус" означает любой РНК-вирус, который реплицируется в клетке-хозяине с помощью фермента обратной транскриптазы с образованием ДНК из его генома РНК и который относится к семейству Retroviridae.

Термин "ретровирус" используют в настоящем описании в его общепринятом значении, и, как правило, он включает класс вирусов, в которых генетический материал представляет собой одноцепочечную РНК, и которые используют обратную транскриптазу для транскрипции вирусной РНК в ДНК в хозяине. Ретровирусы, как предусмотрено в настоящем описании, могут, в частности, принадлежать к семейству вирусов Retroviridae, более конкретно, к подсемействам Oncovirinae, Lentivirinae или Spumavirinae, ретровирусы, как предусмотрено в настоящем описании, могут быть патогенными. Последовательности env могут быть получены из любого известного ретровируса, включая, но не ограничиваясь ими, ВИЧ, MuLV, SMRV, SFV, HPV, MMTV, SRV, HTLV-I, HTLV-II, BLV, BIV, SIV, вирус висны, EIAV, FIV и EIAV, и из любого вируса подсемейства ретровирусов (например, Oncovirinae, Lentivirinae или Spumavirinae). Многие клоны ретровирусов, включая клоны ВИЧ-1, являются хорошо охарактеризованными и доступными.

В частности, в настоящем описании предусмотрены ретровирусы, инфицирующие животных, более предпочтительно, ретровирусы теплокровных животных, еще более предпочтительно, позвоночных животных, еще более предпочтительно, млекопитающих, еще более предпочтительно, приматов и, наиболее предпочтительно, людей. Особенно предпочтительными в настоящем описании являются ретровирусы человека, включая, но ими не ограничиваясь, ВИЧ-1, ВИЧ-2, HTLV-I и HTLV-2. Общепринятые хранилища информации последовательности ВИЧ (и других ретровирусов) включают GenBank, EMBL, DDBJ и NCBI. Хорошо охарактеризованные клоны ВИЧ-1 включают HXCB2, ВИЧ-1-MN и ВИЧ-1-MN-ST.1. См. Hall L, et al., J. Virol., 1992, 66(9):5553-5560.

В предпочтительном варианте осуществления библиотека рекомбинантных вирусов представляет собой библиотеку вирусов ВИЧ, получаемых при рандомизации по меньшей мере одного поверхностного полипептида. Сокращение "ВИЧ" используют в настоящем описании для обозначения вирусов иммунодефицита человека в общем, и оно включает все типы и/или штаммы вируса иммунодефицита человека 1 (ВИЧ-1) и вируса иммунодефицита человека 2 (ВИЧ-2) и является синонимичным более старым терминам для ВИЧ, таким как HTL VIII и LAV.

В еще одном предпочтительном варианте осуществления различные члены библиотеки ВИЧ являются рандомизированными по гену env. Как используется в настоящем изобретении термин ген env относится к полинуклеотиду вирусного генома, который кодирует белок оболочки ВИЧ. Как используется в настоящем изобретении термины "полипептид Env" или "полипептид оболочки" относятся к молекуле, получаемой из белка оболочки ВИЧ. Белок оболочки ВИЧ представляет собой гликопротеин приблизительно 160 кДа (gp160). При вирусной инфекции клетки-хозяина gp160 расщепляется протеазами клетка-хозяина с образованием gp120 и интегрального мембранного белка gp41.

"Полипептид gp120" представляет собой молекулу, получаемую из области gp120 полипептида Env. Зрелые полипептиды gp120 дикого типа содержат приблизительно 500 аминокислот в своей первичный последовательности. Gp120 является сильно N-гликозилированным, что обуславливает кажущуюся молекулярную массу 120 кДа. Аминокислотная последовательность gp120 приблизительно составляет 511 аминокислот. Gp120 содержит пять относительно консервативных доменов (C1-C5), диспергированных с пятью вариабельными доменами (V1-V5). Вариабельные домены содержат много аминокислотных замен, вставок и делеций. "Полипептид gp120" содержит отдельные субъединицы и мультимеры. Участок gp41 закреплен (и пронизывает) мембранный бислой вириона, тогда так сегмент gp120 выступает в окружающую среду. Рецептор-связывающий домен gp120 расположен на N-концевой половине белка. За ним следует пролин-богатая область (PRR), которая, как предполагают, действует как шарнирная область или инициатор взаимодействия связывания рецептора с комплексом слияния. C-конец gp120 является высококонсервативным и взаимодействует с gp41. Примерные последовательности полипептидов gp160 дикого типа являются доступными. См. номера доступа GeneBank AAB05604 и AAD12142.

Рандомизацию гена env можно проводить по полной последовательности гена env или, предпочтительно, по части гена env, которая соответствует кодирующей области gp120, т.к. она представляет собой молекулу, которая взаимодействует с рецептором на клетки-мишени и которая является лучшим кандидатом для связывания с антителами с нейтрализующей активностью. Кроме того, рандомизацию области гена env, кодирующей gp120 можно проводить по полной последовательности, или она может быть направленной к одному или более доменам полипептида gp120. Таким образом, способ RIS по изобретению предусматривает использование библиотеки ВИЧ, получаемой рандомизацией в любой из консервативных петель (C1-C5) gp120, в любой из вариабельных петель (V1-V5) в gp120 или в предпочтительной комбинации консервативных областей и вариабельных петель. В предпочтительном варианте осуществления рандомизацию проводят по всему гену env. В другом варианте осуществления рандомизацию проводят в области гена env, соответствующей gp120. В другом варианте осуществления рандомизацию проводят в областях гена env, соответствующих областям V1 и/или V2 gp120.

Для введения мутации в молекулу нуклеиновой кислоты можно использовать любые способы мутагенеза. См. Sambrook J, et al., “Molecular Cloning. A Laboratory Manual” (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, US, 1989), Bishop T, et al., “Nucleic Acid and Protein Sequence. A Practical Approach” (IRL Press, Oxford, England, 1987), Reznikoff W, Ed., “Maximizing Gene Expression” (Butterworths Publishers, Stoneham, MA, US, 1987), Davis L, et al., “Basic Methods in Molecular Biology” (Elsevier Science Publishing Co., New York, NY, US, 1986), Schleef M, Ed., “Plasmid for Therapy and Vaccination” (Wiley-VCH Verlag GmbH, Weinheim, Germany 2001), Adereth Y, et al., Biotechniques 2005, 38:864-868, Allan J, et al., Biotechniques 1995; 18:746-750, Bubeck A, et al., J. Virol. 2004, 78:8026-8035, Doran B, патентная публикация США 20070111201, Locher C, et al., DNA Cell Biol. 2005; 24:256-263, Vasl J, et al., Biotechniques 2004; 37:726-730, Weiss G, et al., Proc. Natl. Acad. Sci. USA 2000; 97:8950-8954, и Delcourt M, US 6924112. Стратегии мутагенеза включают случайный мутагенез, Ala-сканирующий мутагенез, сайт-специфический мутагенез и химерную рекомбинацию. Наборы и службы для проведения мутагенеза являются коммерчески широкодоступными.

Термин "антитела с нейтрализующей активностью" включает подкласс BNAb. Как используется в настоящем изобретении под "антителом с нейтрализующей активностью с широким спектром действия" или "BNAb" понимают антитело, получаемое любым способом, которое при доставке в эффективной дозе можно использовать в качестве терапевтического средства для профилактики или лечения инфекции ВИЧ или СПИД, против более 7 штаммов ВИЧ, предпочтительно, более 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 или более штаммов ВИЧ. Подходящие антитела с нейтрализующей активностью, которые можно использовать в способе RIS по настоящему изобретению включают, но ими не ограничиваются, антитела, направленные против мембрано-проксимального внешнего региона (MPER), антитела, направленные против участка связывания CD4, и антитела, направленные против гликанов с высоким содержанием маннозы. В предпочтительных вариантах осуществления антитела с нейтрализующей активностью, которые можно использовать в способе RIS по настоящему изобретению включают одно или более антител, выбранных из группы, состоящей из:

a) антитела 4E10, которое распознает сегмент эктодомена gp41, прилежащего к вирусной мембране. См. Cardoso R, et al., Immunity, 2005, 22:163-173, номер доступа PHSL 90091703, каталожный номер NIH ARRRP 10091 и Katinger H, et al., US 5753503;

b) антитела 2F5, которое распознает сегмент эктодомена gp41, прилежащего к вирусной мембране. См. Ofek G. et al., J. Virol., 2004, 78:10724-10737, номер доступа PHSL 90.091704, каталожный номер NIH ARRRP 1475 и Katinger, выше;

c) антитела, описанного в EP 0822941, связывающегося с двумя различными антигенными детерминантами ВИЧ-1, где антигенные детерминанты представляют собой фрагменты gp160 и соответствуют аминокислотным последовательностям 79-184 и 326-400 процессированного gp120 изолята ВИЧ-1 BH10. См. номера доступа PHSL 95032240 и 95032241;

d) 2G12, которое распознает углеводороды на внешней поверхности gp120 (mAb 2G12). См. Trkola A, et al., J. Virol., 1996, 70:1100-1108, номер доступа EACC 93091517 и NIH ARRRP каталожный номер 1476;

e) антитела b12, которое распознает участок связывания CD4. См. Burton D, et al., Science, 1994, 266: 1024-1027, каталожный номер NIH ARRRP 2640 и Burton D, et al., EP 0675904; и

f) антител с нейтрализующей активностью PG9, PG16, PG20, PGG14 и PGC14. См. Chan-Hui P, et al., WO2010107939.

Способы определения, является ли антитело антителом nAb, описаны в данной области. Некоторые из этих способов основаны на определении уменьшение эффекта антитела, экспрессии репортерного гена после одного круга вирусной инфекции с использованием получающей клеточной линии, которая кодирует репортерный ген. См. Li, 2005, Wei, 2003, Montefiori, 2005, выше и Alvin C. WO2009117661.

Нейтрализующую способность антител для применения по настоящему изобретению можно охарактеризовать IC50 (т.е. концентрацией антитела, которая вызывает 50% снижение инфекции клетки-мишени). Предпочтительно, антитела с нейтрализующей активностью для применения по настоящему изобретению обладают IC50 2 мкг/мл или менее (менее 0,15 мкг/мл, менее 0,125 мкг/мл, менее 0,10 мкг/мл, менее 0,075 мкг/мл, менее 0,05 мкг/мл, менее 0,025 мкг/мл, менее 0,02 мкг/мл, менее 0,015 мкг/мл, менее 0,0125 мкг/мл, менее 0,01 мкг/мл, менее 0,0075 мкг/мл, менее 0,005 мкг/мл или менее 0,004 мкг/мл (концентрация антитела 10-8 или менее, предпочтительно, 10-9 M или менее, предпочтительно, 10-10 M или менее, т.е. 10-11 M, 10-12 M, 10-13 M или менее). Это означает, что для 50 процентной нейтрализации клинического изолята ВИЧ in vitro необходимы только очень низкие концентрации антитела. Активность может быть измерена стандартным анализом нейтрализации, как описано в данной области.

Стадию приведения в контакт проводят в условиях, достаточных для того, чтобы члены библиотеки рекомбинантных вирусов, которые способны специфически связываться с антителами с нейтрализующей активностью, фактически связывались с указанными антителами.

Как используется в настоящем изобретении термин "специфически связываться" (или его производные) относится к взаимодействию между связывающимися парами (например, двумя белками или соединениями). В некоторых вариантах осуществления константа аффинности взаимодействия составляет не более 10-6 моль/литр, не более 10-7 моль/литр или не более 10-8 моль/литр. В основном фраза "специфически связывается" относится к специфическому связыванию одного соединения с другим, где уровень связывания, как измерено стандартным анализом (например, иммунологическим анализом), является статистически значимо выше контрольного фонового значения анализа.

Условия во время стадии приведения в контакт специалист в данной области может определять общепринятым способом. Примерные условия "приведения в контакт" могут включать инкубацию в течение от 15 минут до 4 часов (например, один час при 4°C, 37°C или при комнатной температуре). Однако их можно изменять при необходимости в зависимости, например, от природы взаимодействующих партнеров по связыванию. Образец можно необязательно и, предпочтительно, подвергать аккуратному встряхиванию, перемешиванию или вращению. Кроме того, можно добавлять другие соответствующие реагенты, такие как блокирующие средства, для снижения неспецифического связывания. Например, можно использовать 1-4 процентный BSA или другое подходящее блокирующее средство (например, молоко). Следует понимать, однако, что специалист может изменять и адаптировать условия для приведения в контакт в зависимости от цели способа скрининга. Например, если температура инкубации, например, составляет комнатную температуру или 37°C, это может повышать возможность идентификации связывающих средств, которые являются стабильными в этих условиях (например, в случае инкубации при 37°C, связывающие средства, которые являются стабильными в условиях, встречающихся в организме человека). Такое свойство может быть чрезвычайно полезным, если один или оба партнера по связыванию представляют собой кандидат для применения в некоторых видах терапевтического применения (например, антитело). Такие адаптации входят в компетенцию специалиста.

В предпочтительном варианте осуществления антитело с нейтрализующей активностью, используемое на стадии приведения в контакт, можно иммобилизовать на твердой подложке различными способами, известными специалистам в данной области, которые подробно описаны в патентной и научной литературе. Твердая подложка может представлять собой любое известное специалистам в данной области вещество, для которого известно, что на нем можно фиксировать антитело. Например, твердая подложка может представлять собой стенку тестового планшета для микротитрования или нитроцеллюлозный фильтр, или другую подходящую мембрану. Альтернативно, подложка может представлять собой гранулу или диск, такой как из стекла, стеклопластика, латекса или пластикового материала, такого как полистирол или поливинилхлорид. Подложка также может представлять собой магнитную частицу или волоконный оптический сенсор. См. Jorgenson R, et al., US 5359681.

Антитело можно иммобилизовать на твердой подложке различными способами, известными специалисту в данной области, которые подробно описаны в патентной и научной литературе. В контексте настоящего изобретения иммобилизация включает нековалентную связь, такую как адсорбция, и ковалентное связывание (которое может представлять собой прямую связь между антигеном и функциональными группами на подложке или может представлять собой связь посредством перекрестносшивающего средства). Предпочтительной является иммобилизация посредством адсорбции в лунке планшета для микротитрования или на мембране. В таких случаях адсорбцию можно получать приведением в контакт антитела в подходящем буфере с твердой подложкой в течение подходящего количества времени. Время приведения в контакт зависит от температуры, но, как правило, составляет приблизительно от 1 часа до 1 суток. В одном из вариантов осуществления приведение в контакт лунки пластикового планшета для микротитрования (такого как из полистирола или поливинилхлорида) с количеством антитела в диапазоне приблизительно от 10 нг приблизительно до 1 мкг и, предпочтительно, приблизительно 100-200 нг является достаточным для иммобилизации подходящего количества полипептида.

Ковалентное связывание антитела с твердой подложкой можно также получать сначала взаимодействием подложки с бифункциональным реагентом, который взаимодействует с подложкой и функциональной группой, такой как гидроксильная группа или аминогруппа, на антителе. Например, антитело можно ковалентно связывать с подложками, содержащими соответствующее полимерное покрытие, с использованием бензохинона или путем конденсации альдегидной группы на подложке с амином и активным водородом на партнере по связыванию хорошо известными способами.

Альтернативно, вместо иммобилизации антитела с нейтрализующей активностью ковалентно или нековалентно на подложке в изобретение предусмотрена возможность иммобилизации антитела посредством связывания с первым специфическим к Fc антителом или фрагментом антитела против Fc, который предварительно иммобилизовали на подложке. В дополнение к облегчению иммобилизации антитела первое антитело располагает антитело с нейтрализующей активностью так, чтобы повышать процент иммобилизованного антитела, которое является активным для связывания с членами вирусной библиотеки. Например, иммобилизацию можно проводить сначала приведением в контакт антитела, которое иммобилизовали на твердой подложке, как правило, в лунке планшета для микротитрования, с библиотекой, таким образом, чтобы обеспечить тем вирусам в библиотеке, которые обладают аффинностью к образцу антитела с нейтрализующей активностью, связывание с иммобилизованным антителом. Затем удаляют несвязавшийся образец из иммобилизованных комплексов антитело-вирус. Более конкретно, после того, как антитело иммобилизуют на подложке, как описано выше, как правило, оставшиеся участки связывания белка на подложке являются блокированными.

A.2 Стадия разделения

На второй стадии способ RIS по изобретению включает отделение тех членов библиотеки рекомбинантных вирусов, которые связываются с антителом с нейтрализующей активностью, от членов, которые не связываются, на основании их способности связываться с антителом с нейтрализующей активностью.

Указанная стадия разделения может относиться к физическому разделению (например, на гранулах или FACS) или удалению твердой фазы из реакционной смеси, или может относиться к стадии, в которой твердую фазу подвергают одной или более стадиям промывания для удаления других компонентов реакционной смеси. В вариантах осуществления, где проводят физическое разделение или удаление твердой фазы, предпочтительно, затем твердую фазу также подвергают одной или более стадиям промывания.

Стадии промывания можно проводить любым подходящим образом в зависимости от природы твердой фазы и взаимодействующих партнеров по связыванию, связанных с ней. Специалисту в данной области хорошо известны подходящие способы промывания твердых фаз в форме частиц. Например, если твердая фаза является фазой в форме частиц, то стадии промывания можно проводить центрифугированием частиц в таких условиях, что они образуют осадок при удалении супернатанта. Затем частицы можно ресуспендировать в подходящей водной среде (например, в той же среде, используемой на стадии приведения в контакт). Жесткость промываний (или фактически стадии приведения в контакт) можно модифицировать добавлением подходящих реагентов, хорошо известных специалисту в данной области (например, Tween), например, для снижения фонового или неспецифического связывания. Такие стадии осаждения и ресуспендирования представляют собой одно промывание. Можно проводить любое подходящее число промываний. Однако если твердая фаза представляет собой ферромагнетик, тогда подходящим способом проводят стадии промывания, применяя магнитное поле к сосуду, в котором проводили стадию приведения в контакт, удаляя супернатант и ресуспендируя твердую фазу в подходящей водной среде. Такие стадии магнитного разделения и ресуспендирования представляют собой одну стадию промывания, и можно проводить любое подходящее число промываний. Если твердая подложка не является на основе частиц (например, представляет собой плоскую поверхность, такую как пластина, чашка или фильтр), то специалисту в данной области также известны подходящие способы промывания таких твердых фаз.

Следует отметить, что также как и описанные выше необязательные стадии промывания в способе RIS одну или более стадий промывания также можно проводить на любой другой подходящей стадии. Например, одну или более стадий промывания твердых фаз также можно проводить после того, как проводят любую стадию иммобилизации, например, для удаления антител с нейтрализующей активностью, которые не связались с твердой фазой. Фактически такие стадии промывания являются предпочтительными. Также, одну или более стадий промывания можно проводить на твердых фазах в другие подходящие моменты времени во время проведения способа удаления, например, несвязавшихся молекул. Специалист в данной области может легко определять число необходимых промываний.

После того как удаляют компоненты реакционной смеси, которые слабо связываются или неспецифически связываются с антителами с нейтрализующей активностью, в заключении проводят стадию разделения, элюируя те члены библиотеки рекомбинантных вирусов, которые связались специфически с антителами с нейтрализующей активностью. В зависимости от типа иммобилизации указанную стадию элюирования можно проводить любым подходящим способом, таким как, например, с использованием щелочного детергента или аналогичного средства, которое разрывает нековалентные связи, с последующей нейтрализацией, предоставляя возможность взаимодействующим партнерам повторно сворачиваться и связываться друг с другом. В случае биотиновых меток, как правило, содержащие такие метки конструкции библиотеки конструируют так, чтобы они содержали своего рода участок расщепления, такой как участок протеазы, участок распознавания рестрикционного фермента или расщепляемую S-S линкерную группу, которую можно открывать дитиотреитолом (DTT). Также можно использовать TEA. Участок расщепления, такой как описанный выше участок, можно использовать с любым типом метки для обеспечения или облегчения элюирования.

Высвобождение вирусов из антитела с нейтрализующей активностью в результате стадии элюирования можно проводить, как правило, определяя наличие одного или более полипептидов вируса в супернатанте. В предпочтительном варианте осуществления анализируемый полипептид представляет собой капсидный полипептид вируса. Когда используют библиотеку ВИЧ, в частности, неограничивающие примеры белков ВИЧ, которые могут быть подходящими для использования в вариантах осуществления, представленных в настоящем описании, включают белки gag ВИЧ p53, p24, p17, p7, p6, p2 или p1, гликопротеины env ВИЧ gp120, gp41 или gp160, ферменты ВИЧ, включая интегразу (p31), обратную транскриптазу (p51 или p66), РНКазу H (p15), протеазу (p10), белки nef ВИЧ (p25/p27), белок vif ВИЧ p23, белок rev ВИЧ p19, белок vpr ВИЧ (p12/p10), белок vpu ВИЧ (p16) или белки tat ВИЧ (p16/p14). В предпочтительном варианте осуществления полипептид ВИЧ, анализируемый для того, чтобы выяснить эффективно ли элюируется отобранный вирус из антитела с нейтрализующей активностью, представляет собой p24.

Как используется в настоящем изобретении термин "p24 ВИЧ" относится к продукту гена области gag ВИЧ, охарактеризованного как обладающий кажущейся относительной молекулярной массой приблизительно 24000 Дальтон. Термин "p24 ВИЧ" также относится к модификациям и фрагментам p24, обладающим иммунологической активностью p24.

P24 может быть измерен ферментативными иммунологическими анализами, тогда как для детекции связывания p24 необходима предварительная обработка кислотой для диссоциации комплекса. Хотя способы изменяются в зависимости от производителей, в тестах антигена p24 ВИЧ используют способ ELISA с модификациями для детекции антигена, а не антитела. В характерном анализе, таком как типа "антитело-сэндвич", специфическое моноклональное антитело против p24 ВИЧ является связанным с твердой фазой (лункой планшета для микротитрования или полистирольными гранулами), действует, "захватывая" вирусный антиген в образце при добавлении. Для разрушения вирионов добавляют детергент (например, Triton X100), и если антиген содержится в среде, антиген свяжется с моноклональным антителом на твердой фазе.

A.3 Стадия детекции

На третьей стадии способ RIS по изобретению включает определение последовательности указанного вариантного пептида, находящегося на поверхности вируса на тех членах библиотеки, которые отобраны на стадии (ii).

После того как один или более наборов взаимодействующих членов вирусной библиотеки отобрали или выделили способами по изобретению, их подвергают дополнительному анализу. Для указанного дополнительного анализа или применений, как правило, кандидатные партнеры по связыванию необходимо отделять, удалять, выделять или элюировать из антитела с нейтрализующей активностью и дополнительно экспрессировать или продуцировать. Таким образом, способ по настоящему изобретению дополнительно включает стадию, где указанные члены вирусной библиотеки, способные специфически взаимодействовать с антителом с нейтрализующей активностью, отделяют, удаляют, элюируют или, предпочтительно, выделяют или экспрессируют, или продуцируют раздельно друг от друга. Указанный дополнительный анализ, как правило, включает выделение индивидуальных взаимодействующих членов библиотеки путем выделения РНК из связавшихся вирусов, обратную транскрипцию вирусной РНК в кДНК и клонирование указанной кДНК в подходящий вектор экспрессии.

После того как ДНК, кодирующую партнеры по связыванию, клонируют в подходящий вектор экспрессии, можно секвенировать ДНК, кодирующую партнер по связыванию, или можно экспрессировать белок в растворимой форме и подвергать соответствующим исследованиям связывания для дальнейшей характеристики кандидатов на уровне белков. Соответствующие исследования связывания зависят от природы партнеров по связыванию и включают, но не ограничиваются ими, ELISA, фильтрационные анализы скрининга, FACS или иммунофлуоресцентные анализы, измерение аффинности BiaCore или другие способы количественного определения константы связывания, окрашивание срезов ткани или клеток и другие иммуногистохимические способы. Такие способы хорошо описаны в литературе, и для анализа выбранных вариантов белка оболочки можно использовать один или более из них.

Как указано выше, в данной области известны подходящие способы анализа индивидуальных взаимодействующих партнеров по связыванию. Один из предпочтительных способов представляет собой секвенирование генетического материала вирусов библиотеки, которые специфически связываются с антителом с нейтрализующей активностью.

Как правило, в случае ретровирусов, которые в качестве генетического материала содержат РНК, стадия детекции включает выделение РНК, обратную транскрипцию РНК с получением одноцепочечной кДНК, обработку одноцепочечной ДНК с получением двухцепочечной ДНК и клонирование двухцепочечной кДНК в выбранный вектор и секвенирование кДНК.

Обратную транскрипцию проводят известными специалисту способами и можно проводить изотермически, а также с использованием термостабильной РНК-полимеразы в присутствии РНК-зависимой ДНК-полимераза, включая, но ими не ограничиваясь, AMV, клонированный AMV, MMLV, SuperscriptII, ReverTraAce, обратную транскриптазу Tth, обратную транскриптазу гепатита B, обратную транскриптазу вируса мозаики цветной капусты, бактериальную обратную транскриптазу и Thermoscript. Используемые в настоящем изобретении ферменты включают такие, которые обладают сниженной, по существу сниженной или полностью удаленной активностью РНКазы H. Под ферментом с "по существу пониженной активностью РНКазы H" подразумевают фермент, который обладает менее приблизительно 20%, предпочтительно, менее приблизительно 15%, 10% или 5% и, наиболее предпочтительно, менее приблизительно 2% активности РНКазы H соответствующего фермента дикого типа или РНКазы H+, такого как обратные транскриптазы вируса мышиного лейкоза Молони (M-MLV) дикого типа, вируса миелобластоза птиц (AMV) или вируса саркомы Рауса (RSV). Активность РНКазы H любого фермента можно определять различными известными анализами. См. Kotewicz M, et al., Nucl. Acids Res., 1988, 16:265-277, Gerard G, et al., Focus 1992, 14(5):91-93 и Kotewicz M, et al., US 5244797. Особенно предпочтительные полипептиды для применения в изобретении включают, но не ограничиваются ими, обратную транскриптазу M-MLV, обратную транскриптазу RSV, обратную транскриптазу AMV, обратную транскриптазу RAV (Раус-связанного вируса), обратную транскриптазу MAV (связанного с миелобластозом вируса) и обратную транскриптазу ВИЧ. См. Kotewicz M, et al., US 5244797 и Gerard G, et al., WO1998047912. Однако специалисту в данной области следует понимать, что в композициях, способах и наборах по изобретению можно эквивалентно использовать любой фермент, способный продуцировать молекулу ДНК из молекулы рибонуклеиновой кислоты (т.е. обладающий активностью обратной транскриптазы).

Одноцепочечную кДНК можно обрабатывать таким образом, чтобы получать известным в данной области способом двухцепочечную ДНК. Предпочтительно, конверсию одноцепочечной кДНК в двухцепочечную ДНК проводят способами амплификации in vitro, такими как полимеразная цепная реакция (ПЦР), лигазная цепная реакция (LCR), амплификация на основе последовательности нуклеиновой кислоты (NASBA), амплификация с замещением цепей (SDA), опосредованная транскрипцией амплификация (TMA), технология разветвленной ДНК (bDNA), амплификация ДНК с помощью линкера (LADA), амплификация с использованием репликазы Q-бета (Q-бета), изотермическая амплификация с формированием петель (LAMP) и способ амплификации по типу катящегося кольца (RCAT) или другие способы ферментативной амплификации in vitro. Стадию амплификация проводят с использованием праймеров, соответствующих последовательностям адаптерных областей. Получаемую двухцепочечную ДНК можно очищать с использованием колонки для очистки, электромагнитных гранул, к которым присоединяют праймер, или посредством электрофореза на агарозном геле.

Получаемую двухцепочечную ДНК затем можно встраивать известными в данной области способами в выбранный вектор. В предпочтительном варианте осуществления используемые на стадии ПЦР-амплификации праймеры содержат в своих 5'-областях участки-мишени для рестрикционных эндонуклеаз, которые образуют совместимые концы с концами, содержащимися в выбранном векторе. Участки-мишени эндонуклеазы обеспечивают образование липких концов, которые можно использовать для клонирования полинуклеотидов в подходящие векторы.

Стадию секвенирования можно проводить любыми известными способами секвенирования, такими как химическое секвенирование (по Максаму-Гилберту), дидезокси-секвенирование по Сэнгеру, пиросеквенирование, секвенирование с детекцией флуоресценции и секвенирование ДНК с использованием масс-спектрометрии.

B. Иммуногенные полипептиды, полинуклеотиды, векторы и клетки-хозяева

Способ быстрого отбора иммуногенов (RIS) по настоящему изобретению обеспечивает идентификацию полипептидов, которые представляют собой варианты полипептида, находящегося на поверхности вируса, и которые являются кандидатами для индукции антител с нейтрализующей активностью и, таким образом, для их применения в качестве иммуногенных композиций или вакцин. Таким образом, в другом аспекте изобретение относится к полипептидам, идентифицируемым способом по изобретению.

Термин "полипептид", который используют взаимозаменяемо с белком в настоящем описании, относится к цепочке аминокислот любой длины, где различные аминокислоты связаны друг с другом посредством пептидных связей или дисульфидных мостиков.

В конкретном случае, где вирус, отобранный способом по изобретению, представляет собой ретровирус, полипептид представляет собой вариант белка оболочки. В предпочтительном варианте осуществления ретровирус представляет собой ВИЧ, и полипептид по настоящему изобретению представляет собой вариант gp120.

Идентифицированный способом RIS по изобретению полипептид, предпочтительно, содержит по меньшей мере мутацию в области, выбранной из группы, состоящей из константной области C1, вариабельной области V1, вариабельной области V2, константной области C2, константной области C5 и эктодомена gp41.

В более предпочтительном варианте осуществления мутация в константной области C1 представляет собой мутацию в положении 88. В более предпочтительном варианте осуществления мутированный остаток в положении 88 представляет собой Asp. В еще более предпочтительном варианте осуществления мутация в константной области C1 представляет собой мутацию N88D.

В более предпочтительном варианте осуществления мутация в вариабельной области V1 представляет собой мутацию в одном или более положений, выбранных из группы, состоящей из положений 131, 132 и 138. В более предпочтительном варианте осуществления мутированные остатки в положениях 131, 132 и 138 в области V1 представляют собой Y, N и/или G, соответственно. В еще более предпочтительном варианте осуществления мутация в области V1 представляет собой C131Y, T132N и/или D138G.

В более предпочтительном варианте осуществления мутация в вариабельной области V2 представляет собой мутацию в одном или более положений, выбранных из группы, состоящей из положений 160 и 187. В более предпочтительном варианте осуществления мутированные остатки в области V2 представляют собой Y в положении 160 и/или Asp в положении 187. В еще более предпочтительном варианте осуществления мутация в области V2 представляет собой N160Y и/или N191D.

В более предпочтительном варианте осуществления мутация в константной области C2 представляет собой мутацию в положении 219. В более предпочтительном варианте осуществления мутированный остаток в положении 219 в области C2 представляет собой Val. В еще более предпочтительном варианте осуществления мутация в области C2 представляет собой I219V.

В более предпочтительном варианте осуществления мутация в константной области C5 представляет собой мутацию в одном или более положений, выбранных из группы, состоящей из положений 479 и 507. В более предпочтительном варианте осуществления мутированные остатки в положениях 479 и 507 в области C5 представляют собой Ile и Trp, соответственно. В еще более предпочтительном варианте осуществления мутация в области C5 представляет собой M475I и/или R507W.

В более предпочтительном варианте осуществления вариант gp120 или его фрагмент по изобретению несет мутации C131Y, T132N, D138G и N160Y.

В более предпочтительном варианте осуществления вариант gp120 или его фрагмент по изобретению несет мутации N88D, C131Y, T132N, D138G, N160Y, N191D, A226V, M479I, R507W и Y647N.

В другом варианте осуществления вариант gp120 или его фрагмент по изобретению несет мутации N203S и G604E.

В более предпочтительном варианте осуществления мутация в эктодомене gp41 представляет собой T643N.

Нумерация указанных выше положений относится к последовательности белка-предшественника gp160, кодируемого геном env (SEQ ID NO:1) изолята AC10HXb2 ВИЧ, проиллюстрированного в SEQ ID NO:2, который кодируется геном env, проиллюстрированным в SEQ ID NO:1. См. Li, 2005, выше и номер доступа NCBI AY835446.

В предпочтительном варианте осуществления иммуногенный полипептид по изобретению содержит полипептид env изолята LR1-C1 (SEQ ID NO:4), кодируемый полинуклеотидом SEQ ID NO:3, или его фрагмент. Изолят LR1-C1 содержит мутации N88D, C131Y, T132N, D138G, T132N, N160Y, N191D, A226V, M479I, R507W и Y647N в отношении нумерации SEQ ID NO:2.

В предпочтительном варианте осуществления иммуногенный полипептид по изобретению содержит полипептид env клона 10, выделяемого с использованием антитела PG16 (SEQ ID NO:31), или его фрагмент. Для модифицированной последовательности показаны мутации N203S и G604E.

В предпочтительном варианте осуществления иммуногенный вариант gp120 по изобретению или его фрагмент содержит последовательность, выбранную из группы, состоящей из SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, и SEQ ID NO:31.

Хотя мутанты gp120, обладающие повышенной аффинностью по отношению к антителам с нейтрализующей активностью, определяемые в настоящем описании, выделяли из изолята AC10 ВИЧ (номер доступа NCBI AY835446 и ген env, показанный в SEQ ID NO:1), следует понимать, что иммуногенные полипептиды по настоящему изобретению можно получать из других изолятов ВИЧ, заменой соответствующих положений в гене env указанных других изолятов ВИЧ. Соответствующие положения в других изолятах ВИЧ можно определять без каких-либо трудностей с использованием любого подходящего для выравнивания последовательностей алгоритма.

Способы выравнивания последовательностей для сравнения хорошо известны в данной области. Оптимальное выравнивание последовательностей для сравнения можно проводить, например, алгоритмом локальной гомологии Смита-Уотермана, алгоритмом гомологичного выравнивания Нидлмана-Вунша, способом поиска сходства Пирсона-Липмана, компьютеризированными реализациями этих алгоритмов или выравниванием ручным способом и визуальной проверкой. См. Smith T., Waterman M., Adv. Appl. Math. 1981, 2:482-489, Needleman S., Wunsch C., J. Mol. Biol., 1970, 48:443-453, Pearson W., Lipman D., Proc. Natl. Acad. Sci. USA, 1988, 85:2444-2448, программы GAP, BESTFIT, FASTA и TFASTA, пакет программного обеспечения Wisconsin Genetics, Genetics Computer Group, Madison, WI, US, Ausubel F. et al., Eds, "Short Protocols in Molecular Biology", 4th Ed. (John Wiley and Sons, Inc., New York, NY, US).

"Фрагмент" представляет собой уникальный участок полинуклеотида, кодирующего полипептид оболочки ВИЧ-1 по настоящему изобретению более короткой длины, чем исходная последовательность. Аналогично, термин "фрагмент" относится к полипептиду оболочки ВИЧ-1 по настоящему изобретению, содержащему вплоть до полной длины определенной пептидной последовательности минус один аминокислотный остаток и кодирующую его нуклеотидную последовательность. Например, фрагмент может содержать от 5 до 2500 смежных нуклеотидов или аминокислотных остатков. Длина используемого в качестве фрагмент зонда, праймера, антигена, терапевтической молекулы или для других целей фрагмента может составлять по меньшей мере 5, 10, 15, 16, 20, 25, 30, 40, 50, 60, 75, 100, 150, 250, 500 или по меньшей мере 700 смежных нуклеотидов или аминокислотных остатков. Фрагменты, предпочтительно, можно выбирать из определенных участков молекулы. Например, полипептидный фрагмент может содержать определенные длины смежных аминокислот, выбранных из первых 250 или 500 аминокислот (или первых 25 процентов или 50 процентов) полипептида, как показано в определенной указанной последовательности. Понятно, что эти длины являются примерными, и любая длина, которая основана на описании, включая список последовательностей, таблицы и фигуры, может входить в настоящие варианты осуществления.

Настоящее изобретение относится к конструкциям нуклеиновой кислоты, содержащим полинуклеотидные последовательности, которые кодируют антигенные полипептиды gp120 ВИЧ-1. Эти полинуклеотиды включают последовательности ДНК, кДНК и РНК, которые кодируют полипептид, представляющий интерес.

Термин "полинуклеотид", как используют в настоящем изобретении, относится к полимеру, образованному различным числом мономеров, где мономеры представляют собой нуклеотиды, включая рибонуклеотиды и дезоксирибонуклеотиды. Полинуклеотиды включают мономеры, модифицированные метилированием, а также немодифицированные формы. Термины "полинуклеотид" и "нуклеиновая кислота" в настоящем изобретении используют взаимозаменяемо, и они включают мРНК, кДНК и рекомбинантные полинуклеотиды. Как используют в настоящем изобретении, полинуклеотиды не ограничены полинуклеотидами, к которым они принадлежат по природе, а включают полинуклеотиды, содержащие неприродные нуклеотидные аналоги и внутринуклеотидные связи.

Способы манипуляции и встраивания нуклеиновых кислот по настоящему изобретению в векторы хорошо известны в данной области. См. Sambrook, 1989, выше и Ausubel F. et al., Eds., "Short Protocols in Molecular Biology", 4th Ed. (John Wiley and Sons, Inc., New York, NY, US, 2002).

Как правило, конструкции нуклеиновой кислоты, кодирующие полипептиды gp120 по изобретению, представляют собой плазмиды. Однако для репликации нуклеиновых кислот можно использовать другие векторы (например, вирусные векторы, фаг, космиды). В контексте настоящего изобретения конструкции нуклеиновой кислоты, как правило, представляют собой векторы экспрессии, которые содержат промоторную последовательность, которая облегчает эффективную транскрипцию встроенной генетической последовательности. Вектор экспрессии, как правило, содержит участок начала репликации, промотор, а также конкретные последовательности нуклеиновой кислоты, которые обеспечивают возможность отбора по фенотипу трансформированных клеток.

В более общем смысле, полинуклеотидные последовательности, кодирующие полипептиды gp120 по настоящему изобретению, могут быть функционально связанными с любым промотором и/или энхансером, способным стимулировать экспрессию нуклеиновой кислоты после введения в клетку-хозяина. Промотор представляет собой ряд контролирующих последовательностей нуклеиновой кислоты, который направляет транскрипцию нуклеиновой кислоты. Промотор содержит обязательные последовательности нуклеиновой кислоты (которые могут находиться) вблизи участка начала транскрипции, такие как в случае промотора полимеразы II типа (элемента TATA). Промотор также может содержать дистальный энхансер или репрессорные элементы, которые могут располагаться на расстоянии в несколько тысяч пар оснований от участка начала транскрипции. Включены как конститутивные, так и индуцибельные промоторы. См. Bitter G. et al., Meth. Enzymol. 1987, 153:516-544.

Для получения таких конструкций нуклеиновой кислоты полинуклеотидные последовательности, кодирующие полипептиды gp120, встраивают в подходящий вектор экспрессии, такой как плазмидный вектор экспрессии. Способы получения полинуклеотидных последовательностей, кодирующих полипептиды gp120, и манипулирования с ними in vitro хорошо известны специалистам в данной области. См. Sambrook, 1989 и Ausubel, 2002, выше.

Полинуклеотидные последовательности, кодирующие иммуногенный полипептид gp120, можно встраивать в вектор экспрессии, включая, но, не ограничиваясь ими, плазмиду, вирус или другой носитель, который можно обрабатывать таким образом, чтобы обеспечивать встраивание или включение последовательностей, и можно экспрессировать в прокариотах или эукариотах. Хозяева могут включать микробные, дрожжевые организмы, организмы насекомых и млекопитающих. Способы экспрессии последовательностей ДНК, содержащих эукариотические или вирусные последовательности, в прокариота хорошо известны в данной области. В данной области известны биологически функциональные вирусные и плазмидные ДНК векторы, способные к экспрессии и репликации в хозяине.

Трансформацию клетки-хозяина рекомбинантной ДНК можно проводить общепринятыми способами, которые хорошо известны специалистам в данной области. В случае, если хозяин является прокариотическим, таким как E. coli, компетентные клетки, которые способны к поглощению ДНК, могут быть получены из клеток, получаемых после фазы экспоненциального роста и затем обработанных способом CaCl2 с использованием хорошо известных в данной области способов. Альтернативно, можно использовать MgCl2 или RbCl. Трансформацию также можно проводить после получения протопласта клетки-хозяина при желании или посредством электропорации.

Когда хозяин представляет собой эукариота, можно использовать такие способы трансфекции ДНК, как копреципитаты фосфатом кальция, общепринятые механические способы, такие как микроинъекция, электропорация, введение плазмиды, инкапсулированной в липосомы или вирусные векторы. Эукариотические клетки также можно совместно трансформировать полинуклеотидными последовательностями, кодирующими иммуногенный полипептид gp120, и второй чужеродной молекулой ДНК, кодирующей селектируемый фенотип, такой как ген тимидинкиназы простого герпеса. Другой способ заключается в использовании эукариотического вирусного вектора, такого как вирус 40 обезьяны (SV40) или вирус папилломы крупного рогатого скота, для временной инфекции или трансформации эукариотических клеток и экспрессии белка. См. Gluzman Y, Ed., "Eukaryotic Viral Vectors" (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, US, 1982).

C. Антитела

Варианты gp120 и их фрагменты по настоящему изобретению также можно использовать для индукции антител, способных распознавать и нейтрализовать ВИЧ, когда вирус или его частицы содержатся в биологической жидкости индивидуума. Таким образом, в другом аспекте изобретение относится к антителу, которое специфически связывается с иммуногенным полипептидом по изобретению.

Как используют в настоящем изобретении, термин "антитело" относится к мономерному или мультимерному белку, который содержит по меньшей мере один полипептид, обладающий активностью связывания определенного антигена и содержащий все или часть вариабельной области легкой или тяжелой цепи молекулы иммуноглобулина. Антитела по изобретению включают, но не ограничиваются ими, моноклональные антитела, моноспецифические антитела, поликлональные антитела, полиспецифические антитела, диатела, триатела, тетратела, антитела человека, гуманизированные антитела, камелизированные антитела, химерные антитела, одноцепочечные антитела, антитела с одним доменом, фрагменты Fab, фрагменты F(ab'), фрагменты F(ab')2, фрагменты Fv (т.е. наименьшие функциональные модули антитела), одноцепочечные Fv (scFv), стабилизированные дисульфидом Fv (dsFv), Fd, VH, VL, Vα, Vβ и антиидиотипические (антитела против Id) антитела (например, антитела против Id к антителам по изобретению), интратела и эпитопсвязывающие фрагменты любого из указанных выше. В некоторых вариантах осуществления антитела представляют собой моноклональные антитела. В других вариантах осуществления антитела представляют собой фрагменты Fv, содержащие VH и VL области.

Эти антитела могут быть получены общепринятыми способами с использованием пептидов по настоящему изобретению. См. Kieber-Emmons T, et al., WO1991004273. Например, поликлональные антитела могут быть получены, общепринято стимулируя иммунную систему выбранного животного одним или обоими из указанных выше пептидов или поливалентными конструкциями, обеспечивая то, что иммунная система продуцирует свойственные ей антитела, и собирая эти антитела из крови или другой биологической жидкости животного. Поликлональные антитела с высоким титром могут быть получены с использованием поливалентных конструкций, описанных выше в качестве антигенов. Получаемые антитела способны связываться с выбранным антигеном HTV, как только он появляется в биологических жидкостях инфицированного индивидуума.

Дополнительно, пептиды по настоящему изобретению также можно использовать для получения антител, которые можно использовать в качестве матриц для получения антиидиотипических антител, содержащих "внутренний образ" нейтрализующей эпитопной структуры, содержащейся в пептидной последовательности. Эти антитела, поликлональные или моноклональные, затем можно использовать в составах вакцин или при активной иммунотерапии. Таким образом, настоящее изобретение также относится к моноклональным или поликлональным антителам, которые несут пептиды "внутреннего образа", а также к способам получения таких антител. См. Kieber-Emmons, выше.

В случае если желательно получать и использовать моноклональные антитела (MAb) для композиций и способов по настоящему изобретению, могут быть получены гибридомные клеточные линии, экспрессирующие желаемые MAb, хорошо известными общепринятыми способами с использованием доступных линий опухолевых клеток. См. Kohler G, Milstein C., Nature, 1975, 256(5517):495-497.

Рекомбинантные антитела могут быть получены известными способами их получения. См. Huse W, et al., Science, 1989, 246:1275-1281. Желаемые антитела с высоким титром также могут быть получены, применяя известные рекомбинантные способы в отношении моноклональных или поликлональных антител, индуцируемых этими антигенами. См. Amit R. et al., Science, 1986, 233:747-753, Queen C, et al., Proc. Natl. Acad. Sci. USA, 1988, 86:10029-10033, Riechmann L. et al., Nature, 1988, 332:323-327 и Barbas C., et al., Proc. Natl. Acad. Sci. USA, 1992, 89:4457-4461 и Winter P., GB 2188638.

D. Иммуногенные композиции, способные индуцировать антитела с нейтрализующей активностью

Вариантные полипептиды gp120 и молекулы нуклеиновой кислоты, кодирующие полипептиды вариантов gp120, описываемые в настоящем описании, можно использовать в качестве иммуногенов или для получения иммуногенов для индукции иммунного ответа (иммуногенные композиции) против gp120 или экспрессирующего gp120 вируса для профилактики, уменьшения или борьбы, например, с инфекцией ВИЧ-1 или связанными с ней симптомами. После введения терапевтически эффективного количества описываемых терапевтических композиций можно наблюдать за индивидуумом в отношении инфекции ВИЧ-1, симптомов, связанных с инфекцией ВИЧ-1 или того и другого. Таким образом, в другом аспекте изобретение относится к иммуногенной композиции, содержащей вариантный полипептид gp120 ВИЧ-1 или его иммуногенный фрагмент по изобретению, кодирующий указанный полипептид полинуклеотид или вектор экспрессии, содержащий указанный полинуклеотид.

Подходящие иммуногенные фрагменты gp120, подходящие для использования в иммуногенных композициях, включают пептиды относительно малого размера, такого как приблизительно размером от 5 до 100 аминокислот, например, приблизительно 5, приблизительно 6, приблизительно 7, приблизительно 8, приблизительно 9, приблизительно 10, приблизительно 15, приблизительно 20, приблизительно 25, приблизительно 30, приблизительно 40, приблизительно 50, приблизительно 60, приблизительно 70, приблизительно 80, приблизительно 90 или приблизительно 100. Таким образом, в качестве иммуногенов можно использовать фрагменты (например, эпитопы или другие антигенные фрагменты) полипептида gp120, такого как любой из описываемых в настоящем описании полипептидов gp120 или его фрагмент.

Термин "иммуногенная композиция" относится к композиции, которая индуцирует иммунный ответ, который продуцирует антитела или клеточно-опосредованные иммунные ответы против конкретного иммуногена. Инъецируемые композиции могут быть получены, например, в виде жидких растворов, суспензий и эмульсий. Термин "антигенная композиция" относится к композиции, которую может распознавать иммунная система хозяина. Например, антигенная композиция содержит эпитопы, которые могут быть распознаны гуморальными (например, антителом) и/или клеточными (например, T-лимфоцитами) компонентами иммунной системы хозяина.

Термин "вакцина" относится к иммуногенной композиции для введения in vivo хозяину, который может представлять собой примата, в частности, являющегося человеком хозяина, для обеспечения защиты от заболевания, в частности, вирусного заболевания.

Иммуногенные композиции по изобретению являются подходящими для лечения или профилактики заболеваний, вызываемых инфекцией ВИЧ. В дополнительном аспекте изобретение относится к пептиду, нуклеиновой кислоте, вектору, иммуногенной композиции или вакцине по изобретению для применения при лечении или профилактики заболевания, обусловленного инфекцией ВИЧ-1. Альтернативно, изобретение относится к применению пептида, нуклеиновой кислоты, вектора, иммуногенной композиции или вакцины по изобретению для получения лекарственного средства для лечения или профилактики заболевания, обусловленного инфекций ВИЧ-1. Альтернативно, изобретение относится к способу для лечения или профилактики заболевания у индивидуума, обусловленного инфекцией ВИЧ-1, который включает введение указанному индивидууму пептида, нуклеиновой кислоты, вектора или иммуногенной композиции, или вакцины по изобретению.

Термин "лечение", как используют где-либо в настоящем описании, включает любой тип терапии, которая направлена на прекращение, профилактику, улучшение состояния и/или снижения подверженности клиническому состоянию, как описано в настоящем описании. В предпочтительном варианте осуществления термин лечение относится к профилактическому лечению (т.е. терапии для уменьшения подверженности клиническому состоянию, нарушению или состоянию, как определено в настоящем описании).

Таким образом, как используется в настоящем изобретении "лечение", "лечащий" и т.п. относятся к получению желаемого фармакологического и/или физиологического эффекта, включающего любое лечение патологического состояния или нарушения у млекопитающего, включая человека. Эффект может быть профилактическим в отношении полного или частичного предотвращения нарушения или его симптома и/или может быть терапевтическим в отношении частичного или полного излечения нарушения и/или неблагоприятного воздействия, обусловленного нарушением. Другими словами, "лечение" включает (1) профилактику возникновения или повторного возникновения нарушения у индивидуума, (2) ингибирование нарушения, такое как задержка его развития, (3) купирование или прекращение нарушения или по меньшей мере симптомов, связанных с ним, таким образом, что хозяин больше не страдает от нарушения или его симптомом, таким образом, вызывая регрессию нарушения или его симптомов, например, восстанавливая или корригируя потерю, отсутствие или дефектную функцию, или стимулируя неэффективный процесс, или (4) облегчение, уменьшение или улучшение состояния нарушения или связанных с ним симптомов, где улучшение состояния используют в широком смысле для обозначения по меньшей мере восстановления величины параметра, такого как воспаление, боль и/или иммунодефицитного состояния.

Термины "предотвращать", "предотвращающий" и "профилактики", как используется в настоящем изобретении, относятся к снижению частоты возникновения патологических клеток у животного. Предотвращение может быть полным (например, полное отсутствие патологических клеток у индивидуума). Профилактика также может быть частичной так, что, например, частота возникновения патологических клеток у индивидуума составляет менее чем та, которая возникнет без настоящего изобретения. Предотвращение также относится к уменьшению подверженности клиническому состоянию.

Иммуногенные композиции по изобретению могут дополнительно содержат фармацевтически приемлемый носитель.

"Фармацевтически приемлемый носитель", "фармацевтически приемлемый разбавитель" или "фармацевтически приемлемый эксципиент", или "фармацевтически приемлемый носитель", используемые в настоящем описании взаимозаменяемо, относятся к нетоксическому твердому, полутвердому или жидкому наполнителю, разбавителю, инкапсулирующему веществу или составу вспомогательного средства любого общепринятого типа. Фармацевтически приемлемый носитель является по существу нетоксичным для реципиентов в применяемых дозах и концентрациях и является совместимым с другими ингредиентами состава. Например, носитель для содержащего полипептиды состава обычно не содержит окислители и другие соединения, для которых известно, что они являются вредными для полипептидов. Подходящие носители включают, но не ограничиваются ими, воду, декстрозу, глицерин, физиологический раствор, этанол и их сочетания. Носитель может содержать дополнительные средства, такие как увлажняющее средство или эмульгаторы, средства для буферирования pH или адъюванты, которые усиливают эффективность состава. Адъюванты можно, например, выбирать из группы, состоящей из: AlK(SO4)2, AlNa(SO4)2, AlNH4(SO4), диоксида кремния, алюминия, Al(OH)3, Ca3(PO4)2, каолина, углерода, гидроксида алюминия, мурамилдипептидов, N-ацетил-мурамил-L-треонил-D-изоглутамин (thr-DMP), N-ацетил-норнурамил-L-аланил-D-изоглутамин (CGP 11687, также обозначаемый как нор-MDP), N-ацетилмурамил-L-аланил-D-изоглутаминил-L-аланин-2-(1'2'-дипальмитоил-sn-глицеро-3-гидроксфосфорилокси)этиламин (CGP 19835A, также обозначаемый как MTP-PE), RIBI (MPL+TDM+CWS) в 2 процентной эмульсии сквален/Tween-80®, липополисахаридов и их различных производных, включая липид A, полного адъюванта Фрейнда (FCA), неполных адъювантов Фрейнда, Merck Adjuvant 65, полинуклеотидов (например, поли-IC и поли-AU-кислот), воска D из Mycobacterium, tuberculosis, веществ, обнаруженных в Corynebacterium parvum, Bordetella pertussis и представителях рода Brucella, Titermax, ISCOMS, Quil A, ALUN, производных липида A, производныех холерного токсина, производных HSP, производных LPS, синтетических пептидных матриц или GMDP, интерлейкина 1, интерлейкина 2, Montanide ISA-51 и QS-21, олигонуклеотида CpG, поли I:C и GM-CSF. См. Hunter R., US 5554372 и Jager E., Knuth A., WO 1997028816.

Вариантный полипептид gp120 по изобретению можно ковалентно связывать с носителем, который представляет собой иммуногенную макромолекулу, с которой может связываться антигенная молекула. При связывании с носителем связанный полипептид становится более иммуногенным. Носители выбирают так, чтобы повышать иммуногенность связанной молекулы и/или индуцировать более высокие титры антител против носителя, которые являются эффективными с диагностической, аналитической и/или терапевтической точки зрения. Ковалентное связывание молекулы с носителем может обеспечивать повышенную иммуногенность и T-клеточную зависимость. См. Pozsgay V. et al., PNAS, 1999, 96:5194-5197, Lee S. et al., J. Immunol., 1976, 116:1711-1718 и Dintzis R. et al., PNAS, 1976, 73:3671-3675. Подходящие носители включают полимерные носители, которые могут представлять собой природные (например, полисахариды, полипептиды или белки из бактерий или вирусов), полусинтетические или синтетические вещества, содержащие одну или более функциональных групп, к которым можно присоединять реакционноспособную составную группу. Также в качестве носителей можно использовать бактериальные продукты и вирусные белки (например, поверхностный антиген и коровый антиген гепатита B), а также белки от высших организмов, такие как гемоцианин морского блюдца, гемоцианин мечехвоста, эдестин, сывороточные альбумины млекопитающих и иммуноглобулины млекопитающих. Дополнительные бактериальные продукты для применения в качестве носителей включают белки и другие продукты бактериальной стенки (например, клеточные стенки и липополисахарид (LPS) стрептококков или стафилококков).

Настоящее изобретение дополнительно относится к профилактики или уменьшению симптомов, связанных с инфекцией ВИЧ. Такие симптомы включают симптомы, связанные с малой симптоматической фазой инфекции ВИЧ, включая, например, опоясывающий лишай, кожную сыпь и инфекцию ногтей, стоматиты, рецидивирующую инфекцию носа и горла, и потерю массы. Кроме того, дополнительные симптомы, связанные с основной симптоматической фазой инфекции ВИЧ, включают, например, пероральную и вагинальную молочницу (Candida), персистирующую диарею, потерю массы, персистирующий кашель, реактивированный туберкулез и рецидивирующие инфекции герпеса, такие как герпетические лихорадки (простой герпес). Симптомы развернутой клинической картины СПИД, которые можно лечить в соответствии с настоящим изобретением, включают, например, диарею, тошноту и рвоту, молочницу и стоматиты, персистирующие рецидивирующие вагинальные инфекции и рак шейки матки, персистирующую генерализованную лимфаденопатию (PGL), тяжелые кожные инфекции, бородавки и трихофитоз, респираторные инфекции, пневмонию, в частности,, Pneumocystis carinii pneumonia (PCP), опоясывающий герпес (или опоясывающий лишай), проблемы нервной системы, такие как боли, онемение или "покалывание" в руках и ступнях, неврологические расстройства, саркому Капоши, лимфому, туберкулез и другие оппортунистические инфекции.

Положительное воздействие пептидов, нуклеиновых кислот и векторов по изобретению включает, например, предотвращение или замедление первоначальной инфекции индивидуума, подвергающегося воздействию ВИЧ, снижение вирусной нагрузки у индивидуума, инфицированного ВИЧ, продление бессимптомной фазы инфекции ВИЧ, поддержание низких вирусных нагрузок у инфицированных ВИЧ пациентов, у которых уровни вируса понизились вследствие антиретровирусной терапии (ART), увеличение уровней CD4 T-клеток или снижение уменьшения CD4 T-клеток, специфичных и неспецифичных к ВИЧ-1 у не получавших медикаментозного лечения пациентов и у пациентов, получавших лечение ART, увеличение общего здоровья или качества жизни индивидуума со СПИД и увеличение продолжительности жизни индивидуума со СПИД. Клиницист может сравнивать эффект иммунизации с состоянием пациента до лечения или с предполагаемым состоянием пациента, не получавшего лечение, для определения, является ли лечение эффективным в отношении ингибирования СПИД.

Иммуногенную композицию можно вводить любыми средствами, известными специалисту в данной области, такими как посредством внутримышечной, подкожной или внутривенной инъекции и перорального, назального или анального введения. См. Banga A., "Parenteral Controlled Delivery of Therapeutic Peptides and Proteins" в Therapeutic Peptides and Proteins (Technomic Publishing Co., Inc., Lancaster, PA, US, 1995). Для увеличения времени, в течение которого пептид или белок является доступным для стимуляции ответа, пептид или белок можно предоставлять в виде имплантата, инъекции на масляной основе или в виде системы твердых частиц. Система твердых частиц может представлять собой микрочастицу, микрокапсулу, микросферу, нанокапсулу или аналогичную частицу. См. Banga, 1995, выше. Показано, что носитель на основе частиц на основе синтетического полимера действует как адъювант, усиливая иммунный ответ в дополнение к обеспечению контролируемого высвобождения. Для индукции иммунного ответа в качестве адъювантов также можно использовать соли алюминия.

Иммуногенные композиции можно получать в стандартной лекарственной форме, подходящей для индивидуального введения точных доз. При пульсовых дозах обеспечивают болюсное введение иммуногенной композиции, которая содержит описываемый иммуноген, с последующим периодом времени, где индивидууму не вводят описываемый иммуноген, с последующим вторым болюсным введением. Терапевтически эффективное количество иммуногенной композиция можно вводить в однократной дозе или в многократных дозах, например, ежесуточно в течение курса лечения. В конкретных неограничивающих примерах пульсовые дозы иммуногенной композиции, которая содержит описываемый иммуноген, вводят в течение суток, в течение недели или в течение месяца.

Иммуногенные композиции можно вводить в тех случаях, когда эффект (такой как уменьшение признаков, симптома или результатов лабораторных исследований инфекции ВИЧ-1) является желательным. Как правило, доза является достаточной для лечения или уменьшения симптомов или признаков заболевания, не вызывая неприемлемой токсичности у индивидуума. Можно применять системное или локальное введение.

Эффективные для терапевтического применения количества могут зависеть от тяжести заболевания и возраста, массы, общего состояния пациента и других клинических факторов. Таким образом, конечное определение подходящей схемы лечения проводит лечащий клиницист. Как правило, дозирования, используемые in vitro могут представлять собой пригодное руководство в отношении количеств, пригодных для введения in situ фармацевтической композиции, и для определения эффективных дозировок для лечения конкретных нарушений можно использовать модели на животных. См. Gilman R. et al., Eds., Goodman and Gilman's: The Pharmacological Basis of Therapeutics, 8th Ed. (Pergamon Press, New York, NY, US, 1990) and Gennaro A., Ed., Remington's Pharmaceutical Sciences, 18th Ed. (Mack Publishing Co., Easton, PA, US, 1990). Как правило, диапазон доз для полипептида gp120 составляет приблизительно от 0,1 мкг/кг массы тела приблизительно до 100 мг/кг массы тела. Другие подходящие диапазоны включают дозы приблизительно от 1 мкг/кг до 10 мг/кг массы тела. В одном из примеров доза составляет приблизительно от 1,0 мкг приблизительно до 50 мг, например, от 1 мкг до 1 мг, такая как 1 мг пептида на индивидуума. Схема дозирования может изменяться от ежедневного до такого редкого, как один раз в год в зависимости от клинических факторов, таких как чувствительность индивидуума к пептиду и темпа его заболевания. Таким образом, индивидуум может получать первую дозу описываемой терапевтической молекулы, а затем получать вторую дозу (или даже больше доз) через некоторый момент(ы) времени, такой как по меньшей мере через одни сутки, такой как по меньшей мере через одну неделю.

Описываемые в настоящем описании фармацевтические композиции можно получать и вводить в единицах дозирования. Твердые единицы дозирования включают таблетки, капсулы, трансдермальные системы доставки и суппозитории. Введение терапевтического количества можно проводить однократным введением в форме отдельной единицы дозирования или в виде нескольких меньших единиц дозирования, а также многочисленными введениями дробных доз в конкретные интервалы времени. Подходящие однократные или дробные дозы включают, но не ограничиваются ими, приблизительно 0,01, 0,1, 0,5, 1, 3, 5, 10, 15, 30 или 50 мкг белка/кг/сутки.

Конструкции нуклеиновой кислоты, кодирующие описываемые в настоящем описании антигенные полипептиды gp120, используют, например, в комбинации в виде фармацевтических композиций (лекарственных средств) для применения в терапевтических, например, профилактических схемах лечения (таких как вакцины) и вводят индивидуумам (например, являющимся приматами индивидуумам, таким как являющиеся человеком индивидуумы) для индукции иммунного ответа против одного или более типов или штаммов ВИЧ. Например, описываемые в настоящем описании композиции можно вводить являющемуся человеком (или не являющемуся человеком) индивидууму до инфицирования ВИЧ для ингибирования инфекции или репликации вируса. Таким образом, описанные выше фармацевтические композиции можно вводить индивидууму для индукции протективного иммунного ответа против ВИЧ. Для индукции иммунного ответа терапевтически эффективное (например, иммунологически эффективное) количество конструкций нуклеиновой кислоты вводят индивидууму, такому как человек (или не являющегося человеком) индивидуум.

Иммунизация конструкциями нуклеиновой кислоты хорошо известна в данной области и описана, например, см. Robinson H. et al., US 5643578 (в котором описаны способы иммунизации позвоночных введением ДНК, кодирующей желаемый антиген, для индукции клеточно-опосредованного или гуморального ответа), Weiner D. et al., US 5593972 и Weiner D. et al., US 5817637 (в которых описана функционально связанная кодирующая антиген последовательность нуклеиновой кислоты с регуляторными последовательностями, обеспечивающими экспрессию) и Urban R. et al., US 5880103 (в котором описано несколько способов доставки нуклеиновых кислот, кодирующих иммуногенные пептиды или другие антигены, в организм). Способы включают липосомную доставку нуклеиновых кислот (или самих синтетических пептидов), и иммуностимулирующие конструкции или ISCOMS® отрицательно заряженные клеткообразные структуры размером 30-40 нм, образуемые спонтанно при смешивании холестерина и QUILA® (сапонина).

Для введения молекул нуклеиновой кислоты gp120 нуклеиновую кислоту можно доставлять внутриклеточно, например, посредством экспрессии соответствующим вектором экспрессии нуклеиновой кислоты, который вводят таким образом, чтобы он становился внутриклеточным, таким образом, как с использованием ретровирусного вектора, прямой инъекцией, с использованием бомбардировки микрочастицами (например, генная пушка, Biolistic, Dupont Corp, Delware, DE, US), покрытия липидами, рецепторами клеточной поверхности или средствами трансфекции, или ее введением в связанном состоянии с подобным гомеобоксу пептидом, для которого известно, что он проникает в ядро. См. Morgan J. et al., US 4980286 и Joliot A. et al., Proc. Natl. Acad. Sci. USA, 1991, 88:1864-1868. Настоящее изобретение относится ко всем формам доставки нуклеиновой кислоты, включая синтетические олигомеры, голую ДНК, плазмиду и вирус, встроенные или невстроенные в геном.

В другом подходе применения нуклеиновых кислот для иммунизации иммуногенный полипептид gp120 также может экспрессироваться ослабленными вирусными хозяевами или векторами, или бактериальными векторами. Для экспрессии пептида или белка можно использовать рекомбинантный вирус осповакцины, аденосвязанный вирус (AAV), вирус герпеса, ретровирус или другие вирусные векторы, таким образом, индуцируя ответ CTL. Например, векторы на основе вируса осповакцины и способы, подходящие в протоколах иммунизации TB, представляют другие потенциальные носители для пептидов по изобретению. См. Paoletti E. et al., US 4722848 и Stover C. et al., Nature, 1991; 351:456-460.

В одном из примеров используют вирусный вектор. Эти векторы включают, но не ограничиваются ими, аденовирус, вирус герпеса, вирус осповакцины или РНК-вирус, такой как ретровирус. В одном из примеров ретровирусный вектор представляет собой производное ретровируса мышей или птиц. Примеры ретровирусных векторов, в которые можно встраивать один чужеродный ген, включают, но не ограничиваются ими: вирус лейкоза мышей Молони (MoMuLV), вирус саркомы мышей Харви (HaMuSV), вирус опухоли молочной железы мышей (MuMTV) и вирус саркомы Рауса (RSV). Когда индивидуум является человеком, можно использовать вектор, такой как вирус лейкоза гиббонов (GaLV). Ряд дополнительных ретровирусных векторов может встраивать многие гены. Все эти векторы могут переносить или встраивать ген селектируемого маркера, таким образом, что трансдуцированные клетки можно идентифицировать и получать. Путем встраивания последовательности нуклеиновой кислоты, кодирующей полипептид gp120, в вирусный вектор совместно с другим геном, который кодирует, например, лиганд рецептора по поверхности клетки-мишени, вектор с этого момента становится специфически направленным. Ретровирусные векторы можно конструировать специфически направленными, связывая, например, с сахаром, гликолипидом или белком. Предпочтительную направленность проводят с использованием антитела для направления ретровирусного вектора. Специалистам в данной области известны, или они могут без труда установить без излишнего экспериментирования конкретные полинуклеотидные последовательности, которые можно встраивать в ретровирусный геном или связывать с вирусной оболочкой для обеспечения специфической направленной доставки ретровирусного вектора, содержащего полинуклеотид, кодирующий полипептид gp120.

Подходящие составы конструкций нуклеиновой кислоты содержат водные и неводные растворы, изотонические стерильные растворы, которые могут содержать антиоксиданты, буферы и бактериостатические средства, и водные и неводные стерильные суспензии, которые могут содержать суспендирующие средства, солюбилизаторы, сгущающие средства, стабилизаторы и консерванты. Составы могут находиться в однодозовых или многодозовых запечатанных контейнерах, таких как ампулы и флаконы, и их можно хранить в высушенном сублимацией (лиофилизированном) состоянии, где необходимо только добавить стерильный жидкий носитель, например, воду, непосредственно перед применением. Получаемые для немедленного применения растворы и суспензии могут быть получены из стерильных порошков, гранул и таблеток. Предпочтительно, носитель представляет собой забуференный физиологический раствор. Более предпочтительно, композицию для применения в способе по изобретению формулируют для защиты конструкций нуклеиновой кислоты от повреждений до введения. Например, композицию можно формулировать, чтобы снижать потерю аденовирусных векторов на устройствах, используемых для получения, хранения или введения вектора экспрессии, таких как стеклянная тара, шприцы или иглы. Композиции можно формулировать, чтобы уменьшать чувствительность к свету и/или чувствительность к температуре компонентов. Для этой цели композиция, предпочтительно, содержит фармацевтически приемлемый жидкий носитель, такой как, например, описанные выше носители, и стабилизатор, выбранный из группы, состоящей из полисорбата 80, L-аргинина, поливинилпирролидона, трегалозы и их сочетаний.

При терапевтических применениях индивидууму вводят терапевтически эффективное количество композиции перед или после воздействия или инфекции ВИЧ. При введении перед воздействием терапевтическое применение можно обозначать как профилактическое введение (такое как в форме вакцины). Однократные или многократные введения композиций проводят в зависимости от дозы и частоты, которая необходима и переносится индивидуумом. В одном из вариантов осуществления дозу вводят однократно в виде болюса, а в другом варианте осуществления можно вводить периодически до достижения терапевтического результата, такого как защитный иммунный ответ. Как правило, доза является достаточной для лечения или уменьшения симптомов или признаков заболевания, не вызывая неприемлемую токсичность у индивидуума. Можно применять системное или местное введение.

В отношении вакцин нуклеиновых кислот совместно с конструкциями нуклеиновой кислоты, кодирующими полипептиды gp120, можно вводить природные или синтетические иммуностимулирующие композиций, которые связываются и стимулируют рецепторы, участвующие во врожденном иммунитете. Например, средства, которые стимулируют определенные Toll-подобные рецепторы (такие как TLR7, TLR8 и TLR9), можно вводить в комбинации с конструкциями нуклеиновой кислоты, кодирующей полипептиды gp120. В некоторых вариантах осуществления конструкцию нуклеиновой кислоты вводят в комбинации с иммуностимулирующими олигонуклеотидами CpG.

Конструкции нуклеиновой кислоты, кодирующие полипептиды gp120, можно вводить in vivo в виде плазмид на основе “голой” ДНК. Векторы ДНК можно вводить в желаемые клетки-хозяева известными в данной области способами, включая, но, не ограничиваясь ими, трансфекцию, электропорацию (например, чрескожную электропорацию), микроинъекцию, трансдукцию, слияние клеток, DEAE декстран, осаждение фосфатом кальция, использование генной пушки или использование переносчика вектора ДНК. См. Wu C. et al., J. Biol. Chem., 1992, 267:963-967, Wu C. and Wu G., Biol. Chem., 1988, 263:14621-14624 и Williams R. et al., Proc. Natl. Acad. Sci. USA, 1991, 88:2726-2730. Способы формулирования и введения “голой” ДНК в мышечную ткань млекопитающих также известны. См. Felgner P. et al., US 5580859 и US 5589466. Другие молекулы также могут быть подходящими для облегчения трансфекции нуклеиновой кислоты in vivo, такие как катионные олигопептиды, пептиды, получаемые из связывающих ДНК белков, или катионные полимеры. См. Bazile D. et al., WO 1995021931 и Byk G. et al., WO1996025508.

Другой хорошо известный способ, который можно использовать для встраивания конструкций нуклеиновой кислоты, кодирующей иммуногены gp120, в клетки-хозяева представляет собой бомбардировку частицами (также известную как биолистическая трансформация). Биолистическую трансформацию, как правило, проводят по одному из нескольких путей. Один из общепринятых способов включает проталкивание инертных или биологически активных частиц в клетки. См. Sanford J, et al., US 4945050, US 5036006 и US 5100792.

Альтернативно, вектор можно встраивать in vivo с помощью липофекции. Применение катионных липидов может способствовать инкапсулированию отрицательно заряженных нуклеиновых кислот, а также может способствовать слиянию с отрицательно заряженными клеточными мембранами. См. Felgner P., Ringold G., Science, 1989, 337:387-388. Описаны особенно подходящие липидные соединения и композиции для переноса нуклеиновых кислот. См. Felgner P, et al., US 5459127, Behr J. et al., WO1995018863 и Byk G., WO 1996017823.

Как и в случае с иммуногенным полипептидом для индукции иммунного ответа против ВИЧ композиции нуклеиновой кислоты можно вводить в виде однократной дозы или можно вводить в виде многократных доз, разделенных временными интервалами. Например, для оптимизации иммунного ответа индивидууму можно вводить в течение нескольких недель, нескольких месяцев или даже нескольких лет две дозы или три дозы, или четыре дозы, или пять доз, или шесть доз или более.

Предпочтительным может быть введение описываемых в настоящем описании иммуногенных композиций совместно с другими средствами, такими как белки, пептиды, антитела и другие средства против ВИЧ. Примеры таких терапевтических средств против ВИЧ включают нуклеозидные ингибиторы обратной транскриптазы, такие как абакавир, AZT, диданозин, эмтрицитабин, ламивудин, ставудин, тенофовир, зальцитабин, зидовудин и т.п., ненуклеозидные ингибиторы обратной транскриптазы, такие как делавирдин, эфавиренз, невирапин, ингибиторы протеаз, такие как ампренавир, атазанавир, индинавир, лопинавир, нелфинавир осампренавир, ритонавир, саквинавир, типранавир и т.п., и ингибиторы слияния белков, такие как энфувиртид и т.п. В определенных вариантах осуществления иммуногенные композиции вводят одновременно с другими терапевтическими средствами против ВИЧ. В определенных вариантах осуществления иммуногенные композиции вводят последовательно с другими терапевтическими средствами против ВИЧ, таким образом, как до или после другого средства. Специалисту в данной области известно, что последовательное введение может означать введение непосредственно сразу или через подходящий период времени, такой как часы, сутки, недели, месяцы или годы.

E. Способы детекции антител против ВИЧ в биологическом образце и способы детекции ответа антитела с нейтрализующей активностью

Описываемые в настоящем изобретении иммуногены являются подходящими для идентификации в образце пациента антител, специфических к указанным иммуногенам. Вследствие того, что иммуногены по настоящему изобретению специфически связываются с антителами с нейтрализующей активностью, иммуногены можно использовать для выявления пациентов, у которых индуцированы антитела с нейтрализующей активностью. Таким образом, антитела могут быть подходящими при определении персонализированной терапии в зависимости от того, выявляют ли у пациента антитела с нейтрализующей активностью или не выявляют. Таким образом, в другом аспекте изобретение относится к способу детекции в образце специфических к вирусу антител с нейтрализующей активностью, включающему:

i) приведение в контакт указанного образца с полипептидом по изобретению и

ii) детекцию образования иммунного комплекса между указанным полипептидом.

Термины и выражения "антитела с нейтрализующей активностью", "вирус", "полипептид" более подробно описаны выше.

В предпочтительном варианте осуществления вирус представляет собой ВИЧ, и полипептид представляет собой вариантный полипептид gp120 или его иммуногенной фрагмент, как определено выше. В более предпочтительном варианте осуществления образец получают у пациента, инфицированного ВИЧ-1, или у реципиента вакцины против СПИД.

Можно использовать любой из широкого спектра форматов анализа в соответствии со способами по настоящему изобретению. Такие форматы могут быть гетерогенными или гомогенными, последовательными или одновременными, конкурентными или неконкурентными. См. Peterson M, et al., US 5563036, Cheng A, et al., US 5627080, Lee J, et al., US 5633141, Peterson M, et al., US 5679525, Draetta G, et al., US 5691147, Lucas F, et al., US 5698411, Yan C, et al., US 5747352, Davidson R., US 5811526, Oh C, et al., US 5851778 и Landrum E, et al., US 5976822. Такие анализы можно оформлять, чтобы они являлись количественными, для определения концентрации или количества антитела против ВИЧ, или их можно оформлять, чтобы они были качественными для определения наличия или отсутствия антитела к ВИЧ. Дополнительные описания иммунологических анализов, которые можно адаптировать для применения в соответствии с принципами настоящего изобретения, доступны в научной литературе. См. Gnann J, et al., Methods Enzymol. 1989; 178:693-714, Dopel S, et al., Eur. J. Clin. Chem. Clin. Biochem. 1991; 29:331-337, Manocha M, et al., Immunol. Lett. 2003; 85(3):275-278), Brattegaard K, et al., AIDS 1995; 9(6):656-657, Beristain C, et al., J. Clin. Lab. Anal. 1995; 9:347-350, Modrow S, et al., J. Acquir. Immune Defic. Syndr. 1989; 2:141-148, Gueye-Ndiaye A, et al., AIDS 1993; 7:475-481, Sabatier J, et al., AIDS 1989; 3:215-220, Sommerfelt M, et al., Expert Opin. Biol. Ther. 2004; 4:349-361, Alcaro M, et al., Curr. Protein Pept. Sci. 2003; 4:285-290, Smith R, et al., Arch. Pathol. Lab. Med. 1990; 114:254-258, Petrov R, et al., Biomed. Sci. 1990; 1:239-244, Zolla-Pazner S, Nat. Rev. Immunol. 2004; 4:199-210, Baillou A, et al., J. Clin. Microbiol. 1991; 29:1387-1391, and McGaughey G, et al., Curr. HIV Res. 2004; 2:193-204.

Способы гетерогенного иммунологического анализа, как правило, включают использование вещества твердой фазы, с которым связывается продукт, и их можно адаптировать, чтобы они предусматривали связывание неиммобилизованных антигенов и антител (т.е. жидкофазный иммунологический анализ). Продукт реакции отделяют от избыточного образца, реагентов анализа и других веществ, удаляя твердую фазу из реакционной смеси (например, промыванием). Один из типов твердофазных иммунологических анализов, которые можно использовать в соответствии с настоящим изобретением, представляет собой сэндвич-иммуноанализ. В сэндвич-анализе чем больше аналита содержится в образце, тем большее количество метки содержится на твердой фазе. Как правило, такой тип формата анализа является предпочтительным, в частности, для визуализации низких концентраций аналита, т.к. появление метки на твердой фазе легче детектировать.

В соответствии с предпочтительным вариантом осуществления настоящего изобретения пептид по настоящему изобретению, который специфически взаимодействует с антителом к ВИЧ, является связанным с твердой подложкой (т.е. иммобилизованным), и его инкубируют при контактировании с биологическим образцом, который тестируют на наличие антитела к ВИЧ. Для уменьшения неспецифического связывания можно добавлять блокирующее средство.

Как будет понятно, пептид можно инкубировать с биологическим образцом в несвязанном состоянии, а затем связывать с твердой подложкой (т.е. иммобилизовать). Затем, предпочтительно, тщательно обрабатывать подложки (например, промыванием) по существу для удаления антител не-ВИЧ, которые могут содержаться, но которым не удалось связаться со связанным пептидом. Следовательно, при такой обработке образуется иммунный комплекс между пептидом и антителом к ВИЧ.

Затем, предпочтительно, добавляют меченное с возможностью детектирования вторичное антитело (способное связываться с исходным антителом (например, антителом против IgG человека)) и инкубируют подложку в условиях, достаточных для обеспечения возможности вторичного антитела связываться с любым антителом к ВИЧ, которое может содержаться. Затем подложку, предпочтительно, тщательно обрабатывают (например, промыванием) по существу для удаления любого несвязанного вторичного антитела. Если в тестируемом образце содержится антитело против ВИЧ, то два антитела образуют иммунный комплекс с иммобилизованным пептидом (т.е. сэндвич вторичное антитело/антитело к ВИЧ/иммобилизованный пептид). В таком анализе связанное с подложкой детектируемое вторичное антитело является показателем того, что в тестируемом образце содержится антитело против ВИЧ. См. Schuurs A. et al., US 3791932 и US 4016043 и Pankratz T. et al., US 5876935. Вторичное антитело может представлять собой природный иммуноглобулин, выделяемый у видов, не принадлежащих человеку (например, антитело мыши против IgG человека, антитело козы против IgG человека, антитело козы против IgM человека), или его можно получать рекомбинантно или синтетически. Оно может представлять собой интактный иммуноглобулин или фрагмент иммуноглобулина (например, FAb, F[Ab]2). При желании можно применять другие связывающиеся молекулы (способные связываться с антителами к ВИЧ) совместно или вместо таких вторичных антител. Например, антитела к ВИЧ можно биотинилировать и вторичное антитело можно заменять меченым авидином или стрептавидином.

Для устранения стадии разделения без связывания и уменьшения времени и оборудования, необходимых для химического анализа связывания, можно альтернативно применять гомогенный формат анализа. В таких анализах один компонент из связывающейся пары может еще быть иммобилизованным, однако наличие второго компонента связывающейся пары детектируют без разделения без связывания. Примеры гомогенных оптических способов представляют собой способ EMIT (Syva, Sunnyvale, CA, US), который осуществляют посредством детекции гашения флуоресценции, способ лазерной нефелометрии латекс-агглютинации от Behringwerke (Marburg, DE), который осуществляют посредством детекции изменений рассеяния света, способ латекс-агглютинации LPIA (Mitsubishi Chemical Industries, Tokyo, JP), способ деполяризации флуоресценции TDX (Abbott Laboratories, Abbott Park, IL, US) и способ переноса энергии флуоресценции (Cis Bio International, Paris, FR). Любой из таких анализов можно адаптировать для применения в соответствии с задачами настоящего изобретения.

Анализ связывания по настоящему изобретению можно конфигурировать в виде конкурентного анализа. В конкурентном анализе, чем больше содержится антитела к ВИЧ в тестируемом образце, тем меньше количество метки, содержащейся на твердой фазе.

Аналогично сэндвич-анализу конкурентный анализ можно проводить, предоставляя различное количество меченого антитела к ВИЧ и определяя, содержит ли тестируемая жидкость антитело к ВИЧ, которое конкурирует с меченым антителом за связывание с подложкой. В таком конкурентном анализе количество захваченного меченого антитела является обратно пропорциональным количеству аналита, содержащегося в тестируемом образце. В данной области описаны некоторые анализы такого рода. См. Smith D, et al., US 4401764, Clagett J, et al., US 4,746,631, Li C, et al., US 4661444, Chieregatt E, et al., GB 2084317, Mochida E, et al., US 4185084, Sadeh D, et al., US 4243749, Lucas F, et al., US 5698411, Landrum, выше, Leuvering J, US 4313734, Gribnau T, et al., US 4373932, и Baugher B, et al., US 5501985. Предпочтительным является использование ферментов (в частности, щелочной фосфатазы, бета-галактозидазы, пероксидазы хрена или уреазы) в качестве детектируемой метки (т.е. ферментного иммунологического анализа или EIA).

Наличие ферментативной метки можно детектировать с использованием хромогенных субстратов (включая такие, которые испускают или поглощают флуоресцентный, УФ, видимый спектр света) в ответ на катализ ферментной меткой. Более предпочтительно, можно применять химические метки (например, метки на основе коллоидного золота, латексных гранул).

Детекцию метки можно проводить с использованием множественных детекторов, широкополосных фильтров, решеток или спектрально различных флуоресцирующих средств. См. Ward D. et al., US 5759781. Особенно предпочтительно, в качестве ферментной метки использовать пероксидазу, в частности, совместно с хромогенным субстратом 3,3',5,5'-тетраметилбензидином (TMB), OPD или ABTS. В случае мечения антител пероксидазой в качестве фермента, можно применять способ на основе периодата или описанный способ, в котором партнеры являются связанными гетеробифункциональным реагентом. См. Nakane P. et al., J. Histochem. Cytochem., 1974, 22:1084-1090. В иммунологических анализах по настоящему изобретению можно применять любую из широкого спектра твердых подложек. Подходящие вещества для твердой подложки представляют собой синтетические, такие как полистирол, поливинилхлорид, полиамид, или другие синтетические полимеры, природные полимеры, такие как целлюлоза, а также дериватизированные природные полимеры, такие как ацетат целлюлозы или нитроцеллюлоза, и стекло, в частности, стекловолокно. Подложка может находиться в форме гранул, палочек, трубочек и планшетов для микроанализа или микротитрования. Аналогично, подходящими являются пластинчатые структуры, такие как полоски бумаги, небольшие пластины и мембраны. Поверхность носителей может быть проницаемой и непроницаемой для водных растворов.

Несмотря на то, что указанное выше описание относится к анализу наличия антител к ВИЧ в биологических образцах, которые представляют собой жидкости (например, сыворотки, кровь, мочу, слюну, панкреатический сок, цереброспинальную жидкость, семенную жидкость), следует понимать, что в анализах по настоящему изобретению аналогично можно использовать любой жидкий биологический образец (например, экстракты ткани или биопсии, экстракты кала, мокроты). Наиболее предпочтительно, анализируемый биологический образец представляет собой сыворотку или плазму.

Вследствие того, что иммуногены по настоящему изобретению способны индуцировать продукцию антител с нейтрализующей активностью с широким спектром действия, эти иммуногены также можно использовать для детекции ответа антитела с нейтрализующей активностью на патоген у пациента. Таким образом, в другом аспекте изобретение относится к способу детекции ответа антитела с нейтрализующей активностью против инфекции вирусом у индивидуума, включающему детекцию у указанного индивидуума наличия антител с нейтрализующей активностью способом детекции антител с нейтрализующей активностью по изобретению, где наличие антител с нейтрализующей активностью у указанного индивидуума по сравнению с контрольным индивидуумом является показателем ответа антитела с нейтрализующей активностью на указанную инфекцию вирусом у указанного индивидуума.

В предпочтительном варианте осуществления вирус представляет собой ВИЧ, и где полипептид представляет собой вариантный полипептид gp120 или его фрагмент по изобретению. В более предпочтительном варианте осуществления образец получают у инфицированного ВИЧ-1 пациента или у реципиента вакцины против СПИД.

Общие способы

1. Реагенты

Использовали следующие реагенты:

a) Плазмиды. Плазмиду pNL4.3 получали от National Institutes of Health AIDS Research and Reference Reagent Program (NIH ARRRP, NIH, Bethesda, MD, US). Плазмиду pcDNA 3.1 получали от Invitrogen (Carslbad, CA, US).

b) Изолят ВИЧ-1. Использовали первичный изолят ВИЧ-1 типа B, AC-10, (NeutNet consortium, Milan, IT).

c) Клеточные линии. Клетки TZM-bl (CD4+ CXCR4+ CCR5+) получали из хранилища NIH (NIH, Bethesda, Maryland, US). Клетки 293T и TZM-bl содержали в модифицированной Дульбекко среде Игла (DMEM), содержащей 10% эмбриональной телячьей сыворотки, 20 мМ L-глутамина, 100 ед. пенициллина/мл и 100 мкг стрептомицина/мл.

d) Антитела. Использовали моноклональные антитела (MAb) к Env-ВИЧ-1 с широким спектром нейтрализующей активности (специфичности эпитопа указаны в скобках) (NIH ARRRP, NIH, Bethesda, MD, US, Polymun AG, Vienna, AT). Они включали: 4E10 (мембрано-проксимального внешнего региона, MPER), 2F5 (MPER), b12 (CD4 участок связывания), 2G12 (гликаны с высоким содержанием маннозы gp120) и PG16 (вирусные шипики gp120).

2. Случайный мутагенез in vitro

Мутации вводили в env AC-10 ВИЧ-1 с использованием набора Genemorph II Random Mutagenesis (Stratagene, La Jolla, CA, US). Библиотеку химерных вирионов ВИЧ получали посредством переноса случайно мутировавших оболочек в плазмиды pNL4-3 и pcDNA3.1. Перенос был опосредованным введением в участки рестрикции сохраняющих последовательность вируса и расщепляющих ферментов XbaI и NotI (New England Biolabs, Ipswich, MA, US).

3. Клонирование и получение библиотеки

Продукты ПЦР клонировали в векторы pNL4.3 и pcDNA3.1 с использованием набора Rapid DNA Ligation (Roche Applied Science, Indianapolis, IN) по инструкциям производителя. Рекомбинантные векторы pNL4.3 и pcDNA3.1 встраивали в компетентные клетки MAX Efficiency® Stbl2™ и компетентные клетки MAX Efficiency® DH5αТМ (Invitrogen, Carslbad, CA, US), соответственно, и амплифицировали в течение ночи (ON) при 30°C при перемешивании в объеме 3 мл. Несколько трансформаций проводили одновременно для предотвращения потери разнообразия и смешивали друг с другом при увеличенном масштабе амплификации (250 мл, 30°C, в течение ночи при перемешивании). После инкубации высевали 20 мкл и выделяли плазмидную ДНК с использованием PureYieldTM Plasmid Maxiprep System (Promega, Madison, WI, US). Оба продукта в дальнейшем расщепляли XbaI и NotI для подтверждения наличия гена env. В случае положительного результата, клоны секвенировали и/или использовали для трансфекции. Вирусы получали с помощью временной совместной трансфекции клеток 293T с использованием конструкций pNL4.3. Супернатанты клеточных культур, содержащие вирионы собирали на 2 сутки после трансфекции и концентрировали вирионы с использованием центрифужного ультрафильтрационного устройства Amicon®. Вирионы ресуспендировали в фосфатно-солевом буфере (PBS).

4. Анализ захвата вирионов

Лунки планшета для микротитрования покрывали поликлональными антителами против Fc (5 мкг/мл в 100 мкл PBS) в течение ночи при 4°C. Лунки блокировали 3% бычьим сывороточным альбумином (BSA) в PBS в течение 1 часа при 37°C. В лунки планшета для микротитрования добавляли 100 мкл вируса (1000 нг/мл) из библиотеки. В соответствующие лунки добавляли 5 мкл иммобилизованного MAb (100 нг/мл) и инкубировали планшет при 37°C при перемешивании (450 об./мин.). После инкубации в течение 2 часов лунки промывали PBS шесть раз, и эквиваленты вируса p24 количественно определяли твердофазным иммуноферментным анализом (ELISA) или экстрагировали РНК с использованием набора High Pure Viral RNA (Roche Applied Science, Indianapolis, IN, US) по инструкциям производителя.

5. Амплификация РНК env ВИЧ-1 вложенной ПЦР с обратной транскрипцией

Выделенную РНК env ВИЧ-1 амплифицировали полимеразной цепной реакцией с обратной транскрипцией (ПЦР с обратной транскрипцией) с использованием набора RT-PCR (GeneAmp® Gold RNA PCR Reagent Kit, Applied Biosystems, Carlsbad, CA, US) и Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN). Для реакции ПЦР с обратной транскрипцией использовали матрицу РНК объемом 8 мкл и РНК обратно транскрибировали с использованием праймера 102 (обратного) при 50°C в течение 20 минут. Область env амплифицировали с использованием праймеров 101 (прямого) и 104 (обратного) из объема 5 мкл кДНК с последующей вложенной ПЦР с использованием праймеров 179 (прямого) и 180 (обратного) с использованием объема 2 мкл матрицы. См. таблицу 1. Условия обеих амплификаций ПЦР env являлись следующими: i) 1 цикл 94°C в течение 2 минут, ii) 35 циклов 94°C в течение 2 минут, 55°C в течение 1 минуты и 72°C в течение 3 минут, iii) 1 цикл 72°C в течение 7 минут и iv) остановка при 4°C. Получаемый ампликон (2583 п.н.) подвергали электрофорезу совместно с маркером молекулярной массы 1 т.п.н. в 1,0% агарозном геле, окрашенным красителем для геля SYBR® Safe DNA.

6. Клонирование и секвенирование гена env

Продукты ПЦР предшествующей стадии клонировали в векторы pNL4.3 и pcDNA3.1, как описано выше. Компетентные клетки Stbl2 и DH5α трансформировали этими плазмидами, как показано выше. Плазмидную ДНК выделяли с использованием набора QIAprep Spin Miniprep (Qiagen, Valencia, CA, US) и в дальнейшем расщепляли XbaI и NotI для подтверждения наличия гена env. Env-положительные клоны секвенировали с использованием BigDye® Terminator v3.1 и праймеров 183 (прямого), 185 (прямого), 186 (прямого), 190 (обратного), 192 (обратного) и 193 (обратного). См. таблицу 1.

7. Анализ последовательности

Выравнивание нуклеотидных последовательностей проводили с использованием программы CLUSTAL W (EMBL-EBI, http://www.ebi.ac.uk/FTP/, февраль 2011 года) и приложений программы Contig Assembly (CAP), интегрированных в BioEdit версии 7.0.9.0, а затем редактировали вручную. См. Thompson J. et al., Nucl. Acids Res., 1994, 22(22):673-4680 и Huang X., Genomics, 1992, 14(1):18-25.

Таблица 1
Последовательности праймера и локализация гена. Локализация гена основана на геноме HXB2 ВИЧ-1 (номер доступа GenBank K03455). 1Wei X. et al., Antimicrob. Agents Chemother., 2002, 46(6):1896-1905.
Идентификатор праймера Последовательность Локализация в геноме SEQ ID NO:
101 TAGAGCCCTGGAAGCATCCAGGAAG 5853-5877 5
102 TTGCTACTTGTGATTGCTCCATGT 8936-8913 6
104 AGCTGGATCCGTCTCGAGATACTGCTCCCACCC 8916-8882 7
179 GTAGTACATGTAATGCAACC 6050-6069 8
180 AGCTCGTCTCATTCTTTCCC 8865-8846 9
183 CCAATTCCCATACATTATTGTGC 6858-6880 10
185 GGAGCAGCAGGAAGCACTATGGGC 7794-7817 11
186 GAGTTAGGCAGGGATACTCACC 8344-8365 12
190 GCCAGGACTCTTGCCTGGAGCTG 7969-7947 13
192 CTTGTATTGTTGTTGGGTC 7135-7117 14
193 CATGGCTTTAGGCTTTGATCCC 6580-6559 15

8. Получение рекомбинантных вирусов

Клоны, экспрессирующие гликопротеины оболочки, специфические к 4E10 с соответствующими мутациями (потеря потенциальных участков гликозилирования и изменение архитектуры петель V1/V2) амплифицировали в течение ночи в объеме 250 мл при 30°C при перемешивании. Плазмидную ДНК выделяли с использованием PureYield™ Plasmid Maxiprep System (Promega, Madison, WI, US) и использовали для временной совместной трансфекции клеток 293T. Содержащие псевдовирус супернатанты собирали через двое суток после трансфекции. Уровень p24 количественно определяли ELISA.

9. Анализы связывания

Связывание MAb (4E10, 2F5, 2G12, b12 и PG16) с интактными вирионами определяли анализом захвата, описанным выше. Сначала вирус инкубировали с BMAb в растворе для облегчения связывания вирус-BMAb. Затем комплексы вирус-BMAb, захватываемые антителами к FC, предварительно иммобилизованными на планшете. Иммобилизованные вирус-BMAb лизировали 1% Triton-X в PBS. p24 в лизатах вируса количественно определяли ELISA, как описано выше. Конструкцию pNL4.3 ΔEnv использовали в качестве отрицательного контроля. Повышение аффинности связывания определяли сравнением с вирусом AC-10 дикого типа.

Все указанные выше в настоящем описании публикации, таким образом, включены в качестве ссылки в полном объеме.

Несмотря на то, что указанное выше изобретение описано более подробно для ясности и понимания, специалисту в данной области следует понимать из прочтения этого описания, что можно проводить различные изменения в форме и деталях, не выходя за рамки объема изобретения и прилагаемой формулы изобретения.

1. Полипептид, способный индуцировать антитела с нейтрализующей активностью против ВИЧ-1, содержащий вариант gp120 ВИЧ-1, где полипептид имеет последовательность SEQ ID NO: 4.

2. Полинуклеотид, кодирующий полипептид по п. 1.

3. Полинуклеотид по п. 2, содержащий последовательность SEQ ID NO: 3.

4. Вектор экспрессии, содержащий полинуклеотид по п. 2 или 3.

5. Клетка-хозяин для экспрессии полипептида по п. 1, содержащая вектор экспрессии по п. 4.

6. Иммуногенная композиция или вакцина для лечения или предотвращения заболевания, вызываемого инфекцией ВИЧ, содержащая терапевтически эффективное количество полипептида по п. 1, полинуклеотида по п. 2 или 3 или вектора экспрессии по п. 4 и фармацевтически приемлемый носитель.

7. Применение полипептида по п. 1, полинуклеотида по п. 2 или 3, вектора экспрессии по п. 4 или иммуногенной композиции или вакцины по п. 6 для получения лекарственного средства для лечения или профилактики заболевания, вызываемого инфекцией ВИЧ.



 

Похожие патенты:

Изобретение относится к области молекулярной биологии и диагностической медицины. Предложен способ выделения циркулирующих ДНК из плазмы или сыворотки крови.

Изобретение относится к молекулярной биологии и может быть использовано при проведении медико-биологических исследований. Предложен способ подготовки суспензии лимфоцитов человека в этанол-уксусном фиксаторе для выделения ДНК, включающий центрифугирование указанной суспензии и удаление надосадочной жидкости.

Изобретение относится к области молекулярной биологии. Предложен способ автоматизированного выделения с одновременной очисткой нуклеиновых кислот из двух и более биологических образцов.

Изобретение относится к биотехнологии. Описан способ идентификации жизненно важного продукта гена, который служит мишенью для антибиотика в бактерии.

Группа изобретений относится к области геномики. Предложены способ выявления вариации числа копий в образце генома и система, используемая для осуществления способа.

Изобретение относится к биотехнологии и молекулярной генетике. Способ предусматривает картирование положений ряда метилированных нуклеотидных последовательностей Pu(5mC)GPy в протяженной ДНК для построения эпигенетического профиля и выявления аномально метилированных участков ДНК.

Изобретение относится к области молекулярной биологии и диагностической медицины. Предложен способ выделения микроРНК из биологических жидкостей.

Изобретение относится к биотехнологии, а именно к способу выделения целевого олигонуклеотида из смеси целевого олигонуклеотида и одной или более примесей. Способ включает выделение олигонуклеотида из смеси с применением двухфазной жидкость-жидкостной хроматографической системы подвижная фаза/неподвижная фаза.

Изобретение относится к области биохимии. Заявлен способ молекулярно-генетического внутривидового типирования Vibrio cholerae O1 и O139 серогрупп.

Изобретение относится к области биотехнологии и представляет собой способ получения по меньшей мере одного варианта протеазы с улучшенной моющей эффективностью в порошкообразной или жидкой детергентной композиции, имеющей pH между 5 и 12,0, в сравнении с исходной протеазой.

Настоящее изобретение относится к биохимии, в частности к иммуногенным композициям против ВИЧ-1, содержащим фармацевтически приемлемый носитель и антигенный пептид, выбранный из группы, состоящей из PWNASASNKSLDDIW, PWNASWANKSLDDIW, PWNASWSAKSLDDIW и PWNASWSNKALDDIW.

Изобретение относится к области биотехнологии. Описаны новые конструкции транспортеров общей формулы (I) D1LLLxDm(LLLyDn)a и их варианты.

Изобретение относится к области биотехнологии, генной инженерии и иммунологии. Раскрыты связывающие gp41 ВИЧ-1 одноцепочечные 3-нитиевые альфа-спиральные суперспирализованные молекулы, обозначенные как "Альфатела".

Изобретение относится к области биотехнологии. Описано применение специфических молекул-конъюгатов, которые являются транспортерами карго-молекул, для транспортировки представляющей интерес субстанции в лейкоциты.

Изобретение относится к области биотехнологии. .

Изобретение относится к области биотехнологии, вирусологии и иммунологии. .

Изобретение относится к области биотехнологии, вирусологии и медицины. .

Изобретение относится к области вирусологии и генетической инженерии. .

Настоящее изобретение относится к биохимии, в частности к иммуногенным композициям против ВИЧ-1, содержащим фармацевтически приемлемый носитель и антигенный пептид, выбранный из группы, состоящей из PWNASASNKSLDDIW, PWNASWANKSLDDIW, PWNASWSAKSLDDIW и PWNASWSNKALDDIW.

Изобретение относится к области биотехнологии, конкретно к новым иммуногенам ВИЧ, и может быть использовано в медицине для лечения или предотвращения заболевания, вызываемого инфекцией ВИЧ. Полипептид - вариант gp120 ВИЧ-1 с SEQ ID NO: 4 отбирают способом быстрого отбора иммуногенов на основании связывания библиотеки рекомбинантных вирусов, содержащих рандомизированные варианты gp120 ВИЧ, поверхностного полипептида, находящегося на антителах с нейтрализующей активностью. Изобретение позволяет эффективно индуцировать антитела с нейтрализующей активностью против ВИЧ-1. 6 н. и 1 з.п. ф-лы, 5 ил., 1 табл.

Наверх