Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1



Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1
Лечение заболеваний, связанных с аполипопротеином-а1, путем ингибирования природного антисмыслового транскрипта аполипопротеина-а1

 

C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2604489:

КьюРНА,Инк.,US (US)

Изобретение относится к области биохимии. Предложен антисмысловой олигонуклеотид, содержащий по меньшей мере одну модифицированную межнуклеотидную связь, который гибридизуется с природным антисмысловым полинуклеотидом аполипопротеина A1 (ApoA1) и повышает экспрессию молекул ApoA1 по сравнению с нормальным контролем. Также предложены варианты композиции, содержащей указанный антисмысловой олигонуклеотид. Композиции предназначены для повышения экспрессии ApoA1, а также для предотвращения или лечения заболеваний, связанных с ApoA1. Изобретение обеспечивает ингибирование природного антисмыслового транскрипта ApoA1 у пациента и, таким образом, позволяет повысить экспрессию ApoA1. 5 н. и 22 з.п. ф-лы, 11 ил., 4 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННЫЕ ЗАЯВКИ

Настоящая заявка испрашивает приоритет на основании предварительной патентной заявки США № 61/102681, поданной 3 октября 2008, предварительной патентной заявки США № 61/152236, поданной 12 февраля 2009, и предварительной патентной заявки США № 61/176267, поданной 7 мая 2009, каждая из которых включена в данное описание в качестве ссылки во всей полноте.

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Воплощения данного изобретения включают в себя олигонуклеотиды, модулирующие экспрессию и/или функцию аполипопротеина и ассоциированных с ним молекул.

УРОВЕНЬ ТЕХНИКИ ИЗОБРЕТЕНИЯ

Гибридизация ДНК-РНК и РНК-РНК имеет большое значение для многих аспектов функционирования нуклеиновых кислот, включающих в себя репликацию, транскрипцию и трансляцию ДНК. Гибридизация также играет ключевую роль в ряде технологий, используемых либо для детекции конкретной нуклеиновой кислоты, либо для изменения ее экспрессии. Например, антисмысловые нуклеотиды нарушают экспрессию гена путем гибридизации с целевой РНК, что препятствует сплайсингу, транскрипции, трансляции и репликации РНК. Дополнительной характеристикой антисмысловой ДНК является способность гибридов ДНК-РНК расщепляться под действием рибонуклеазы H, активность которой можно обнаружить в клетках большинства типов. Антисмысловые молекулы можно доставлять в клетки, как в случае олигодезоксинуклеотидов (ODN), или их можно экспрессировать из эндогенных генов, как в случае молекул РНК. Недавно FDA утвердило антисмысловое лекарственное средство, VITRAVENETM (для лечения цитомегаловирусного ретинита), что свидетельствует о возможности терапевтического применения антисмысловых молекул.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

В разделе Сущность изобретения приводится краткое описание содержания и предмета изобретения. Следует понимать, что данный раздел не предназначен для интерпретации или ограничения объема или смысла формулы изобретения.

В одном воплощении изобретение предлагает способы ингибирования активности природного антисмыслового транскрипта путем применения антисмыслового олигонуклеотида (олигонуклеотидов), направленного на некоторый участок природного антисмыслового транскрипта, где указанное применение приводит к повышающей регуляции соответствующего смыслового гена. В данном описании также предполагается, что ингибирование природного антисмыслового транскрипта может происходить под действием миРНК, рибозимов и маленьких молекул, которые входят в объем настоящего изобретения.

Одно воплощение относится к способу модуляции функции и/или экспрессии полинуклеотида аполипопротеина (ApoA1) в клетках или тканях пациента in vivo или in vitro, который включает в себя приведение в контакт указанных клеток или тканей с антисмысловым олигонуклеотидом, содержащим от 5 до 30 нуклеотидов в длину, где последовательность указанного олигонуклеотида, по меньшей мере, на 50% идентична обратному комплементу полинуклеотида, содержащего от 5 до 30 последовательных нуклеотидов из нуклеотидов 1-932 последовательности SEQ ID NO:2 (фигура 8); и последующую модуляцию функции и/или экспрессии полинуклеотида аполипопротеина (ApoA1) в клетках или тканях пациента in vivo или in vitro.

В другом предпочтительном воплощении олигонуклеотид направлен на природную антисмысловую последовательность полинуклеотидов ApoA1, например, полинуклеотидов, описанных как SEQ ID NO: 2, а также любых вариантов, аллелей, гомологов, мутантов, производных, фрагментов указанных полинуклеотидов и комплементарных им последовательностей. Примеры антисмысловых олигонуклеотидов описаны как SEQ ID NO: 81-173.

Другое воплощение относится к способу модуляции функции и/или экспрессии полинуклеотида аполипопротеина (ApoA1) в клетках или тканях пациента in vivo или in vitro, который включает в себя приведение в контакт указанных клеток или тканей с антисмысловым олигонуклеотидом, содержащим от 5 до 30 нуклеотидов в длину, где последовательность указанного олигонуклеотида, по меньшей мере, на 50% идентична обратной последовательности, комплементарной антисмысловому полинуклеотиду аполипопротеина (ApoA1); и последующую модуляцию функции и/или экспрессии полинуклеотида аполипопротеина (ApoA1) в клетках или тканях пациента in vivo или in vitro.

Другое воплощение относится к способу модуляции функции и/или экспрессии полинуклеотида аполипопротеина (ApoA1) в клетках или тканях пациента in vivo или in vitro, который включает в себя приведение в контакт указанных клеток или тканей с антисмысловым олигонуклеотидом, содержащим от 5 до 30 нуклеотидов в длину, где последовательность указанного олигонуклеотида, по меньшей мере, на 50% идентична последовательности олигонуклеотида, который является антисмысловым по отношению к антисмысловому полинуклеотиду аполипопротеина (ApoA1); и последующую модуляцию функции и/или экспрессии полинуклеотида аполипопротеина (ApoA1) в клетках или тканях пациента in vivo или in vitro.

В предпочтительном воплощении композиция содержит один или более антисмысловых олигонуклеотидов, которые связываются со смысловыми и/или антисмысловыми полинуклеотидами аполипопротеина (ApoA1).

В другом предпочтительном воплощении олигонуклеотиды содержат один или более модифицированных или замещенных нуклеотидов.

В другом предпочтительном воплощении олигонуклеотиды содержат одну или более модифицированных связей.

В следующем воплощении модифицированные нуклеотиды содержат модифицированные основания, включающие в себя фосфоротиоат, метилфосфонат, мономеры пептидных нуклеиновых кислот или молекулы замкнутых нуклеиновых кислот (LNA). Предпочтительно модифицированные нуклеотиды представляют собой молекулы замкнутых нуклеиновых кислот, включающих в себя α-L-LNA.

В другом предпочтительном воплощении олигонуклеотиды вводят пациенту подкожно, внутримышечно, внутривенно или внутрибрюшинно.

В другом предпочтительном воплощении олигонуклеотиды вводят в составе фармацевтической композиции. Режим лечения включает в себя, по меньшей мере, однократное введение пациенту антисмысловых соединений, однако данный режим можно изменить и вводить несколько доз в течение определенного периода времени. Лечение можно сочетать с одним или более другими видами терапии.

В другом предпочтительном воплощении олигонуклеотиды заключают в липосому.

Другие аспекты описаны ниже.

КРАТКОЕ ОПИСАНИЕ РИСУНКОВ

На фигуре 1 приведено графическое изображение результатов ПЦР в реальном времени, демонстрирующих, что уровни мРНК ApoA1 в клетках HepG2 значительно увеличиваются через 48 часов после обработки некоторыми олигонуклеотидами, являющимися антисмысловыми по отношению к антисмысловой последовательности ApoA1 DA327409ext. Столбики RH3-RH597 соответствуют образцам, обработанным SEQ ID NO: 81-158.

На фигуре 2 приведено графическое изображение результатов ПЦР в реальном времени, демонстрирующих кратность изменения уровня мРНК ApoA1 (верхняя панель) и природной последовательности DA327409ext, антисмысловой по отношению к РНК ApoA1 (нижняя панель), после обработки клеток HepG2 оголенными LNA или фосфотиоатными олигонуклеотидами в течение 7 дней, по сравнению с контролем. Столбики #6LNA, #11LNA, #6PS и #11PS обозначают SEQ ID NO: 159, 160, 161, 162 соответственно.

На фигуре 3 приведено графическое изображение результатов ПЦР в реальном времени, демонстрирующих степень изменения уровня природной последовательности DA327409ext, антисмысловой по отношению к РНК АроА1 (первый столбик в каждой паре столбиков, не закрашенный) и ApoA1 мРНК (второй столбик в каждой паре столбиков, закрашенный) после обработки клеток HepG2 олигонуклеотидами LNA. Столбики 6-11 соответствуют SEQ ID NO 159, 167-170 и 160.

На фигуре 4 изображено дозозависимое увеличение уровней мРНК (нижняя панель) и белка (верхняя панель) ApoA1 после обработки клеток HepG2 олигонуклеотидами. Столбики CUR-4806 и CUR-4811 обозначают SEQ ID NO 159 и 160 соответственно.

На фигуре 5 приведено графическое изображение результатов ПЦР в реальном времени, демонстрирующих повышающую регуляцию мРНК ApoA1 в первичных гепатоцитах африканской зеленой мартышки после обработки олигонуклеотидами, направленными против природной антисмысловой последовательности ApoA1 DA327409ext. Столбики CUR-4816 и CUR-4811 обозначают SEQ ID NO 173 и 160 соответственно.

На фигуре 6 приведен график, демонстрирующий, что уровни мРНК и белка ApoA1 в биопсийных образцах печени обезьян увеличиваются после обработки CUR-962, олигонуклеотидом, сконструированным против антисмысловой последовательности ApoA1 DA327409ext, по сравнению с исходным уровнем, как определено методами ПЦР в реальном времени и ELISA, соответственно (правые панели). Уровни мРНК или белка ApoA1 не изменяются в контрольной группе, получающей в течение такого же периода времени олигонуклеотид, который заведомо не влияет на уровень ApoA1 in vitro (CUR-963) (левые панели). Столбики CUR-962 и CUR-963 представляют SEQ ID NO: 170 и 171 соответственно.

На фигуре 7 показаны SEQ ID NO 1, мРНК ApoA1 и SEQ ID NO 1a, геномная последовательность ApoA1 получена из собрания генов UCSC, март 2006 (http://genome.ucsc. edu/index.html?org=Human&db=hgl8&hgsid=144980821, экзоны показаны заглавными буквами, интроны - маленькими)

На фигуре 8 показана SEQ ID NO: 2.

На фигурах 9A-D показаны SEQ ID NO: 3-158.

На фигуре 10 показаны SEQ ID NO: 159-173. * обозначает фосфотиоатную связь, + обозначает модификацию LNA.

На фигуре 11 показано параллельное выравнивание природных антисмысловых последовательностей ApoA1 человека и макак-резуса, а также положение некоторых олигонуклеотидов, используемых для таргетирования на указанные последовательности.

ПОДРОБНОЕ ОПИСАНИЕ

Некоторые аспекты данного изобретения описаны ниже с целью иллюстрации со ссылкой на возможные способы применения. Следует понимать, что многочисленные конкретные детали, взаимосвязи и способы описаны для облегчения полного понимания изобретения. Однако рядовой специалист в данной области может легко понять, что изобретение можно осуществить без использования одной или более конкретных деталей или с помощью других способов. Настоящее изобретение не ограничивается показанным порядком процессов или событий, так как некоторые процессы могут протекать в другой последовательности и/или одновременно с другими процессами или событиями. Кроме того, не все описанные процессы или события являются необходимыми для выполнения методологии настоящего изобретения.

Подразумевается, что все гены, названия генов и генные продукты, раскрытые в данном описании, относятся к гомологам, полученным из любых видов, которые можно использовать в сочетании с раскрытыми в данном описании композициями и способами. Так, указанные термины включают в себя, без ограничения, человеческие и мышиные гены и генные продукты. Следует понимать, что описание гена или генного продукта, полученных из конкретного вида, является только иллюстративным и не должно толковаться как ограничение, если контекст, в котором это описание встречается, однозначно не указывает иначе. Так, например, в случае раскрытых в данном описании генов, которые в некоторых воплощениях связаны с нуклеотидными и аминокислотными последовательностями млекопитающих, предполагается, что они охватывают гомологичные и/или ортологичные гены и генные продукты, полученные из других животных, которые включают в себя, без ограничения, других млекопитающих, рыб, амфибий, рептилий и птиц. В предпочтительных воплощениях гены или нуклеотидные последовательности являются человеческими.

Определения

Используемая в данном описании терминология предназначается только для описания конкретных воплощений, но не для ограничения данного изобретения. В данном описании предполагается, что единственное число равным образом включает в себя множественное число, если контекст однозначно не указывает иначе. Кроме того, подразумевается, что термины "включающий в себя", "включает в себя", "имеющий", "имеет", "с", или их варианты, используемые в отношении какого-либо диапазона в подробном описании и/или формуле изобретения, являются включающими, подобно термину "содержащий".

Термин "примерно" или "приблизительно" означает, что конкретное значение находится в приемлемом диапазоне ошибки, который определяется рядовым специалистом в данной области и отчасти зависит от способа измерения или определения значения, т.е. от ограничений системы измерения. Например, "приблизительно" может относиться к стандартному отклонению в пределах 1 или более 1, в соответствии с принятой в данной области практикой. Альтернативно "приблизительно" может относиться к диапазону, составляющему до 20%, предпочтительно до 10%, более предпочтительно до 5%, и еще более предпочтительно до 1% от заданного значения. Альтернативно, особенно в отношении к биологическим системам или процессам, данный термин может относиться к порядку величины, предпочтительно в пределах 5-кратного диапазона и более предпочтительно в пределах 2-кратного диапазона значения. Если не указано иначе, предполагается, что термин "приблизительно", в применении к конкретным значениям, описанным в заявке и формуле изобретения, относится к приемлемому диапазону ошибки конкретного значения.

В данном описании термин "мРНК" относится к известному в настоящее время транскрипту (известным транскриптам) целевого гена, а также к любым другим транскриптам, которые могут быть обнаружены.

Под "антисмысловым олигонуклеотидом" или "антисмысловым соединением" подразумевается молекула РНК или ДНК, которая связывается с другой РНК или ДНК (целевой РНК, ДНК). Например, олигонуклеотид РНК, который связывается с другой молекулой целевой РНК посредством РНК-РНК взаимодействий и изменяет активность РНК-мишени (Eguchi et al., 1991 Ann. Rev. Biochem. 60, 631-652). Антисмысловой олигонуклеотид может осуществлять повышающую или понижающую регуляцию экспрессии и/или функционирования конкретного полинуклеотида. Подразумевается, что данное определение включает в себя любую чужеродную молекулу РНК или ДНК, которая является полезной с терапевтической, диагностической или другой точки зрения. Такие молекулы включают в себя, например, антисмысловые молекулы РНК или ДНК, интерферирующие РНК (РНКи), микро РНК, молекулы РНК-ловушек, миРНК, каталитические РНК, терапевтические редактирующие РНК, а также агонистические и антагонистические РНК, антисмысловые олигомерные соединения, антисмысловые олигонуклеотиды, олигонуклеотиды внешних вспомогательных последовательностей (EGS), продукты альтернативного сплайсинга, праймеры, зонды и другие олигомерные соединения, которые гибридизуются, по меньшей мере, с частью целевой нуклеиновой кислоты. Как таковые, указанные соединения можно вводить в виде одноцепочечных, двухцепочечных, частично одноцепочечных или циклических олигомерных соединений.

В контексте данного изобретения термин "олигонуклеотид" относится к олигомеру или полимеру рибонуклеиновой кислоты (РНК) или дезоксирибонуклеиновой кислоты (ДНК) или к их миметикам. Термин "олигонуклеотид" также включает в себя линейные или циклические олигомеры, содержащие природные и/или модифицированные мономеры или связи, в том числе дезоксирибонуклеозиды, рибонуклеозиды, их замещенные и альфа-аномерные формы, пептидные нуклеиновые кислоты (PNA), замкнутые нуклеиновые кислоты (LNA), фосфоротиоат, метилфосфонат и т.п. Олигонуклеотиды могут специфически связываться с целевым полинуклеотидом посредством регулярных мономер-мономерных взаимодействий, таких как спаривание оснований по принципу Уотсона-Крика, хугстиновское спаривание оснований, обратное хугстиновское спаривание оснований и т.п.

Олигонуклеотид может быть "химерным", то есть, он может состоять из разных участков. В контексте данного изобретения "химерные" соединения представляют собой олигонуклеотиды, которые содержат два или более различных химических участков, например, участок (участки) ДНК, участок (участки) РНК, участок (участки) ПНК и другие. Каждый химический участок состоит, по меньшей мере, из одного мономерного элемента, т.е. нуклеотида в случае олигонуклеотидного соединения. Указанные олигонуклеотиды, как правило, содержат, по меньшей мере, один участок, где олигонуклеотид является модифицированным с целью придания ему одного или более желательных свойств. Желательные свойства олигонуклеотида включают в себя, без ограничения, например, повышенную устойчивость к деградации под действием нуклеазы, повышенную способность поглощаться клеткой, и/или повышенное сродство связывания с целевой нуклеиновой кислотой. Таким образом, разные участки олигонуклеотида могут обладать разными свойствами. Химерные олигонуклеотиды настоящего изобретения можно получить в виде смешанных структур, содержащих два или более олигонуклеотидов, модифицированных олигонуклеотидов, олигонуклеозидов и/или аналогов олигонуклеотидов, описанных выше.

Олигонуклеотид может состоять из участков, соединенных "стандартным способом", то есть, мономеры могут быть соединены последовательно, как в нативной ДНК, или они могут соединяться через спейсеры. Спейсеры предназначаются для формирования ковалентного "мостика" между участками и имеют в предпочтительных случаях длину, не превышающую примерно 100 атомов углерода. Спейсеры могут нести разные функциональные группы, например, имеющие положительный или отрицательный заряд, особые связывающие свойства в отношении нуклеиновых кислот (интеркаляторы, вещества, связывающиеся с бороздкой, токсины, флуорофоры и другие), они могут являться липофильными и индуцировать образование особых вторичных структур, таких как, например, аланинсодержащие пептиды, которые индуцируют образование альфа-спиралей.

В данном описании термины "аполипопротеин" и "аполипопротеин A" охватывают все члены семейства, мутанты, аллели, фрагменты, разновидности, кодирующие и некодирующие последовательности, смысловые и антисмысловые полинуклеотидные цепи и другие.

В данном описании термин "олигонуклеотид, специфичный к" или "олигонуклеотид, направленный на" относится к олигонуклеотиду, имеющему последовательность, (i) способную образовывать стабильный комплекс с частью гена-мишени, или (ii) способную образовывать стабильный дуплекс с частью транскрипта мРНК гена-мишени. Стабильность комплексов и дуплексов можно определить с помощью теоретических расчетов и/или in vitro анализов. Примеры анализов, используемых для определения стабильности гибридизационных комплексов и дуплексов, описаны ниже в разделе Примеры.

В данном описании термин "нуклеиновая кислота-мишень" охватывает ДНК, РНК (в том числе пре-мРНК и мРНК), транскрибированную с такой ДНК, а также кДНК, полученную из такой РНК, кодирующие, некодирующие последовательности, смысловые или антисмысловые полинуклеотиды. Специфическая гибридизация олигомерного соединения с нуклеиновой кислотой-мишенью препятствует нормальному функционированию нуклеиновой кислоты. Такую модуляцию функции нуклеиновой кислоты-мишени под действием соединений, которые специфически гибридизуются с ней, обычно называют "антисмысловой". Функции ДНК, подлежащие нарушению, включают в себя, например, репликацию и транскрипцию. Функции РНК, подлежащие нарушению, включают в себя все жизненно важные функции, такие как, например, перемещение РНК в участок трансляции белка, трансляция белка с РНК, сплайсинг РНК с образованием одного или более разновидностей мРНК, и каталитическая активность, которая может реализовываться или опосредоваться РНК. Общий эффект такого препятствования функционированию нуклеиновой кислоты-мишени заключается в модуляции экспрессии кодируемого продукта или олигонуклеотидов.

РНК-интерференция "РНКи" опосредуется молекулами двухцепочечных РНК (дцРНК), которые имеют последовательность-специфичную гомологию по отношению к последовательности нуклеиновой кислоты-"мишени" (Caplen, N. J., et al, Proc. Natl. Acad. Sci. USA 98:9742-9747 (2001)). В некоторых воплощениях настоящего изобретения медиаторами являются "малые интерферирующие" дуплексы РНК (миРНК), содержащие 5-25 нуклеотидов. миРНК образуются в результате процессинга дцРНК под действием фермента РНКазы, известного как дайсер (Bernstein, E., et al, Nature 409:363-366 (2001)). Дуплексные продукты миРНК участвуют в образовании мультибелкового комплекса, содержащего миРНК, который называют RISC (комплекс РНК-индуцированного сайленсинга (RNA Induced Silencing Complex)). Без связи с какой-либо конкретной теорией полагают, что RISC затем направляется к нуклеиновой кислоте-мишени (подходящей мишенью является мРНК), где дуплекс миРНК взаимодействует в последовательность-специфичной манере с мишенью, опосредуя ее каталитическое расщепление (Bernstein, E., et al, Nature 409:363-366 (2001); Boutla, A., et al, Curr. Biol 11: 1776-1780 (2001)). Малые интерферирующие РНК, пригодные для применения в настоящем изобретении, можно синтезировать и использовать с помощью способов, хорошо известных в данной области и знакомых рядовым специалистам в данной области. Малые интерферирующие РНК, подходящие для применения в способах настоящего изобретения, содержат примерно от 1 до 50 нуклеотидов (нт). В примерах неограничивающих воплощений миРНК могут содержать примерно от 5 до 40 нт, примерно от 5 до 30 нт, примерно от 10 до 30 нт, примерно от 15 до 25 нт или примерно 20-25 нуклеотидов.

Выбор подходящих олигонуклеотидов проводят с помощью компьютерных программ, которые автоматически выравнивают нуклеотидные последовательности и указывают участки идентичности или гомологии. Такие программы используют для сравнения нуклеотидных последовательностей, полученных, например, в результате поиска в базах данных, таких как GenBank, или в результате секвенирования продуктов ПЦР. Сравнение нуклеотидных последовательностей, полученных из ряда видов, позволяет выбирать нуклеотидные последовательности, которые обладают подходящей степенью идентичности среди видов. В случае не секвенированных генов проводят саузерн-блоттинг, чтобы определить степень идентичности генов целевых видов и других видов. Путем проведения саузерн-блоттинга в условиях разной жесткости, хорошо известных в данной области, можно определить примерную величину идентичности. Указанные процедуры позволяют проводить отбор олигонуклеотидов, которые обладают высокой степенью комплементарности по отношению к целевым нуклеотидным последовательностям субъекта, подлежащим регулированию, и низкой степенью комплементарности по отношению к нуклеотидным последовательностям, полученным из других видов. Для специалиста в данной области будет очевидно, что существует очень широкая свобода действий при выборе подходящих участков генов для применения в настоящем изобретении.

Под "каталитической РНК" подразумевается молекула РНК с ферментативной активностью (Cech, 1988 J. American. Med. Assoc. 260, 3030-3035). Действие каталитических нуклеиновых кислот (рибозимы) включает в себя вначале связывание с РНК-мишенью. Такое связывание происходит за счет мишень-связывающего фрагмента каталитической нуклеиновой кислоты, который находится в непосредственной близости от каталитического фрагмента молекулы, осуществляющего расщепление РНК-мишени. Таким образом, каталитическая нуклеиновая кислота вначале распознает РНК-мишень и затем связывается с ней путем спаривания оснований, и после связывания с нужным участком указанная нуклеиновая кислота действует как фермент, расщепляя РНК-мишень.

Термин "РНК-ловушка" относится к молекуле РНК, которая имитирует природный связывающий домен для лиганда. Следовательно, РНК-ловушка конкурирует с природной связывающей мишенью за связывание со специфическим лигандом. Например, показано, что при сверхэкспрессии РНК трансактивационного ответа (TAR) ВИЧ может действовать как "ловушка", эффективно связывая белок tat ВИЧ и предотвращая посредством этого его связывание с последовательностями TAR, кодируемыми РНК ВИЧ (Sullenger et ah, 1990, Cell, 63, 601-608). Это конкретный пример. Специалистам в данной области будет ясно, что данный пример не является единственным, и что другие воплощения можно легко сгенерировать с помощью широко известных в данной области методов.

В данном описании термин "мономеры" обычно обозначает мономеры, связанные фосфодиэфирными связями или их аналогами, образующие олигонуклеотиды, размер которых варьирует от нескольких мономерных единиц, например, примерно от 3-4, до нескольких сотен мономерных единиц. Аналоги фосфодиэфирных связей включают в себя: фосфоротиоат, фосфородитиоат, метилфосфонаты, фосфороселеноат, фосфорамидат и т.п., как более подробно описано ниже.

В контексте настоящего изобретения термины "нуклеиновое основание" и "нуклеотид" или "нуклеозид" используются как взаимозаменяемые и охватывают природные нуклеиновые основания и неприродные нуклеиновые основания. Специалистам в данной области известно, что разные нуклеиновые основания, которые ранее считались "неприродными", впоследствии были обнаружены в природе. Таким образом, термин "нуклеиновое основание" включает в себя не только пуриновые и пиримидиновые гетероциклы, но и их гетероциклические аналоги и таутомеры. Иллюстративные примеры нуклеиновых оснований включают в себя аденин, гуанин, тимин, цитозин, урацил, пурин, ксантин, диаминопурин, 8-оксо-N6-метиладенин, 7-деазаксантин, 7-деазагуанин, N4,N4- этаноцитозин, N6,N6-этано-2,6-диаминопурин, 5-метилцитозин, 5-(C3-C6)-алкинилцитозин, 5-фторурацил, 5-бромурацил, псевдоизоцитозин, 2-гидрокси-5-метил-4-триазолопиридин, изоцитозин, изогуанин, инозин, а "неприродные" нуклеиновые основания описаны в Benner et al., патент США № 5432272. Подразумевается, что термин "нуклеиновое основание" охватывает каждый из приведенных примеров и все приведенные примеры, а также их аналоги и таутомеры. Особый интерес с точки зрения терапевтического и диагностического применения у людей вызывают такие нуклеиновые основания, как аденин, гуанин, тимин, цитозин и урацил, которые считаются природными нуклеиновыми основаниями. Термин "нуклеозид" включает в себя природные нуклеозиды, в том числе 2'-дезоксильные и 2'-гидроксильные формы, например, описанные в Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992).

Термин "аналоги" в отношении к нуклеозидам включает в себя синтетические нуклеозиды, содержащие модифицированные основные фрагменты и/или модифицированные сахарные фрагменты, например, описанные в общих чертах Scheit, Nucleotide Analogs, John Wiley, New York, 1980; Freier & Altmann, Nucl. Acid. Res., 1997, 25(22), 4429-4443, Toulme, J.J., Nature Biotechnology 19:17-18 (2001); Manoharan M., Biochemica et Biophysica Acta 1489:117-139(1999); Freier S. M., Nucleic Acid Research, 25:4429-4443 (1997), Uhlman, E., Drug Discovery & Development, 3: 203-213 (2000), Herdewin P., Antisense & Nucleic Acid Drug Dev., 10:297-310 (2000)); 2'-O,3'-C-связанные [3.2.0] бициклоарабинонуклеозиды (см., например N. K Christiensen., et al, J. Am. Chem. Soc, 120: 5458-5463 (1998). Такие аналоги включают в себя синтетические нуклеозиды, сконструированные с целью улучшения связывающих свойств, например, стабильности дуплекса или триплекса, специфичности или т.п.

В данном описании термин "гибридизация" относится к спариванию по существу комплементарных цепей олигомерных соединений. Механизм спаривания включает в себя образование водородных связей между комплементарными нуклеозидными или нуклеотидными основаниями (нуклеиновые основания), которые могут представлять собой уотсон-криковские пары оснований, хугстиновские пары оснований или обратные хугстиновские пары оснований. Например, аденин и тимин являются комплементарными нуклеиновыми основаниями, которые спариваются посредством образования водородных связей. Гибридизация может происходить в разных условиях.

Антисмысловое соединение "специфически гибридизуется", если связывание соединения с нуклеиновой кислотой-мишенью препятствует нормальному функционированию нуклеиновой кислоты-мишени, приводя к модуляции ее функции и/или активности, и существует степень комплементарности, достаточная для того, чтобы избежать неспецифического связывания антисмыслового соединения с нуклеотидными последовательностями-не мишенями в условиях, в которых желательно образование специфического связывания, т.е. в физиологических условиях в случае анализов in vivo или терапевтического лечения, и в условиях проведения анализов in vitro.

В данном описании фраза "жесткие условия гибридизации" или "жесткие условия" относится к условиям, в которых соединение данного изобретения гибридизуется с последовательностью-мишенью и с минимальным числом других последовательностей. Жесткие условия являются последовательность-зависимыми и могут различаться в зависимости от обстоятельств, например, в контексте данного изобретения "жесткие условия", в которых олигомерные соединения гибридизуются с последовательностью-мишенью, зависят от природы и состава олигомерных соединений и методов анализа, используемых для исследования данных соединений. Как правило, жесткие условия гибридизации включают в себя низкие концентрации (<0,15M) солей, содержащих неорганические катионы, такие как Na++ или K++ (т. е., низкую ионную силу), температуру выше 20°C-25°C и ниже Тпл комплекса олигомерное соединение:последовательность-мишень, и присутствие денатурирующих средств, таких как формамид, диметилформамид, диметилсульфоксид или детергента додецилсульфата натрия (SDS). Например, степень гибридизации уменьшается на 1,1% с каждым 1% формамида. Примером условий высокой жесткости гибридизации является 0,1X натрий хлорид-натрий цитратный буфер (SSC)/0,1% (масс./об.) SDS при 60ºC в течение 30 минут.

Термин "комплементарность" в данном описании обозначает способность к точному спариванию двух оснований, находящихся на одной или двух олигомерных цепях. Например, если нуклеиновое основание в определенном положении антисмыслового соединения способно образовывать водородные связи с нуклеиновым основанием в определенном положении нуклеиновой кислоты-мишени, где указанная нуклеиновая кислота-мишень представляет собой ДНК, РНК или молекулу олигонуклеотида, то положение водородной связи между олигонуклеотидом и нуклеиновой кислотой-мишенью считается комплементарным положением. Олигомерное соединение и другая молекула ДНК, РНК или олигонуклеотида являются комплементарными друг другу, если достаточное число комплементарных положений в каждой молекуле занято нуклеиновыми основаниями, которые могут образовывать друг с другом водородные связи. Таким образом, термины "способный к специфической гибридизации" и "комплементарный" используются для обозначения достаточной степени точного спаривания или комплементарности достаточного числа нуклеиновых оснований, что обеспечивает стабильное и специфическое связывание олигомерного соединения и нуклеиновой кислоты-мишени.

В данной области известно, что последовательность олигомерного соединения способна к специфической гибридизации, если она на 100% комплементарна нуклеиновой кислоте-мишени. Кроме того, олигонуклеотид может гибридизоваться на протяжении одного или более сегментов, так что находящиеся между ними или соседние сегменты не участвуют в событиях гибридизации (например, в случае петлеобразной структуры, несовпадающей структуры или шпилькообразной структуры). Олигомерные соединения настоящего изобретения содержат последовательность, которая по меньшей мере примерно на 70%, или по меньшей мере примерно на 75%, или по меньшей мере примерно на 80%, или по меньшей мере примерно на 85%, или по меньшей мере примерно на 90%, или по меньшей мере примерно на 95%, или по меньшей мере примерно на 99% комплементарна последовательности целевого участка нуклеиновой кислоты-мишени, против которой они направлены. Например, антисмысловое соединение, 18 из 20 нуклеотидов которого комплементарны целевому участку и, следовательно, способны гибридизоваться с ним, обладает 90 процентной комплементарностью. В данном примере остальные некомплементарные нуклеотиды могут быть собраны в группы или рассеяны среди комплементарных нуклеотидов, они могут не быть смежными по отношению друг к другу или к комплементарным нуклеотидам. Как таковое, антисмысловое соединение, которое, имея длину 18 нуклеотидов, содержит 4 (четыре) некомплементарных нуклеотида, фланкируемых двумя участками, полностью комплементарными нуклеиновой кислоте-мишени, обладает общей комплементарностью 77,8% по отношению к нуклеиновой кислоте-мишени и, следовательно, входит в объем настоящего изобретения. Процент комплементарности антисмыслового соединения участку нуклеиновой кислоты-мишени можно определить стандартным способом с использованием известных в данной области программ BLAST (средство поиска основного локального выравнивания) и PowerBLAST (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Процент гомологии, идентичности или комплементарности последовательностей можно определить, например, с помощью программы Gap (Пакет для анализа последовательностей Wisconsin, версия 8 для Unix, Genetics Computer Group, University Research Park, Madison Wis.), используя параметры по умолчанию алгоритма Смита-Ватермана (Adv. Appl. Math., 1981, 2, 482-489).

В данном описании термин "температура плавления (Тпл)" относится к температуре, при которой 50% олигонуклеотидов, комплементарных последовательности-мишени, гибридизуются с последовательностью-мишенью в состоянии равновесия в условиях определенной ионной силы, pH, и концентрации нуклеиновой кислоты. Поскольку последовательности-мишени обычно присутствуют в избытке, при Тпл 50% олигонуклеотидов встречаются в состоянии равновесия). Как правило, жесткие условия включают в себя концентрацию соли, составляющую по меньшей мере примерно от 0,01 до 1,0 M ионов Na (или других солей) при pH от 7,0 до 8,3, и температуру, составляющую по меньшей мере примерно 30°C для коротких олигонуклеотидов (например, содержащих от 10 до 50 нуклеотидов). Жесткие условия также включают в себя применение дестабилизирующих средств, таких как формамид.

В данном описании термин "модуляция" означает либо увеличение (стимуляция), либо уменьшение (ингибирование) экспрессии гена.

Термин "вариант" в контексте полинуклеотидной последовательности может относиться к полинуклеотидной последовательности, родственной гену дикого типа. Данное определение также может включать в себя, например, "аллельные", "сплайсинговые", "видовые" или "полиморфные" варианты. Сплайсинговый вариант может обладать значительной идентичностью по отношению к молекуле сравнения, однако он содержит большее или меньшее число полинуклеотидов вследствие альтернативного сплайсинга экзонов при процессинге мРНК. Соответствующий полипептид может содержать дополнительные функциональные домены, или в нем могут отсутствовать такие домены. Видовые варианты представляют собой полинуклеотидные последовательности, варьирующие от одного вида к другому. Особое значение в настоящем изобретении имеют варианты продуктов гена дикого типа. Варианты могут образовываться в результате, по меньшей мере, одной мутации в нуклеотидной последовательности и могут приводить к синтезу измененных мРНК или полипептидов, у которых может быть необязательно изменена структура или функция. Любой конкретный природный или рекомбинантный ген может не иметь аллельных форм, или он может иметь одну или более аллельных форм. Распространенные мутационные изменения, которые приводят к образованию вариантов, как правило, обусловлены природными делециями, добавлениями или заменами нуклеотидов. Каждый из указанных типов изменений может встречаться по отдельности или в сочетании с другими, один или более раз на протяжении конкретной последовательности.

Полученные полипептиды обычно обладают значительной аминокислотной идентичностью по отношению друг к другу. Полиморфные варианты представляют собой вариации полинуклеотидной последовательности конкретного гена у субъектов определенного вида. Полиморфные варианты также могут включать в себя "однонуклеотидные полиморфизмы" (SNP) или одноосновные мутации, которые приводят к изменению полинуклеотидной последовательности по одному основанию. Присутствие SNP может указывать, например, на наличие некоторой популяции с предрасположенностью к болезненному состоянию, то есть, на чувствительность вместо устойчивости.

Производные полинуклеотидов включают в себя нуклеиновые кислоты, подвергшиеся химической модификации, такой как замена водорода на алкил, ацил или аминогруппу. Производные, например, производные олигонуклеотидов, могут содержать неприродные фрагменты, такие как измененные сахарные фрагменты или междусахарные связи. Их примерами являются фосфоротиоат и другие серосодержащие элементы, известные в данной области. Производные нуклеиновых кислот также могут содержать метки, включающие в себя радионуклеотиды, ферменты, флуоресцентные агенты, хемилюминесцентные агенты, хромогенные агенты, субстраты, кофакторы, ингибиторы, магнитные частицы и т.п.

"Производное" полипептида или пептида представляет собой соединение, модифицированное, например, путем гликозилирования, пэгилирования, фосфорилирования, сульфатирования, восстановления/алкилирования, ацилирования, химической конденсации или обработки слабым раствором формалина. Производное также можно модифицировать путем введения непосредственно или косвенно детектируемой метки, включающей в себя, без ограничения, радиоизотопную, флуоресцентную и ферментную метку.

В данном описании термин "животное" или "пациент" включает в себя, например, людей, овец, лосей, оленей, чернохвостых оленей, норок, млекопитающих, обезьян, лошадей, крупный рогатый скот, свиней, коз, собак, кошек, крыс, мышей, птиц, кур, рептилий, рыб, насекомых и паукообразных.

Термин "млекопитающее" охватывает теплокровных животных, которые обычно подлежат медицинскому обслуживанию (например, люди и домашние животные). Примеры включают в себя кошек, собак, лошадей, коров и людей, или только людей.

Термин "лечение" относится к лечению болезненного состояния у млекопитающего, которое включает в себя: (a) предотвращение болезненного состояния у млекопитающего, в частности, если такое млекопитающее предрасположено к болезненному состоянию, но еще не имеет диагноза, свидетельствующего о наличии такого состояния; (b) ингибирование болезненного состояния, например, остановка его развития; и/или (c) облегчение болезненного состояния, например, инициация регрессии болезненного состояния до достижения желательного результата. Лечение также включает в себя улучшение симптома заболевания (например, уменьшение боли или дискомфорта), где такое улучшение необязательно оказывает непосредственное влияние на заболевание (например, причина, передача, экспрессия и другие).

Композиции и молекулы полинуклеотидов и олигонуклеотидов

Липопротеин высокой плотности (HDL) захватывает избыточный холестерин в крови и возвращает его в печень. Липопротеин низкой плотности (или LDL) является основным транспортером холестерина в организме. Однако чрезмерно повышенный в течение многих лет уровень LDL может привести к атеросклерозу (сужению и отверждению артерий) и вызвать болезнь сердца или инфаркт миокарда. Отношение определяют путем деления холестерина LDL на холестерин HDL. Например, если у субъекта уровень холестерина HDL составляет 50 мг/дл, а уровень холестерина LDL составляет 150 мг/дл, отношение HDL/LDL равно 0,33. Желательно, чтобы отношение HDL/LDL было выше 0,3, а идеальное отношение HDL/LDL превышает 0,4.

Мишени: в одном воплощении мишени представляют собой нуклеотидные последовательности аполипопротеина (ApoA1), включающие в себя, без ограничения, смысловые и/или антисмысловые некодирующие и/или кодирующие последовательности, связанные с ApoA. Человеческий аполипопротеин A-I (ApoA-I) является основным белковым компонентом липопротеинов высокой плотности (HDL и лимфатических хиломикронов). В человеческой плазме циркулируют четыре основных липопротеина: хиломикроны (CM), липопротеины очень низкой плотности (VLDL), липопротеины низкой плотности (LDL) и липопротеины высокой плотности (HDL). HDL участвуют в удалении холестерина из периферических тканей путем транспортировки их в печень или к другим липопротеинам.

HDL синтезируются de novo в печени и в тонком кишечнике в виде обогащенных белком дискообразных частиц. Первичными апопротеинами HDL являются apoA-I, apoA-II, apoC-I, apoC-II и apoE. Новообразованные HDL содержат очень мало холестерина и эфиров холестерина. В результате накопления эфиров холестерина в нейтральном ядре липопротеиновой частицы форма HDL меняется с дискообразной на сферическую. HDL накапливают холестерин из остатков хиломикронов и из остатков VLDL (также называемых липопротеины промежуточной плотности или IDL) и непосредственно из мембран клеточной поверхности. Этерификация холестерина происходит под действием HDL-ассоциированного фермента лецитин-холестерин ацилтрансферазы ("LCAT"). Чтобы осуществить перенос жирной кислоты из лецитина (фосфатидилхолин) на C-3-OH-группу холестерина, требуется взаимодействие LCAT с ApoA-I, находящимся на поверхности HDL. По мере накопления в ядре эфиров холестерина новообразованные HDL превращаются в HDL2 и HDL3. См. R. I. Levy et al., "The structure, function and metabolism of high-density lipoproteins: A status report," Circulation, vol. 62, pp. IV4-8 (1980); and D. I. Silverman et al., "High-density lipoprotein sub fractions," Am. J. Med., vol. 94, pp. 636-45 (1993).

HDL обычно выделяют из плазмы путем ультрацентрифугирования. Нормальные HDL, плотность которых варьирует от 1,063 г/мл до 1,21 г/мл, ориентировочно подразделяют на две группы, HDL2 (плотность от 1,063 г/мл до 1,125 г/мл) и HDL3 (плотность от 1,125 г/мл до 1,21 г/мл). Позднее две основные популяции частиц HDL были идентифицированы методом двухмерного электрофореза с последующими иммуноблоттингом и иммуноферментным твердофазным анализом с дифференциальным окрашиванием антителами. Одна из этих популяций состоит из частиц, содержащих только apoA-I, а другая популяция состоит из частиц, содержащих как apoA-I, так и apoA-II. Относительная доля частиц apoA-I выше во фракции HDL2, тогда как HDL3 в основном содержит сочетание apoA-I и apoA-II. См. J. C. Fruchart et al., "Apolipoprotein A-containing lipoprotein particles: physiological role, quantification, and clinical significance," Clin. Chem., vol. 38, pp. 793-7 (1992); and B. F. Asztalos et al., "Normolipidemic subjects with low HDL холестерин levels have altered HDL subpopulations," Arterioscler. Thromb. Vase. Biol., vol. 17, pp. 1885-1893 (1997).

Человеческий аполипопротеин A-I (ApoA-I) является основным белковым компонентом HDL и лимфатических хиломикронов. ApoA-I первоначально синтезируется в печени и в тонком кишечнике в виде белка-предшественника (препроапо A-I). Внутри клетки препроапо A-I расщепляется с образованием проапо A-I, формы, секретируемой в плазму и лимфу. В плазме от проапо A-I отщепляется шесть аминокислот и образуется зрелый ApoA-I.

Зрелый ApoA-I представляет собой одиночный негликозилированный полипептид с известной последовательностью, состоящий из 243 аминокислот. ApoA-I служит кофактором плазматического фермента (лецитин-холестерин ацилтрансферазы (LCAT)), отвечающего за образование большинства эфиров холестерина в плазме. Уменьшение уровня ApoA-I может привести к нарушению системы плазматического транспорта липидов и к развитию коронарной болезни сердца. Показано, что низкие уровни ApoA-I и HDL являются фактором высокого риска развития инфаркта миокарда и других атеросклеротических сосудистых заболеваний. См. патенты США №№ 5059528 и 6258596.

В предпочтительных воплощениях антисмысловые олигонуклеотиды используют для предотвращения или лечения заболеваний или нарушений, связанных с аполипопротеинами, липопротеинами высокой плотности. Примеры заболеваний, которые можно лечить антисмысловыми соединениями, включают в себя высокий холестерин, отношение HDL/LDL, артрит, болезнь сердца, болезнь Танжера, системный не невропатический амилоидоз, другие амилоидные заболевания, болезнь Альцгеймера, болезнь Паркинсона, диабет, сердечно-сосудистые заболевания, рак, ожирение, атеросклероз, данные соединения также можно использовать для ингибирования роста опухоли, зависимого от ангиогенеза, и уменьшения числа сосудов, образованных опухолью. Они являются эффективными при лечении нераковых заболеваний, симптомы которых включают в себя увеличение ангиогенеза, например, псориаза, ретинопатии недоношенных, реваскуляризационной глаукомы, диабетической ретинопатии, ревматоидного артрита, ожирения и псориаза.

В предпочтительном воплощении олигонуклеотиды являются специфичными к полинуклеотидам ApoA, которые включают в себя, без ограничения, некодирующие участки. Мишени-ApoA1 включают в себя варианты ApoA; мутанты ApoA, в том числе SNP; некодирующие последовательности ApoA; аллели, фрагменты и т.п. Предпочтительно олигонуклеотид представляет собой антисмысловую молекулу РНК.

В соответствии с воплощениями данного изобретения молекула нуклеиновой кислоты-мишени не ограничивается полинуклеотидами ApoA 1, но включает в себя все изоформы, рецепторы, гомологи, некодирующие участки ApoA и т.п.

В другом предпочтительном воплощении олигонуклеотид направлен на природную антисмысловую последовательность (природную антисмысловую по отношению к кодирующим и некодирующим участкам) мишеней ApoA1, включающих в себя, без ограничения, варианты, аллели, гомологи, мутанты, производные, фрагменты и комплементарные им последовательности. Предпочтительно олигонуклеотид представляет собой антисмысловую молекулу РНК.

В другом предпочтительном воплощении олигомерные соединения настоящего изобретения также включают в себя варианты, которые содержат другое основание в одном или более нуклеотидных положениях соединения. Например, если первый нуклеотид представляет собой аденозин, можно получить варианты, которые содержат тимидин, гуанозин или цитидин в данном положении. Такую замену можно осуществить по любому положению антисмыслового соединения. Затем указанные соединения тестируют с использованием методов, описанных в данном документе, чтобы определить их способность ингибировать экспрессию нуклеиновой кислоты-мишени.

В некоторых воплощениях гомология, идентичность и комплементарность последовательностей антисмыслового соединения и соединения-мишени составляет примерно от 50% до 60%. В некоторых воплощениях гомология, идентичность и комплементарность последовательностей составляет примерно от 60% до 70%. В некоторых воплощениях гомология, идентичность и комплементарность последовательностей составляет примерно от 70% до 80%. В некоторых воплощениях гомология, идентичность и комплементарность последовательностей составляет примерно от 80% до 90%. В некоторых воплощениях гомология, идентичность и комплементарность последовательностей составляет примерно 90%, примерно 92%, примерно 94%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или примерно 100%.

Антисмысловое соединение способно к специфической гибридизации, если связывание соединения с нуклеиновой кислотой-мишенью препятствует нормальному функционированию нуклеиновой кислоты-мишени и вызывает уменьшение активности, и если существует достаточная степень комплементарности, позволяющая избежать неспецифического связывания антисмыслового соединения с нуклеотидными последовательностями-не мишенями в условиях, в которых желательно достичь специфического связывания. Такие условия включают в себя, например, физиологические условия в случае анализов in vivo или терапевтического лечения, и условия проведения анализов в случае анализов in vitro

Антисмысловое соединение, независимо от того, представляет ли оно собой ДНК, РНК, химерное соединение, замещенное соединение и другие, способно к специфической гибридизации, если связывание соединения с целевой молекулой ДНК или РНК препятствует нормальному функционированию целевой ДНК или РНК и вызывает уменьшение активности, и если существует достаточная степень комплементарности, позволяющая избежать неспецифического связывания антисмыслового соединения с последовательностями-не мишенями в условиях, в которых желательно достичь специфического связывания, т.е. в физиологических условиях в случае анализов in vivo или терапевтического лечения, и в условиях проведения анализов, в случае анализов in vitro.

В другом предпочтительном воплощении таргетирование ApoA1, включающее в себя, без ограничения, антисмысловые последовательности, идентифицированные и размноженные, например, с помощью методов ПЦР, гибридизации и других, одну или более из последовательностей, описанных в SEQ ID NO: 81-173, и т.п., модулирует экспрессию или функцию ApoA. В одном воплощении экспрессия или функция подвергается повышающей регуляции по сравнению с контролем. В другом предпочтительном воплощении экспрессия или функция подвергается понижающей регуляции по сравнению с контролем.

В другом предпочтительном воплощении олигонуклеотиды содержат нуклеотидные последовательности, описанные как SEQ ID NO: 81-173, включающие в себя антисмысловые последовательности, идентифицированные и размноженные, например, с помощью методов ПЦР, гибридизации и других. Указанные олигонуклеотиды могут содержать один или более модифицированных нуклеотидов, более короткие или более длинные фрагменты, модифицированные связи и т.п. Примеры модифицированных связей или межнуклеотидных связей включают в себя фосфоротиоат, фосфородитиоат и т.п. В другом предпочтительном воплощении нуклеотиды включают в себя фосфорсодержащее производное. Фосфорсодержащее производное (или модифицированная фосфатная группа), которое можно присоединить к фрагменту сахара или аналога сахара в модифицированных олигонуклеотидах настоящего изобретения, может представлять собой монофосфат, дифосфат, трифосфат, алкилфосфат, алканфосфат, фосфоротиоат и т.п. Как таковые, способы получения вышеуказанных аналогов фосфата и способы их включения в нуклеотиды, модифицированные нуклеотиды и олигонуклеотиды, также являются известными и не нуждаются в описании в данном документе.

Специфичность и чувствительность антисмыслового соединения также корректируются специалистами в данной области для терапевтического применения. Антисмысловые олигонуклеотиды используют в виде терапевтических фрагментов для лечения болезненных состояний у животных и людей. Антисмысловые олигонуклеотиды можно безопасно и эффективно вводить людям и в настоящее время проводятся многочисленные клинические испытания. Таким образом, установлено, что олигонуклеотиды могут являться полезными терапевтическими средствами, структуру которых можно изменить, чтобы приспособить их для режимов лечения, применяющихся для клеток, тканей и животных, особенно людей.

В воплощениях настоящего изобретения олигомерные антисмысловые соединения, особенно олигонуклеотиды, связываются с молекулами нуклеиновой кислоты-мишени и модулируют экспрессию и/или функцию молекул, кодируемых целевым геном. Функции ДНК, которые подлежат подавлению, включают в себя, например, репликацию и транскрипцию. Функции РНК, которые подлежат подавлению, включают в себя все жизненно важные функции, такие как, например, транслокация РНК в участок трансляции белка, трансляция белка с РНК, сплайсинг РНК с образованием одного или более видов мРНК, и каталитическую активность, которая может опосредоваться или обеспечиваться РНК. В зависимости от вида функций, они могут подвергаться повышающей регуляции или ингибированию.

Антисмысловые соединения включают в себя антисмысловые олигомерные соединения, антисмысловые олигонуклеотиды, олигонуклеотиды внешней вспомогательной последовательности (EGS), продукты альтернативного сплайсинга, праймеры, зонды и другие олигомерные соединения, которые гибридизуются, по меньшей мере, с частью нуклеиновой кислоты-мишени. Как таковые, указанные соединения можно вводить в виде одноцепочечных, двухцепочечных, частично одноцепочечных или циклических олигомерных соединений.

Таргетирование антисмыслового соединения на конкретную молекулу нуклеиновой кислоты в контексте данного изобретения может представлять собой многостадийный процесс. Процесс обычно начинается с идентификации нуклеиновой кислоты-мишени, функция которой подлежит модуляции. Данная нуклеиновая кислота-мишень может представлять собой, например, клеточный ген (или мРНК, транскрибируемую из данного гена), экспрессия которого связана с конкретным нарушением или болезненным состоянием, или молекулу нуклеиновой кислоты возбудителя инфекции. В соответствии с настоящим изобретением нуклеиновая кислота-мишень кодирует аполипопротеин (ApoA1).

Процесс таргетирования, как правило, также включает в себя определение, по меньшей мере, одного целевого участка, сегмента или сайта нуклеиновой кислоты-мишени, взаимодействие которого с антисмысловым соединением приводит к желательному эффекту, например, к модуляции экспрессии. В контексте настоящего изобретения термин "участок" определяют как часть нуклеиновой кислоты-мишени, имеющую, по меньшей мере, одну опознаваемую структуру, функцию или характеристику. Участки нуклеиновых кислот-мишеней включают в себя сегменты. "Сегменты" определяют как более мелкие части или субфрагменты участков нуклеиновой кислоты-мишени. "Сайты" в соответствии с настоящим изобретением определяют как положения нуклеиновой кислоты-мишени.

В предпочтительном воплощении антисмысловые олигонуклеотиды связываются с природной антисмысловой последовательностью аполипопротеина (ApoA1) и модулируют экспрессию и/или функцию аполипопротеина (ApoA1) (SEQ ID NO: 1). Примеры антисмысловой последовательности включают в себя SEQ ID NOS: 2, 81-173 (ApoA1). Другие примеры включают в себя антисмысловые олигонуклеотиды, содержащие коровую последовательность gctagt (SEQ ID NO: 175), такие как олигонуклеотиды SEQ ID NO 60-69 и 172.

В другом предпочтительном воплощении антисмысловые олигонуклеотиды связываются с одним или более сегментами полинуклеотидов аполипопротеина (ApoA1) и модулируют экспрессию и/или функцию аполипопротеина (ApoA1). Сегменты содержат, по меньшей мере, пять последовательных нуклеотидов смысловых или антисмысловых полинуклеотидов аполипопротеина (ApoA1).

В другом предпочтительном воплощении антисмысловые олигонуклеотиды являются специфичными к природной антисмысловой последовательности аполипопротеина (ApoA1), где связывание олигонуклеотидов с природной антисмысловой последовательностью аполипопротеина (ApoA1) модулирует экспрессию и/или функцию аполипопротеина (ApoA1).

В другом предпочтительном воплощении олигонуклеотидные соединения включают в себя последовательности, описанные как SEQ ID NO: 3-173, антисмысловые последовательности, идентифицированные и размноженные с помощью, например, методов ПЦР, гибридизации и других. Указанные олигонуклеотиды могут содержать один или более модифицированных нуклеотидов, более короткие или более длинные фрагменты, модифицированные связи и т.п. Примеры модифицированных связей или межнуклеотидных связей включают в себя фосфоротиоат, фосфородитиоат и т.п. В другом предпочтительном воплощении нуклеотиды включают в себя фосфорсодержащее производное. Фосфорсодержащее производное (или модифицированная фосфатная группа), которое может быть присоединено к фрагменту сахара или аналога сахара в модифицированных олигонуклеотидах настоящего изобретения, может представлять собой монофосфат, дифосфат, трифосфат, алкилфосфат, алканфосфат, фосфоротиоат и т.п. Как таковые, способы получения вышеуказанных аналогов фосфата и способы их включения в нуклеотиды, модифицированные нуклеотиды и олигонуклеотиды, также являются известными и не нуждаются в описании в данном документе.

Поскольку, как известно в данной области, кодон инициации трансляции обычно представляет собой 5'-AUG (в молекуле транскрибируемой мРНК; 5'-ATG в соответствующей молекуле ДНК), кодон инициации трансляции также называют "кодон AUG", "старт-кодон" или "старт-кодон AUG". Меньшая часть генов имеет кодон инициации трансляции с РНК-последовательностью 5'-GUG, 5'-UUG или 5'-CUG; и показано, что in vivo функционируют 5'-AUA, 5'-ACG и 5'-CUG. Таким образом, термины "кодон инициации трансляции" и "старт-кодон" охватывают кодоны с разными последовательностями, даже хотя инициирующая аминокислота в каждом случае обычно представляет собой метионин (у эукариотов) или формилметионин (у прокариотов). Эукариотические и прокариотические гены могут содержать два или более альтернативных старт-кодона, любой из которых может предпочтительно использоваться для инициации трансляции в клетке или ткани конкретного типа, или при конкретном наборе условий. В контексте данного изобретения термины "старт-кодон" и "кодон инициации трансляции" относятся к кодону или кодонам, которые используются in vivo для инициации трансляции мРНК, транскрибируемой с гена, кодирующего аполипопротеин (ApoA1), независимо от последовательности (последовательностей) таких кодонов. Кодон терминации трансляции (или "стоп-кодон") гена может иметь одну из трех последовательностей 5'-UAA, 5'-UAG и 5'-UGA (для последовательности ДНК 5'-TAA, 5'-TAG и 5'-TGA, соответственно).

Термины "участок старт-кодона" и "участок кодона инициации трансляции" относится к фрагменту мРНК или гена, который содержит примерно от 25 до 50 последовательных нуклеотидов в любом направлении (т.е. 5' или 3') от кодона инициации трансляции. Подобным образом, термины "участок стоп-кодона" и "участок кодона терминации трансляции" относятся к фрагменту мРНК или гена, который содержит примерно от 25 до 50 последовательных нуклеотидов в любом направлении (т. е., 5' или 3') от кодона терминации трансляции. Следовательно, "участок старт-кодона" (или "участок кодона инициации трансляции") и "участок стоп-кодона" (или "участок кодона терминации трансляции") представляют собой участки, которые могут являться эффективными мишенями для антисмысловых соединений настоящего изобретения.

Открытая рамка считывания (ORF) или "кодирующий участок", который, как известно в данной области, относится к участку, находящемуся между кодоном инициации трансляции и кодоном терминации трансляции, также может являться эффективной мишенью. В контексте настоящего изобретения целевой участок представляет собой внутригенный участок, включающий в себя кодон инициации или терминации транскрипции открытой рамки считывания (ORF) гена.

Другой целевой участок включает в себя 5'-нетранслируемый участок (5'UTR), который, как известно в данной области, представляет собой фрагмент мРНК, располагающийся в 5'-направлении от кодона инициации трансляции и, следовательно, включает в себя нуклеотиды между 5'-сайтом кэпирования и кодоном инициации трансляции мРНК (или соответствующие нуклеотиды гена). Другой целевой участок включает в себя 3'-нетранслируемый участок (3'UTR), который, как известно в данной области, представляет собой фрагмент мРНК, располагающийся в 3'-направлении от кодона терминации трансляции и, следовательно, включает в себя нуклеотиды между кодоном терминации трансляции и 3'-концом мРНК (или соответствующие нуклеотиды гена). 5'-сайт кэпирования мРНК содержит остаток N7-метилированного гуанозина, присоединенный к последнему остатку 5'-конца мРНК посредством 5'-5'-трифосфатной связи. Считается, что 5'-участок кэпирования мРНК включает в себя саму структуру 5'-кэпирования, а также первые 50 нуклеотидов, присоединенные к сайту кэпирования. Другой целевой участок данного изобретения представляет собой участок 5'-кэпирования.

Хотя некоторые транскрипты эукариотических мРНК транслируются непосредственно, многие из них содержат один или более участков, известных как "интроны", которые вырезаются из транскрипта перед трансляцией. Оставшиеся (и, следовательно, транслируемые) участки, называемые "экзоны", соединяются с образованием непрерывной последовательности мРНК. В одном воплощении направленность на сайты сплайсинга, т.е. на места соединений интрон-экзон или соединений экзон-интрон, является особенно полезной в тех ситуациях, когда заболевание опосредуется аберрантным сплайсингом или повышенной продукцией конкретного продукта сплайсинга. Аберрантные участки соединений, образующиеся вследствие реаранжировки или делеции, являются другим воплощением целевого участка. Транскрипты мРНК, полученные в результате сплайсинга двух (или более) мРНК из разных генных источников, называют "гибридные транскрипты". Интроны могут представлять собой эффективные мишени для антисмысловых соединений, направленных, например, на ДНК или пре-мРНК.

В другом предпочтительном воплощении антисмысловые олигонуклеотиды связываются с кодирующими и/или некодирующими участками целевого полинуклеотида и модулируют экспрессию и/или функцию молекулы-мишени.

В другом предпочтительном воплощении антисмысловые олигонуклеотиды связываются с природными антисмысловыми полинуклеотидами и модулируют экспрессию и/или функцию молекулы-мишени.

В другом предпочтительном воплощении антисмысловые олигонуклеотиды связываются со смысловыми полинуклеотидами и модулируют экспрессию и/или функцию молекулы-мишени.

Из одного геномного участка ДНК могут быть получены альтернативные транскрипты РНК. Указанные альтернативные транскрипты обычно называют "варианты". Более конкретно, "варианты пре-мРНК" представляют собой транскрипты, полученные из одной геномной ДНК, которые отличаются от других транскриптов, полученных из той же геномной ДНК, по положению старт- или стоп-кодонов и содержат как интронные, так и экзонные последовательности.

После вырезания в процессе сплайсинга одного или более экзонных или интронных участков, или их фрагментов, из вариантов пре-мРНК образуются "варианты мРНК" меньшего размера. Следовательно, варианты мРНК представляют собой преобразованные варианты пре-мРНК и каждый уникальный вариант пре-мРНК в результате сплайсинга всегда продуцирует уникальный вариант мРНК. Указанные варианты мРНК также известны как "альтернативные сплайсинговые варианты". Если вариант пре-мРНК не подвергается сплайсингу, то он идентичен варианту мРНК.

Варианты могут продуцироваться в результате применения альтернативных сигналов для инициации или завершения транскрипции. Пре-мРНК и мРНК могут содержать несколько старт- или стоп-кодонов. Варианты, образующиеся из пре-мРНК или мРНК в результате использования альтернативных старт-кодонов, известны как "альтернативные старт-варианты" пре-мРНК или мРНК. Транскрипты, образующиеся в результате использования альтернативных стоп-кодонов, известны как "альтернативные стоп-варианты" пре-мРНК или мРНК. Конкретным типом альтернативного стоп-варианта является "вариант полиА", который образуется в результате альтернативного выбора механизмом транскрипции одного из "стоп-сигналов полиА", который приводит к продукции транскриптов, терминация которых осуществляется по уникальным участкам полиА. В контексте данного изобретения типы описанных здесь вариантов также являются воплощениями нуклеиновых кислот-мишеней.

Положения в нуклеиновой кислоте-мишени, с которыми гибридизуются антисмысловые соединения, определяют как фрагмент целевого участка, содержащий, по меньшей мере, 5 нуклеиновых оснований, на который направлено активное антисмысловое соединение.

Хотя в данном документе описаны конкретные последовательности некоторых примеров целевых сегментов, специалисту в данной области следует понимать, что они служат для иллюстрации и описания конкретных воплощений в пределах объема настоящего изобретения. Исходя из настоящего описания рядовой специалист в данной области может легко идентифицировать другие целевые сегменты.

Для таргетирования также можно использовать целевые сегменты длиной 5-100 нуклеотидов, которые содержат участок, по меньшей мере, из пяти (5) последовательных нуклеотидов, выбранный из примеров предпочтительных целевых сегментов.

Целевые сегменты могут включать в себя последовательности ДНК или РНК, которые содержат, по меньшей мере, 5 последовательных нуклеотидов начиная от 5'-конца одного из примеров предпочтительных целевых сегментов (остальные нуклеотиды составляют непрерывную цепь той же ДНК или РНК, начинающуюся сразу за 5'-концом целевого сегмента и продолжающуюся вверх до тех пор, пока ДНК или РНК не будет содержать примерно от 5 до 100 нуклеотидов). Подобным образом, предпочтительные целевые сегменты представляют собой последовательности ДНК или РНК, которые содержат, по меньшей мере, 5 последовательных нуклеотидов начиная от 3'-конца одного из примеров предпочтительных целевых сегментов (остальные нуклеотиды составляют непрерывную цепь той же ДНК или РНК, начинающуюся сразу за 3'-концом целевого сегмента и продолжающуюся вниз до тех пор, пока ДНК или РНК не будет содержать примерно от 5 до 100 нуклеотидов). На основе описанных здесь целевых сегментов специалист в данной области может без излишнего экспериментирования идентифицировать другие предпочтительные целевые сегменты.

После идентификации одного или более целевых участков, сегментов или сайтов выбирают антисмысловые соединения, которые обладают достаточной степенью комплементарности по отношению к мишени, т.е. гибридизуются с ней с достаточной эффективностью и специфичностью, обеспечивая желательный эффект.

В воплощениях данного изобретения олигонуклеотиды связываются с антисмысловой последовательностью конкретной мишени. Олигонуклеотиды, которые содержат, по меньшей мере, 5 нуклеотидов в длину, синтезируют так, чтобы все олигонуклеотиды были направлены на перекрывающиеся последовательности, и чтобы синтезированные олигонуклеотиды охватывали всю длину целевого полинуклеотида. Мишени также включают в себя кодирующие и некодирующие участки.

В одном воплощении предпочтительно проводят таргетирование антисмысловых олигонуклеотидов на конкретные нуклеиновые кислоты-мишени. Таргетирование антисмыслового соединения на конкретную молекулу нуклеиновой кислоты представляет собой многостадийный процесс. Процесс обычно начинается с идентификации последовательности нуклеиновой кислоты, функция которой подлежит модуляции. Данная нуклеиновая кислота может представлять собой, например, клеточный ген (или мРНК, транскрибируемую из данного гена), экспрессия которого связана с конкретным нарушением или болезненным состоянием, или некодирующий полинуклеотид, такой как, например, некодирующая РНК (нкРНК).

РНК можно подразделить на (1) матричные РНК (мРНК), которые транслируются в белки, и (2) РНК, не кодирующие белки (нкРНК). нкРНК включают в себя микроРНК, антисмысловые транскрипты и другие единицы транскрипции (TU), которые характеризуются высокой плотностью стоп-кодонов и отсутствием сколько-нибудь протяженной "открытой рамки считывания". Многие нкРНК начинаются с сайтов инициации в 3'-нетранслируемых участках (3'UTR) кодирующих белок локусов. Многие нкРНК встречаются редко и, по меньшей мере, половина нкРНК, секвенированных консорциумом FANTOM, не подлежит полиаденилированию. Большая часть исследователей по очевидным причинам фокусирует свое внимание на полиаденилированных мРНК, которые после процессинга экспортируются в цитоплазму. Недавно было показано, что семейство не полиаденилированных ядерных РНК может быть очень большим, и что многие такие транскрипты образуются из так называемых межгенных участков (Cheng, J. et al. (2005) Transcriptional maps of 10 human chromosomes at 5-nucleotide resolution. Science 308 (5725), 1149-1154; Kapranov, P. et al. (2005). Примеры of the complex architecture of the human transcriptome revealed by RACE and high-density tiling arrays. Genome Res 15 (7), 987-997). Наиболее распространенный механизм, посредством которого нкРНК регулируют экспрессию генов, включает в себя спаривание оснований нкРНК и транскриптов-мишеней. РНК, которые функционируют путем спаривания оснований, можно подразделить на (1) цис-кодируемые РНК, которые кодируются тем же генным участком, что и РНК, на которые они действуют, но противоположной цепью, и, следовательно, обладают превосходной комплементарностью по отношению к мишени, и (2) транс-кодируемые РНК, которые кодируются хромосомным участком, отличным от участка, кодирующего РНК, на которые они действуют, и, как правило, не обладают идеальной способностью к спариванию оснований с основаниями мишеней.

Без связи с какой-либо теорией, авторы полагают, что разрушение антисмыслового полинуклеотида под действием описанных здесь антисмысловых олигонуклеотидов, может изменить экспрессию соответствующих смысловых матричных РНК. Однако данная регуляция может быть либо дискордантной (нокдаун антисмысловой последовательности приводит к увеличению уровня смыслового транскрипта) либо конкордантной (нокдаун антисмысловой последовательности приводит к уменьшению уровня сопутствующего смыслового транскрипта). В указанных случаях антисмысловые олигонуклеотиды, которые могут быть направлены на перекрывающиеся или не перекрывающиеся участки антисмысловой цепи, обуславливают нокдаун мишени. И кодирующие, и некодирующие антисмысловые последовательности, которые можно таргетировать одинаковыми способами, способны регулировать соответствующие смысловые транскрипты - либо в конкордантной, либо в дисконкордантной манере. В основе стратегии идентификации новых олигонуклеотидов, предназначенных для применения против мишени, лежит нокдаун антисмысловых транскриптов РНК под действием антисмысловых олигонуклеотидов или любые другие способы модуляции целевой мишени.

Стратегия 1: в случае дискордантной регуляции нокаутирование антисмыслового транскрипта повышает экспрессию традиционного (смыслового) гена. Если указанный ген кодирует известную или предполагаемую мишень лекарственного средства, то нокдаун его антисмыслового аналога потенциально может имитировать действие агониста рецептора или стимулятора фермента.

Стратегия 2: в случае конкордантной регуляции можно одновременно нокаутировать антисмысловой и смысловой транскрипты и в результате достичь синергическое уменьшение экспрессии традиционного (смыслового) гена. Если, например, нокдаун осуществляют с помощью антисмыслового олигонуклеотида, то в данной стратегии используют один антисмысловой олигонуклеотид, направленный против смыслового транскрипта, и другой антисмысловой олигонуклеотид, направленный против соответствующего антисмыслового транскрипта, или единственный энергетически симметричный антисмысловой олигонуклеотид, который одновременно направлен на перекрывающиеся смысловой и антисмысловой транскрипты.

В соответствии с настоящим изобретением антисмысловые соединения включают в себя антисмысловые олигонуклеотиды, рибозимы, олигонуклеотиды внешней вспомогательной последовательности (EGS), соединения миРНК, одно- или двухцепочечные соединения РНК-интерференции (РНКи), такие как соединения миРНК, и другие олигомерные соединения, которые гибридизуются, по меньшей мере, с частью нуклеиновой кислоты-мишени и модулируют ее функцию. Как таковые, они могут представлять собой ДНК, РНК, ДНК-подобные соединения, РНК-подобные соединения или их смеси, или они могут представлять собой миметики одного или более из указанных соединений. Указанные соединения могут представлять собой одноцепочечные, двухцепочечные, циклические или шпилькообразные олигомерные соединения и могут содержать такие структурные элементы, как внутренние или концевые выступы, несовпадения или петли. Антисмысловые соединения обычно получают в линейном виде, однако их можно соединить или получить другим способом в виде циклических и/или разветвленных соединений. Антисмысловые соединения могут включать в себя такие конструкции, как, например, две цепи, гибридизованные с образованием полностью или частично двухцепочечного соединения, или одна цепь с достаточной степенью самокомплементарности, обеспечивающей гибридизацию и образование полностью или частично двухцепочечного соединения. Две цепи могут быть соединены внутри, так что 3'- или 5'-конец остается свободным, или они могут быть соединены с образованием непрерывной шпилькообразной структуры или петли. Шпилькообразная структура может содержать липкий конец на 5'- или 3'-конце, позволяющий осуществлять удлинение одноцепочечной структуры. Двухцепочечные соединения необязательно могут содержать липкие концы. Дополнительные модификации могут включать в себя присоединение групп, содержащих сопряженные двойные связи, к одному из концов, выбранным положениям нуклеотидов, положениям сахаров, или к одной из межнуклеотидных связей. Альтернативно две цепи можно соединить посредством ненуклеотидного фрагмента или линкерной группы. При образовании из одной цепи дцРНК может принимать форму самокомплементарной шпилькообразной молекулы, которая закручивается вокруг самой себя с образованием двойной спирали. Таким образом, дцРНК могут быть полностью или частично двухцепочечными. Специфическую модуляцию экспрессии гена можно провести путем стабильной экспрессии шпилькообразных дцРНК в трансгенных клеточных линиях, однако в некоторых воплощениях экспрессия или функция гена подвергается повышающей регуляции. При образовании из двух цепей или из одной цепи, которая принимает форму самокомплементарной шпилькообразной молекулы, закручивающейся вокруг самой себя с образованием двойной спирали, две цепи (или дуплекс-образующие участки одной цепи) представляют собой комплементарные цепи РНК, спаривание оснований которых проходит по Уотсону-Крику.

После введения в систему соединения данного изобретения могут инициировать расщепление или другую модификацию нуклеиновой кислоты-мишени под действием одного или более ферментов или структурных белков, или они могут действовать посредством механизмов, основанных на захвате мишени. Как правило, нуклеиновые кислоты (в том числе олигонуклеотиды) могут быть описаны как "ДНК-подобные" (т. е., обычно содержащие один или более 2'-дезоксисахаров и основания T вместо оснований U) или "РНК-подобные" (т. е., обычно содержащие один или более 2'-гидроксил-сахаров или 2'-модифицированных сахаров и основания U вместо оснований T). Спирали нуклеиновых кислот могут иметь структуры разных типов, чаще всего встречаются A- и B-формы. Считается, что в большинстве случаев олигонуклеотиды, которые имеют структуру, соответствующую B-форме, являются "ДНК-подобными", а олигонуклеотиды, которые имеют структуру, соответствующую A-форме, являются "РНК-подобными". В некоторых (химерных) воплощениях, антисмысловое соединение может содержать участки, соответствующие A-форме, и участки, соответствующие B-форме.

В другом предпочтительном воплощении целевые олигонуклеотиды или антисмысловые соединения представляют собой, по меньшей мере, одно соединение, выбранное из группы, включающей в себя: антисмысловые РНК, антисмысловые ДНК, химерные антисмысловые олигонуклеотиды, антисмысловые олигонуклеотиды, содержащие модифицированные связи, соединения РНК-интерференции (РНКи), малые интерферирующие РНК (миРНК); интерферирующие микро-РНК (микроРНК); малые временные РНК (stPHK); или короткие шпилькообразные РНК (shPHK); малые РНК, индуцирующие активацию гена (РНКa); малые активирующие РНК (saPHK) или их сочетания.

дцРНК также могут ативировать экспрессию гена по механизму, называемому "активация гена, индуцированная малыми РНК" или РНКa. дцРНК, направленные на промоторы генов, эффективно индуцируют активацию транскрипции ассоциированных генов. РНКa можно продемонстрировать в человеческих клетках с использованием синтетических дцРНК, называемых "малые активирующие РНК" (saPHK). В настоящее время неизвестно, существует ли РНКa в других организмах.

Обнаружено, что малые двухцепочечные РНК (дцРНК), такие как малые интерферирующие РНК (миРНК) и микро РНК (микроРНК), инициируют консервативный с точки зрения эволюции механизм, известный как РНК-интерференция (РНКи). РНКи неизменно приводит к сайленсингу генов посредством реструктурирования хроматина с последующим подавлением транскрипции, деградации комплементарных мРНК или блокирования трансляции белка. Однако показано, что в случаях, подробно описанных в нижеследующем разделе Примеры, олигонуклеотиды повышают экспрессию и/или функцию полинуклеотидов аполипопротеина и кодируемых ими продуктов. дцРНК также могут действовать как малые активирующие РНК (saPHK). Без связи с какой-либо теорией полагают, что saPHK, последовательности которых направленные на промоторы генов, могут индуцировать экспрессию целевого гена посредством явления, называемого индуцированная дцРНК активация транскрипции (РНКa).

В другом воплощении "предпочтительные целевые сегменты", идентифицированные в данном описании, можно использовать для скрининга других соединений, модулирующих экспрессию полинуклеотидов аполипопротеина (ApoA1). "Модуляторы" представляют собой соединения, которые уменьшают или увеличивают экспрессию молекулы нуклеиновой кислоты, кодирующей аполипопротеин (ApoA1), и содержат, по меньшей мере, 5-нуклеотидный фрагмент, комплементарный предпочтительному целевому сегменту. Способ скрининга включает в себя стадии приведения в контакт предпочтительного целевого сегмента молекулы нуклеиновой кислоты, кодирующей полинуклеотиды аполипопротеина (ApoA1), с одним или более модуляторами-кандидатами, и выбор одного или более модуляторов-кандидатов, которые уменьшают или увеличивают экспрессию молекулы нуклеиновой кислоты, кодирующей полинуклеотиды аполипопротеина (ApoA1), например, SEQ ID NO: 81-173. После установления, что модулятор-кандидат или модуляторы-кандидаты способны модулировать (например, уменьшать или увеличивать) экспрессию молекулы нуклеиновой кислоты, кодирующей полинуклеотиды аполипопротеина (ApoA1), модулятор можно использовать в дальнейших исследованиях функции полинуклеотидов аполипопротеина (ApoA1), или в качестве исследовательского, диагностического или терапевтического средства в соответствии с настоящим изобретением.

Таргетирование антисмысловой последовательности предпочтительно модулирует функцию целевого гена, например, гена аполипопротеина A-I (NM_000039; геномная база данных UCSC). В предпочтительном воплощении мишень представляет собой антисмысловой полинуклеотид гена аполипопротеина A-I. В предпочтительном воплощении антисмысловой олигонуклеотид направлен на смысловые и/или природные антисмысловые последовательности полинуклеотидов аполипопротеина (ApoA1) (например, с номером доступа NM 000039), их варианты, аллели, изоформы, гомологи, мутанты, производные, фрагменты, а также комплементарные им последовательности. Предпочтительно олигонуклеотид представляет собой антисмысловую молекулу, а мишени включают в себя кодирующие и некодирующие участки антисмысловых и/или смысловых полинуклеотидов ApoAI.

Предпочтительные целевые сегменты настоящего изобретения также можно объединить с соответствующими комплементарными им антисмысловыми соединениями настоящего изобретения с образованием стабилизированных двухцепочечных (дуплексных) олигонуклеотидов.

В данной области известно, что такие двухцепочечные олигонуклеотидные фрагменты модулируют экспрессию мишени и регулируют трансляцию, а также процессинг РНК посредством антисмыслового механизма. Кроме того, двухцепочечные фрагменты могут подвергаться химическим модификациям (Fire et al, Nature, 1998, 391, 806-811; Timmons and Fire, Nature 1998, 395, 854; Timmons et al, Gene, 2001, 263, 103-112; Tabara et al, Science, 1998, 282, 430-431; Montgomery et al, Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et al, Genes Dev., 1999, 13, 3191-3197; Elbashir et al, Nature, 2001, 411, 494-498; Elbashir et al, Genes Dev. 2001, 15, 188-200). Например, показано, что такие двухцепочечные фрагменты ингибируют мишень путем классической гибридизации антисмысловой цепи дуплекса с мишенью и последующей инициации ферментативной деградации мишени (Tijsterman et al, Science, 2002, 295, 694-697).

В предпочтительном воплощении антисмысловой олигонуклеотид направлен на полинуклеотиды аполипопротеина (ApoA1) (например, с номером доступа NM 000039), их варианты, аллели, изоформы, гомологи, мутанты, производные, фрагменты, а также комплементарные им последовательности. Предпочтительно олигонуклеотид представляет собой антисмысловую молекулу.

В соответствии с воплощениями данного изобретения молекула нуклеиновой кислоты-мишени не ограничивается только аполипопротеином (ApoA1), но включает в себя все изоформы, рецепторы, гомологи и т.п. молекулы аполипопротеина (ApoA1).

В другом предпочтительном воплощении олигонуклеотид направлен на природную антисмысловую последовательность полинуклеотидов ApoA1, например, на полинуклеотиды, описанные как SEQ ID NO: 2-165, а также на любые их варианты, аллели, гомологи, мутанты, производные, фрагменты и комплементарные им последовательности. Примеры антисмысловых олигонуклеотидов описаны как SEQ ID NO: 81-173.

В одном воплощении олигонуклеотиды комплементарны или связываются с антисмысловыми нуклеотидными последовательностями аполипопротеина (ApoA1), включающими в себя, без ограничения, некодирующие смысловые и/или антисмысловые последовательности, связанные с полинуклеотидами аполипопротеина (ApoA1), и модулируют экспрессию и/или функцию молекулы аполипопротеина (ApoA1).

В другом предпочтительном воплощении олигонуклеотиды комплементарны или связываются с природными антисмысловыми нуклеотидными последовательностями ApoA1, описанными как SEQ ID NO: 2, 173, и модулируют экспрессию и/или функцию молекулы ApoA1.

В предпочтительном воплощении олигонуклеотиды включают в себя последовательности, которые содержат, по меньшей мере, 5 последовательных нуклеиновых оснований, описанные как SEQ ID NO: 81-173, и модулируют экспрессию и/или функцию молекулы аполипопротеина (ApoA1).

Мишени полинуклеотида включают в себя ApoA, в том числе члены его семейства, варианты ApoA; мутанты ApoA, в том числе SNP; некодирующие последовательности ApoA; аллели ApoA; разновидности, варианты, фрагменты и т.п. Предпочтительно олигонуклеотид представляет собой антисмысловую молекулу.

В другом предпочтительном воплощении олигонуклеотид, направленный на полинуклеотиды аполипопротеина (ApoA1), включает в себя: антисмысловую РНК, соединения РНК-интерференции (РНКи), малые интерферирующие РНК (миРНК); микроинтерферирующие РНК (микроРНК); малые временные РНК (stRNA); или короткие шпилькообразные РНК (shPHK); малые РНК, индуцирующие активацию гена (РНКa); или малые активирующие РНК (saPHK).

В другом предпочтительном воплощении направленность на полинуклеотиды аполипопротеина (ApoA1), например SEQ ID NOS: 81-173, модулирует экспрессию или функцию указанных мишеней. В одном воплощении экспрессия или функция подвергается повышающей регуляции по сравнению с контролем. В другом предпочтительном воплощении экспрессия или функция подвергается понижающей регуляции по сравнению с контролем.

В другом предпочтительном воплощении антисмысловые соединения включают в себя последовательности, описанные как SEQ ID NO: 81-173. Указанные олигонуклеотиды могут содержать одно или более модифицированных нуклеиновых оснований, более короткие или более длинные фрагменты, модифицированные связи и т.п.

В другом предпочтительном воплощении SEQ ID NOS: 81-173 содержат один или более нуклеотидов LNA.

Модуляцию желательной нуклеиновой кислоты-мишени можно проводить с помощью нескольких известных в данной области способов. Например, с использованием антисмысловых олигонуклеотидов, миРНК и других. Молекулы каталитических нуклеиновых кислот (например, рибозимы) представляют собой молекулы нуклеиновых кислот, способные катализировать одну или более из ряда реакций, включающих в себя многократное расщепление других отдельных молекул нуклеиновых кислот в манере, специфичной по отношению к последовательности нуклеотидных оснований. Такие молекулы каталитических нуклеиновых кислот можно использовать, например, в отношении практически любого транскрипта РНК (Zaug et al, 324, Nature 429 1986; Cech, 260 JAMA 3030, 1988; and Jefferies et al, 17 Nucleic Acids Research 1371, 1989).

Вследствие специфичности к последовательности транс-расщепляющие молекулы каталитических нуклеиновых кислот представляют собой перспективные терапевтические средства для лечения заболеваний человека (Usman & McSwiggen, 1995 Ann. Rep. Med. Chem. 30, 285-294; Christoffersen and Marr, 1995 J. Med. Chem. 38, 2023-2037). Молекулы каталитических нуклеиновых кислот можно сконструировать так, чтобы они расщепляли конкретные РНК-мишени в среде клеточных РНК. Такое событие расщепления делает мРНК нефункциональной и останавливает экспрессию белка из данной РНК. Таким образом можно селективно ингибировать синтез белка, связанного с болезненным состоянием.

Как правило, каталитические нуклеиновые кислоты с РНК-расщепляющей активностью вначале связываются с РНК-мишенью. Такое связывание осуществляется посредством мишеньсвязывающего фрагмента, который находится в непосредственной близости от каталитического фрагмента молекулы, обеспечивающего расщепление РНК-мишени. Таким образом, каталитическая нуклеиновая кислота вначале распознает РНК-мишень, затем связывается с ней посредством спаривания комплементарных оснований, и после связывания с нужным участком она действует как фермент, расщепляя РНК-мишень. Стратегическое расщепление такой РНК-мишени нарушает ее способность управлять синтезом кодируемого белка. После того, как каталитическая нуклеиновая кислота связывается с РНК-мишенью и расщепляет ее, она высвобождается из комплекса с данной РНК и начинает поиск другой мишени, то есть, она может многократно связываться с новыми мишенями и расщеплять их.

Для разработки новых нуклеиновых кислот-катализаторов, способных катализировать ряд реакций, таких как расщепление и лигирование фосфодиэфирных и амидных связей (Joyce, 1989, Gene, 82, 83-87; Beaudry et al., 1992, Science 257, 635-641; Joyce, 1992, Scientific American 267, 90-97; Breaker et al, 1994, TIBTECH 12, 268; Bartel et al, 1993, Science 261:1411-1418; Szostak, 1993, TIBS 17, 89-93; Kumar et al, 1995, FASEB J., 9, 1183; Breaker, 1996, Curr. Op. Biotech., 1, 442), используют несколько подходов, таких как стратегии селекции (эволюции) in vitro (Orgel, 1979, Proc. R. Soc. London, B 205, 435).

Разработка рибозимов, обладающих оптимальной каталитической активностью, вносит значительный вклад в любую стратегию, которая использует РНК-расщепляющие рибозимы для регуляции экспрессии генов. Рибозим в виде головки молотка, например, функционирует с каталитической скоростью (kcat) примерно 1 мин-1 в присутствии насыщающих (10 мМ) концентраций кофактора Mg2+. Показано, что искусственный рибозим "РНК-лигаза" катализирует соответствующую реакцию самомодификации со скоростью, составляющей примерно 100 мин-1. Кроме того, показано, что некоторые модифицированные рибозимы в виде головки молотка, которые содержат субстрат-связывающие плечи из ДНК, катализируют расщепление РНК со скоростью многократного оборота, приближающейся к 100 мин-1. Наконец, замена конкретного остатка в каталитическом центре головки молотка на некоторые аналоги нуклеотидов приводит к получению модифицированных рибозимов, которые характеризуются 10-кратным повышением каталитической скорости. Эти результаты демонстрируют, что рибозимы могут обеспечивать химические преобразования с каталитический скоростью, которая значительно превышает скорость катализа in vitro под действием большинства природных саморасщепляющихся рибозимов. Затем структуры некоторых саморасщепляющихся рибозимов можно оптимизировать с получением максимальной каталитической активности, или можно получить полностью новые мотивы РНК, которые характеризуются значительно более высокими скоростями расщепления фосфодиэфирных связей РНК.

Внутримолекулярное расщепление РНК-субстрата под действием РНК-катализатора, который соответствует модели "головка молотка", впервые было продемонстрировано в 1987 г. (Uhlenbeck, O. C. (1987) Nature, 328: 596-600). РНК-катализатор восстанавливается и взаимодействует с несколькими молекулами РНК, демонстрируя, что он действительно обладает каталитическими функциями.

Каталитические РНК конструируют на основе мотива "головки молотка", используемой для расщепления специфической последовательности-мишени, путем проведения соответствующих изменений в составе оснований каталитической РНК, чтобы поддержать необходимое спаривание этих оснований с основаниями последовательности-мишени (Haseloff and Gerlach, Nature, 334, 585 (1988); Walbot and Bruening, Nature, 334, 196 (1988); Uhlenbeck, O. C. (1987) Nature, 328: 596-600; Koizumi, M., Iwai, S. and Ohtsuka, E. (1988) FEBS Lett., 228: 228-230). Такое спаривание позволяет использовать каталитическую РНК для расщепления специфической последовательности-мишени и указывает на то, что каталитические РНК, сконструированные в соответствии с моделью "головки молотка", по всей вероятности, могут расщеплять специфические РНК-субстраты in vivo (см. Haseloff and Gerlach, Nature, 334, 585 (1988); Walbot and Bruening, Nature, 334, 196 (1988); Uhlenbeck, O. C. (1987) Nature, 328: 596-600).

РНК-интерференция (РНКи) является эффективным инструментом для модуляции экспрессии генов у млекопитающих и в клетках млекопитающих. Для проведения данного способа необходимо осуществить доставку малых интерферирующих РНК (миРНК), либо в виде самих РНК, либо в виде ДНК, с использованием плазмиды или вируса экспрессии и последовательности, кодирующей малые шпилькообразные РНК, которые в результате процессинга преобразуются в миРНК. Данная система обеспечивает эффективный транспорт пре-миРНК в цитоплазму, где они проявляют свою активность, и позволяет использовать регулируемые и ткане-специфичные промоторы для экспрессии генов.

В предпочтительном воплощении олигонуклеотид или антисмысловое соединение включает в себя олигомер или полимер рибонуклеиновой (RNA) и/или дезоксирибонуклеиновой кислоты (ДНК), или его миметик, химеру, аналог или гомолог. Данный термин включает в себя олигонуклеотиды, содержащие природные нуклеотиды, сахара и ковалентные межнуклеозидные (скелет) связи, а также олигонуклеотиды, содержащие неприродные фрагменты, функционирующие подобным образом. Такие модифицированные или замещенные олигонуклеотиды зачастую являются более предпочтительными, чем природные формы, поскольку они обладают желательными свойствами, такими как, например, повышенное поглощение клетками, повышенное сродство к нуклеиновой кислоте-мишени и повышенная стабильность в присутствии нуклеаз.

В соответствии с настоящим изобретением олигонуклеотиды или "антисмысловые соединения" включают в себя антисмысловые олигонуклеотиды (например, РНК, ДНК, их миметики, химеры, аналоги или гомологи), рибозимы, олигонуклеотиды внешней вспомогательной последовательности (EGS), соединения миРНК, одно- или двухцепочечные соединения РНК-интерференции (РНКи), такие как соединения миРНК, saPHK, aРНК, и другие олигомерные соединения, которые гибридизуются, по меньшей мере, с частью нуклеиновой кислоты-мишени и модулируют ее функцию. Как таковые, они могут представлять собой ДНК, РНК, ДНК-подобное соединение, РНК-подобное соединение или их смеси, или они могут представлять собой миметики одного или более указанных соединений. Указанные соединения могут представлять собой одноцепочечные, двухцепочечные, циклические или шпилькообразные олигомерные соединения и могут содержать такие структурные элементы, как внутренние или концевые выступы, несовпадения или петли. Антисмысловые соединения обычно получают в линейном виде, однако их можно соединить или получить другим способом в виде циклических и/или разветвленных соединений. Антисмысловые соединения могут включать в себя такие конструкции, как, например, две цепи, гибридизованные с образованием полностью или частично двухцепочечного соединения, или одна цепь с достаточной степенью самокомплементарности, обеспечивающей гибридизацию и образование полностью или частично двухцепочечного соединения. Две цепи могут быть соединены внутри, так что 3'- или 5'-конец остается свободным, или они могут быть соединены с образованием непрерывной шпилькообразной структуры или петли. Шпилькообразная структура может содержать липкий конец на 5'- или 3'-конце, позволяющий осуществлять удлинение одноцепочечной структуры. Двухцепочечные соединения необязательно могут содержать липкие концы. Дополнительные модификации могут включать в себя присоединение групп, содержащих сопряженные двойные связи, к одному из концов, выбранным положениям нуклеотидов, положениям сахаров, или к одной из межнуклеотидных связей. Альтернативно две цепи можно соединить посредством ненуклеотидного фрагмента или линкерной группы. При образовании из одной цепи дцРНК может принимать форму самокомплементарной шпилькообразной молекулы, которая закручивается вокруг самой себя с образованием двойной спирали. Таким образом, дцРНК могут быть полностью или частично двухцепочечными. Специфическую модуляцию экспрессии гена можно провести путем стабильной экспрессии шпилькообразных дцРНК в трансгенных клеточных линиях (Hammond et al., Nat. Rev. Genet., 1991, 2, 110-119; Matzke et al., Curr. Opin. Genet. Dev., 2001, 11, 221-227; Sharp, Genes Dev., 2001, 15, 485-490). При образовании из двух цепей, или из одной цепи, которая принимает форму самокомплементарной шпилькообразной молекулы, закручивающейся вокруг самой себя с образованием двойной спирали, две цепи (или дуплекс-образующие участки одной цепи) представляют собой комплементарные цепи РНК, спаривание оснований которых проходит по Уотсону-Крику.

После введения в систему соединения данного изобретения могут инициировать расщепление или другую модификацию нуклеиновой кислоты-мишени под действием одного или более ферментов или структурных белков, или они могут действовать посредством механизмов, основанных на захвате мишени. Как правило, нуклеиновые кислоты (в том числе олигонуклеотиды) могут быть описаны как "ДНК-подобные" (т.е. обычно содержащие один или более 2'-дезоксисахаров и основания T вместо оснований U) или "РНК-подобные" (т.е. обычно содержащие один или более 2'-гидроксил-сахаров или 2'-модифицированных сахаров и основания U вместо оснований T). Спирали нуклеиновых кислот могут иметь структуры разных типов, чаще всего встречаются A- и B-формы. Считается, что в большинстве случаев олигонуклеотиды, которые имеют структуру, соответствующую B-форме, являются "ДНК-подобными", а олигонуклеотиды, которые имеют структуру, соответствующую A-форме, являются "РНК-подобными". В некоторых (химерных) воплощениях, антисмысловое соединение может содержать участки, соответствующие A-форме, и участки, соответствующие B-форме.

Антисмысловые соединения в соответствии с данным изобретением могут содержать антисмысловой фрагмент, содержащий примерно от 5 до 80 нуклеотидов (т.е. примерно от 5 до 80 связанных нуклеозидов) в длину. Это относится к длине антисмысловой цепи фрагмента антисмыслового соединения. Другими словами, одноцепочечное антисмысловое соединение данного изобретения содержит от 5 до 80 нуклеотидов, а двухцепочечное антисмысловое соединение данного изобретения (такое как дцРНК, например) содержит антисмысловую цепь или фрагмент длиной от 5 до 80 нуклеотидов. Для рядового специалиста в данной области очевидно, что указанное определение включает в себя антисмысловые фрагменты, содержащие 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 или 80 нуклеотидов в длину, или любой диапазон в указанных пределах.

В одном воплощении антисмысловые соединения данного изобретения содержат антисмысловые фрагменты длиной от 10 до 50 нуклеотидов. Для рядового специалиста в данной области очевидно, что указанное определение заключает в себе олигонуклеотиды, содержащие антисмысловые фрагменты, длина которых составляет 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 или 50 нуклеотидов, или любой диапазон в указанных пределах. В некоторых воплощениях олигонуклеотиды содержат 15 нуклеотидов в длину.

В одном воплощении антисмысловые или олигонуклеотидные соединения данного изобретения содержат антисмысловые фрагменты длиной от 12 или 13 до 30 нуклеотидов. Для рядового специалиста в данной области очевидно, что указанное определение заключает в себе антисмысловые соединения, содержащие антисмысловые фрагменты, длина которых составляет 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов в длину, или любой диапазон в указанных пределах.

В предпочтительном воплощении введение, по меньшей мере, одного олигонуклеотида, направленного на один или более полинуклеотидов аполипопротеина (ApoA1), предотвращает или лечит заболевания, связанные с аномальной экспрессией или функцией полинуклеотидов аполипопротеина (ApoA1) и кодируемых ими продуктов, или другие родственные заболевания. Примеры заболеваний, которые можно лечить антисмысловыми олигонуклеотидами, включают в себя: высокий холестерин, сердечно-сосудистые заболевания, болезнь сердца, болезнь Танжера, артрит, воспаление, аутоиммунные заболевания, воспалительные заболевания, неврологические заболевания или нарушения (например, болезнь Альцгеймера, болезнь Паркинсона); нейродегенерация, рак, заболевания или нарушения, вызванные чужеродными организмами, такими как вирусы, бактерии, паразиты, грибки и т.п.

В другом предпочтительном воплощении олигомерные соединения настоящего изобретения также включают в себя варианты, в одном или более положениях которых присутствует другое основание. Например, если первый нуклеотид представляет собой аденозин, можно получить варианты, которые содержат тимидин, гуанозин или цитидин в данном положении. Такую замену можно осуществить по любому положению антисмыслового соединения или дцРНК. Затем указанные соединения тестируют с помощью описанных здесь способов, чтобы определить их способность ингибировать экспрессию нуклеиновой кислоты-мишени.

В некоторых воплощениях гомология, идентичность или комплементарность последовательностей антисмыслового соединения и мишени составляет примерно от 40% до 60%. В некоторых воплощениях гомология, идентичность или комплементарность последовательностей составляет примерно от 60% до 70%. В некоторых воплощениях гомология, идентичность или комплементарность последовательностей составляет примерно от 70% до 80%. В некоторых воплощениях гомология, идентичность или комплементарность последовательностей составляет примерно от 80% до 90%. В некоторых воплощениях гомология, идентичность или комплементарность последовательностей составляет примерно 90%, примерно 92%, примерно 94%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или примерно 100%.

В другом предпочтительном воплощении антисмысловые олигонуклеотиды, такие как, например, молекулы нуклеиновых кислот, описанные в SEQ ID NO: 3-172, содержат одну или более замен или модификаций. В одном воплощении нуклеотиды заменяют на замкнутые нуклеиновые кислоты (LNA).

В другом предпочтительном воплощении олигонуклеотиды направлены на один или более участков смысловых и/или антисмысловых цепей кодирующих и/или некодирующих последовательностей молекул нуклеиновых кислот, связанных с ApoA1 и последовательностями, описанными как SEQ ID NO: 1, 2. Олигонуклеотиды также направлены на перекрывающиеся участки SEQ ID NO: 1, 2.

Некоторые предпочтительные олигонуклеотиды данного изобретения представляют собой химерные олигонуклеотиды. "Химерные олигонуклеотиды" или "химеры" в контексте данного изобретения представляют собой олигонуклеотиды, которые содержат два или более химически различных участков, каждый из которых состоит, по меньшей мере, из одного нуклеотида. Указанные олигонуклеотиды, как правило, включают в себя, по меньшей мере, один участок, содержащий модифицированные нуклеотиды с целью придания ему одного или более полезных свойств (таких как, например, повышенная устойчивость к нуклеазе, повышенная способность поглощаться клеткой, и/или повышенное сродство связывания с мишенью) и участок, который является субстратом ферментов, способных расщеплять гибриды РНК:ДНК или РНК:РНК. Например, РНКаза H представляет собой клеточную эндонуклеазу, которая расщепляет РНК-цепь дуплекса РНК:ДНК. Следовательно, активация РНКазы H приводит к расщеплению РНК-мишени и посредством этого значительно увеличивает эффективность антисмысловой модуляции экспрессии гена. Таким образом, в случае применения химерных олигонуклеотидов сравнимые результаты зачастую можно получить с использованием более коротких олигонуклеотидов, чем фосфоротиоатные дезоксиолигонуклеотиды, гибридизующиеся с тем же участком-мишенью. Расщепление РНК-мишени обычно детектируют с помощью известных в данной области методов гель-электрофореза и, при необходимости, гибридизации ассоциированных нуклеиновых кислот. В предпочтительном воплощении химерный олигонуклеотид содержит, по меньшей мере, один участок, модифицированный с целью повышения сродства связывания с мишенью, и зачастую участок, являющийся субстратом для РНКазы H. Сродство олигонуклеотида к мишени (в данном случае нуклеиновой кислоты, кодирующей ras) обычно определяют путем измерения Тпл пары олигонуклеотид/мишень, которая представляет собой температуру, при которой олигонуклеотид и мишень диссоциируют; диссоциацию детектируют методом спектрофотометрии. Чем выше Тпл, тем выше сродство олигонуклеотида к мишени.

Химерные антисмысловые соединения данного изобретения можно получить в виде структур, состоящих из двух или более олигонуклеотидов, модифицированных олигонуклеотидов, олигонуклеозидов и/или миметиков олигонуклеотидов, как описано выше. Такие соединения в данной области также называют гибридами или гэпмерами. Примеры патентов США, в которых описано получение таких гибридных структур, включают в себя, без ограничения, патенты США №№ 5013830; 5149797; 5220007; 5256775; 5366878; 5403711; 5491133; 5565350; 5623065; 5652355; 5652356; и 5700922, каждый из которых включен в данное описание в качестве ссылки.

В другом предпочтительном воплощении модифицированный участок олигонуклеотида содержит, по меньшей мере, один нуклеотид, модифицированный по 2'-положению сахара, наиболее предпочтительно 2'-O-алкил-, 2'-O-алкил-O-алкил- или 2'-фтор-модифицированный нуклеотид. В других предпочтительных воплощениях модификации РНК включают в себя 2'-фтор-, 2'-амино- и 2'-O-метил-модификации рибозы пиримидинов, остатки с удаленными азотистыми основаниями или инвертированными основаниями на 3'-конце РНК. Такие модификации вводят в олигонуклеотиды обычными способами и показано, что полученные олигонуклеотиды обладают более высокой Тпл (т.е. более высоким сродством связывания с мишенью) чем 2'-дезоксиолигонуклеотиды в отношении данной мишени. Такое повышение сродства приводит к значительному усилению ингибирования экспрессии гена посредством олигонуклеотидной РНКи. РНКаза H представляет собой клеточную эндонуклеазу, которая расщепляет РНК-цепь дуплекса РНК:ДНК; следовательно, активация данного фермента приводит к расщеплению РНК-мишени и посредством этого значительно увеличивает эффективность ингибирования по механизму РНКи. Расщепление РНК-мишени обычно демонстрируют методом гель-электрофореза. В другом предпочтительном воплощении химерный олигонуклеотид также модифицируют с целью увеличения устойчивости к нуклеазе. Клетки содержат разные экзо- и эндонуклеазы, способные расщеплять нуклеиновые кислоты. Показано, что ряд нуклеотидных и нуклеозидных модификаций обеспечивает повышение устойчивости олигонуклеотида, в который эти модификации вводят, к расщеплению под действием нуклеазы, по сравнению с нативным олигодезоксинуклеотидом. Устойчивость к нуклеазе обычно измеряют путем инкубации олигонуклеотидов с клеточными экстрактами или растворами выделенных нуклеаз с последующим определением количества оставшегося интактного олигонуклеотида в динамике по времени, как правило, методом гель-электрофореза. Олигонуклеотиды, модифицированные с целью повышения устойчивости к нуклеазе, дольше остаются интактными, чем немодифицированные олигонуклеотиды. Показано, что ряд модификаций олигонуклеотидов повышает или придает устойчивость к нуклеазе. В настоящее время предпочтительными считаются олигонуклеотиды, которые содержат, по меньшей мере, одну фосфоротиоатную модификацию. В некоторых случаях модификации олигонуклеотидов, повышающие сродство связывания к мишени, также могут независимо увеличивать устойчивость к нуклеазе. Некоторые желательные модификации можно найти в De Mesmaeker et al. Ace. Chem. Res. 1995, 28:366-374.

Конкретные примеры некоторых предпочтительных олигонуклеотидов данного изобретения включают в себя олигонуклеотиды, содержащие модифицированные скелеты, например, фосфоротиоаты, фосфотриэфиры, метилфосфонаты, короткоцепочечные алкильные или циклоалкильные мостики между сахарами или короткоцепочечные гетероатомные или гетероциклические мостики между сахарами. Наиболее предпочтительными являются олигонуклеотиды, содержащие фосфоротиоатные скелеты, и олигонуклеотиды, содержащие гетероатомные скелеты, в особенности скелеты CH2-NH-O-CH2, CH2-N(CH3)-O-CH2 [известный как метилен(метилиминовый) или MMI скелет], CH2-O-N(CH3)-CH2, CH2-N(CH3)-N(CH3)-CH2 и O-N(CH3)-CH2-CH2, где нативный фосфодиэфирный скелет представлен как O-P-O-CH). Предпочтительными также являются амидные скелеты, раскрытые De Mesmaeker et al. Ace. Chem. Res. 1995, 28:366-374). Предпочтительными также являются олигонуклеотиды, содержащие морфолиновые скелетные структуры (Summerton and Weller, патент США № 5034506). В других предпочтительных воплощениях, таких как скелет пептидной нуклеиновой кислоты (PNA), фосфодиэфирный скелет олигонуклеотида заменяется полиамидным скелетом, где нуклеотиды связаны непосредственно или косвенно с аза-атомами азота полиамидного скелета (Nielsen et al. Science 1991, 254, 1497). Олигонуклеотиды также могут содержать один или более замещенных сахарных фрагментов. Предпочтительные олигонуклеотиды содержат в 2'-положении один из следующих фрагментов: OH, SH, SCH3, F, OCN, OCH3OCH3, OCH3O(CH2)nCH3, O(CH2)nNH2 или O(CH2)nCH3, где n находится в интервале от 1 до 10; C1-C10 низший алкил, алкоксиалкокси, замещенный низший алкил, алкарил или аралкил; Cl; Br; CN; CF3; OCF3; O-, S- или N-алкил; O-, S- или N-алкенил; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; гетероциклоалкил; гетероциклоалкарил; аминоалкиламино; полиалкиламино; замещенный силил; РНК-расщепляющая группа; репортерная группа; интеркалятор; группа, улучшающая фармакокинетические свойства олигонуклеотида; или группа, улучшающая фармакодинамические свойства олигонуклеотида, и другие заместители, обладающие подобными свойствами. Предпочтительная модификация включает в себя 2'-метоксиэтокси [2'-О-CH2CH2OCH3, также известный как 2'-O- (2-метоксиэтил)] (Martin et al, Helv. Chim. Acta, 1995, 78, 486). Другие предпочтительные модификации включают в себя 2'-метокси (2'-О-CH3), 2'-пропокси (2'-OCH2CH2CH3) и 2'-фтор (2'-F). Подобные модификации также можно осуществить в других положениях олигонуклеотида, в частности, в 3'-положении сахара 3'-концевого нуклеотида и в 5'-положении сахара 5'-концевого нуклеотида. Олигонуклеотиды также могут содержать миметики сахаров, такие как циклобутил, вместо пентофуранозильной группы.

Олигонуклеотиды также могут включать в себя, дополнительно или альтернативно, модификации или замены нуклеиновых оснований (зачастую называемых в данной области просто "основания"). В данном описании "немодифицированные" или "природные" нуклеиновые основания включают в себя аденин (A), гуанин (G), тимин (T), цитозин (C) и урацил (U). Модифицированные нуклеиновые основания включают в себя нуклеиновые основания, присутствующие в природных нуклеиновых кислотах редко или временно, например, гипоксантин, 6-метиладенин, 5-Me-пиримидины, в частности 5-метилцитозин (также называемый 5-метил-2'-дезоксицитозин и обозначаемый в данной области 5-Me-C), 5-гидроксиметилцитозин (HMC), гликозил HMC и гентобиозил HMC, а также синтетические нуклеиновые основания, такие как 2-аминоаденин, 2-(метиламино)аденин, 2-(имидазолилалкил)аденин, 2-(аминоалкиламино)аденин или другие гетерозамещенные алкиладенины, 2-тиоурацил, 2-тиотимин, 5-бромурацил, 5-гидроксиметилурацил, 8-азагуанин, 7-деазагуанин, N6 (6-аминогексил)аденин и 2,6-диаминопурин. Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, 1980, pp75-77; Gebeyehu, G., et al. Nucl. Acids Res. 1987, 15:4513). Данное определение также включает в себя "универсальное" основание, известное в данной области, например, инозин. Показано, что замены 5-Me-C повышают стабильность нуклеотидного дуплекса на 0,6-1,2°C (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) и в настоящее время являются предпочтительными заменами оснований.

Другая модификация олигонуклеотидов данного изобретения включает в себя химическое присоединение к олигонуклеотиду одного или более фрагментов или конъюгатов, которые повышают активность или клеточное поглощение олигонуклеотида. Такие фрагменты включают в себя, без ограничения, липидные фрагменты, такие как фрагмент холестерина, холестерильный фрагмент (Letsinger et al., Proc. Natl. Acad. ScL USA 1989, 86, 6553), холевая кислота (Manoharan et al. Bioorg. Med. Chem. Let. 1994, 4, 1053), простой тиоэфир, например, гексил-S-тритилтиол (Manoharan et al. Ann. NY. Acad. Sci. 1992, 660, 306; Manoharan et al. Bioorg. Med. Chem. Let. 1993, 3, 2765), a тиохолестерин (Oberhauser et al., Nucl. Acids Res. 1992, 20, 533), алифатическую цепь, например, остатки додекандиола или ундецила (Saison-Behmoaras et al. EMBOJ. 1991, 10, 111; Kabanov et al. FEBS Lett. 1990, 259, 327; Svinarchuk et al. Biochimie 1993, 75, 49), фосфолипид, например, дигексадецил-rac-глицерин или триэтиламмоний 1,2-ди-O-гексадецил-rac-глицеро-3-H-фосфонат (Manoharan et al. Tetrahedron Lett. 1995, 36, 3651; Shea et al. Nucl. Acids Res. 1990, 18, 3777), цепь полиамина или полиэтиленгликоля (Manoharan et al. Nucleosides & Nucleotides 1995, 14, 969), или адамантануксусную кислоту (Manoharan et al. Tetrahedron Lett. 1995, 36, 3651). Олигонуклеотиды, содержащие липофильные фрагменты, и способы получения таких олигонуклеотидов описаны в данной области, например, в патентах США №№ 5138045, 5218105 и 5459255.

Нет необходимости, чтобы все положения в конкретном олигонуклеотиде были модифицированы одинаково, и фактически несколько вышеупомянутых модификаций можно ввести в один олигонуклеотид, или даже в один нуклеозид, входящий в состав олигонуклеотида. Настоящее изобретение также включает в себя химерные олигонуклеотиды, описанные в данном документе выше.

В другом воплощении молекулу нуклеиновой кислоты настоящего изобретения конъюгируют с другим фрагментом, включающим в себя, без ограничения, не содержащие азотистых оснований нуклеотиды, простые полиэфиры, полиамины, полиамиды, пептиды, углеводы, липиды или полиуглеводороды. Специалистам в данной области известно, что указанные молекулы можно присоединить к одному или более нуклеотидам, входящим в состав молекулы нуклеиновой кислоты, по нескольким положениям сахара, основания или фосфатной группы.

Олигонуклеотиды, используемые в соответствии с настоящим изобретением, традиционно и стандартно получают с помощью хорошо известного метода твердофазного синтеза. Оборудование для такого синтеза поставляется несколькими производителями, в том числе Applied Biosystems. Для такого синтеза также можно использовать любые другие средства; фактический синтез олигонуклеотидов относится к компетенции рядового специалиста в данной области. Также хорошо известно, что подобные методы можно использовать для получения других олигонуклеотидов, таких как фосфоротиоаты и алкилированные производные. Кроме того, широко известно, что подобные методы и коммерчески доступные модифицированные амидиты и продукты на основе стекла с контролируемым размером пор (CPG), такие как биотин, флуоресцеин, акридин или псорален-модифицированные амидиты и/или CPG (доступные от Glen Research, Sterling VA) можно использовать для синтеза флуоресцентно меченных, биотинилированных или других модифицированных олигонуклеотидов, таких как холестерин-модифицированные олигонуклеотиды.

Применение модификаций в соответствии с данным изобретением, такое как применение мономеров LNA с целью увеличения активности, специфичности и продолжительности действия, и увеличения числа способов введения олигонуклеотидов, включает в себя использование в современных химических методах, таких как MOE, ANA, FANA, PS и других. (ссылка: Recent advances in the medical chemistry of antisense oligonucleotide by Uhlman, Current Opinions in Drug Discovery & Development 2000 Vol. 3 No 2). Такую модификацию можно осуществить путем замены некоторых мономеров в олигонуклеотидах настоящего изобретения на мономеры LNA. По размеру LNA-модифицированный олигонуклеотид может быть таким же, как исходное соединение, больше или, предпочтительно, меньше чем исходное соединение. Предпочтительно такие LNA-модифицированные олигонуклеотиды содержат менее чем примерно 70%, более предпочтительно, менее чем примерно 60%, наиболее предпочтительно, менее чем примерно 50% мономеров LNA, и имеют размер примерно от 5 до 25 нуклеотидов, более предпочтительно примерно от 12 до 20 нуклеотидов.

Предпочтительные модифицированные скелеты олигонуклеотидов включают в себя, без ограничения, фосфоротиоаты, хиральные фосфоротиоаты, фосфородитиоаты, фосфотриэфиры, аминоалкил фосфотриэфиры, метил- и другие алкилфосфонаты, в том числе 3'алкиленфосфонаты и хиральные фосфонаты, фосфинаты, фосфорамидаты, в том числе 3'-аминофосфорамидат и аминоалкилфосфорамидаты, тионофосфорамидаты, тионоалкилфосфонаты, тионоалкилфосфотриэфиры, и боранофосфаты, содержащие нормальные 3'-5'-связи, их 2'-5'-соединенные аналоги, а также скелеты с инвертированной полярностью, где соединение соседних пар нуклеозидных элементов меняется с 3'-5' на 5'-3' или с 2'-5' на 5'-2'. Также можно использовать разные соли, смешанные соли и свободные кислоты.

Примеры патентов США, в которых описаны способы получения вышеуказанных фосфорсодержащих связей, включают в себя, без ограничения, патенты США №№ 3687808; 4469863; 4476301; 5023243; 5177196; 5188897; 5264423; 5276019; 5278302; 5286717; 5321131; 5399676; 5405939; 5453496; 5455233; 5466677; 5476925; 5519126; 5536821; 5541306; 5550111; 5563253; 5571799; 5587361; и 5625050, каждый из которых включен в данное описание в качестве ссылки.

Предпочтительные модифицированные не содержащие фосфора олигонуклеотидные скелеты включают в себя скелеты, образованные короткоцепочечными алкильными или циклоалкильными межнуклеозидными мостиками, смешанными гетероатомными и алкильными или циклоалкильными межнуклеозидными мостиками, или одним или более короткоцепочечными гетероатомными или гетероциклическими межнуклеозидными мостиками. Указанные скелеты включают в себя скелеты, содержащие морфолиновые мостики (образованные отчасти сахарным фрагментом нуклеозида); силоксановые скелеты; сульфидные, сульфоксидные и сульфоновые скелеты; формацетильные и тиоформацетильные скелеты; метиленформацетильные и тиоформацетильные скелеты; алкенсодержащие скелеты; сульфаматные скелеты; метилениминовые и метиленгидразиновые скелеты; сульфонатные и сульфонамидные скелеты; амидные скелеты; и другие, включающие в себя смешанные N-, O-, S- и CH2- содержащие компоненты.

Примеры патентов США, в которых описаны способы получения вышеуказанных олигонуклеозидов, включают в себя, без ограничения, патенты США №№ 5034506; 5166315; 5185444; 5214134; 5216141; 5235033; 5264562; 5264564; 5405938; 5434257; 5466677; 5470967; 5489677; 5541307; 5561225; 5596086; 5602240; 5610289; 5602240; 5608046; 5610289; 5618704; 5623070; 5663312; 5633360; 5677437; и 5677439, каждый из которых включен в данное описание в качестве ссылки.

В других предпочтительных олигонуклеотидных миметиках и сахар, и межнуклеозидную связь, т.е. скелет, нуклеотидных элементов заменяют на новые группы. Основания сохраняют для гибридизации с соответствующим соединением нуклеиновой кислоты-мишени. Одно из таких олигомерных соединений, олигонуклеотидный миметик, который, как показано, обладает превосходными гибридизационными свойствами, представляет собой пептидную нуклеиновую кислоту (PNA). В соединениях PNA сахарный скелет олигонуклеотида заменен на амидсодержащий скелет, такой как аминоэтилглициновый скелет. Нуклеиновые основания сохраняются и связываются непосредственно или косвенно, через атомы азота аза-группы амидного фрагмента скелета. Примеры патентов США, в которых описаны способы получения соединений PNA, включают в себя, без ограничения, патенты США №№ 5539082; 5714331; и 5719262, каждый из которых включен в данное описание в качестве ссылки. Дополнительную информацию по соединениям PNA можно найти в o Nielsen et al, Science, 1991, 254, 1497-1500.

Другое предпочтительное воплощение данного изобретения включает в себя олигонуклеотиды с фосфоротиоатным скелетом и олигонуклеозиды с гетероатомным скелетом, таким как -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2-, известным как метиленовый (метилиминовый) или MMI скелет, -CH2-O-N(CH3)-CH2-, -CH2N(CH3)-N(CH3)CH2- и -O-N(CH3)-CH2-CH2-, где природный фосфодиэфирный скелет представляет собой -O-P-O-CH2-, описанный в указанном выше патенте США № 5489677, а амидные скелеты описаны в указанном выше патенте США № 5602240. В указанном выше патенте США № 5034506 также описаны олигонуклеотиды с морфолиновым скелетом.

Модифицированные олигонуклеотиды также могут содержать один или более замещенных сахарных фрагментов. Предпочтительные олигонуклеотиды содержат в 2'-положении один из следующих фрагментов: OH; F; O-, S- или N-алкил; O-, S- или N-алкенил; O-, S- или N-алкинил; или O-алкил-O-алкил, где алкил, алкенил и алкинил могут быть замещенными или незамещенными C на CO алкил или C2 на CO алкенил и алкинил. Особенно предпочтительными являются O(CH2)nOmCH3, O(CH2)n, OCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2 и O(CH2nON(CH2)nCH3)2, где n и m могут быть выбраны из интервала от 1 до 10. Другие предпочтительные олигонуклеотиды в 2'-положении один из следующих фрагментов: C - CO, низший алкил, замещенный низший алкил, алкарил, аралкил, O-алкарил или O-аралкил, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, гетероциклоалкил, гетероциклоалкарил, аминоалкиламино, полиалкиламино, замещенный силил, РНК-расщепляющая группа, репортерная группа, интеркалятор, группа, улучшающая фармакокинетические свойства олигонуклеотида, группа, улучшающая фармакодинамические свойства олигонуклеотида, и другие заместители, обладающие подобными свойствами. Предпочтительная модификация включает в себя группу 2'-метоксиэтокси (2'-О-CH2CH2OCH3, также известную как 2'-O-(2-метоксиэтил) или 2'-MOE) (Martin et al., HeIv. Chim. Acta, 1995, 78, 486-504) т.е. алкоксиалкоксильную группу. Другая предпочтительная модификация включает в себя 2'-диметиламинооксиэтокси, т.е. группу O(CH2)2ON(CH3)2, также известную как 2'-DMAOE, описанную ниже в разделе Примеры, и 2'-диметиламиноэтоксиэтокси (также известную в данной области как 2'-O-диметиламиноэтоксиэтил или 2'-DMAEOE), т.е. 2'-О-CH2-O-CH2-N(CH2)2.

Другие предпочтительные модификации включают в себя 2'-метокси (2'-OCH3), 2'-аминопропокси (2'-OCH2CH2CH2NH2) и 2'-фтор (2'-F). Подобные модификации также можно осуществить в других положениях олигонуклеотида, в частности, в 3'-положении сахара 3'-концевого нуклеотида, или, в случае 2'-5' связанных олигонуклеотидов, в 5'-положении сахара 5'-концевого нуклеотида. Олигонуклеотиды также могут содержать миметики сахаров, такие как циклобутил, вместо пентофуранозильной группы. Примеры патентов США, в которых описаны способы получения таких модифицированных сахарных структур, включают в себя, без ограничения, патенты США №№ 4981957; 5118800; 5319080; 5359044; 5393878; 5446137; 5466786; 5514785; 5519134; 5567811; 5576427; 5591722; 5597909; 5610300; 5627053; 5639873; 5646265; 5658873; 5670633; и 5700920, каждый из которых включен в данное описание в качестве ссылки.

Олигонуклеотиды также могут содержать модификации или замены нуклеиновых оснований (зачастую называемых в данной области просто "основания"). В данном описании "немодифицированные" или "природные" нуклеиновые основания включают в себя пуриновые основания аденин (A) и гуанин (G), и пиримидиновые основания тимин (T), цитозин (C) и урацил (U). Модифицированные нуклеиновые основания включают в себя другие синтетические и природные нуклеиновые основания, такие как 5-метилцитозин (5-me-C), 5-гидроксиметилцитозин, ксантин, гипоксантин, 2-аминоаденин, 6-метильные и другие алкильные производные аденина и гуанина, 2-пропильные и другие алкильные производные аденина и гуанина, 2-тиоурацил, 2-тиотимин и 2-тиоцитозин, 5-галогенурацил и цитозин, 5-пропинилурацил и цитозин, 6-азоурацил, цитозин и тимин, 5-урацил (псевдоурацил), 4-тиоурацил, 8-галоген-, 8-амино-, 8-тиол-, 8-тиоалкил-, 8-гидроксил- и другие 8-замещенные аденины и гуанины, 5-галоген-, в частности 5-бром, 5-трифторметил, и другие 5-замещенные урацилы и цитозины, 7-метилгуанин и 7-метиладенин, 8-азагуанин и 8-азааденин, 7-деазагуанин и 7-деазааденин, а также 3-деазагуанин и 3-деазааденин.

Кроме того, нуклеиновые основания включают в себя основания, раскрытые в патенте США № 3687808, описанные в 'The Concise Encyclopedia of Polymer Science And Engineering', pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, описанные в Englisch et al., Angewandle Chemie, International Edition', 1991, 30, page 613, и описанные в Sanghvi, Y. S., Chapter 15, 'Antisense Research and Applications', pages 289- 302, Crooke, S.T. and Lebleu, B. ea., CRC Press, 1993. Некоторые из указанных нуклеиновых оснований особенно подходят для увеличения сродства связывания олигомерных соединений данного изобретения. Такие основания включают в себя 5-замещенные пиримидины, 6-азапиримидины и N-2, N-6 и О-6 замещенные пурины, в том числе 2-аминопропиладенин, 5-пропинилурацил и 5-пропинилцитозин. Показано, что замены на 5-метилцитозин повышают стабильность нуклеотидного дуплекса на 0,6-1,2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds, 'Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp. 276-278) и в настоящее время являются предпочтительными заменами оснований, в особенности, в сочетании с 2'-O-метоксиэтильными модификациями сахаров.

Примеры патентов США, в которых описаны способы получения вышеуказанных модифицированных нуклеиновых оснований, а также других модифицированных нуклеиновых оснований, включают в себя, без ограничения, патенты США №№ 3687808, а также 4845205; 5130302; 5134066; 5175273; 5367066; 5432272; 5457187; 5459255; 5484908; 5502177; 5525711; 5552540; 5587469; 5596091; 5614617; 5750692 и 5681941, каждый из которых включен в данное описание в качестве ссылки.

Другая модификация олигонуклеотидов данного изобретения включает в себя химическое присоединение к олигонуклеотиду одного или более фрагментов или конъюгатов, которые повышают активность, облегчают распределение в клетке или поглощение клеткой олигонуклеотида.

Такие фрагменты включают в себя, без ограничения, липидные фрагменты, такие как фрагмент холестерина (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), холевую кислоту (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), тиоэфир, например, гексил-S-тритилтиол (Manoharan et al, Ann. N. Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), тиохолестерин (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), алифатическую цепь, например, остатки додекандиола или ундецила (Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), фосфолипид, например, дигексадецил-rac-глицерин или триэтиламмоний 1,2-ди-O-гексадецил-rac-глицеро-3-H-фосфонат (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), цепь полиамина или полиэтиленгликоля (Mancharan et al., Нуклеозиды & Нуклеотиды, 1995, 14, 969-973) или адамантануксусную кислоту (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), пальмитиловый фрагмент (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237) или октадециламин или гексиламинокарбонил-t оксихолестериновый фрагмент (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).

Примеры патентов США, в которых описаны способы получения таких конъюгатов олигонуклеотидов включают в себя, без ограничения, патенты США №№ 4828979; 4948882; 5218105; 5525465; 5541313; 5545730; 5552538; 5578717, 5580731; 5,580,731; 5591584; 5109124; 5118802; 5138045; 5414077; 5486603; 5512439; 5578718; 5608046; 4587044; 4605735; 4667025; 4762779; 4789737; 4824941; 4835263; 4876335; 4904582; 4958013; 5082830; 5112963; 5214136; 5082830; 5112963; 5214136; 5245022; 5254469; 5258506; 5262536; 5272250; 5292873; 5317098; 5371241, 5391723; 5416203, 5451463; 5510475; 5512667; 5514785; 5565552; 5567810; 5574142; 5585481; 5587371; 5595726; 5597696; 5599923; 5599928 и 5688941, каждый из которых включен в данное описание в качестве ссылки.

Поиск новых лекарств: Соединения настоящего изобретения также можно использовать в технологиях поиска новых лекарств и установления мишеней. Настоящее изобретение охватывает применение соединений и предпочтительных сегментов-мишеней, идентифицированных в данном документе, в исследованиях, связанных с поиском новых лекарств, чтобы выявить взаимосвязи, существующие между полинуклеотидами аполипопротеина (ApoA1) и статусом, фенотипом или состоянием заболевания. Указанные способы включают в себя детекцию или модуляцию полинуклеотидов аполипопротеина (ApoA1), включающую в себя приведение в контакт образца, ткани, клетки или организма с соединениями настоящего изобретения, измерение уровня нуклеиновой кислоты или белка аполипопротеина (ApoA1) и/или связанного с ними фенотипического или химического результата через определенный промежуток времени после обработки, и, необязательно, сравнение измеренного значения со значением, полученным для необработанного образца или образца, обработанного другим соединением данного изобретения. Указанные способы также можно проводить параллельно или в сочетании с другими экспериментами, чтобы определить функцию неизвестных генов в процессе установления мишени, или чтобы определить, можно ли использовать конкретный генный продукт в качестве мишени для лечения или предотвращения конкретного заболевания, состояния или фенотипа.

Анализ повышающей регуляции или ингибирования экспрессии генов

Перенос экзогенной нуклеиновой кислоты в клетку или организм хозяина можно оценить путем непосредственной детекции присутствия нуклеиновой кислоты в клетке или организме. Такую детекцию можно проводить с помощью нескольких методов, хорошо известных в данной области. Например, присутствие экзогенной нуклеиновой кислоты можно детектировать методом саузерн-блоттинга или полимеразной цепной реакции (PCR) с использованием праймеров, которые обеспечивают специфическую амплификацию нуклеотидной последовательности, ассоциированной с нуклеиновой кислотой. Экспрессию экзогенных нуклеиновых кислот также можно измерить с помощью традиционных методов, включающих в себя анализ экспрессии генов. Например, мРНК, продуцируемую экзогенной нуклеиновой кислотой, можно детектировать и количественно определить методами нозерн-блоттинга и ПЦР с обратной транскрипцией (ОТ-ПЦР).

Экспрессию РНК из экзогенной нуклеиновой кислоты также можно определить путем измерения ферментативной активности или активности репортерного белка. Например, модуляторную активность антисмысловой последовательности можно измерить косвенно путем определения уменьшения или увеличения экспрессии нуклеиновой кислоты-мишени, свидетельствующего о том, что экзогенная нуклеиновая кислота продуцирует эффекторную РНК. Исходя из консервативности последовательности можно сконструировать праймеры для амплификации кодирующих участков генов-мишеней. Вначале можно сконструировать модель контрольного гена на основе наиболее интенсивно экспрессирующегося кодирующего участка каждого гена, хотя можно использовать любой кодирующий или некодирующий участок. Каждый контрольный ген собирают путем вставки каждого кодирующего участка между участком, кодирующим репортер, и его сигналом поли(A). Полученные плазмиды могут продуцировать мРНК, содержащую репортерный ген в верхней части гена и потенциальную мишень РНКи в 3'-некодирующем участке. Эффективность отдельных антисмысловых олигонуклеотидов анализируют путем модуляции репортерного гена. Репортерные гены, пригодные для применения в способах настоящего изобретения, включают в себя гены, кодирующие такие продукты, как синтетаза ацетогидроксикислот (AHAS), щелочная фосфатаза (AP), бета-галактозидаза (LacZ), бета-глюкуронидаза (GUS), хлорамфеникол-ацетилтрансфераза (CAT), зеленый флуоресцентный белок (GFP), красный флуоресцентный белок (RFP), желтый флуоресцентный белок (YFP), голубой флуоресцентный белок (CFP), пероксидаза хрена (HRP), люцифераза (Luc), нопалинсинтаза (NOS), октопинсинтаза (OCS) и их производные. Существует несколько селектируемых маркеров, придающих устойчивость к ампициллину, блеомицину, хлорамфениколу, гентамицину, гигромицину, канамицину, линкомицину, метотрексату, фосфинотрицину, пуромицину и тетрациклину. Способы определения модуляции репортерного гена хорошо известны в данной области и включают в себя, без ограничения, флуорометрические методы (такие как флуоресцентная спектроскопия, клеточный сортинг с активацией флуоресценции (FACS), флуоресцентная микроскопия), определение устойчивости к антибиотикам.

Наборы, реагенты для исследования, диагностические средства и терапевтические средства

Соединения настоящего изобретения можно использовать для диагностики, лечения и профилактики, а также в качестве реагентов для исследований и компонентов наборов. Кроме того, антисмысловые олигонуклеотиды, способные ингибировать экспрессию гена с высокой специфичностью, часто используются рядовыми специалистами в данной области для выяснения функций конкретных генов или определения различий в функциях разных членов биологического пути.

В случае применения в составе наборов и в качестве диагностических средств в разных биологических системах соединения настоящего изобретения, по отдельности или в сочетании с другими соединениями или терапевтическими средствами, можно использовать в качестве инструментов в дифференциальных и/или комбинаторных анализах, проводимых для определения характера экспрессии части или всего комплекта генов, экспрессирующихся в клетках и тканях.

В данном описании термин "биологическая система" или "система" относится к любым организму, клетке, клеточной культуре или ткани, которые экспрессируют, или которым придана способность экспрессировать продукты генов аполипопротеина (ApoA1). Биологические системы включают в себя, без ограничения, людей, трансгенных животных, клетки, клеточные культуры, ткани, ксенотрансплантаты, трансплантаты и их сочетания.

В качестве неограничивающего примера определяют профили экспрессии в клетках или тканях, обработанных одним или более антисмысловыми соединениями, по сравнению с контрольными клетками или тканями, не обработанными антисмысловыми соединениями, затем полученные профили анализируют для разных уровней экспрессии генов, например, связанных с заболеванием, сигнальным путем, клеточной локализацией, уровнем экспрессии, размером, структурой или функцией исследуемых генов. Указанные анализы можно проводить на стимулированных или нестимулированных клетках и в присутствии или отсутствии других соединений, влияющих на профили экспрессии.

Примеры известных в данной области методов анализа экспрессии генов включают в себя применение чипов или микрочипов ДНК (Brazma and Vilo, FEBS Lett., 2000 480, 17-24; Celis, et al, FEBS Lett., 2000 480, 2-16), SAGE (серийный анализ экспрессии генов) (Madden, et al, Drug Discov. Today, 2000, 5, 415-425), READS (амплификация кДНК, расщепленной под действием фермента рестрикции) (Prashar and Weissman, Methods Enzymol, 1999, 303, 258-72), TOGA (общий анализ экспрессии генов) (Sutcliffe, et al, Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 1976-81), применение белковых чипов и протеомики (Celis, et al, FEBS Lett., 2000, 480, 2-16; Jungblut, et al, Electrophoresis, 1999, 20, 2100-10), секвенирование экспрессированного маркера последовательности (EST) (Celis, et al, FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotechnol, 2000, 80, 143-57), субтрактивный фингерпринтинг РНК (SuRF) (Fuchs, et al, Anal. Biochem., 2000, 286, 91-98; Larson, et al, Cytometry, 2000, 41, 203-208), субтрактивное клонирование, сравнительный анализ (DD) (Jurecic and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), сравнительную геномную гибридизацию (Carulli, et al., J. Cell Biochem. SuppL, 1998, 31, 286-96), FISH (флуоресцентный анализ гибридизации in situ) (Going and Gusterson, Eur. J. Cancer, 1999, 35, 1895-904) и масс-спектрометрию (To, Comb. Chem. High Throughput Screen, 2000, 3, 235-41).

Соединения данного изобретения можно использовать для исследовательских и диагностических целей, поскольку данные соединения гибридизуются с нуклеиновыми кислотами, кодирующими аполипопротеин (ApoA1). Например, олигонуклеотиды, которые гибридизуются с такой эффективностью и в таких условиях, что в соответствии с настоящим изобретением могут считаться эффективными модуляторами аполипопротеина (ApoA1), представляют собой эффективные праймеры или зонды в условиях, способствующих амплификации или детекции гена, соответственно. Указанные праймеры и зонды можно использовать в способах, основанных на специфической детекции молекул нуклеиновых кислот, кодирующих аполипопротеин (ApoA1), а также для амплификации указанных молекул нуклеиновых кислот с целью детекции или применения в других исследованиях аполипопротеина (ApoA1). Гибридизацию антисмысловых олигонуклеотидов данного изобретения, в частности праймеров и зондов, с нуклеиновой кислотой, кодирующей аполипопротеин (ApoA1), можно детектировать с помощью известных в данной области средств. Такие средства могут включать в себя конъюгацию фермента с олигонуклеотидом, мечение олигонуклеотида радиоактивным изотопом, или другие подходящие средства детекции. Кроме того, можно использовать наборы, содержащие такие средства для детекции уровня аполипопротеина (ApoA1) в образце.

Специфичность и чувствительность антисмысловых последовательностей также используются специалистами в данной области для терапевтических применений. Антисмысловые соединения используются как терапевтические средства для лечения болезненных состояний у животных, в том числе у людей. Существует опыт безопасного и эффективного введения людям лекарственных средств на основе антисмысловых олигонуклеотидов и в настоящее время проводятся многочисленные клинические испытания по применению таких средств. Таким образом, установлено, что антисмысловые соединения можно использовать в качестве терапевтических средств, и что их можно приспособить для применения в режимах лечения, включающих в себя обработку клеток, тканей и животных, особенно людей.

В случае применения в качестве терапевтических средств, животному, предпочтительно человеку, предположительно страдающему от заболевания или нарушения, которое можно лечить путем модулирования экспрессии полинуклеотидов аполипопротеина (ApoA1), вводят антисмысловые соединения настоящего изобретения. Например, в одном неограничивающем воплощении способы включают в себя стадию введения животному, нуждающемуся в лечении, терапвтически эффективного количества модулятора аполипопротеина (ApoA1). Модуляторы аполипопротеина (ApoA1) настоящего изобретения эффективно модулируют активность белка аполипопротеина (ApoA1) или экспрессию белка аполипопротеина (ApoA1). В одном воплощении активность или экспрессия аполипопротеина (ApoA1) у животного ингибируется примерно на 10% по сравнению с контролем. Предпочтительно активность или экспрессия аполипопротеина (ApoA1) у животного ингибируется примерно на 30%. Более предпочтительно активность или экспрессия аполипопротеина (ApoA1) у животного ингибируется на 50% или более. Так, олигомерные соединения модулируют экспрессию мРНК аполипопротеина (ApoA1), по меньшей мере, на 10%, по меньшей мере, на 50%, по меньшей мере, на 25%, по меньшей мере, на 30%, по меньшей мере, на 40%, по меньшей мере, на 50%, по меньшей мере, на 60%, по меньшей мере, на 70%, по меньшей мере, на 75%, по меньшей мере, на 80%, по меньшей мере, на 85%, по меньшей мере, на 90%, по меньшей мере, на 95%, по меньшей мере, на 98%, по меньшей мере, на 99%, или на 100% по сравнению с контролем.

В одном воплощении активность или экспрессия аполипопротеина (ApoA1) у животного повышается примерно на 10% по сравнению с контролем. Предпочтительно активность или экспрессия аполипопротеина (ApoA1) у животного повышается примерно на 30%. Более предпочтительно активность или экспрессия аполипопротеина (ApoA1) у животного повышается на 50% или более. Так, олигомерные соединения модулируют экспрессию мРНК аполипопротеина (ApoA1) по меньшей мере, на 10%, по меньшей мере, на 50%, по меньшей мере, на 25%, по меньшей мере, на 30%, по меньшей мере, на 40%, по меньшей мере, на 50%, по меньшей мере, на 60%, по меньшей мере, на 70%, по меньшей мере, на 75%, по меньшей мере, на 80%, по меньшей мере, на 85%, по меньшей мере, на 90%, по меньшей мере, на 95%, по меньшей мере, на 98%, по меньшей мере, на 99%, или на 100% по сравнению с контролем.

Например, уменьшение экспрессии аполипопротеина (ApoA1) можно измерить в сыворотке, крови, жировой ткани, печени или в любых других жидкостях, тканях или органах животного. Предпочтительно клетки, содержащиеся в указанных подлежащих анализу жидкостях, тканях или органах, содержат молекулу нуклеиновой кислоты, кодирующей пептиды аполипопротеина (ApoA1) и/или белок аполипопротеин (ApoA1) как таковой.

Соединения данного изобретения можно использовать в составе фармацевтических композиций, содержащих эффективное количество соединения и подходящий фармацевтически приемлемый разбавитель или носитель. Соединения и способы данного изобретения также можно использовать в профилактических целях.

Конъюгаты

Другая модификация олигонуклеотидов данного изобретения включает в себя химическое присоединение к олигонуклеотиду одного или более фрагментов или конъюгатов, которые повышают активность, облегчают распределение в клетке или поглощение клеткой олигонуклеотида. Указанные фрагменты или конъюгаты могут включать в себя конъюгатные группы, ковалентно связанные с функциональными группами, такими как первичные или вторичные гидроксильные группы. Конъюгатные группы данного изобретения включают в себя интеркаляторы, репортерные молекулы, полиамины, полиамиды, полиэтиленгликоли, простые полиэфиры, группы, которые улучшают фармакодинамические свойства олигомеров, и группы, которые улучшают фармакокинетические свойства олигомеров. Типичные конъюгатные группы включают в себя холестерины, липиды, фосфолипиды, биотин, феназин, фолат, фенантридин, антрахинон, акридин, флуоресцеины, родамины, кумарины и красители. Группы, которые улучшают фармакодинамические свойства, в контексте данного изобретения включают в себя группы, которые улучшают поглощение, повышают устойчивость к деградации и/или стабилизируют последовательность-специфичную гибридизацию с нуклеиновой кислотой-мишенью. Группы, которые улучшают фармакокинетические свойства, в контексте данного изобретения включают в себя группы, которые улучшают поглощение, распределение, метаболизм или экскрецию соединений настоящего изобретения. Примеры конъюгатных групп раскрыты в международной патентной заявке № PCT/US92/09196, поданной 23 октября 1992, и в патенте США № 6287860, которые включены в данное описание в качестве ссылки. Конъюгатные фрагменты включают в себя, без ограничения, фрагменты липидов, такие как фрагмент холестерина, холевую кислоту, простой тиоэфир, например, гексил-5-тритилтиол, тиохолестерин, алифатическую цепь, например, остатки додекандиола или ундецила, фосфолипид, например, дигексадецил-rac-глицерин или триэтиламмоний 1,2-ди-O-гексадецил-rac-глицеро-3-H-фосфонат, цепь полиамина или полиэтиленгликоля, или адамантануксусную кислоту, пальмитиловый фрагмент, или фрагмент октадециламин- или гексиламинокарбонилоксихолестерина. Олигонуклеотиды данного изобретения также можно конъюгировать с активными лекарственными средствами, такими как аспирин, варфарин, фенилбутазон, ибупрофен, супрофен, фенбуфен, кетопрофен, (S)-(+)-пранопрофен, карпрофен, дансилсаркозин, 2,3,5-трииодбензойная кислота, флуфенамовая кислота, фолиновая кислота, бензотиадиазид, хлортиазид, диазепин, индометацин, барбитурат, цефалоспорин, сульфа-содержащие средства, противодиабетические средства, противобактериальные средства или антибиотики.

Примеры патентов США, в которых описаны способы получения таких олигонуклеотидных конъюгатов, включают в себя, без ограничения патенты США №№ 4828979; 4948882; 5218105; 5525465; 5541313; 5545730; 5552538; 5578717, 5580731; 5580731; 5591584; 5109124; 5118802; 5138045; 5414077; 5486603; 5512439; 5578718; 5608046; 4587044; 4605735; 4667025; 4762779; 4789737; 4824941; 4835263; 4876335; 4904582; 4958013; 5082830; 5112963; 5214136; 5082830; 5112963; 5214136; 5245022; 5254469; 5258506; 5262536; 5272250; 5292873; 5317098; 5371241 5391723; 5416203 5451463; 5510475; 5512667; 5514785; 5565552; 5567810; 5574142; 5585481; 5587371; 5595726; 5597696; 5599923; 5599928 и 5688941.

Композиции

Соединения данного изобретения также могут быть смешаны, заключены в капсулу, конъюгированы или иным образом объединены с другими молекулами, молекулярными структурами или смесями соединений, такими как, например, липосомы, рецептор-специфичные молекулы, пероральные, ректальные, местные или другие композиции, облегчающими поглощение, распределение и/или абсорбцию. Примеры патентов США, в которых описаны способы получения таких композиций, облегчающих поглощение, распределение и/или абсорбцию, включают в себя, без ограничения, патенты США №№ 5108921; 5354844; 5416016; 5459127; 5521291; 5543165; 5547932; 5583020; 5591721; 4426330; 4534899; 5013556; 5108921; 5213804; 5227170; 5264221; 5356633; 5395619; 5416016; 5417978; 5462854; 5469854; 5512295; 5527528; 5534259; 5543152; 5556948; 5580575; и 5595756, каждый из которых включен в данное описание в качестве ссылки.

Хотя антисмысловые олигонуклеотиды не обязательно вводить в составе вектора для модуляции экспрессии и/или функции мишени, воплощения данного изобретения включают в себя конструкции векторов экспрессии антисмысловых олигонуклеотидов, которые содержат промоторы, последовательности составных промоторов и обладают высокой конститутивной промоторной активностью, или промоторной активностью, которую можно индуцировать в желательных обстоятельствах.

В одном воплощении осуществление изобретения включает в себя введение, по меньшей мере, одного из вышеописанных антисмысловых олигонуклеотидов с использованием подходящей системы доставки нуклеиновой кислоты. В одном воплощении данная система включает в себя невирусный вектор, функционально связанный с полинуклеотидом. Примеры таких невирусных векторов включают в себя только олигонуклеотид (например, один или более из SEQ ID NO: 81-173), или нуклеотид в сочетании с подходящей белковой, полисахаридной или липидной композицией.

Другие подходящие системы доставки нуклеиновой кислоты включают в себя вирусный вектор, который обычно содержит последовательность, по меньшей мере, одного из аденовируса, аденовирус-ассоциированного вируса (AAV), хелпер-зависимого аденовируса, ретровируса или комплекса гемагглютинирующий японский вирус (HVJ)-липосома. Предпочтительно вирусный вектор содержит активный эукариотический промотор, функционально связанный с полинуклеотидом, такой как промотор цитомегаловируса (CMV).

Другие предпочтительные векторы включают в себя вирусные векторы, гибридные белки и химические конъюгаты. Ретровирусные векторы включают в себя вирусы мышиного лейкоза Молони и вирусы на основе ВИЧ. Предпочтительный вирусный вектор на основе ВИЧ содержит, по меньшей мере, два вектора, где гены gag и pol получены из генома ВИЧ, а ген env получен из другого вируса. Векторы на основе ДНК-вирусов являются предпочтительными. Такие векторы включают в себя векторы на основе поксвируса, такого как ортопоксвирус или авипоксвирус, векторы на основе вируса герпеса, такого как вирус простого герпеса I (HSV) [Geller, A.I. et al., J. Neurochem, 64: 487 (1995); Lim, F., et al., in DNA Cloning: Mammalian Systems, D. Glover, Ed. (Oxford Univ. Press, Oxford England) (1995); Geller, A.I. et al., Proc Natl. Acad. ScL: U.S.A.:90 7603 (1993); Geller, A.I., et al., Proc Natl. Acad. Sci USA: 87:1149 (1990)], Adenovirus Vectors [LeGaI LaSaIIe et al., Science, 259:988 (1993); Davidson, et al., Nat. Genet. 3: 219 (1993); Yang, et al., J. Virol. 69: 2004 (1995)], и векторы на основе аденоассоциированного вируса [Kaplitt, M.G., et al., Nat. Genet. 8:148 (1994)].

Антисмысловые соединения данного изобретения включают в себя все фармацевтически приемлемые соли, сложные эфиры или соли таких эфиров, или любое другое соединение, которое после введения животному, в том числе человеку, способно продуцировать (непосредственно или косвенно) биологически активный метаболит или его остаток.

Термин "фармацевтически приемлемые соли" относится к физиологически и фармацевтически приемлемым солям соединений данного изобретения: т.е. к солям, которые сохраняют желательную биологическую активность исходного соединения и не вызывают нежелательных токсических эффектов. Предпочтительные примеры фармацевтически приемлемых солей олигонуклеотидов и способы их применения дополнительно описаны в патенте США № 6287860, который включен в данное описание в качестве ссылки.

Настоящее изобретение также включает в себя фармацевтические композиции и составы, содержащие антисмысловые соединения данного изобретения. Фармацевтические композиции настоящего изобретения можно вводить разными способами, в зависимости от того, желательно ли местное или системное воздействие, и от участка, который должен подвергаться воздействию. Введение может быть местным (такое как введение в глаз, в слизистые оболочки, включающее в себя вагинальную и ректальную доставку, легочное, например, путем ингаляции или инсуффляции порошков или аэрозолей, в том числе с помощью распылителя; интратрахеальное, интраназальное, эпидермальное и чрескожное), пероральным или парентеральным. Парентеральное введение включает в себя внутривенные, внутриартериальные, подкожные, внутрибрюшинные или внутримышечные инъекции или инфузии; или внутричерепное введение, например, интратекальное или интравентрикулярное. Олигонуклеотиды, содержащие, по меньшей мере, одну 2'-O-метоксиэтильную модификацию, считаются особенно подходящими для перорального введения. Фармацевтические композиции и составы для местного введения могут включать в себя чрескожные пластыри, мази, лосьоны, кремы, гели, капли, свечи, спреи, жидкости и порошки. Применение традиционных фармацевтических носителей, водных, порошкообразных или масляных основ, загустителей и т.п. может быть необходимым или желательным. Также можно использовать содержащие покрытие кондомы, перчатки и т.п.

Фармацевтические композиции настоящего изобретения, которые обычно находятся в виде стандартных лекарственных форм, можно получить с помощью традиционных методов, хорошо известных в фармацевтической промышленности. Такие методы включают в себя стадию объединения активных ингредиентов с фармацевтическим носителем (носителями) или наполнителем (наполнителями). Как правило, композиции получают путем равномерного и однородного смешивания активных ингредиентов с жидкими носителями или с мелкоизмельченными твердыми носителями, или с теми и другими, и при необходимости с последующим формованием продукта.

Композиции настоящего изобретения могут быть получены в виде любой из многих возможных лекарственных форм, включающих в себя, без ограничения, таблетки, капсулы, гелевые капсулы, жидкие сиропы, мягкие гели, свечи и клизмы. Композиции настоящего изобретения также могут быть получены в виде суспензий в водной, неводной или смешанной среде. Водные суспензии могут дополнительно содержать вещества, которые повышают вязкость суспензии, такие как, например, карбоксиметилцеллюлоза натрия, сорбит и/или декстран. Суспензия также может содержать стабилизаторы.

Фармацевтические композиции настоящего изобретения включают в себя, без ограничения, растворы, эмульсии, пенки и композиции, содержащие липосомы. Фармацевтические композиции и составы настоящего изобретения могут содержать одно или более веществ, способствующих проникновению, носителей, наполнителей или других активных или неактивных ингредиентов.

Эмульсии обычно представляют собой гетерогенные системы, в которых одна жидкость диспергирована в другой в виде капелек, размер которых обычно превышает 0,1 мкм в диаметре. Эмульсии могут содержать дополнительные компоненты помимо диспергированных фаз и активное лекарственное средство, которое может присутствовать в растворенном виде в водной или в масляной фазе, или как таковое в виде отдельной фазы. Микроэмульсии также входят в объем определения как воплощение настоящего изобретения. Эмульсии и их применение хорошо известны в данной области и дополнительно описаны в патенте США № 6287860.

Композиции настоящего изобретения включают в себя липосомальные композиции. В настоящем изобретении термин "липосома" обозначает везикулу, состоящую из амфифильных липидов, образующих сферический бислой или сферические бислои. Липосомы представляют собой однослойные или многослойные везикулы, которые состоят из мембраны, образованной липофильным веществом, и водной внутренней части, которая содержит предназначенную для высвобождения композицию. Катионные липосомы представляют собой положительно заряженные липосомы, которые предположительно взаимодействуют с отрицательно заряженными молекулами ДНК с образованием стабильного комплекса. Как полагают, pH-чувствительные или отрицательно заряженные липосомы скорее улавливают ДНК, чем образуют с ней комплекс. Для доставки ДНК в клетки используют как катионные, так и некатионные липосомы.

Липосомы также включают в себя "стерически стабилизированные" липосомы, термин, который в данном описании относится к липосомам, содержащим один или более специализированных липидов. При включении в липосомы эти специализированные липиды приводят к увеличению времени жизни липосом в кровотоке по сравнению с липосомами, не содержащими таких специализированных липидов. Примерами стерически стабилизированных липосом являются липосомы, в которых часть везикула-образующих липидов содержит один или более гликолипидов или дериватизирована одним или более гидрофильными полимерами, такими как полиэтиленгликолевый (PEG) фрагмент. Липосомы и способы их применения дополнительно описаны в патенте США № 6287860.

Фармацевтические составы и композиции настоящего изобретения также могут содержать поверхностно-активные вещества. Применение поверхностно-активных веществ в лекарственных продуктах, композициях и эмульсиях хорошо известно в данной области. Поверхностно-активные вещества и способы их применения дополнительно описаны в патенте США № 6287860, который включен в данное описание в качестве ссылки.

В одном воплощении настоящего изобретения, чтобы повысить эффективность доставки нуклеиновых кислот, в частности олигонуклеотидов, используют разные средства, способствующие проникновению. Помимо облегчения диффузии нелипофильных лекарственных средств через клеточные мембраны, средства, способствующие проникновению, также повышают способность к проникновению у липофильных лекарственных средств. Средства, способствующие проникновению, можно подразделить на пять основных категорий, а именно, поверхностно-активные вещества, жирные кислоты, соли желчных кислот, хелатирующие средства и нехелатирующие не поверхностно-активные вещества. Средства, способствующие проникновению, и способы их применения дополнительно описаны в патенте США № 6287860, который включен в данное описание в качестве ссылки.

Для специалиста в данной области очевидно, что композиции, как правило, получают в соответствии с их предполагаемым применением, т.е. способом введения.

Предпочтительные композиции для местного введения включают в себя композиции, которые содержат олигонуклеотиды данного изобретения в смеси со средством, обеспечивающим местную доставку, таким как липиды, липосомы, жирные кислоты, эфиры жирных кислот, стероиды, хелатирующие средства и поверхностно-активные вещества. Предпочтительные липиды и липосомы могут быть нейтральными (которые включают в себя диолеоил-фосфатидил DOPE этаноламин, димиристоилфосфатидилхолин DMPC, дистеароилфосфатидилхолин), отрицательно заряженными (которые включают в себя димиристоилфосфатидилглицерин DMPG) и катионными (которые включают в себя диолеоилтетраметиламинопропил DOTAP и диолеоилфосфатидилэтаноламин DOTMA).

Олигонуклеотиды данного изобретения, предназначенные для местного или другого введения, могут быть заключены в липосомы, или они могут образовывать комплексы с липосомами, особенно, с катионными липосомами. Альтернативно олигонуклеотиды могут образовывать комплексы с липидами, в частности, с катионными липидами. Предпочтительные жирные кислоты и их эфиры, а также их фармацевтически приемлемые соли и способы применения дополнительно описаны в патенте США № 6287860.

Композиции и составы для перорального введения включают в себя порошки или гранулы, микрочастицы, наночастицы, суспензии или растворы в воде или неводной среде, капсулы, гелевые капсулы, саше, таблетки или минитаблетки. Иногда желательно использовать загустители, ароматизирующие средства, разбавители, эмульгаторы, диспергирующие или связующие средства. Предпочтительные пероральные композиции содержат олигонуклеотиды данного изобретения в сочетании с одним или более веществами, способствующими проникновению, поверхностно-активными веществами и хелаторами. Предпочтительные поверхностно-активные вещества включают в себя жирные кислоты и/или их эфиры или соли, желчные кислоты и/или их соли. Предпочтительные желчные кислоты/соли и жирные кислоты и способы их применения дополнительно описаны в патенте США № 6287860, который включен в данное описание в качестве ссылки. Кроме того, предпочтительно использовать сочетания веществ, способствующих проникновению, например, жирные кислоты/соли в сочетании с желчными кислотами/солями. Особенно предпочтительное сочетание содержит натриевую соль лауриновой кислоты, каприновую кислоту и UDCA. Другие вещества, способствующие проникновению, включают в себя полиоксиэтилен-9-лауриловый эфир, полиоксиэтилен-20-цетиловый эфир. Олигонуклеотиды данного изобретения можно доставлять перорально, в гранулярной форме, включающей в себя высушенные распылением частицы, или собранные с образованием микро или наночастиц. Средства, образующие комплексы с олигонуклеотидами, и способы их применения дополнительно описаны в патенте США № 6287860, который включен в данное описание в качестве ссылки.

Композиции и составы для парентерального, интратекального или интравентрикулярного введения могут включать в себя стерильные водные растворы, которые также могут содержать буферы, разбавители и другие подходящие добавки, такие как, без ограничения, вещества, способствующие проникновению, соединения-носители и другие фармацевтически приемлемые носители или наполнители.

Некоторые воплощения данного изобретения предлагают фармацевтические композиции, содержащие одно или более олигомерных соединений и одно или более других химиотерапевтических средств, которые функционируют по механизму, отличному от антисмыслового. Примеры таких химиотерапевтических средств включают в себя, без ограничения, противораковые химиотерапевтические средства, такие как даунорубицин, дауномицин, дактиномицин, доксорубицин, эпирубицин, идарубицин, эзорубицин, блеомицин, мафосфамид, ифосфамид, цитозина арабинозид, бис-хлорэтил-нитрозомочевина, бусульфан, митомицин C, актиномицин D, митрамицин, преднизон, гидроксипрогестерон, тестостерон, тамоксифен, дакарбазин, прокарбазин, гексаметилмеламин, пентаметилмеламин, митоксантрон, амсакрин, хлорамбуцил, метилциклогексилнитрозомочевина, азотистый иприт, мелфалан, циклофосфамид, 6-меркаптопурин, 6-тиогуанин, цитарабин, 5-азацитидин, гидроксимочевина, дезоксикоформицин, 4-гидроксипероксициклофосфорамид, 5-фторурацил (5-FU), 5-фтордезоксиуридин (5-FUdR), метотрексат (MTX), колхицин, таксол, винкристин, винбластин, этопозид (VP-16), триметрексат, иринотекан, топотекан, гемцитабин, тенипозид, цисплатин и диэтилстильбэстрол (DES). При использовании с соединениями данного изобретения такие химиотерапевтические средства можно использовать отдельно (например, 5-FU и олигонуклеотид), последовательно (например, 5-FU и олигонуклеотид и через некоторое время MTX и олигонуклеотид), или в сочетании с одним или более другими такими химиотерапевтическими средствами (такими как 5-FU, MTX и олигонуклеотид, или 5-FU, лучевая терапия и олигонуклеотид). Противовоспалительные средства, включающие в себя, без ограничения, нестероидные противовоспалительные средства и кортикостероиды, и противовирусные средства, включающие в себя, без ограничения, рибавирин, видарабин, ацикловир и ганцикловир, также можно сочетать с композициями данного изобретения. Сочетания антисмысловых соединений и других неантисмысловых лекарственных средств также входят в объем данного изобретения. Два или более соединения, входящих в состав сочетания, можно использовать одновременно или последовательно.

В другом родственном воплощении композиции данного изобретения могут содержать одно или более антисмысловых соединений, в частности олигонуклеотидов, направленных на первую нуклеиновую кислоту, и одно или более других антисмысловых соединений, направленных на вторую нуклеиновую кислоту-мишень. Например, первая мишень может представлять собой конкретную антисмысловую последовательность аполипопротеина (ApoA1), а вторая мишень может представлять собой участок другой нуклеотидной последовательности. Альтернативно композиции данного изобретения могут содержать два или более антисмысловых соединений, направленных на разные участки одной целевой нуклеиновой кислоты аполипопротеина (ApoA1). Многочисленные примеры антисмысловых соединений описаны в данном документе, а другие можно выбрать среди подходящих соединений, известных в данной области. Два или более соединения, входящих в состав сочетания, можно использовать одновременно или последовательно.

Дозирование

Считается, что получение терапевтических композиций и их последующее введение (дозирование) относятся к компетенции специалистов в данной области. Дозирование зависит от тяжести болезненного состояния, подлежащего лечению, и его способности к ответной реакции, при этом курс лечения может продолжаться от нескольких дней до нескольких месяцев, или до достижения излечения или облегчения болезненного состояния. Оптимальные режимы дозирования можно рассчитать на основе измерения накопления лекарственного средства в организме пациента. Рядовые специалисты в данной области могут легко определить оптимальные дозы, методологии дозирования и частоту повторения. Оптимальные дозы могут варьировать в зависимости от относительной активности отдельных олигонуклеотидов и, как правило, могут быть рассчитаны на основе EC50, определенных in vitro и in vivo у животных моделей. Как правило, дозу, составляющую от 0,01 мкг до 100 г на кг массы тела, можно вводить один или более раз в день, неделю, месяц или год, или даже один раз каждые 2-20 лет. Рядовые специалисты в данной области могут легко определить частоту повторения дозирования на основе измерения времени пребывания в организме и концентраций лекарственного средства в жидкостях или тканях организма. После успешного завершения лечения иногда желательно провести для пациента поддерживающую терапию, чтобы предотвратить рецидив болезненного состояния, где олигонуклеотид вводят в поддерживающих дозах, варьирующих от 0,01 мкг до 100 г на кг массы тела, от одного или более раз в день до одного раза каждые 20 лет.

Хотя выше описаны разные воплощения настоящего изобретения, следует понимать, что они приведены только для иллюстрации, но не для ограничения. В соответствии с приведенным здесь описанием, в раскрытые воплощения можно внести многочисленные изменения, не отступая от сущности и объема настоящего изобретения. Таким образом, сущность и объем настоящего изобретения не ограничиваются описанными выше воплощениями.

Все упомянутые здесь документы включены в настоящее описание в качестве ссылки. Все публикации и патентные документы, цитирующиеся в данной заявке, включены в качестве ссылки для любой цели, в такой степени, как если бы каждая отдельная публикация или каждый патентный документ были бы указаны отдельно. Цитирование разных ссылок в данном документе не является допущением, что какая-либо конкретная ссылка относится к "известному уровню техники" данного изобретения. Воплощения композиций и способов изобретения иллюстрируются в нижеследующих примерах.

ПРИМЕРЫ

Нижеследующие неограничивающие примеры служат для иллюстрации отдельных воплощений данного изобретения. Специалисты в данной области могут варьировать соотношения и виды элементов показанных компонентов, причем такие вариации входят в объем воплощений настоящего изобретения.

Пример 1: Конструирование антисмысловых олигонуклеотидов, специфичных к антисмысловой и/или смысловой цепи молекулы полинуклеотида аполипопротеина (ApoA1)

Как указано выше, термин "олигонуклеотид, специфичный к" или "олигонуклеотид, направленный на" относится к олигонуклеотиду, последовательность которого (i) способна образовывать стабильный комплекс с фрагментом гена-мишени или (ii) способна образовывать стабильный дуплекс с фрагментом транскрипта мРНК гена-мишени.

Выбор подходящих олигонуклеотидов осуществляют с помощью компьютерных программ, которые автоматически выравнивают нуклеотидные последовательности и указывают участки идентичности или гомологии. Такие программы используют, например, для сравнения нуклеотидных последовательностей, полученных в результате поиска в базах данных, таких как GenBank, или путем секвенирования продуктов ПЦР. Сравнение нуклеотидных последовательностей, полученных из разных видов, позволяет выбрать нуклеотидные последовательности, которые обладают соответствующей степенью межвидовой идентичности. Если гены не подвергались секвенированию, степень идентичности генов целевых видов и генов других видов определяют методом саузерн-блоттинга. Путем проведения саузерн-блоттинга в условиях разной жесткости, хорошо известных в данной области, можно определить примерное значение идентичности. С помощью указанных процедур можно выбрать олигонуклеотиды, обладающие высокой степенью комплементарности по отношению к целевым нуклеотидным последовательностям субъекта, подлежащего обработке, и низкой степенью комплементарности по отношению к соответствующим нуклеотидным последовательностям, полученным из других видов. Для специалистов в данной области очевидно, что существует широкая свобода действий при выборе подходящих участков генов для применения в настоящем изобретении.

Антисмысловое соединение "специфически гибридизуется", если связывание соединения с нуклеиновой кислотой-мишенью препятствует нормальному функционированию нуклеиновой кислоты-мишени, приводя к модуляции ее функции и/или активности, и существует степень комплементарности, достаточная для того, чтобы избежать неспецифического связывания антисмыслового соединения с нуклеотидными последовательностями-не мишенями в условиях, в которых желательно образование специфического связывания, т.е. в физиологических условиях в случае анализов in vivo или терапевтического лечения, и в условиях проведения анализов in vitro.

Гибридизационные свойства описанных здесь олигонуклеотидов можно определить с помощью одного или более in vitro анализов, известных в данной области. Например, свойства олигонуклеотидов, описанных в данном документе, можно определить путем измерения прочности связывания природной антисмысловой последовательности-мишени с потенциальной лекарственной молекулой путем анализа кривой плавления.

Прочность связывания природной антисмысловой последовательности-мишени с потенциальной лекарственной молекулой (Молекула) можно определить с помощью любого традиционного метода измерения интенсивности межмолекулярных взаимодействий, например, путем анализа кривой плавления.

Анализ кривой плавления позволяет определить температуру, при которой происходит быстрое превращение двухцепочечной конформации комплекса природная антисмысловая последовательность/Молекула в одноцепочечную. Данная температура широко используется в качестве надежной меры силы взаимодействия между двумя молекулами.

Анализ кривой плавления можно проводить с использованием копии кДНК существующей в природе антисмысловой молекулы РНК или синтетического нуклеотида ДНК или РНК, соответствующей связывающему участку Молекулы. Существует несколько наборов, содержащих все необходимые реагенты для проведения данного анализа (например, набор MeltDoctor, Applied Biosystems Inc.). Такие наборы содержат подходящий буферный раствор, содержащий один из красителей, связывающихся с двухцепочечной ДНК (дцДНК) (таких как красители ABI HRM, SYBR Green, SYTO и другие). Красители для дцДНК практически не испускают флуоресцентное излучение в свободной форме, но обладают интенсивной флуоресценцией при связывании с дцДНК.

При проведении анализа кДНК соответствующего олигонуклеотида смешивают с Молекулой в концентрациях, указанных в инструкциях производителя. Смесь нагревают до 95°C, чтобы диссоциировать все ранее образовавшиеся комплексы дцДНК, затем медленно охлаждают до комнатной температуры или другой более низкой температуры, указанной производителем набора, чтобы обеспечить отжиг молекул ДНК. Вновь образованные комплексы медленно нагревают до 95°C и одновременно проводят непрерывную регистрацию количества флуоресценции, продуцирующегося в процессе реакции. Интенсивность флуоресценции обратно пропорциональна количеству дцДНК, присутствующей в реакции. Данные собирают с помощью прибора для проведения ПЦР в режиме реального времени, совместимого с набором (такого как прибор ABFs StepOne Plus Real Time PCR System or LightTyper, Roche Diagnostics, Lewes, UK).

Пики плавления получают путем построения графика зависимости отрицательного производного флуоресценции относительно температуры (по оси y откладывают значения (-d(флуоресценция)/dT)) от температуры (ось x) с помощью подходящего программного обеспечения (такого как LightTyper (Roche) или SDS Dissociation Curve, ABI). В результате анализа данных определяют температуру быстрого превращения комплекса дцДНК в одноцепочечные молекулы. Данная температура, называемая Тпл, прямо пропорциональна силе взаимодействия двух молекул. Как правило, Тпл превышает 40°C.

Пример 2: Модуляция полинуклеотидов ApoA1

Материалы и методы:

Клетки обрабатывают с помощью одного из следующих способов:

Способ 1: Обработка клеток HepG2 оголенными антисмысловыми олигонуклеотидами

Клетки HepG2 из коллекции ATCC (№ по каталогу HB-8065) выращивают в питательной среде (MEM/EBSS (Hyclone, № по каталогу SH30024, или Mediatech, № по каталогу MT-10-010CV) + 10% FBS (Mediatech, № по каталогу MT35-011-CV) + пенициллин/стрептомицин (Mediatech, № по каталогу MT30-002-CI)) при 37°C в атмосфере 5% CO2. За день до эксперимента клетки пересевают с плотностью 0,5×104/мл в 6-луночные планшеты и инкубируют при 37°C в атмосфере 5% CO2. В день эксперимента среду в 6-луночных планшетах заменяют свежей питательной средой в количестве 1,5 мл/лунку.

Все антисмысловые олигонуклеотиды разбавляют водой до концентрации 20 мкМ. 2 мкл полученного раствора смешивают с 400 мкл свежей питательной среды и добавляют в каждую лунку 6-луночного планшета, содержащего клетки HepG2. Подобную смесь, содержащую 2 мкл воды вместо раствора олигонуклеотида используют в качестве контроля с мнимой обработкой. После инкубации в течение 3-18 ч при 37°C в атмосфере 5% CO2 среду заменяют свежей питательной средой. Через 72 ч после добавления антисмысловых олигонуклеотидов проводят повторную обработку клеток по описанному выше способу. Через 48-72 ч после повторной обработки среду удаляют и из клеток экстрагируют РНК, используя систему для выделения общей РНК SV, Promega (№ по каталогу Z3105), или набор для выделения общей РНК RNeasy, Qiagen (№ по каталогу 74181), в соответствии с инструкциями производителей. 600 нг РНК используют для проведения реакции обратной транскрипции с помощью набора Verso cDNA, Thermo Scientific (№ по каталогу AB1453B), в соответствии с инструкцией производителя. кДНК, полученную в результате реакции обратной транскрипции, используют для определения экспрессии гена методом ПЦР в режиме реального времени с использованием набора для экспрессии генов ABI Taqman (№ по каталогу 4369510) и праймеров/зондов, сконструированных ABI (для 18S № по каталогу 4319413E, для ApoA1 - Hs00163641_m1, Applied Biosystems Inc., Foster City CA). ПЦР проводят с использованием следующего цикла: 50°C в течение 2 мин, 95°C в течение 10 мин, 40 циклов (95°C в течение 15 секунд, 60°C в течение 1 мин), и термоциклера Mx4000 (Stratagene). Кратность изменения экспрессии гена после обработки антисмысловыми олигонуклеотидами рассчитывают на основе различия нормализованных по 18S значений dCt в обработанных образцах и в образцах с мнимой трансфекцией.

Способ 2: Обработка клеток HepG2 антисмысловыми олигонуклеотидами

Клетки HepG2 из коллекции ATCC (№ по каталогу HB-8065) выращивают в питательной среде (MEM/EBSS (Hyclone, № по каталогу SH30024, или Mediatech, № по каталогу MT-10-010-CV) + 10% FBS (Mediatech, № по каталогу MT35-011-CV) + пенициллин/стрептомицин (Mediatech, № по каталогу MT30-002-CI)) при 37°C в атмосфере 5% CO2. За день до эксперимента клетки пересевают с плотностью 0,5×105/мл в 6-луночные планшеты и инкубируют при 37°C в атмосфере 5% CO2. В день эксперимента среду в 6-луночных планшетах заменяют свежей питательной средой. Все антисмысловые олигонуклеотиды разбавляют до концентрации 20 мкМ. 2 мкл полученного раствора инкубируют с 400 мкл среды Opti-MEM (Gibco, № по каталогу 31985-070) и 4 мкл липофектамина 2000 (Invitrogen, № по каталогу 11668019) при комнатной температуре в течение 20 мин и затем добавляют в каждую лунку 6-луночного планшета, содержащего клетки HepG2. Подобную смесь, содержащую 2 мкл воды вместо раствора олигонуклеотида, используют в качестве контроля с мнимой обработкой. После инкубации в течение 3-18 ч при 37°C в атмосфере 5% CO2 среду заменяют свежей питательной средой. Через 48 ч после добавления антисмысловых олигонуклеотидов среду удаляют и из клеток экстрагируют РНК, используя систему для выделения общей РНК SV, Promega (№ по каталогу Z3105), или набор для выделения общей РНК RNeasy, Qiagen (№ по каталогу 74181), в соответствии с инструкциями производителей. 600 нг РНК используют для проведения реакции обратной транскрипции с помощью набора Verso cDNA, Thermo Scientific (№ по каталогу AB1453B), в соответствии с инструкцией производителя. кДНК, полученную в результате реакции обратной транскрипции, используют для определения экспрессии гена методом ПЦР в режиме реального времени с использованием набора для экспрессии генов ABI Taqman (№ по каталогу 4369510) и праймеров/зондов, сконструированных ABI (для 18S № по каталогу 4319413E, для ApoA1 - Hs00163641_m1, Applied Biosystems Inc., Foster City CA). ПЦР проводят с использованием следующего цикла: 50°C в течение 2 мин, 95°C в течение 10 мин, 40 циклов (95°C в течение 15 секунд, 60°C в течение 1 мин), и термоциклера Mx4000 (Stratagene). Кратность изменения экспрессии гена после обработки антисмысловыми олигонуклеотидами рассчитывают на основе различия нормализованных по 18S значений dCt в обработанных образцах и в образцах с мнимой трансфекцией.

Результаты:

Результаты ПЦР в режиме реального времени демонстрируют, что уровни мРНК ApoA1 значительно выше в клетках HepG2 через 48 ч после обработки антисмысловыми олигонуклеотидами против антисмысловой последовательности DA327409ext ApoA1 (фиг. 1).

Пример 3: Модуляция экспрессии гена ApoA1

Материалы и методы:

Клетки обрабатывают с помощью одного из следующих способов:

Способ 1: Обработка клеток HepG2 оголенными антисмысловыми олигонуклеотидами

Клетки HepG2 выращивают в MEM/EBSS (Hyclone (№ по каталогу SH30024)) + 10% FBS + пенициллин/стрептомицин при 37°C в атмосфере 5% CO2. За день до эксперимента клетки пересевают с плотностью 1,5×104/мл в 6-луночные планшеты и оставляют при 37°C в атмосфере 5% CO2. В день эксперимента среду в 6-луночных планшетах заменяют на свежую MEM/EBSS + 10% FBS. Все антисмысловые олигонуклеотиды, изготовленные IDT, разбавляют до концентрации 20 мкМ. 2 мкл полученного раствора инкубируют с 400 мкл среды Opti-MEM (Gibco, № по каталогу 31985-070) и добавляют в каждую лунку 6-луночного планшета, содержащего клетки HepG2. Подобную смесь, содержащую 2 мкл воды вместо раствора олигонуклеотида используют в качестве контроля с мнимой трансфекцией. Через 72 ч после добавления антисмысловых олигонуклеотидов среду удаляют и проводят повторную обработку по описанному выше способу. Через 48-72 ч после повторной обработки из клеток экстрагируют РНК, используя систему для выделения общей РНК SV, Promega (№ по каталогу Z3105), или набор для выделения общей РНК RNeasy, Qiagen (№ по каталогу 74181), в соответствии с инструкциями производителей. 600 нг РНК используют для проведения реакции обратной транскрипции с помощью набора Verso cDNA, Thermo Scientific (№ по каталогу AB1453B), в соответствии с инструкцией производителя. кДНК, полученную в результате реакции обратной транскрипции, используют для определения экспрессии гена методом ПЦР в режиме реального времени с использованием набора для экспрессии генов ABI Taqman (№ по каталогу 4369510) и праймеров/зондов, сконструированных ABI (для 18S № по каталогу 4319413E, для ApoA1 - Hs00163641_m1, и индивидуальный заказ для антисмысловой последовательности DA327409ext ApoA1, Applied Biosystems Inc., Foster City CA). ПЦР проводят с использованием следующего цикла: 50°C в течение 2 мин, 95°C в течение 10 мин, 40 циклов (95°C в течение 15 секунд, 60°C в течение 1 мин), и термоциклера Mx4000 (Stratagene). Кратность изменения экспрессии гена после обработки антисмысловыми олигонуклеотидами рассчитывают на основе различия нормализованных по 18S значений dCt в обработанных образцах и в образцах с мнимой трансфекцией.

Для анализа Taqman конструируют по индивидуальному заказу праймеры и зонды, специфичные к природной антисмысловой последовательности DA327409ext ApoA1. Заглавные буквы обозначают немодифицированные дезоксирибонуклеотиды.

Последовательность прямого праймера: CTCCTCCTGCCACTTCTTCTG (SEQ ID NO: 163)

Последовательность обратного праймера: CTGGTGGATGAAGAAGGTTTGC (SEQ ID NO: 164)

Последовательность зонда (FAM-меченного): TTTGGATCTGGACGACTTC (SEQ ID NO: 165)

Способ 2: Обработка клеток HepG2 антисмысловыми олигонуклеотидами

Клетки HepG2 из коллекции ATCC (№ по каталогу HB-8065) выращивают в питательной среде (MEM/EBSS (Hyclone, № по каталогу SH30024, или Mediatech, № по каталогу MT-10-010-CV) + 10% FBS (Mediatech, № по каталогу MT35-011-CV) + пенициллин/стрептомицин (Mediatech, № по каталогу MT30-002-CI) при 37°C в атмосфере 5% CO2. За день до эксперимента клетки пересевают с плотностью 1,5×105/мл в 6-луночные планшеты и инкубируют при 37°C в атмосфере 5% CO2. В день эксперимента среду в 6-луночных планшетах заменяют свежей питательной средой. Все антисмысловые олигонуклеотиды разбавляют до концентрации 20 мкМ. 2 мкл полученного раствора инкубируют с 400 мкл среды Opti-MEM (Gibco, № по каталогу 31985-070) и 4 мкл липофектамина 2000 (Invitrogen, № по каталогу 11668019) при комнатной температуре в течение 20 мин и затем добавляют в каждую лунку 6-луночного планшета, содержащего клетки HepG2. Подобную смесь, содержащую 2 мкл воды вместо раствора олигонуклеотида, используют в качестве контроля с мнимой обработкой. После инкубации в течение 3-18 ч при 37°C в атмосфере 5% CO2 среду заменяют свежей питательной средой. Через 48 ч после добавления антисмысловых олигонуклеотидов среду удаляют и из клеток экстрагируют РНК, используя систему для выделения общей РНК SV, Promega (№ по каталогу Z3105), или набор для выделения общей РНК RNeasy, Qiagen (№ по каталогу 74181), в соответствии с инструкциями производителей. 600 нг РНК используют для проведения реакции обратной транскрипции с помощью набора Verso cDNA, Thermo Scientific (№ по каталогу AB1453B), в соответствии с инструкцией производителя. кДНК, полученную в результате реакции обратной транскрипции, используют для определения экспрессии гена методом ПЦР в режиме реального времени с использованием набора для экспрессии генов ABI Taqman (№ по каталогу 4369510) и праймеров/зондов, сконструированных ABI (для 18S № по каталогу 4319413E, для ApoA1 - Hs00163641_m1, и индивидуальный заказ для антисмысловой последовательности DA327409ext ApoA1, Applied Biosystems Inc., Foster City CA). ПЦР проводят с использованием следующего цикла: 50°C в течение 2 мин, 95°C в течение 10 мин, 40 циклов (95°C в течение 15 секунд, 60°C в течение 1 мин), и термоциклера Mx4000 (Stratagene). Кратность изменения экспрессии гена после обработки антисмысловыми олигонуклеотидами рассчитывают на основе различия нормализованных по 18S значений dCt в обработанных образцах и в образцах с мнимой трансфекцией.

Для анализа Taqman конструируют по индивидуальному заказу праймеры и зонды, специфичные к природной антисмысловой последовательности DA327409ext ApoA1. Заглавные буквы обозначают немодифицированные дезоксирибонуклеотиды.

Последовательность прямого праймера: CTCCTCCTGCCACTTCTTCTG (SEQ ID NO: 163)

Последовательность обратного праймера: CTGGTGGATGAAGAAGGTTTGC (SEQ ID NO: 164)

Последовательность зонда (FAM-меченного): TTTGGATCTGGACGACTTC (SEQ ID NO: 165)

Обработка первичных гепатоцитов обезьяны. Первичные гепатоциты обезьяны, культура которых получена RxGen Inc., помещают в 6-луночные планшеты. Их обрабатывают олигонуклеотидами следующим образом. Среду в 6-луночных планшетах заменяют свежей питательной средой, состоящую из среды Уильяма E (Sigma, № по каталогу W4128), дополненной 5% FBS, 50 ед./мл пенициллина и 50 мкг/мл стрептомицина, 4 мкг/мл инсулина, 1 мкM дексаметазона, 10 мкг/мл фунгина (InVivogen, San Diego CA). Все антисмысловые олигонуклеотиды разбавляют до концентрации 20 мкМ. 2 мкл полученного раствора инкубируют с 400 мкл среды Opti-MEM (Gibco, № по каталогу 31985-070) и 4 мкл липофектамина 2000 (Invitrogen, № по каталогу 11668019) при комнатной температуре в течение 20 мин и затем добавляют в каждую лунку 6-луночного планшета, содержащего клетки HepG2. Подобную смесь, содержащую 2 мкл воды вместо раствора олигонуклеотида, используют в качестве контроля с мнимой обработкой. После инкубации в течение 3-18 ч при 37°C в атмосфере 5% CO2 среду заменяют свежей питательной средой. Через 48 ч после добавления антисмысловых олигонуклеотидов среду удаляют и из клеток экстрагируют РНК, используя систему для выделения общей РНК SV, Promega (№ по каталогу Z3105), или набор для выделения общей РНК RNeasy, Qiagen (№ по каталогу 74181), в соответствии с инструкциями производителей. 600 нг РНК используют для проведения реакции обратной транскрипции с помощью набора Verso cDNA, Thermo Scientific (№ по каталогу AB1453B), в соответствии с инструкцией производителя. кДНК, полученную в результате реакции обратной транскрипции, используют для определения экспрессии гена методом ПЦР в режиме реального времени с использованием набора для экспрессии генов ABI Taqman (№ по каталогу 4369510) и праймеров/зондов, сконструированных ABI (для 18S № по каталогу 4319413Е, для ApoA1 - Hs00163641_m1, и индивидуальный заказ для антисмысловой последовательности DA327409ext ApoA1, Applied Biosystems Inc., Foster City CA). ПЦР проводят с использованием следующего цикла: 50°С в течение 2 мин, 95°С в течение 10 мин, 40 циклов (95°С в течение 15 секунд, 60°С в течение 1 мин), и термоциклера Мх4000 (Stratagene). Кратность изменения экспрессии гена после обработки антисмысловыми олигонуклеотидами рассчитывают на основе различия нормализованных по 18S значений dCt в обработанных образцах и в образцах с мнимой трансфекцией.

Метод ELISA проводят с использованием набора ApoA1 ELISA MabTech Inc. (№ по каталогу 3710-11-6) в соответствии с инструкциями производителя.

Результаты показаны на фигурах 2, 3, 4 и 5. На фигуре 2 показано, что и олигонуклеотиды с фосфотиоатными скелетами, т.е. межнуклеотидными связями, и олигонуклеотиды LNA эффективно модулируют экспрессию гена-мишени, которую определяют путем измерения количеств мРНК ApoA1 (верхняя панель) и антисмысловой РНК DA327409ext ApoA1 (нижняя панель). На фигуре 3 показаны уровни природной последовательности DA327409ext, антисмысловой по отношению к РНК ApoA1 (первый столбик в каждой паре столбиков, не закрашенный) и ApoA1 мРНК (второй столбик в каждой паре столбиков, закрашенный) в клетках HepG2, обработанных олигонуклеотидами, направленными против DA327409ext. На фигуре 4 показана дозозависимая повышающая регуляция мРНК (нижняя панель) и белка (верхняя панель) ApoA1 в культурах HepG2, обработанных олигонуклеотидами, направленными против DA327409ext. На фигуре 5 показана повышающая регуляция мРНК ApoA1 в первичных гепатоцитах африканской зеленой мартышки после обработки олигонуклеотидами, направленными против DA327409ext.

Пример 4: Исследование эффективности и продолжительности действия CUR-962 у африканской зеленой мартышки

Целью данного исследования является определение и сравнение эффекта антисмыслового нокдауна дискордантной некодирующей антисмысловой последовательности, которая регулирует гены ApoA1, после внутривенного введения модели примата, отличного от человека. Тестируемые препараты антисмыслового олигонуклеотида, сконструированные для ингибирования регуляторных последовательностей ApoA1, обозначают CUR-962.

CUR-962: +G*+C*T* A*G*T* C*T*G* +T*+T*+G (SEQ ID NO: 170).

CUR-963 (контроль): +G*+T*C*T*G*A*T*G*G*+A*+G*+A (SEQ ID NO: 171).

НОРМАТИВНЫЕ РЕКОМЕНДАЦИИ ПО ТЕСТИРОВАНИЮ

Данное исследование проводят в соответствии с принятыми токсикологическими принципами и согласованным трехсторонним руководством Международной конференции по согласованию (ICH) (доклиническое исследование безопасности для проведения клинических испытаний фармацевтических препаратов на людях ICH M3(m), 9 ноября 2000), и, как правило, в соответствии с принятыми процедурами тестирования терапевтических средств.

ТЕСТИРУЕМЫЕ И КОНТРОЛЬНЫЕ ПРЕПАРАТЫ

Идентичность и получение тестируемого препарата

Тестируемый препарат, CUR-962, представляет собой химически стабилизированный антисмысловой олигонуклеотид. В качестве среды для внутривенной доставки используют забуференный фосфатом физиологический раствор (PBS).

Характеристика среды

Состав, номер партии, срок хранения и условия хранения (температура и режим свет/темнота) среды PBS указывает поставщик.

Хранение и обработка тестируемого препарата

Тестируемый препарат и среду хранят в соответствии с условиями хранения, рекомендуемыми заказчиком и производителем, соответственно.

Анализ композиций тестируемого препарата

Образцы композиции тестируемого препарата хранят в замороженном состоянии до анализа концентрации, стабильности и гомогенности композиции тестируемого препарата.

ОПТИМАЛЬНАЯ СИСТЕМА ТЕСТИРОВАНИЯ

Приматы включают в себя подходящие, отличные от грызунов виды, приемлемые для контролирующих органов как показатели потенциальной опасности, для которых существуют подробные исходные данные. Африканская зеленая мартышка конкретно представляет собой в высокой степени подходящую для клинических исследований модель многочисленных физиологических и болезненных состояний человека.

Внутривенный способ введения представляет собой терапевтический способ, подходящий для человека. Дозу тестируемых препаратов определяют на основе результатов исследований по подбору дозы аналогичных соединений, ранее проводимых на африканской зеленой мартышке.

Африканскую зеленую мартышку выбирают в качестве примата, поскольку последовательности, являющиеся мишенями для тестируемых препаратов, обладают консервативностью среди разных видов со 100% гомологией у приматов. Кроме того, тестируемое вещество представляет собой синтетический олигонуклеотид. Следовательно, введение приматам обеспечивает превосходную оценку эффективности указанных соединений и лучше отражает характер усвоения, по всей вероятности, наблюдающийся у людей, чем введение другим видам.

ЖИВОТНЫЕ

Виды

Chlorocebus sabaeus, отличный от человека примат

Порода

Африканская зеленая мартышка, обитающая на Сент-Китсе.

Источник

RxGen, Lower Bourryeau, St. Kitts, West Indies.

Предполагаемый возраст

Тестируемые животные являются взрослыми.

Предполагаемая масса тела

Масса тела обезьян составляет примерно 3-4 кг. Реальная масса может варьировать, но вариации должны быть отражены в результатах.

Пол

Тестируемые животные представляют собой взрослых самок.

Число животных

Десять животных подвергают скринингу, чтобы идентифицировать 8, подходящих для участия в исследовании.

Число животных, участвующих в исследовании

Самки: 8

Обоснование числа животных, участвующих в исследовании

Данное исследование разработано для применения минимально возможного числа животных, в соответствии с основной целью определения терапевтической эффективности тестируемого препарата у африканской зеленой мартышки и предварительными исследованиями по системному введению олигонуклеотидов данного типа животным этого вида.

Характеристика животных

В данном исследовании используют десять взрослых африканских зеленых мартышек с массой тела в диапазоне от 3 до 4 кг. Мартышки представляют собой не подвергавшихся воздействию лекарственных препаратов взрослых животных, гуманно выловленных из дикой популяции, населяющей остров. Выловленных мартышек обрабатывают противоглистными средствами, чтобы исключить любое возможное присутствие паразитов в кишечнике, и наблюдают в изоляторе в течение минимум 4 недель перед скринингом на пригодность к участию в исследовании. Возраст выловленных мартышек определяют по размеру и зубам, исключая старых животных из исследования. Перед участием в исследовании проводят клинический осмотр каждой мартышки, включающий в себя оценку двигательной активности и физической ловкости. Берут образцы крови и посылают их в Antech Diagnostics (Memphis, TN) для полного клинического биохимического анализа, общего анализа крови и профиля липидов (описание можно найти в разделах 9.2 и 319567928). Мартышки с аномальными результатами анализов по сравнению с нормальным диапазоном, установленным для обезьян колонии Сент-Киттса, исключаются из исследования. Чтобы идентифицировать 8 мартышек, которые удовлетворяют данному критерию, 10 обезьян подвергают скринингу и при необходимости проводят скрининг дополнительных животных. Перед началом исследования выбранных обезьян переводят в отдельные клетки, чтобы акклиматизировать их к пребыванию в отдельных клетках в течение одной недели. Только животные, которых считают подходящими для проведения эксперимента, участвуют в исследовании. Диапазоны фактических (или определенных) возраста и массы в начале исследования подробно описаны в исходных данных и конечном отчете.

Здоровье и благополучие животных

Наивысшие стандарты благополучия животных вытекают из и придерживаются руководств, предусмотренных Департаментом сельского хозяйства Сент-Киттса и Министерством здравоохранения и социальных служб США. Все исследования проводят в соответствии с указанными требованиями и всеми применимыми нормами по уходу и содержанию лабораторных животных. Все используемые стандарты по уходу за животными, проведение эксперимента и мероприятия по контролю находятся в соответствии с Руководством NIH по уходу и применением животных. Средства обслуживания Св. Киттса поддерживают комитет по исследованию животных, который рассматривает протоколы и инспектирует оборудование в соответствии с Руководством. Фонд имеет утвержденную гарантию, представленную Службой по защите лабораторных животных, в соответствии с руководством #A4384-01 (Исследовательский фонд Axion/Биомедицинский фонд Сент-Киттса). Особые проблемы по ветеринарному уходу за отличными от человека приматами отсутствуют, как и проблемы биоопасности, являющиеся предметом исследования, описанного в данном документе.

Содержание животных и окружающая среда

Чтобы диагностировать симптомы, связанные с лечением, животных держат по отдельности до хирургического вмешательства и после операции до умерщвления. Помещение для приматов, в котором находятся индивидуальные клетки, полностью освещается естественным освещением, которое примерно соответствует 12-часовому периоду при 17 градусах северной широты: 12 ч цикл чередования света и темноты, как рекомендуется в руководствах D.H.H.S США. Помещение для приматов RxGen полностью проветривается внешним воздухом. Постоянную температуру 23-35°C, которая обычно присутствует на Сент-Киттсе в течение всего года, поддерживают путем дополнительного движения воздуха, обеспечиваемого потолочным вентилятором. Ежедневно измеряют крайние значения температуры и относительной влажности (которая также не контролируется), наблюдающиеся в течение двадцати четырех часов. На протяжении исследования клетки регулярно чистят.

Рацион и вода

Каждое животное получает примерно 90 грамм в день стандартного корма для обезьян (TekLad, Madison, WI). Регистрируют конкретные питательные вещества, входящие в состав корма. Воду периодически проверяют на микробиологическую чистоту. Показатели приемлемых уровней загрязняющих веществ в исходном корме и воде указываются в аналитических описаниях, предоставленных производителем корма, и определяются путем периодических анализов воды, соответственно. Вода удовлетворяет всем критериям сертификации, необходимой для потребления человеком.

СХЕМА ЭКСПЕРИМЕНТА

Идентификация и случайный выбор животных

Распределение осуществляют путем процедуры стратифицированной рандомизации на основе массы тела и профилей холестерина в плазме. До и после распределения в группу каждому животному на живот наносят отличительный знак в виде татуировки. Татуировки наносят всем животным колонии как средство идентификации при обычных медицинских осмотрах. Рисуют план расположения клеток с указанием находящихся в них субъектов и затем отдельных обезьян идентифицируют путем прикрепления ярлыка к соответствующей клетке.

Размеры групп, дозы и идентификационные номера

Животных распределяют в 2 экспериментальные группы, каждая из которых содержит 4 обезьяны. Каждой обезьяне присваивают идентификационный номер в соответствии с лабораторной системой нумерации. Данная система позволяет однозначно идентифицировать каждую обезьяну путем присвоения ей буквенного обозначения с последующим трехзначным номером, например, Y032.

Способ и частота введения

Тестируемые препараты вводят животным один раз в день на 1, 3 и 5 день внутривенно путем совершаемой вручную инфузии в течение ~10 мин. Скорость инфузии составляет 24 мл/кг/ч. До и в процессе введения тестируемых препаратов животных усыпляют кетамином и ксилазином. Внутривенный катетер (мининабор для внутривенной инфузии Terumo с иглой 20 калибра, или подобный ему подходящий набор для инфузии) вставляют в подкожную вену ноги. Препараты вводят всем обезьянам в интервале от 8:00 до 10:00 утра, сразу после пробуждения животных и до кормления. Перед каждой инфузией собирают образцы крови, чтобы определить уровни холестерина и других липидов в плазме, как описано в приведенном ниже разделе Химический анализ крови. Кровь собирают до кормления в обоих интервалах замеров, чтобы минимизировать влияние пищи на уровень холестерина.

Клинические наблюдения

Все видимые симптомы реакции на лечение регистрируют в день введения препарата. Кроме того, по меньшей мере, один раз в неделю животных обследуют и регистрируют физические признаки, такие как внешний вид и общее состояние.

Масса тела

Массу тела регистрируют еженедельно на протяжении периода лечения и после него.

Потребление корма

Количественное определение индивидуального потребления корма не проводят. Однако отслеживают режим приема пищи и регистрируют любые существенные изменения.

Смертность и заболеваемость

Регистрируют смертность и заболеваемость. Любое решение по поводу преждевременного умерщвления по возможности принимают после консультации с руководителем исследования и контролирующим специалистом спонсора. Животных, которых находят мертвыми, или которые были преждевременно умерщвлены, подвергают вскрытию и собирают ткани печени, почек, сердца, селезенки и легкого, чтобы провести гистопатологический анализ. При преждевременном умерщвлении берут образец крови (если это возможно) и определяют параметры. Животных, которых нашли мертвыми после окончания рабочего времени, хранят в холодильнике в течение ночи и вскрытие проводят в начале следующего рабочего дня. Если состояние животного требует преждевременного умерщвления, его подвергают эвтаназии путем внутривенного введения большой дозы пентобарбитурата натрия. Все исследование проводят в соответствии с Принципами применения животных. RxGen необходим согласно стандартам Министерства здравоохранения и социальных служб США, установленным в отношении помещений для приматов, которые диктуют уровни строгости, которых должны придерживаться процедуры данного исследования, описанные как мягкие.

КЛИНИЧЕСКИЕ ЛАБОРАТОРНЫЕ ИССЛЕДОВАНИЯ

Образцы крови

У всех животных перед обработкой берут три образца крови, чтобы определить исходный уровень холестерина в плазме. После обработки образцы крови собирают путем прокола поверхностной вены. Объем собранной крови во всех случаях не превышает 8 мл, что составляет примерно 4% от общего объема крови у взрослой обезьяны.

У животных берут кровь в двух исходных временных точках и на 1, 3, 5, 7, 9, 11, 13 и 15 дни исследования, с последующим еженедельным сбором образцов до нормализации общего уровня холестерина в плазме у группы 1 (ApoA1) в случае наличия отклонений. На 1, 6 и 11 день берут восемь миллилитров крови, чтобы сделать анализ на клиническую биохимию, определить профили липидов и получить коагулограмму. В другие дни собирают только 5 мл крови, объем, достаточный для проведения клинической биохимии и определения профиля липидов.

Образцы крови, полученные в те дни, когда проводят и биохимические, и гематологические анализы, делят на три части. Один образец помещают в пробирку для сбора плазмы, содержащую 25 мкл гепарина и этикетку, на которой указаны номер исследования, уровень дозы, номер дня, дата и уникальный идентификационный номер животного. 1 мл плазмы после деления переносят в стерильную криопробирку, которая содержит указанные выше детали, и хранят соответственно до транспортировки с целью анализа на биохимию крови. Одну аликвоту плазмы (0,5 мл) переносят в стерильную криопробирку, которая содержит указанную выше этикетку, и хранят соответственно до транспортировки с целью анализа распределения холестерина в плазме и аполипопротеина. Другие аликвоты плазмы объемом 1 мл и 0,5 мл быстро замораживают и хранят в жидком азоте в качестве резервных образцов для потенциального использования в других анализах.

Две другие аликвоты образца целой крови (каждая объемом 2,5 мл) обрабатывают кислым цитратом декстрозы (ACD) в качестве антикоагулянта, маркируют и хранят при 4°C до транспортировки с целью проведения описанных ниже анализов коагуляции и CBC.

Образцы транспортируют так, чтобы достичь конечной точки не более чем через 24 ч после взятия образца, или их хранят в стабильных условиях для транспортировки в определенный момент времени.

Повторные образцы берут только в тех случаях, если способ получения образца или способ анализа находятся вне нормальных пределов качества. Образцы помещают в маркированные пробирки.

Гематология

Все образцы, собранные на 1, 6 и 11 дни (а также в другие дни, если в один из указанных моментов времени детектируют отклонения), используют для проведения клинического анализа крови (CBC), определения протромбинового времени, PTT, фибриногена и D-димера. Для клинического анализа используют 1 мл целой крови, собранной в вакуумный контейнер, содержащий EDTA. Для определения профиля коагуляции используют примерно 2,0 мл крови, собранной в вакуумный контейнер, содержащий кислый цитрат (ACD) в качестве антикоагулянта.

Биохимический анализ крови

Глюкоза, азот мочевины крови, креатинин, общий белок, альбумин, общий билирубин, щелочная фосфатаза, аланинаминотрансфераза (ALT), аспартатаминотрансфераза (AST), холестерин, кальций, фосфор, натрий, калий, хлорид, отношение A/G, отношение азот мочевины крови/креатинин (рассчитанное), глобулины (рассчитанные уровни), липаза, амилаза, триглицериды, CPK, лактатдегидрогеназа, гамма-глутаминтрансфераза (GGT), магний, общий холестерин LDL, VLDL, HDL, ApoA1, ApoA2, ApoB, ApoE, ApoLp(a). Все образцы плазмы подвергают расширенному биохимическому анализу с определением LDL и HDL. Анализ аполипопротеина проводят на выбранных образцах после анализа результатов по LDL и HDL.

Для расширенного биохимического анализа используют примерно 1,0 мл плазмы, а для анализа распределения холестерина и аполипопротеина используют 0,5 мл плазмы. Дополнительную аликвоту плазмы собирают и хранят для потенциального применения в других анализах.

Биопсия печени

Всех обезьян подвергают чрескожной биопсии печени в исходный момент времени и на 7 и 17 дни. С помощью биопсийной иглы 14 калибра (INRAD) производят 2 пункционные биопсии (~1,0 см в длину) из правой и левой доли печени. Успешную биопсию подтверждают путем визуального осмотра биопсийного образца на биопсийной игле перед подразделением, как указано ниже.

Образцы объединяют и затем делят на части следующим образом. Половину биопсийного образца (~0,5 см) из левой доли погружают в параформальдегид и изготовляют срезы для проведения гистопатологии и анализа in situ. Оставшуюся половину каждого из разделенных биопсийных образцов и два других интактных биопсийных образца сразу погружают в маркированную криопробирку, содержащую 2 мл RNAlater (Qiagen), и инкубируют при 4°C в течение ночи, после чего RNAlater удаляют отсасыванием и образец в пробирке быстро замораживают в жидком азоте. После транспортировки в жидком азоте выделяют общую РНК с помощью тризольного или трехреагентного метода, с ожидаемым выходом ~40 мкг на 1,0 см образца пункционной биопсии массой 14 г (всего ~80-100 мкг суммарной РНК, выделенной из всех 4 объединенных образцов пункционной биопсии, полученных от одной обезьяны, за отсутствием компонента, предназначенного для гистопатологии и анализа in situ). 5 мкг фракции РНК используют для мишень-специфичной количественной ПЦР в режиме реального времени (анализ миРНК TaqMan, ABI). Оставшуюся фракцию РНК хранят для потенциального широкого анализа экспрессии генома.

Фиксированную ткань обрабатывают путем погружения в парафин. Срезы окрашивают на H&E и гистопатологические показатели, описанные как макроскопические гистопатологические показатели. Все микроскопические препараты, полученные в данном исследовании, несут ярлык, на котором указаны номер исследования, уровень дозы, номер дня, дата и уникальный идентификационный номер животного.

СТАТИСТИЧЕСКИЙ АНАЛИЗ

Статистика

Определяют описательную статистику для гематологии, клинической биохимии и профилей липидов. Данные по экспрессии подвергают соответствующим биоинформатическим анализам.

Размер образца

Размер образцов определяют на основе предварительных экспериментов по введению модифицированных антисмысловых олигонуклеотидов африканским зеленым мартышкам, результатов анализа клинической биохимии, изменения профилей липидов и ассоциированной вариабельности. Общее число субъектов, используемое для определения эффективности, составляет двадцать животных, по четыре в экспериментальных группах и четыре для дополнительного скрининга.

РЕЗУЛЬТАТЫ

Результаты приведены на нижеследующих фигурах. Фигура 6: уровни мРНК (верхние панели) и белка (нижние панели) ApoA1 в биопсийных образцах печени обезьян увеличиваются после обработки CUR-962, олигонуклеотидом, сконструированным против антисмысловой последовательности ApoA1 DA327409ext, по сравнению с исходным уровнем, как определено методами ПЦР в реальном времени и ELISA, соответственно (две левые панели). Уровни мРНК или белка ApoA1 не изменяются в контрольной группе, получающей в течение такого же периода времени олигонуклеотид, который заведомо не влияет на уровень ApoA1 in vitro (CUR-963) (две правые панели).

Хотя изобретение иллюстрируется и описывается в отношении к одному или более воплощениям, специалисты в данной области могут осуществить эквивалентные изменения и модификации на основе прочтения и понимания данного описания и приложенных рисунков. Кроме того, хотя конкретный признак данного изобретения может быть раскрыт только в отношении к одному из нескольких воплощений, такой признак можно объединить с одним или более другими признаками других воплощений, если это желательно и предпочтительно для какого-либо определенного или конкретного применения.

Реферат настоящего изобретения позволит читателю быстро осознать сущность технического описания. Следует понимать, что реферат не предназначен для интерпретации или ограничения объема или значения нижеследующей формулы изобретения.

1. Композиция для повышения экспрессии полинуклеотида аполипопротеина ApoA1 в клетках или тканях пациента, содержащая:
антисмысловой олигонуклеотид от 10 до 30 нуклеотидов в длину, где указанный олигонуклеотид обладает по меньшей мере одной олигонуклеотидной последовательностью из SEQ ID NO: 81, 84, 87, 99, 100, 101, 104, 109, 111, 116, 117, 119, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 139, 142, 149, 157 159, 160, 161, 162, 170 и 173.

2. Композиция по п.1, где экспрессия аполипопротеина ApoA1 повышается по сравнению с контролем.

3. Композиция по п.1, где антисмысловой олигонуклеотид направлен на природный антисмысловой полинуклеотид, антисмысловой к последовательностям нуклеиновой кислоты полинуклеотида аполипопротеина ApoA1.

4. Композиция по п.1, где антисмысловые олигонуклеотиды направлены на природный антисмысловой полинуклеотид с перекрывающимися и/или неперекрывающимися с полинуклеотидом аполипопротеина ApoA1 последовательностями.

5. Композиция по п.1, где антисмысловые олигонуклеотиды содержат одну или более модификаций, содержащих: модификацию сахарного фрагмента, модификацию межнуклеозидной связи, модификацию нуклеотида и/или их сочетаний.

6. Композиция по п.5, где модифицированный сахарный фрагмент содержит 2′-О-метоксиэтил-модифицированный сахарный фрагмент, 2′-метокси-модифицированный сахарный фрагмент, 2′-O-алкил-модифицированный сахарный фрагмент или бициклический сахарный фрагмент.

7. Композиция по п.5, где модифицированные межнуклеозидные связи содержат фосфоротиоат, алкилфосфонат, фосфородитиоат, алкилфосфонотиоат, фосфорамидат, карбамат, карбонат, фосфатный триэфир, ацетамидат, карбоксиметиловый эфир и/или их сочетания.

8. Композиция по п.5, где олигонуклеотиды необязательно обладают, по меньшей мере, одним модифицированным нуклеотидом, содержащим пептидные нуклеиновые кислоты, молекулы замкнутой нуклеиновой кислоты (LNA), арабино-нуклеиновую кислоту (FANA), пептидные нуклеиновые кислоты (PNA), их аналоги или производные.

9. Композиция по п.1, где антисмысловой олигонуклеотид содержит коровую последовательность gctagt (SEQ ID NO: 172).

10. Композиция для повышения экспрессии гена аполипопротеина ApoA1 в клетках или тканях млекопитающих, содержащая:
антисмысловой олигонуклеотид от 10 до 30 нуклеотидов в длину, специфичный к последовательностям природной антисмысловой цепи полинуклеотида, кодирующего молекулу аполипопротеина ApoA1, где антисмысловой олигонуклеотид обладает по меньшей мере 90% идентичностью к по меньшей мере одной последовательности нуклеиновой кислоты SEQ ID NO: 81, 84, 87, 99, 100, 101, 104, 109, 111, 116, 117, 119, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 139, 142, 149, 157 159, 160, 161, 162, 170 или 173.

11. Антисмысловой олигонуклеотид от 10 до 30 нуклеотидов в длину, содержащий по меньшей мере одну модификацию, где модификация содержит по меньшей мере одну межнуклеотидную связь из: алкилфосфоната, фосфоротиоата, фосфородитиоата, алкилфосфонотиоата, фосфорамидата, карбамата, карбоната, фосфатного триэфира, ацетамидата, карбоксиметилового эфира, или их сочетаний, где указанный олигонуклеотид представляет собой антисмысловое соединение, которое гибридизуется с природным антисмысловым полинуклеотидом аполипопротеина A1 (ApoA1), где указанный природный антисмысловой полинуклеотид обладает SEQ ID NO: 2, и повышает экспрессию молекул аполипопротеина ApoA1 по сравнению с нормальным контролем.

12. Олигонуклеотид по п.11, содержащий сочетания фосфоротиоатных межнуклеотидных связей и по меньшей мере одну межнуклеотидную связь, выбранную из группы, состоящей из: алкилфосфоната, фосфородитиоата, алкилфосфонотиоата, фосфорамидата, карбамата, карбоната, фосфатного триэфира, ацетамидата, карбоксиметилового эфира и/или их сочетаний.

13. Олигонуклеотид по п.12, где указанный олигонуклеотид содержит по меньшей мере одну фосфоротиоатную межнуклеотидную связь.

14. Олигонуклеотид по п.13, где указанный олигонуклеотид содержит скелет из фосфоротиоатных межнуклеотидных связей.

15. Олигонуклеотид по п.14, где олигонуклеотид необязательно содержит по меньшей мере один модифицированный нуклеотид, содержащий пептидные нуклеиновые кислоты, молекулы замкнутой нуклеиновой кислоты (LNA), их аналоги, производные и/или их сочетания.

16. Олигонуклеотид по п.15, где олигонуклеотид содержит модифицированный сахарный фрагмент, содержащий 2′-О-метоксиэтил-модифицированный сахарный фрагмент, 2′-метокси-модифицированный сахарный фрагмент, 2′-О-алкил-модифицированный сахарный фрагмент или бициклический сахарный фрагмент.

17. Олигонуклеотид по п.12, где олигонуклеотид с по меньшей мере примерно на 80% идентичной последовательностью к по меньшей мере примерно 10 последовательным нуклеиновым кислотам полинуклеотида РНК, транскрибированного с полинуклеотида аполипопротеина ApoA1.

18. Олигонуклеотид по п.12, где указанный олигонуклеотид гибридизуется с указанным природным антисмысловым полинуклеотидом, обладающим SEQ ID NO: 2, и повышает экспрессию по меньшей мере одного полинуклеотида аполипопротеина ApoA1, по сравнению с нормальным контролем.

19. Олигонуклеотид по п.18, где олигонуклеотиды содержат коровую последовательность gctagt (SEQ ID NO: 172).

20. Олигонуклеотид по п.12, где олигонуклеотиды содержат последовательности SEQ ID NO: 81, 84, 87, 99, 100, 101, 104, 109, 111, 116, 117, 119, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 139, 142, 149, 157 159, 160, 161, 162, 170 и 173.

21. Композиция для предотвращения или лечения заболеваний, связанных с полинуклеотидами аполипопротеина (ApoA1) и/или кодируемыми ими продуктами, содержащая один или несколько олигонуклеотидов по п.12 и фармацевтически приемлемый эксципиент.

22. Композиция по п.21, где олигонуклеотиды содержат нуклеотидную последовательность, идентичную, по меньшей мере, примерно на 80% по сравнению с любой из нуклеотидных последовательностей SEQ ID NO: 81, 84, 87, 99, 100, 101, 104, 109, 111, 116, 117, 119, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 139, 142, 149, 157 159, 160, 161, 162, 170 и 173.

23. Композиция по п.22, где олигонуклеотиды содержат нуклеотидные последовательности SEQ ID NO: 81, 84, 87, 99, 100, 101, 104, 109, 111, 116, 117, 119, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 139, 142, 149, 157 159, 160, 161, 162, 170 или 173.

24. Композиция по п.23, где олигонуклеотиды SEQ ID NO: 81, 84, 87, 99, 100, 101, 104, 109, 111, 116, 117, 119, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 139, 142, 149, 157 159, 160, 161, 162, 170 и 173, содержат один или несколько модифицированных или замещенных нуклеотидов.

25. Композиция по п.24, где модифицированные нуклеотиды содержат модифицированные основания, содержащие фосфоротиоат, метилфосфонат, пептидные нуклеиновые кислоты, молекулы замкнутых нуклеиновых кислот (LNA).

26. Композиция для предотвращения или лечения заболеваний, связанных с полинуклеотидами аполипопротеина (ApoA1) и/или кодируемыми ими продуктами, содержащая:
вводимую пациенту терапевтически эффективную дозу, по меньшей мере, одного антисмыслового олигонуклеотида по п. 14, который связывается с природной антисмысловой последовательностью полинуклеотида аполипопротеина ApoA1 и повышает экспрессию указанного полинуклеотида аполипопротеина ApoA1; чем осуществляется предотвращение или лечение заболеваний, связанных с полинуклеотидами аполипопротеина ApoA1 и/или кодируемыми ими продуктами.

27. Композиция по п.26, где заболевание, связанное с полинуклеотидами аполипопротеина ApoA1, содержит: сердечно-сосудистые нарушения, холестерин, диабет, заболевание сердца, артрит, воспаление, неврологические заболевания или нарушения, аутоиммунные заболевания, злокачественную опухоль или ожирение.



 

Похожие патенты:

Настоящее изобретение относится к биохимии, в частности к иммуногенным композициям против ВИЧ-1, содержащим фармацевтически приемлемый носитель и антигенный пептид, выбранный из группы, состоящей из PWNASASNKSLDDIW, PWNASWANKSLDDIW, PWNASWSAKSLDDIW и PWNASWSNKALDDIW.
Изобретение относится к области биохимии, в частности к способу борьбы с нежелательной растительностью на поле, содержащем сельскохозяйственную культуру устойчивых к арилоксиалканоат ауксиновому гербициду растений хлопчатника, включающему применение к месту, где желательно уничтожение нежелательной растительности, эффективного количества 2,4-ДБ.

Изобретение относится к области биохимии, в частности к трансгенному растению осины, которое демонстрирует пониженную скорость разложения древесины по сравнению с нетрансформированным растением, содержащему XegA трансген, который кодирует фермент ксилоглюканазу гриба Penicillium canescens с сигнальным пептидом целлюлазы тополя белого.

Настоящее изобретение относится к области иммунологии. Предложен выделенный пептид, обладающий способностью индуцировать цитотоксические Т-лимфоциты (CTL) против белка NEIL3 в присутствии антигенпредставляющей клетки (АРС), несущей HLA-A*0201 и/или HLA-A*0206.

Данное изобретение относится к области биотехнологии и медицины. Предложено применение гантелеподобной линейной, ковалентно замкнутой экспрессионной конструкции ДНК с двухцепочечной основой и одноцепочечными петлями, расположенными на обоих концах основы, где основа комплементарных дезоксирибонуклеиновых кислот кольцевой цепочки ДНК включает промоторную последовательность, кодирующую последовательность и сигнал терминации, где конструкция ДНК кодирует TNF-α, для лечения меланомы, причем указанная конструкция ДНК вводится путем безыгольной инъекции и указанная конструкция вводится одновременно или последовательно с виндесином.

Настоящее изобретение относится к биотехнологии. Предложены соединение, способное ингибировать экспрессию рецептора глюкагона (GCGR), состоящее из 12-30 соединенных нуклеозидов, композиция, снижающая экспрессию GCGR, способы лечения метаболического заболевания, снижения или задержки начала повышения уровней глюкозы в крови, профилактики заболевания, ассоциированного с GCGR, применение предложенного соединения для приготовления лекарственного средства.

Изобретение относится к области биотехнологии, конкретно к способу повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA), и может быть использовано в медицине.

Изобретение относится к генной инженерии. Описан способ доставки нуклеиновой кислоты в митохондрию и генетической модификации клетки, включающий воздействие на клетку композицией, содержащей по меньшей мере одну нуклеиновую кислоту и по меньшей мере один органоидно-направленный наноноситель, где наноноситель доставляет по меньшей мере одну нуклеиновую кислоту сквозь клеточную мембрану в митохондрию.

Изобретение относится к области биохимии. Представлен способ ингибирования репликации вируса иммунодефицита человека (ВИЧ), включающий обработку клеток млекопитающего агентом, выбранным из группы пептидов, интерферирующей РНК или антисмыслового олигонуклеотида, разрушающим структуру белков виментина и/или кератина-10 цитоскелетных промежуточных филаментов (IF) в клетке млекопитающего.

Настоящее изобретение относится к биотехнологии и представляет собой фармацевтические составы для перорального введения антисмыслового олигонуклеотида против SMAD7, фармацевтически приемлемые таблетки для перорального применения антисмыслового олигонуклеотида против SMAD7, а также пероральную дозированную форму, содержащие указанный антисмысловой олигонуклеотид и энтеросолюбильное покрытие, содержащее сополимер этилакрилата-метакриловой кислоты.

Настоящее изобретение относится к биохимии, в частности к одноцепочечным модифицированным олигонуклеотидам, способным ингибировать экспрессию транстиретина в клетке.

Группа изобретений относится к области биотехнологии, в частности к антисмысловым олигомерам, используемым в качестве активного ингредиента в фармацевтических композициях для лечения мышечной дистрофии.
Изобретение относится к медицине и предназначено для индукционной (неоадъювантной) противоопухолевой лекарственной терапии больных с местно-распространенным немелкоклеточным раком легкого.
Изобретение относится к области ветеринарии и может быть использовано для профилактики и фармакокоррекции гепатопатии животных, а также для повышения продуктивности и резистентности организма.

Изобретение относится к области медицины и касается дозирования олигонуклеотида. .

Изобретение относится к новым аналогам 2',5'-олигоаденилата, представленными общей формулой (1), или их фармакологически приемлемым солям, обладающим противовирусной и противоопухолевой активностью, к фармацевтической композиции на их основе и к их применению в качестве лекарственного средства и при получении лекарственного средства.

Изобретение относится к области генной инженерии, конкретно к скринингу веществ, оказывающих регулирующее вес действие, и может быть использовано в медицине. Способ скрининга веществ, оказывающих регулирующее вес действие, включает приведение тестируемого вещества в контакт с клетками, экспрессирующими ген синовиолина, и идентификацию того, имеет или нет указанное тестируемое вещество ингибирующее влияние на экспрессию гена синовиолина.
Наверх