Способы определения зиготности в объемной пробе

Группа изобретений относится к области биотехнологии. Способы определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки в нуклеиновой кислоте включают: выделение нуклеиновой кислоты из одного образца или порций; приведение нуклеиновой кислоты в контакт с прямым праймером, способным связываться с нуклеиновой кислотой выше сайта вставки; первым обратным праймером, специфичным для вставленной нуклеотидной последовательности, и вторым обратным праймером, способным связываться с нуклеиновой кислотой ниже сайта вставки. Реплицированные нуклеиновые кислоты анализируют для определения наличия или отсутствия в образце вставленной нуклеотидной последовательности. Использование способов позволяет с высокой чувствительностью определять зиготность в исследуемой пробе. 2 н. и 4 з.п. ф-лы, 5 ил., 2 табл., 3 пр.



По настоящей заявке испрашивается приоритет по дате подачи предварительной патентной заявки Соединенных Штатов серии № 61/428142, поданной 29 декабря 2010 года, в отношении «Способов определения зиготности в объемной пробе».


Проведение контроля качества в отношении какой-либо примеси в окончательной линии крайне важно для успешной продукции гибридных семян и сохранения и укрепления хороших деловых отношений с покупателями. Загрязнение при всхождении семян окончательной линии может происходить из-за опыления не предусмотренных трансгенных или нетрансгенных растений, выросших вблизи участка продукции, или в процессе обработки семян и, самое важное, примесь может возникать вследствие рассеивания пыльцы стерильных растений. Для достижения полной гомозиготности окончательной линии и освобождения от любых гемизиготных, нулевых или непредусмотренных трансгенных линий на сегодняшний день предлагается способ tester-row. В способе tester-row для оценки статуса зиготности на основе уровней белков отдельного растения используется технология ELISA. Поскольку анализ базируется на основе одного растения, он занимает очень много времени, а также является дорогостоящим. Кроме того, осуществление способа tester-row в полевых условиях создает дополнительные затраты. Способ ELISA используется для определения сайленсинга экспрессии трансгена путем определения уровня белка. Он является нечувствительным и ненадежным для идентификации любой гемизиготной, нулевой или любой другой непредусмотренной примеси в окончательной партии семян. Кроме того, при использовании способа ELISA для испытания на наличие малых примесей необходима раздельная обработка тканей.


Конкретные варианты осуществления изобретения включают способы определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки в нуклеиновой кислоте. Варианты осуществления могут содержать: выделение нуклеиновой кислоты из объемной пробы; приведение нуклеиновой кислоты в контакт с прямым праймером, способным связываться с нуклеиновой кислотой выше сайта вставки, и обратным праймером, способным связываться с нуклеиновой кислотой ниже сайта вставки. Праймеры могут быть использованы для репликации нуклеиновых кислот между праймерами. Реплицированные нуклеиновые кислоты могут быть проанализированы для идентификации наличия или отсутствия в объемной пробе вставленной нуклеотидной последовательности.

Варианты осуществления могут содержать: выделение нуклеиновой кислоты из образца; приведение нуклеиновой кислоты в контакт с прямым праймером, способным связываться с нуклеиновой кислотой выше сайта вставки, и обратным праймером, способным связываться с нуклеиновой кислотой ниже сайта вставки. Праймеры могут быть использованы для репликации нуклеиновых кислот между праймерами в первой порции и второй порции. Реплицированные нуклеиновые кислоты могут быть проанализированы для идентификации наличия или отсутствия в образце вставленной нуклеотидной последовательности. Вторая реакция, либо объединенная с вышеуказанной реакцией, либо самостоятельная, может быть осуществлена, используя прямой праймер и обратный праймер, эта реакция идентифицирует эндогенный ген или последовательность. Эта вторая реакция может быть использована в качестве внутреннего контроля для определения качества и количества использованных ДНК и/или условий проведения ПЦР.


На фиг.1А представлено схематическое изображение компонентов способа определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки согласно варианту осуществления изобретения. На этой фигуре вероятно вставленная нуклеотидная последовательность (110) показана темным блоком, в то время как окружающий геном (120) указан открытыми сегментами. Также показаны прямой праймер (130), первый обратный праймер (140) и второй обратный праймер (150). Дополнительно представлены необязательные специфический зонд вставки (160) и специфический зонд дикого типа (170).

На фиг.1В иллюстрируется модифицированный анализ, который включает создание стандартного протокола определения зиготности в двух отдельных реакциях: реакции 1, включающей общий праймер и специфический праймер дикого типа и специфический зонд дикого типа (FAM); и реакции 2, включающей внутренний контроль (ген инвертазы 1) с зондом VIC.

На фиг.2А представлено схематическое изображение первого реплицированного продукта (200) согласно варианту осуществления изобретения. Также представлены прямой праймер (130), первый обратный праймер (140) и необязательный специфический зонд вставки (160).

На фиг.2В представлено схематическое изображение первого реплицированного продукта (200) согласно варианту осуществления изобретения. Также представлены прямой праймер (130), второй обратный праймер (150) и необязательный специфический зонд дикого типа (170).

На фиг.3 представлено схематическое изображение компонентов способа определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки согласно варианту осуществления изобретения. Первая реакция (400) включает вероятно вставленную нуклеотидную последовательность (110), которая представлена темным блоком, в то время как окружающий геном (120) указан открытыми сегментами. Также показаны прямой праймер (130), первый обратный праймер (140) и необязательный специфический зонд вставки (160).

Вторая реакция (500) включает вероятно вставленную нуклеотидную последовательность (110), которая представлена темным блоком, в то время как окружающий геном (120) указан открытыми сегментами. Также показаны прямой праймер (130), второй обратный праймер (150) и необязательный специфический зонд дикого типа (170).

На фиг.4 представлено графическое отображение результатов флуоресценции FAM в системе LightCycler 480 фирмы Roche.

На фиг.5 представлено графическое отображение результатов флуоресценции VIC в системе LightCycler 480 фирмы Roche.


Варианты осуществления изобретения включают способы определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки в образце нуклеиновых кислот. В некоторых вариантах осуществления нуклеиновые кислоты могут быть выделены и/или очищены из одного источника или совокупности источников, причем совокупность может включать один или несколько отдельных источников, каждый из которых может или не может иметь отличные нуклеиновые кислоты. В других вариантах осуществления источник нуклеиновых кислот может представлять собой, но ими не ограничиваясь, животное, растение, бактерий, архебактерий, простейших, грибы, хромистов, эукариот, прокариот, in vivo, in vitro, клетку, семя, гамету, кукурузу, сою, пшеницу, рапс, рис и созданные источники.

В определенных вариантах осуществления способ может содержать получение, выделение, очистку и/или частичную очистку нуклеиновой кислоты. Согласно фиг.1, выделенные нуклеиновые кислоты могут быть приведены в контакт с прямым праймером (130), способным связываться с нуклеиновой кислотой выше сайта вставки (120), и первым обратным праймером (140), способным специфически связываться с последовательностью внутри вставленной нуклеотидной последовательности (110) (при наличии), и вторым обратным праймером (150), способным специфически связываться с последовательностью ниже (120) сайта вставки, оставляя праймеры для отжига с выделенными нуклеиновыми кислотами. Последовательности, находящиеся между праймерами, затем по возможности могут быть реплицированы, используя праймеры для репликации между праймерами посредством техник, хорошо известных в данной области, таких как, но ею не ограничиваясь, полимеразная цепная реакция (ПЦР). В отношении сайтов вставки, где вставленная нуклеотидная последовательность (110) присутствует и больше чем фрагмент, реплицируемый стандартными способами (например, > 5 т.н.), продукты репликации могут включать первый реплицированный продукт (фиг.2А (200)), содержащий такие последовательности между прямым праймером (130) и первым обратным праймером (140), но, как правило, может отсутствовать второй реплицированный продукт (фиг.2В (300)), праймированный со второго обратного праймера (150). В отношении сайтов вставки, где вставленная нуклеотидная последовательность отсутствует, продукты репродукции могут включать второй реплицированный продукт (фиг.2В (300)), содержащий такие последовательности между прямым праймером (130) и вторым обратным праймером (150). При наличии вставленной нуклеотидной последовательности (110) в некоторых, но не во всех сайтах вставки в нуклеиновой кислоте, будет получаться смесь двух продуктов. Результаты репликации затем анализируют для определения наличия и/или относительных уровней первого реплицированного продукта (200) и/или второго реплицированного продукта (300).

В отношении сайтов вставки при наличии вставленной нуклеотидной последовательности, продукты репликации нуклеиновой кислоты могут включать первый реплицированный продукт (фиг.2А (200)), содержащий такие последовательности между прямым праймером (130) и первым обратным праймером (150). В отношении сайтов вставки при отсутствии вставленной нуклеотидной последовательности, продукты репликации могут включать второй реплицированный продукт (фиг.2В (300)), содержащий такие последовательности между прямым праймером (130) и вторым обратным праймером (150). При наличии вставленной нуклеотидной последовательности (110) в некоторых, но не во всех сайтах вставки в нуклеиновой кислоте, будет получаться смесь двух продуктов. Результаты репликации затем анализируют для определения наличия и/или относительных уровней первого реплицированного продукта (200) и/или второго реплицированного продукта (300).

В некоторых вариантах осуществления при наличии вставленной нуклеотидной последовательности в сайте вставки прямой праймер и первый обратный праймер должны отстоять друг от друга меньше чем приблизительно на 5 т.н., и прямой праймер и второй обратный праймер должны отстоять друг от друга больше чем приблизительно на 5 т.н. В дополнительных вариантах осуществления, в которых в сайте вставки отсутствует вставленная нуклеотидная последовательность, прямой праймер и второй обратный праймер должны отстоять друг от друга меньше чем приблизительно на 5 т.н.

В определенных вариантах осуществления согласно фиг.3 выделенная нуклеиновая кислота может быть разделена на несколько порций. Первая порция нуклеиновой кислоты может быть приведена в контакт с прямым праймером (130), способным связываться с нуклеиновой кислотой выше сайта вставки (120), и первым обратным праймером (140), способным специфически связываться с последовательностью внутри вставленной нуклеотидной последовательности (110) (при наличии), оставляя праймеры для отжига с выделенными нуклеиновыми кислотами. Последовательности, расположенные между праймерами, затем по возможности могут быть реплицированы, используя праймеры для репликации между праймерами посредством техник, хорошо известных в данной области, таких как, но ею не ограничиваясь, ПЦР. В отношении сайтов вставки, когда вставленная нуклеотидная последовательность (110) присутствует, продукты репликации могут включать первый реплицированный продукт (фиг.2А (200)), содержащий такие последовательности между прямым праймером (130) и первым обратным праймером (140).

Вторая порция нуклеиновой кислоты может быть приведена в контакт с прямым праймером (130), способным связываться с нуклеиновой кислотой выше сайта вставки (120), и вторым обратным праймером (150), способным специфически связываться с последовательностью ниже (120) сайта вставки, оставляя праймеры для отжига с выделенной нуклеиновой кислотой. Последовательности, расположенные между праймерами, затем по возможности могут быть реплицированы, используя праймеры для репликации между праймерами посредством техник, хорошо известных в данной области, таких как, но ею не ограничиваясь, ПЦР. В отношении сайтов вставки, когда вставленная нуклеотидная последовательность (110) отсутствует, продукты репликации могут включать второй реплицированный продукт (фиг.2В (300)), содержащий такие последовательности между прямым праймером (130) и вторым обратным праймером (150).

В отношении сайтов вставки, когда вставленная нуклеотидная последовательность присутствует, продукты репликации первой порции нуклеиновой кислоты могут включать первый реплицированный продукт (фиг.2А (200)), содержащий такие последовательности между прямым праймером (130) и первым обратным праймером (150). В отношении сайтов вставки, когда вставленная нуклеотидная последовательность (110) отсутствует, продукты репликации второй порции нуклеиновой кислоты могут включать второй реплицированный продукт (фиг.2В (300)), содержащий такие последовательности между прямым праймером (130) и вторым обратным праймером (150).

В других вариантах осуществления способы могут быть использованы для определения наличия вставки в нуклеиновой кислоте при наличии вставки меньше чем в 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% или 1% сайтов вставки в нуклеиновых кислотах. В вариантах осуществления способы могут быть использованы для определения отсутствия вставки в нуклеиновой кислоте при отсутствии вставки меньше чем в 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% или 1% сайтов вставки в нуклеиновых кислотах.

В некоторых вариантах осуществления нуклеиновая кислота, содержащая сайт вставки, может представлять собой любой вид нуклеиновой кислоты, к которым относятся, но ими не ограничиваясь, ДНК, РНК, PNA или другие модифицированные формы нуклеиновых кислот.

В дополнительных вариантах осуществления наличие и/или количество первого и/или второго продукта репликации может быть определено любыми средствами, известными в данной области, такими как, но ими не ограничиваясь, специфические зонды вставки (160) и специфические зонды дикого типа (170), соответственно. В определенных вариантах осуществления зонд может представлять собой нуклеотидную последовательность, способную связываться в специфическом сайте в первом и/или втором продукте репликации. Отжиг зонда может происходить в процессе или после репликации.

Посредством, не имеющих ограничительного характера, примеров наличие и/или количество первого и/или второго продукта репликации может быть определено, используя хроматографию, гели, метки, фрагменты, саузерн-блот и нозерн-блот.

В некоторых вариантах осуществления для облегчения детекции к одному или нескольким зондам может быть присоединен флуорофор. Кроме того, к зонду также может быть присоединена молекула, гасящая флуорофор. К примерам таких зондов, содержащих флуорофор и молекулу, гасящую флуорофор, относятся система TaqMan® и реагенты, доступные у фирм Roche Molecular Diagnostics и/или Applied Biosystems. В других вариантах осуществления продукция и уровни первого и/или второго продуктов репликации могут отслеживаться в режиме реального времени.

В некоторых вариантах осуществления способы, описанные в настоящем документе, могут быть использованы для определения зиготности нуклеиновых кислот (например, генома(ов)) в определенном сайте вставки. Результаты анализов при наличии первого реплицированного продукта (200) и отсутствии второго реплицированного продукта (300) указывают на то, что нуклеиновые кислоты гомозиготны в отношении наличия вставки. Результаты анализов с отсутствием первого реплицированного продукта (200) и наличием второго реплицированного продукта (300) указывают на то, что нуклеиновые кислоты гомозиготны в отношении отсутствия вставки. Результаты таких анализов, в которых присутствуют и первый реплицированный продукт (200) и второй реплицированный продукт (300), указывают на то, что нуклеиновые кислоты гетерозиготны в отношении вставки (например, по меньшей мере один сайт вставки содержит вставку и по меньшей мере один сайт вставки не содержит вставку).

В определенных вариантах осуществления наборы праймеров и/или зондов могут быть объединены с одним или несколькими другими наборами праймеров и зондов таким образом, чтобы возможно было определить наличие или отсутствие одной или нескольких вставок в одном или нескольких определенных сайтах вставки в нуклеиновой кислоте образца. Используемое в настоящем документе выражение «набор праймеров и/или зондов» включает по меньшей мере один прямой праймер, способный связываться с сайтом выше определенного сайта вставки, и по меньшей мере один обратный праймер, способный связываться с сайтом ниже определенного сайта вставки или внутри определенной вставки. В других вариантах осуществления для идентификации конкретной вставки в одном или нескольких определенных сайтах вставки и/или большого числа вставок в большом числе определенных сайтов вставки может быть использовано большое число наборов праймеров и/или зондов.

В некоторых вариантах осуществления способы, описанные в настоящем документе, могут быть использованы для скрининга популяции на наличие или отсутствие вставки в определенном сайте вставки. В дополнительных вариантах осуществления наличие определенного сайта вставки может быть определено для каждого члена популяции.

Под используемым в настоящем документе выражением «определенный сайт вставки» понимают известное расположение или консервативную последовательность в нуклеиновой кислоте, куда вставка может быть вставлена воспроизводимым образом. В некоторых вариантах осуществления наличие конкретного сайта вставки может быть определено для каждой нуклеиновой кислоты в образце, в качестве не имеющего ограничительного характера примера, путем продукции первого (200) или второго (300) реплицированного продукта способами, описанными в настоящем документе. В других вариантах осуществления последовательности, фланкирующие конкретный сайт вставки, или последовательности внутри вставки могут быть консервативными. В дополнительных вариантах осуществления такой консерватизм последовательностей, фланкирующих определенный сайт вставки, или последовательностей во вставке может быть ограничен сайтами связывания праймеров и/или зондов. Под используемым в данном контексте термином «консервативный» понимают, что специфический праймер и/или зонд способен специфически связываться с областью, которая является «консервативной». В определенных вариантах осуществления специфический праймер и/или зонд останется связанным с «консервативной» областью при условиях повышенной жесткости.

Используемые в настоящем документе термины «выше» и «ниже» являются относительными и означают противоположные стороны сайта вставки в нуклеиновой кислоте. Термины не обозначают, какое из направлений располагается «выше» и «ниже» сайта вставки, а лишь что они лежат на противоположных сторонах сайта вставки.

Используемые в настоящем документе «прямой праймер» и «обратный праймер» представляют собой относительные термины, означающие праймеры, связывающиеся с различными местоположениями на нуклеиновой кислоте таким образом, чтобы дать возможность репликации нуклеиновых кислот между ними способами, доступными в данной области, такими как, но ею не ограничиваясь, ПЦР. Термины «прямой» и «обратный» не обозначают, где именно конкретный праймер свяжется с сайтом последовательности нуклеиновой кислоты, а лишь что они лежат на противоположных сторонах реплицируемой последовательности и могут действовать при репликации в качестве праймеров для полимеразы.

Используемые в настоящем документе «содержащий», «включающий», «отличающийся» и их грамматические эквиваленты представляют собой охватывающие и неограничивающие термины, которые не исключают дополнительных, неперечисленных элементов или стадий способа, но также включают более узкие термины «состоящий из» и «состоящий по существу из».

Настоящее изобретение дополнительно описывается в следующих примерах, которые предлагаются в качестве иллюстрации и не предназначены для того, чтобы каким-либо образом ограничить изобретение.


ПРИМЕР 1: Материал растений:

Скрининг родительских линий: Для определения, является ли краевая последовательность в сайте вставки трансгена высоко консервативной и могут ли трансформант-специфические праймеры быть использованы для различного генетического окружения, скринировали в общем 92 различных инбредных линии, которые представляли различные гетерозисные группы и имели различное происхождение, такие как североамериканские, южноамериканские, европейские, stiff stalk, отличные от stiff stalk, из публичных и личных источников (Таблица 1).

Таблица 1
Перечень материалов, использованных для скрининга краевой последовательности в сайте вставки трансгена
Тип материала Гетерозисная группа Источник
Личный Lancaster Северная Америка
Личный Flint Европа
Личный Stiff stalk Северная Америка
Личный Смешанная Южная Америка
Личный Lancaster Северная Америка
Личный Lancaster Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Lodent Северная Америка
Личный Lodent Северная Америка
Публичный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Lodent Северная Америка
Личный отличная от Stiff stalk Северная Америка
Личный Lancaster Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Публичный Смешанная Северная Америка
Личный Lodent Северная Америка
Личный Flint Южная Америка
Личный Lancaster Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Смешанная Южная Америка
Личный Смешанная Южная Америка
Личный Смешанная Южная Америка
Личный Смешанная Северная Америка
Личный Смешанная Южная Америка
Личный Смешанная Южная Америка
Публичный Stiff stalk Северная Америка
Публичный Stiff stalk Северная Америка
Личный Lodent Северная Америка
Личный Lodent Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Lodent Северная Америка
Личный Lodent Северная Америка
Личный Тропическая Южная Америка
Личный Тропическая Южная Америка
Личный Тропическая Южная Америка
Личный Тропическая Южная Америка
Личный Lancaster Северная Америка
Личный Lodent Северная Америка
Личный Stiff stalk Северная Америка
Личный отличная от Stiff stalk Северная Америка
Личный Lodent Северная Америка
Личный Lancaster Северная Америка
Личный Lancaster Северная Америка
Личный Lancaster Северная Америка
Личный Lancaster Северная Америка
Личный Lancaster Северная Америка
Личный Lancaster Северная Америка
Личный Lancaster Северная Америка
Личный Lancaster Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Публичный Lancaster Северная Америка
Личный Lodent Северная Америка
Личный Тропическая Южная Америка
Личный отличная от Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный отличная от Stiff stalk Северная Америка
Публичный отличная от Stiff stalk Северная Америка
Личный Lancaster Северная Америка
Личный Lancaster Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Stiff stalk Северная Америка
Личный Смешанная Северная Америка
Личный Suwan Южная Америка
Личный Тропическая Южная Америка
Личный Тропическая Южная Америка
Личный отличная от Stiff stalk Северная Америка
Личный Смешанная Северная Америка
Личный Смешанная Южная Америка
Личный Смешанная Южная Америка
Личный Тропическая Южная Америка
Личный Смешанная Южная Америка
Личный Смешанная Северная Америка
Личный Lodent Северная Америка
Личный Lodent Северная Америка

Скрининг объемных проб семян: Для демонстрации применения тестирования на основе ДНК на объемных пробах семян и для определения чувствительности детекции пулы семян, указанные ниже, создавали, используя известные строго гомозиготные DAS-59122, гемизиготные DAS-59122 и нулевые (обычные) семена. Их отсчитывали в шесть различных пробирок типа фалькон объемом 50 мл:

1. 100 гомозиготных семян DAS-59122, репликация-1

2. 100 гомозиготных семян DAS-59122, репликация-2

3. 99 гомозиготных семян DAS-59122 и одно гемизиготное семя DAS-59122, репликация-1

4. 99 гомозиготных семян DAS-59122 и одно гемизиготное семя DAS-59122, репликация-2

5. 99 гомозиготных семян DAS-59122 и одно нулевое (обычное) семя, репликация-1

6. 99 гомозиготных семян DAS-59122 и одно нулевое (обычное) семя, репликация-2.

ПРИМЕР 2: Обмолот семян и экстракция ДНК

Семена мелко измельчали и геномную ДНК выделяли, используя набор DNEasy фирмы Qiagen (Valencia, CA). Из каждой партии семян осуществляли пять отдельных экстракций геномной ДНК. Очищенную геномную ДНК количественно оценивали, используя набор с красителем ДНК Picogreen фирмы QuantIt, и разводили до стандартизованных концентраций.

ПРИМЕР 3: Анализы зиготности на основе TaqMan

Анализ зиготности осуществляли, используя различные наборы реагентов, которые состояли из отличных последовательностей праймеров и зондов. Способ и реагенты создавали конкретно для трансформанта DAS-59122. Схема анализа зиготности предложена на фиг.1. В способе помимо двух зондов использовались ген-специфический праймер, праймер дикого типа и ген-специфический/дикого типа (общий) праймер. Зонды состояли из специфического зонда дикого типа и трансгенного специфического зонда. В первом способе все праймеры и зонды объединялись в одной реакции («способ в одну реакцию»). Для повышения чувствительности определения зиготности также испытывали дополнительный способ, в котором осуществляли две отдельных независимых реакции (фиг.3) («способ с большим числом реакций»). Один ряд лунок содержал специфический праймер дикого типа, общий праймер и специфический зонд дикого типа. Другой ряд лунок содержал специфический праймер трансгена, общий праймер и специфический зонд трансгена. Например, в этом способе использовали лишь два праймера и один зонд в формате 384-луночного планшета, в котором один квадрат содержал специфический праймер дикого типа + общий праймер + специфический зонд дикого типа, другой квадрат содержал специфический праймер трансгена + общий праймер + специфический зонд трансгена.

Модифицированный анализ Taqman с детекцией по конечной точке: получали реакционную смесь, содержавшую следующие компоненты: вода, 15,35 мкл; 10-кратный буфер для проведения ПЦР, 2,50 мкл; MgCl2 в концентрации 25 мМ, 1,50 мкл; dNTP в концентрации 10 мМ (по 2,5 мМ каждого), 2,0 мкл; общий прямой праймер в концентрации 20 мкМ (SEQ ID NO:1), 0,25 мкл; обратный праймер дикого типа в концентрации 20 мкМ (SEQ ID NO:2), 0,25 мкл; дважды меченый зонд дикого типа (SEQ ID NO:3) в концентрации 10 мкМ, на 3' конце меченый с помощью VIC и на 5' конце меченный с помощью BHQ2, 0,20 мкл; Taq-полимераза HotStar (5 Ед/мкл), 0,20 мкл; геномная ДНК в концентрации 10 нг/мкл, 3,0 мкл.

Получали вторую реакционную смесь, содержавшую следующие компоненты: вода, 15,35 мкл; 10-кратный буфер для проведения ПЦР, 2,50 мкл; MgCl2 в концентрации 25 мМ, 1,50 мкл; dNTP в концентрации 10 мМ (по 2,5 мМ каждого), 2,0 мкл; общий прямой праймер в концентрации 20 мкМ (SEQ ID NO:1), 0,25 мкл; обратный праймер 591227 в концентрации 20 мкМ (SEQ ID NO:4), 0,25 мкл; дважды меченый зонд 591227 (SEQ ID NO:5) в концентрации 10 мкМ, меченый на 3' конце с помощью FAM и на 5' конце с помощью BHQ1, 0,20 мкл; Taq-полимераза HotStar (5 Ед/мкл), 0,20 мкл; геномная ДНК в концентрации 10 нг/мкл, 3,0 мкл.

Обе смеси раскапывали в отдельные лунки и амплифицировали, используя систему для проведения ПЦР GenAmp 9700 при следующих условиях: 95°С в течение 15 минут (1 цикл); 95°С в течение 15 секунд, 60°С в течение 60 секунд (35 циклов). Считывание флуоресцентного сигнала анализировали и зиготность определяли, исходя из возбуждения флуорофора VIC или FAM.

Результаты: после определения консервативности краевых последовательностей в сайте связывания праймеров праймеры создавали и испытывали на объемных пулах семян, используя стандартный анализ определения зиготности Taqman. Результаты указали на то, что способ с одной реакцией оказался чувствительным при определении примеси нулевого семени среди строго гомозиготных семян, взятых в большом количестве, с чувствительностью детекции 1%. Тем не менее, способ с одной реакцией оказался неудовлетворительным в определении примеси какого-либо гемизиготного семени при уровне наличия 1%. Низкая чувствительность могла быть следствием преимущественной амплификации реакции-1 (см. фиг.1) из-за избыточной доступности матрицы. Для решения этой проблемы конкуренции за ресурсы в процессе реакции ПЦР способ с одной реакцией модифицировали в большое число отдельных реакций (фиг.3). Эта модификация привела к избирательной амплификации лишь нацеленного региона в отсутствие какой-либо конкуренции за ресурсы. Применение способа с большим числом реакций (тестирование на зиготность родительного семени) на родительских «пулах семян» показало достоверность определения примеси как гемизиготных, так и обычных (нулевых) семян в большом количестве строго гомозиготных семян с чувствительностью детекции 1% (Таблица 2). Результаты также подтверждали посредством ПЦР в режиме реального времени, используя прибор Light Cycler 480 фирмы Roche, для обеспечения отсутствия артефактов в реакции ПЦР или установления их.

Таблица 2
Чувствительность определения зиготности различными способами
Способ Достоверность определения при контаминации 0% Достоверность определения при 1% примеси гемизиготного семени Достоверность определения при 1% примеси нулевого семени
Способ с одной реакцией Да Да Недостоверно
Способ с большим числом реакций Да Да Да

Скрининг родительских линий: Поскольку трансформант-специфические праймеры могут быть использованы для различного генетического окружения, для испытания способа с большим числом реакций использовали 92 отличных инбредных линии (Таблица 1), которые представляют различные гетерозисные группы, произрастающие в местностях, таких как Северная Америка, Южная Америка и Европа. Эти линии испытывали и подтверждали, что они свободны от контаминации трансгеном, используя протокол, описанный выше.

Анализ, используя термоциклер в режиме реального времени Roche 480 (фиг.4 и 5), а также анализы на основе TaqMan по конечной точке показали, что все протестированные инбредные линии имеют консервативную краевую последовательность, фланкирующую вставку трансгена. Их успешно амплифицировали с участием специфического праймера/зонда WT, подтверждая, что праймеры и зонды для анализа трансформанта DAS-59122 могут быть использованы для программ интрогрессии при испытании зиготности родительского семени на окончательных линиях.

К некоторым из преимуществ способа с большим числом реакций относятся все преимущества простоты и надежности тестирования ДНК над тестом ELISA. Самое важное, это позволяет тестировать зиготность, используя объемные пулы семян, в отличие от тестирования ELISA, которое может идентифицировать лишь отдельные растения. Кроме того, этот способ может снизить стоимость процедуры tester-row и ELISA в десять раз. Этот способ также может повысить чувствительность анализа и будет идентифицировать и другие примеси. Способ с большим числом реакций также может быть использован в качестве «индикатора» при испытании на наличие малых примесей (АР), что может быть использовано для тестирования на присутствие непредусмотренного трансформанта, а также должно показать статус строгой гомозиготности объемной пробы.

Тестирование способом с большим числом реакций доказало высокую чувствительность в определении наличия примеси какого-либо гемизиготного или нулевого семени в партии семян строго гомозиготных окончательных линий. Было показано, что способ с большим числом реакций может идентифицировать примесь при уровне контаминации 1% (1 в 100 семенах). Эта новая методология привела к установлению нового направления применения высокопроизводительного молекулярного анализа (НТМА), лучше тестирующего степень чистоты у окончательных линий, а также может обеспечить десятикратную экономию при проведении процедур в полевых условиях.

Несмотря на то, что настоящее изобретение было описано в нескольких вариантах осуществления, настоящее изобретение может быть дополнительно модифицировано в пределах сущности и объема настоящего описания. Эта заявка, поэтому, охватывает любые варианты, применения или адаптации изобретения, использующие его основные принципы. Кроме того, настоящая заявка охватывает такие отклонения от настоящего описания, которые согласуются с известной или обычной практикой в данной области, к которой настоящее изобретение относится и которая находится в рамках прилагаемой формулы изобретения.

1. Способ определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки в образце нуклеиновых кислот, причем способ содержит:
приведение указанного образца нуклеиновых кислот в контакт с прямым праймером, способным связываться с нуклеиновой кислотой выше сайта вставки, и первым обратным праймером, способным специфически связываться с последовательностью внутри вставленной нуклеотидной последовательности, и вторым обратным праймером, способным специфически связываться с последовательностью ниже сайта вставки, осуществляя тем самым отжиг праймеров с выделенными нуклеиновыми кислотами;
где продукт репликации, включающий первый реплицированный продукт, содержащий последовательности между прямым и первым обратным праймером, и не включающий второй реплицированный продукт, праймированный со второго обратного праймера, указывает на наличие вставленной нуклеотидной последовательности в указанном определенном сайте вставки в образце нуклеиновых кислот и продукт репликации, включающий второй реплицированный продукт, содержащий последовательности между прямым праймером и вторым обратным праймером, указывает на отсутствие вставленной нуклеотидной последовательности в указанном определенном сайте вставки в образце нуклеиновых кислот.

2. Способ по п. 1, где смесь указанных двух продуктов указывает на наличие вставленной нуклеотидной последовательности в некоторых сайтах вставки в образце нуклеиновых кислот.

3. Способ по п. 1, дополнительно содержащий приведение нуклеиновой кислоты в контакт во время или после репликации с зондом, специфичным для фрагмента, амплифицированного при наличии вставленной нуклеотидной последовательности.

4. Способ по п. 1, в котором способ используют для определения примеси любых непредусмотренных трансгенов.

5. Способ по п. 1, в котором способ используют для определения примеси каких-либо нетрансгенных линий.

6. Способ определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки в образце нуклеиновых кислот, причем способ содержит:
разделение указанного образца нуклеиновых кислот на первую порцию и вторую порцию, где указанную первую порцию приводят в контакт с прямым праймером, способным связываться с нуклеиновой кислотой выше сайта вставки, и первым обратным праймером, способным специфически связываться с последовательностью внутри вставленной нуклеотидной последовательности, осуществляя тем самым отжиг праймеров с выделенными нуклеиновыми кислотами, и указанную вторую порцию приводят в контакт с прямым праймером, способным связываться с нуклеиновой кислотой выше сайта вставки, и вторым обратным праймером, способным специфически связываться с последовательностью ниже сайта вставки, осуществляя тем самым отжиг праймеров с выделенными нуклеиновыми кислотами;
где продукт репликации указанной первой порции, включающий первый реплицированный продукт, содержащий последовательности между прямым и первым обратным праймером, указывает на наличие вставленной нуклеотидной последовательности в указанном определенном сайте вставки в образце нуклеиновых кислот, и
продукт репликации второй указанной порции, включающий второй реплицированный продукт, содержащий последовательности между прямым праймером и вторым обратным праймером, указывает на отсутствие вставленной нуклеотидной последовательности в указанном определенном сайте вставки в образце нуклеиновых кислот.


Похожие патенты:

Изобретение относится к молекулярной биологии. Способ включает: экстракцию препаратов суммарной РНК, получение комплементарной ДНК с помощью реакции обратной транскрипции на РНК-матрице и последующую амплификацию в режиме реального времени с использованием высокоспецифичных праймеров для генов PTEN, CYP1B1 и АСТВ (референтный локус), а также расчет коэффициента относительной экспрессии генов PTEN и CYP1B1 (КPTEN и КCYP1B1) методом RT-PCR.

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантных молекул МНС II класса, и может быть использовано в медицине. Рекомбинантная молекула МНС II класса включает: (i) весь или часть внеклеточного участка α-цепи МНС II класса; (ii) весь или часть внеклеточного участка β-цепи МНС II класса; при этом (i) и (ii) обеспечивают функциональный пептид-связующий домен и при этом (i) и (ii) соединены дисульфидной связью между остатками цистеина, расположенными на α2 домене указанной α-цепи и β2 домене указанной β-цепи, при этом указанные остатки цистеина не присутствуют в нативных доменах α2 и β2 МНС II класса и полученная рекомбинантная молекула не включает мотив лейциновой молнии.

Изобретение относится к области биохимии, в частности к агенту для придания растению устойчивости к ингибитору 4-HPPD, включающему ДНК, кодирующую белок, обладающий активностью, придающей растению устойчивость к ингибитору 4-HPPD.

Изобретение относится к биохимии. Описан способ получения гетерогенного набора одноцепочечных фрагментов ДНК для мультиплексного генетического анализа.

Настоящее изобретение относится к области биоинформатики. Предложен способ для приготовления улучшенной вычислительной системы, основанной на нуклеиновых кислотах, включающий синтезирование в водном растворе варианта системы молекулярных вычислений, отличающегося включением химической модификации, изменяющей энергию гибридизации молекул нуклеиновых кислот в системе.

Изобретение относится к области генной инженерии, конкретно к скринингу веществ, оказывающих регулирующее вес действие, и может быть использовано в медицине. Способ скрининга веществ, оказывающих регулирующее вес действие, включает приведение тестируемого вещества в контакт с клетками, экспрессирующими ген синовиолина, и идентификацию того, имеет или нет указанное тестируемое вещество ингибирующее влияние на экспрессию гена синовиолина.

Настоящее изобретение относится к биохимии, в частности к способу определения и секвенирования неизвестных последовательностей ДНК, которые фланкируют известные последовательности в выделенной ДНК.

Изобретение относится к области биохимии. Представлен набор синтетических олигодезоксирибонуклеотидов для детекции гена msp1α риккетсии Anaplasma marginale методом полимеразной цепной реакции в режиме «реального времени».

Изобретение относится к области биотехнологии. Описан способ амплификации нуклеиновых кислот, в котором наночастицы в объеме реакционной смеси переносят тепло в окружающую их среду посредством возбуждения.

Изобретение относится к области молекулярной биологии и диагностической медицины. Предложен способ выделения циркулирующих ДНК из плазмы или сыворотки крови.
Изобретение относится к области медицины и предназначено для оценки риска прогрессирования хронической болезни почек (ХБП) у детей. У ребенка с подозрением на ХБП забирают кровь из периферической вены и с помощью метода аллель-специфичной полимеразной цепной реакции проводят идентификацию однонуклеотидных полиморфизмов генов ангиотензин-превращающего фермента (АСЕ) Alu Ins/Del I>D, ангиотензина (AGT) Thr174Met и Met235Thr, рецепторов 1 типа ангиотензина 2 (R1AGT) С1166С и эндотелина-1 (ЕТ-1) Lys198Asn. При выявлении Alu Ins/Ins АСЕ и Thr174Met AGT оценивают риск прогрессирования ХБП как легкий. При выявлении Met174Met AGT и Alu Ins/Del АСЕ оценивают средний риск. При выявлении сочетания однонуклеотидных полиморфизмов Thr235Thr AGT, С1166С R1AGT, Lys198Asn ЕТ-1 и Alu Del/Del АСЕ оценивают высокий риск прогрессирования ХБП. Изобретение позволяет с высокой достоверностью оценивать риск прогрессирования ХБП у детей на основании раннего выявления генетических предикторов - однонуклеотидных полиморфизмов генов. 3 пр.

Изобретение относится к области медицины, в частности к онкологии, и молекулярной биологии. Предложен способ диагностики папиллярной почечноклеточной карциномы (ППК), включающий стадии получения исходной пары образцов ткани от пациента, выделение и очистку препаратов РНК, синтез кДНК на матрице РНК с использованием олигонуклеотидных праймеров, проведение количественной реакции амплификации фрагмента гена CALL и сравнение количества амплифицированного фрагмента CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани. Уменьшение содержания мРНК гена CALL от 4-х до 45-ти раз служит диагностическим признаком ППК. Изобретение позволяет с высокой достоверностью диагностировать ППК, в том числе на ранней стадии опухолевого заболевания. 3 з.п. ф-лы, 1 ил., 4 табл., 6 пр.

Группа изобретений относится к области биотехнологии и представлена набором олигонуклеотидных зондов для профилирования микробиоты желудочно-кишечного тракта (ЖКТ), где указанный набор включает в частности (a) олигонуклеотид, состоящий из (ai) нуклеотидной последовательности, выбранной из ACGCTTGCACCCT (SEQ ID NO: 1) необязательно с не более тремя замещенными основаниями или AGGGTGCAAGCGT (SEQ ID NO: 27) необязательно с не более тремя замещенными основаниями, и (aii) 0-5 нуклеотидов в дополнение к (ai), где олигонуклеотид согласно (а) способен гибридизоваться с SEQ ID NO: 27 или SEQ ID NO: 1, соответственно, в строгих условиях гибридизации. Также предоставлены способы профилирования микробиоты ЖКТ индивидуума и способы диагностики или мониторинга заболевания или состояния у индивидуума или прогнозирования или оценки риска развития у индивидуума заболевания или состояния, в которых используют набор олигонуклеотидных зондов. Использование изобретений позволяет выявлять присутствие и количество определенных бактерий среди множества с высокой точностью благодаря комбинированному эффекту используемого набора зондов. 6 н. и 23 з.п. ф-лы, 2 ил., 7 табл., 1 пр.

Изобретение относится к области биотехнологии, а именно к синтетическим олигонуклеотидным зондам и праймерам для выявления ДНК вируса африканской чумы свиней. Предложенные синтетические олигонуклеотидные праймеры и флуоресцентно меченый зонд с внутренним гасителем комплементарны консервативной области гена Р30 (CP204L) вируса африканской чумы свиней и имеют следующий нуклеотидный состав: F1 р30 5'-GTTACGACCGCTATAAAAACA-3' R1 р30 5'-TTCCATTCTTCTTGAGACCTG-3' Z1 (int) p30 5'-(FAM)TACTGTT(RTQ1)AAGTATGATATTGTGA(BHQ1)-3' Предложенное изобретение может быть использовано в генодиагностике инфекционных болезней свиней и ветеринарной вирусологии. 4 табл., 2 пр.

Настоящее изобретение относится к области генетики. Предложен способ оценки риска возникновения у индивида тромбоэмболического эпизода или диагностики возникновения или наличия такой болезни или эпизода на основании присутствия серпина А10 (ингибитор протеина Z) Arg67Stop (rs2232698), серпина С1 (антитромбин) Ala384Ser (Cambridge II), фактора XII С46Т (rs1801020), фактора XIII Val34Leu (rs5985), фактора II (протромбин) G20210A (rs1799963), фактора V Leiden Arg506Gln (rs6025), фактора V Cambridge Arg306Thr, фактора V Hong Kong Arg306Gly, группы крови ABO rs8176719, группы крови ABO rs7853989, rs8176743 и rs8176750. Кроме того, предложен способ идентификации индивида, нуждающегося в терапевтическом лечении антикоагулянтом и/или антитромбином, либо в профилактическом лечении антикоагулянтом и/или антитромбином на основании присутствия по меньшей мере одного аллеля каждого из указанных полиморфных вариантов. Данное изобретение может найти дальнейшее применение в терапии тромбоэмболических заболеваний. 2 н. и 5 з.п. ф-лы, 2 ил., 8 табл., 1 пр.

Изобретения относятся к ветеринарной вирусологии и биотехнологии, а именно к генетической инженерии. Предложены синтетические олигонуклеотидные праймеры для выявления РНК атипичного пестивируса крупного рогатого скота и способ их применения. Предсавленные синтетические олигонуклеотидные праймеры имеют нуклеотидные последовательности: SEQ ID NO: 1 - 5' tttgcagccgagcgtag 3', SEQ ID NO: 2 - 5' cctcctgcatactgtcacctt 3'. Предложенный способ включает выделение РНК из образцов эмбриональных сывороток и биоматериала, проведение обратной транскрипции и ПЦР с синтетическими олигонуклеотидными праймерами, перенос продукта амплификации на гель и оценку проведения реакции. ПЦР проводят в 1 раунд. В случае положительной реакции синтезируется фрагмент, соответствующий размеру 320 п.н. Изобретения могут быть использованы в ветеринарии для выявления возможных контаминаций эмбриональных сывороток, используемых для культивирования культур клеток и производства биопрепаратов, атипичным пестивирусом крупного рогатого скота, а также для диагностики инфекционных заболеваний сельскохозяйственных животных, в частности инфекции, вызванной атипичным пестивирусом крупного рогатого скота. 2 н.п. ф-лы, 1 ил., 3 табл., 4 пр.

Изобретение относится к области биохимии и медицины, в частности к способу выявления кандидатных генов для проведения популяционных исследований генетического полиморфизма у детей, проживающих в условиях стронциевой геохимической провинции. Для осуществления указанного способа производят отбор пробы крови у детей, проживающих в стронциевой геохимической провинции не менее 3 лет. Из этой пробы выделяют ДНК и создают библиотеку коротких отрезков ДНК. Проводят их гибридизацию с набором заданных праймеров, представляющих в совокупности жидкий ДНК-биочип. Затем гибридизованные участки подвергают секвенированию, устанавливая фактическую последовательность нуклеотидов, составляющих гены, и сравнивают эту последовательность с референтной последовательностью нуклеотидов в генах. Устанавливают отклонения в последовательности, принимая такие отклонения, как ассоциированные с возможными нарушениями здоровья ребенка под действием стронция. В качестве указанных генов используют: CYP1A2, TLR4, TERT, FAS, FOXP3, ТР53, MTHFR, SULT1A1, VEGF, ZMPSTE, SOD, SIRT3, NOS3, PPARD и СРОХ. В последовательности нуклеотидов каждого из указанных генов идентифицируют количество однонуклеотидных полиморфизмов, и в случае наличия таких полиморфизмов в гене в количестве 6 и более прогнозируют связь такого измененного гена с воздействующей на ребенка стронциевой экспозицией в условиях стронциевой геохимической провинции. Этот ген принимают в качестве кандидатного гена для проведения последующих популяционных исследований генетического полиморфизма у детей, проживающих в условиях стронциевой геохимической провинции. Настоящее изобретение позволяет обеспечить возможность выявления через генетический полиморфизм кандидатных генов у детей, ассоциированных с воздействием стронция, и использования в дальнейшем полученной информации для популяционных исследований с целью установлении на ранней стадии определенных заболеваний, обусловленных нарушенным геном. 3 табл., 1 пр.

Изобретение относится к области медицины, стоматологии, молекулярной биологии и клинико-лабораторной диагностики. Описан способ определения выраженности нагноения (гноетечения) тканей пародонта. Способ основан на измерении в соскобах с пародонта уровня РНК гена интерлейкина-8 (IL-8) относительно представленности референсной РНК или ДНК. Полученные показатели используют для вычисления отношения уровней для каждого конкретного образца. Значение полученного показателя интерпретируется как маркер нагноения. Изобретение может быть использовано для определения гноетечения у индивидуальных пациентов с агрессивным и хроническим пародонтом, в том числе после потери зуба, в тех случаях, когда интенсивность этого процесса не позволяет осуществлять визуальное обнаружение гноя, а также в тканях, соприкасающихся с имплантами и другими ортодонтическими конструкциями. Использование метода обеспечивает высокочувствительную и объективную количественную характеристику степени нагноения исследуемого участка пародонта, что позволяет оценивать риск возникновения острого локального воспаления и разрушения пародонта в будущем, приживаемость имплантов и других ортодонтических конструкций, оценивать эффективность лечебных мероприятий. 2 з.п. ф-лы, 4 табл.

Изобретение относится к области биохимии, клинико-лабораторной диагностики, в частности к определению степени обсемененности пародонта патогенными бактериями с помощью ПЦР в реальном времени. Описан способ применения комплексной тест-системы для определения Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, Tannerella forsythensis и Treponema denticola, а также принцип использования порогового значения, позволяющего отличить патологическую обсемененность пародонта (способную служить причиной возникновения пародонтита) от нормальной, встречающейся у лиц без выраженного поражения пародонта или склонности к нему. Способ включает ПЦР в реальном времени для определения в смывах пародонта патогенов. Определяют относительное значение Ct для образца по следующему алгоритму: из усредненного по двум или большему числу независимых определений абсолютного значения Ct (определяется программным обеспечением термоциклера с оптической детекцией) для специфического набора праймеров и зонда вычитают усредненную величину Ct общей бактериальной массы для того же образца серии, после чего идентифицируют патологическую обсемененность пародонта при условии, что величина относительной Ct не превышает 15. Изобретение может быть использовано для выявления причины возникновения хронического пародонтита у индивидуального пациента, оценки риска возникновения у него этого заболевания в будущем и эффективности лечения как агрессивного, так и хронического пародонтита. 6 ил.

Изобретение относится к области биохимии, в частности к способу диагностики растительного материала на трансгенность. Способ включает выделение из биоматериала ДНК и проведение полимеразной цепной реакции в режиме реального времени с зондами, меченными флуоресцентными красителями и гасителями флуоресценции. При этом составляют реакционную смесь, содержащую праймеры aacacatgagcgaaacccta, caagctcgagtttctccata, ccggtcttgcgatgattat, tatattttgttttctatcgcgtatt, tatattttgttttctatcgcgtatt, agatggattgcacgcaggttc, gcatcagagcagccgattgt и зонды FAM-cccttatctgggaactactcacacatta-BHQ1, FAM-tgcgggactctaatcataaaaacccatct-BHQ1, FAM-ccagtcatagccgaatagcctctccacc-BHQ1. Полимеразную цепную реакцию проводят в режиме реального времени, при этом осуществляют непрерывный контроль флуоресценции и по экспоненциальному ее нарастанию диагностируют трансгенность растений. Изобретение позволяет эффективно диагностировать растительный материал на трансгенность. 2 ил., 1 табл.

Группа изобретений относится к области биотехнологии. Способы определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки в нуклеиновой кислоте включают: выделение нуклеиновой кислоты из одного образца или порций; приведение нуклеиновой кислоты в контакт с прямым праймером, способным связываться с нуклеиновой кислотой выше сайта вставки; первым обратным праймером, специфичным для вставленной нуклеотидной последовательности, и вторым обратным праймером, способным связываться с нуклеиновой кислотой ниже сайта вставки. Реплицированные нуклеиновые кислоты анализируют для определения наличия или отсутствия в образце вставленной нуклеотидной последовательности. Использование способов позволяет с высокой чувствительностью определять зиготность в исследуемой пробе. 2 н. и 4 з.п. ф-лы, 5 ил., 2 табл., 3 пр.
