Способ диагностики папиллярной почечноклеточной карциномы и набор для его осуществления



Способ диагностики папиллярной почечноклеточной карциномы и набор для его осуществления
Способ диагностики папиллярной почечноклеточной карциномы и набор для его осуществления
Способ диагностики папиллярной почечноклеточной карциномы и набор для его осуществления
Способ диагностики папиллярной почечноклеточной карциномы и набор для его осуществления
Способ диагностики папиллярной почечноклеточной карциномы и набор для его осуществления
Способ диагностики папиллярной почечноклеточной карциномы и набор для его осуществления
Способ диагностики папиллярной почечноклеточной карциномы и набор для его осуществления
Способ диагностики папиллярной почечноклеточной карциномы и набор для его осуществления
Способ диагностики папиллярной почечноклеточной карциномы и набор для его осуществления
Способ диагностики папиллярной почечноклеточной карциномы и набор для его осуществления

 


Владельцы патента RU 2605829:

Федеральное государственное бюджетное учреждение науки Институт молекулярной биологии им. В.А. Энгельгардта Российской академии наук (ИМБ РАН) (RU)

Изобретение относится к области медицины, в частности к онкологии, и молекулярной биологии. Предложен способ диагностики папиллярной почечноклеточной карциномы (ППК), включающий стадии получения исходной пары образцов ткани от пациента, выделение и очистку препаратов РНК, синтез кДНК на матрице РНК с использованием олигонуклеотидных праймеров, проведение количественной реакции амплификации фрагмента гена CALL и сравнение количества амплифицированного фрагмента CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани. Уменьшение содержания мРНК гена CALL от 4-х до 45-ти раз служит диагностическим признаком ППК. Изобретение позволяет с высокой достоверностью диагностировать ППК, в том числе на ранней стадии опухолевого заболевания. 3 з.п. ф-лы, 1 ил., 4 табл., 6 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к области медицины, в частности онкологии, и молекулярной биологии и может быть использовано для ранней диагностики папиллярной почечноклеточной карциномы (ППК).

Уровень техники

Рак почки очень широко распространен во всем мире и опасен тем, что практически не поддается химио- и радиотерапии. В мире ежегодно выявляется в среднем 190000 новых случаев почечноклеточной карциномы (ПК), причем почти у 1/3 больных опухоль служит причиной смерти. Заболевание до 4% случаев имеет наследственный характер (синдром Хиппеля-Линдау) и связано с терминальными мутациями в соответствующих генах, тогда как подавляющее большинство представляют собой спорадические случаи. В настоящее время выделяют несколько типов ПК в зависимости от происхождения раковых клеток: наиболее распространенный - светлоклеточная почечноклеточная карцинома - СПК (70-75% всех опухолей почек). Папиллярная почечноклеточная карцинома (ППК) находится на втором месте по встречаемости. Остальные гистологические типы встречаются крайне редко - это хромофобная почечноклеточная карцинома, онкоцитарный рак почки и др. Для диагностики рака почки используют неинвазивные методы: ультразвуковая и рентгеновская компьютерная томография, магнитно-резонансная томография. Реже используют пункционную биопсию опухоли почки с последующим гистологическим исследованием. Часто рак почки выявляют на ранних стадиях только благодаря случайным обнаружениям при ультразвуковом обследовании. Около четверти пациентов на момент установления диагноза уже имеют метастазы.

Молекулярные маркеры, специфичные для ПК, в российской клинической практике практически не применяют. Только один опухолевый маркер М2-РК (изомерная форма пируваткиназы) используется для диагностики рака почки. Определение его содержания в крови применяют в качестве дополнительного исследования для диагностики, выявления метастазов и рецидивов некоторых опухолей, включая рак почки.

В литературе предлагают новые маркеры, например, увеличение экспрессии гена CD70 на уровне мРНК и/или белка в опухолевых клетках. Методом иммуногистохимии показана сильная экспрессия этого гена в опухолях ПК и ее отсутствие в прилежащих к опухоли нормальных тканях [Diegmann J, Junker K, Gerstmayer В, Bosio A, Hindermann W, Rosenhahn J, von Eggeling F. 2005. Identification of CD70 as a diagnostic biomarker for clear cell renal cell carcinoma by gene expression profiling, real-time RT-PCR and immunohistochemistry. Eur J Cancer. 41(12), 1794-1801].

Развитая ПК - сложный процесс, при котором найдены изменения более чем в 20 генах, расположенных на разных хромосомах [Velickovic M., Delahunt В., Grebe S.K. 1999. Loss of heterozygosity at 3p14.2 in clear cell renal cell carcinoma is an early event and is highly localized to the FHIT gene locus. Cancer Res. 59, 1323-1326; Lam JS, Leppert JT, Figlin RA, Belldegrun AS. 2005. Role of molecular markers in the diagnosis and therapy of renal cell carcinoma. Urology. 66 (5 Suppl), 1-9]. В настоящее время накоплен достаточно большой объем данных, касающихся отдельных молекулярно-генетических характеристик различных типов ПК. И хотя спектр генетических изменений в случае каждой конкретной опухоли носит индивидуальный характер, тем не менее, наблюдают определенные закономерности генетических изменений, которые дают основания связывать их с развитием и/или прогрессией той или иной патологии. Известно, что при СПК выявляют частые нарушения на коротком плече хромосомы 3. При папиллярной карциноме выявлены дупликации генов на хромосомах Y, 7, 17. Практически отсутствуют данные о генах, изменение содержания мРНК которых, используют для ранней диагностики почечноклеточной карциномы.

Диагностическими признаками злокачественной трансформации клеток могут служить геномные изменения в опухолевых клетках: точечные мутации, микросателлитная нестабильность, аллельные потери, эпигеномные изменения (метилирование промоторных участков генов), а также изменения функциональной активности многих генов на уровне мРНК и белка. В отличие от белковых, молекулярно-генетические маркеры обладают значительно большей чувствительностью. В числе перспективных потенциальных маркерных генов, вовлеченных в канцерогенез разных форм рака почки, рассматривают новые гены, потенциальные супрессоры опухолевого роста (TSG, tumor suppressor genes) на коротком плече хромосомы 3 человека [Zabarovsky ER, Lerman MI, Minna JD. 2002. Tumor suppressor genes on chromosome 3p involved in the pathogenesis of lung and other cancers. Oncogene. 21(45), 6915-6935; Wistuba II, Behrens C, Virmani AK, Mele G, Milchgrub S, Girard L, Fondon JW 3rd, Garner HR, McKay B, Latif F, Lerman MI, Lam S, Gazdar AF, Minna JD. 2000. High resolution chromosome 3p allelotyping of human lung cancer and preneoplastic/preinvasive bronchial epithelium reveals multiple, discontinuous sites of 3p allele loss and three regions of frequent breakpoints, Cancer Res. 60(7), 1949-60; Angeloni D. 2007. Molecular analysis of deletions in human chromosome 3p21 and the role of resident cancer genes in disease. Brief Funct Genomic Proteomic. 6(1), 19-39].

Недавно на коротком плече хромосомы 3 идентифицирован ген CALL (другие обозначения CHL1; cell adhesion molecule with homology to L1CAM (close homolog of L1); FLJ44930; L1CAM2; MGC132578; L1 cell adhesion molecule 2; cell adhesion molecule L1-like; cell adhesion molecule with homology to L1CAM), который открыт при исследовании генов, связанных с задержкой умственного развития у пациентов с 3p-синдромом [Wei ΜΗ, Karavanova I, Ivanov S.V, Popescu N.C, Keck C.L, Pack S, Eisen J.A, Lerman M.I. 1998. In silico-initiated cloning and molecular characterization of a novel human member of the L1 gene family of neural cell adhesion molecules. Hum Genet. 103(3), 355-364]. Этот ген относится к семейству L1 нейральных молекул клеточной адгезии и кодирует мультидоменный белок, содержащий сигнальный пептид, 6 имммуногобулиновых доменов, 4 домена фибронектина типа III, трансмембранный участок и цитоплазматический домен, состоящий из 105 аминокислотных остатков. Цитоплазматический домен консервативен у представителей L1 семейства, и именно благодаря ему эти молекулы участвуют в сигнальных путях. Методом Нозерн-гибридизации показано, что ген CALL экспрессируется в нервной ткани, некоторых других тканях взрослого организма, в том числе легкого и почки, а также в некоторых клеточных линиях, полученных их образцов злокачественных опухолей. Ген CALL экспрессируется, главным образом, как транскрипт из 8 т.п.н. В некоторых тканях и клеточных линиях выявлен более короткий транскрипт длиной 4,5 т.п.н. и соответствующий белок. Поскольку 3p-синдром связан с риском развития карцином, предполагали участие гена CALL в процессах канцерогенеза.

Изобретение, предлагающее способ диагностики различных карцином человека, а также лимфом и лейкемий, основано на выявлении цитогенетических изменений и аллельных потерь для 10-ти генов-супрессоров опухолевого роста, расположенных в критичной области LUCA хромосомы 3 [Ji L., Minna J., Roth J., Lerman M. Chromosome 3p21.3 genes are tumor suppressors. 2002. Международные патенты № WO 0204511, № US 2004016006].

Изобретение, относящееся к способу диагностики рака молочной железы, толстой кишки, мочевого пузыря, основано на обнаружении методом ПЦР с радиоактивно меченными праймерами повышения уровня мРНК множественных сплайсированных форм гена поверхностного гликопротеина CD44 в опухолевых тканях, соответствующих метастазах и биоптатах по сравнению с нормальными тканями [Tarin D., Matsumura Y. Diagnostic method. 1994. Международный патент № WO 94/02633].

Изобретение, предлагающее способ диагностики лимфом, основано на сравнении относительного уровня мРНК генов легких λ- и κ-иммуноглобулинов, вовлеченных в развитие лимфом, методом ПЦР-РВ [Stalberg Α., Kubista M. Method to measure gene expression ratio of key genes. 2002. Международный патент № WO 02/09913].

Изобретение, предлагающее способ диагностики светлоклеточной почечноклеточной карциномы, основанный на определении содержания мРНК гена CALL методом ПЦР в реальном времени [Кудрявцева А.В., Анедченко Е.А., Лерман М.И., Сенченко В.Н. Способ диагностики светлоклеточной почечноклеточной карциномы и набор для его осуществления. Дата приоритета 20.02.2009, регистрационный номер 200915812, Роспатент]. Сделан вывод, что уровень мРНК гена CALL - специфический маркер светлоклеточной почечноклеточной карциномы, который может иметь применение для диагностики этого заболевания. Данный аналог наиболее близок по технической сущности заявленному изобретению и принят за прототип.

Проведен поиск для гена CALL по базам данных с учетом следующих различных обозначений и вариантов написания названия гена: CALL; CHL1; cell adhesion molecule with homology to L1CAM (close homolog of L1); FLJ44930; L1CAM2; MGC132578; L1 cell adhesion molecule 2; cell adhesion molecule L1-like; cell adhesion molecule with homology to L1CAM. Ни для одного из перечисленных вариантов не обнаружено охранных документов и/или патентных заявок, ограничивающих возможность использования снижения содержания мРНК гена CALL, в том числе с использованием метода ПЦР-РВ, для диагностики ППК.

Для оценки содержания мРНК генов используют различные методы. Современный высокочувствительный метод ПЦР-РВ отличается от традиционных качественных и полуколичественных методов тем, что позволяет быстро и точно определить количество копий ДНК или кДНК в широком диапазоне концентраций [Livak K.J., Flood S.J., Marmaro J., Giusti W., Deets K. 1995. Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Appl. 4, 357-362]. Метод широко используют в мире как для научных, так и клинических целей благодаря высокой производительности, обычно проводят 96 или 384 реакций. В отличие от обычной ПЦР, когда количество продуктов определяют на конечной стадии реакции, ПЦР-РВ позволяет следить за накоплением продуктов в экспоненциальной фазе реакции. В этой системе наряду с праймерами используют зонд (пробу), меченный флуоресцентным красителем. Зонд является олигонуклеотидом, который гибридизуется с последовательностью ДНК/кДНК между двумя фланкирующими праймерами. ПЦР-РВ состоит из двух основных этапов: 1) гибридизации исследуемой матрицы с зондом и 2) ПЦР, катализируемой TaqДНК-полимеразой, обладающей 5′-экзонуклеазной активностью, расщепляющей зонд, что приводит к появлению и нарастанию флуоресцентного сигнала. На мировом рынке представлены различные модели приборов для ПЦР-РВ, разработанные известными фирмами-изготовителями - Applied Biosystems, Bio-Rad, Invitrogene, Eppendorf и др., а также отечественные приборы DTprime (ДНК-Технология), АНК-32 (Институт Аналитического Приборостроения РАН, http://www.syntol.ru/productank.htm).

В России этот метод пока не достаточно востребован для количественной оценки содержания мРНК генов как в фундаментальных исследованиях, так и в клинике. Появление на отечественном рынке недорогих приборов, разработанных российскими фирмами, а также недорогих отечественных наборов реактивов («Синтол», «ДНК-Технологии», «Изоген» и др.), сравнимых по эффективности с зарубежными наборами обеспечит более широкое распространения этого технологичного метода [Манзенюк О.Ю., Малахо С.Г., Пехов В.М., Косорукова И.С, Полтараус А.Б. 2006. Характеристика универсальных отечественных наборов реагентов для ПЦР в реальном времени. Опыт использования в молекулярной онкодиагностике. Молекулярная биология. 40, 349-356]. Методики и протоколы, описанные в данной заявке, предполагают, в основном, использование отечественных наборов и хотя выполнены на приборе ABI Prism 7000 (Applied Biosystems, США), могут быть адаптированы для отечественных приборов. Сочетание недорогих приборов и отечественных наборов реактивов позволит сделать доступным этот технологичный метод для отечественных научных и клинических лабораторий.

Из изложенного ясно, что изменение содержания мРНК онкозначимых генов в опухолях по сравнению с нормальными тканями в качестве молекулярного маркера для диагностики рака и почки пока не нашло широкого практического применения в клиниках. В данной области существует потребность в поиске новых диагностических маркеров, позволяющих достоверно и уже на ранних стадиях диагностировать заболевания, а также в разработке на их основе чувствительного, надежного, применимого в условиях клинических или поликлинических медицинских учреждений способа диагностики рака почки, в частности папиллярной почечноклеточной карциномы (ППК).

Раскрытие изобретения

Данное изобретение стало возможным в результате проведенного авторами анализа содержания мРНК гена CALL в образцах ППК на разных клинических стадиях и открытия того факта, что уже на ранних стадиях этого заболевания происходит значительное и частое снижение содержания мРНК гена CALL.

Настоящее изобретение в своем первом аспекте относится к новому способу для диагностики ППК, который представляет собой измерение содержания мРНК гена CALL. Сниженное содержание мРНК гена в предположительно пораженных раком тканях почки человека по сравнению с его содержанием в нормальных/здоровых тканях служит диагностическим маркером рака почки, в первую очередь ППК.

В одном из воплощений рак почки, в отношении которого снижение содержания мРНК гена CALL служит в качестве диагностического маркера, является ППК.

В еще одном аспекте настоящее изобретение относится к применению снижения содержания мРНК гена CALL в качестве маркера для диагностики ППК.

В еще одном аспекте настоящее изобретение относится к способу диагностики ППК.

Данный способ включает следующие стадии:

а) получение исходной пары образцов тканей от пациента, где один из образцов получен из предположительно пораженных раком тканей, а второй получен из прилегающих гистологически нормальных («условно-нормальных») тканей;

б) выделение и очистка препаратов РНК из исходной пары образцов;

в) синтез одноцепочечной кДНК на матрице РНК с использованием олигонуклеотидных праймеров;

г) проведение количественной реакции амплификации фрагмента гена CALL с использованием кДНК, полученной на стадии в), в качестве матрицы и пары геноспецифичных олигонуклеотидных праймеров и зонда;

д) сравнение количества амплифицированного фрагмента ДНК CALL в образце, полученном из предположительно пораженных раком тканей почки, с количеством амплифицированного фрагмента ДНК в образце, полученном из нормальных тканей, где указанные количества амплифицированного фрагмента ДНК отражают содержание мРНК гена CALL, причем его уменьшение служит диагностическим маркером ППК.

В отдельном предпочтительном воплощении данного изобретения последовательность праймеров и зонда представлена SEQ ID NO: 1, 2 и 3.

Еще одним аспектом настоящего изобретения является набор праймеров и зонда для осуществления полимеразной цепной реакции с целью определения содержания мРНК гена CALL, имеющий последовательности SEQ ID NO: 1, 2 и 3.

В еще одном воплощении способа настоящего изобретения на стадии д) количественная реакция амплификации фрагмента гена CALL представляет собой ПЦР в реальном времени.

В следующем воплощении заявленного способа на стадии д) в качестве контрольных генов используют гены GUSB или RPN1, кодирующие бета-глюкуронидазу и рибофорин соответственно.

Перечень фигур.

Далее изобретение будет более подробно раскрыто со ссылкой на отдельные иллюстративные примеры и фигуры, где:

Фиг. 1. Относительное содержание мРНК (R) гена CALL в образцах ППК. Фигура показывает, что снижение содержания мРНК гена CALL обнаружено в большинстве исследованных образцов ППК по сравнению с «условной нормой». Данные нормированы относительно двух контрольных генов RPN1 и GUSB.

Таблица 1. Патоморфологическая характеристика исследованных опухолей почки и данные ПЦР-РВ по изменению уровня мРНК (1/R) гена CALL в образцах ППК по сравнению с нормой.

Осуществление изобретения

Данное изобретение предлагает способ диагностики ППК на разных стадиях развития злокачественной трансформации, включая начальные, основанный на определении снижения содержания мРНК гена CALL. Достоверно обнаруживаемое различие содержания мРНК гена CALL в нормальных и опухолевых тканях может быть использовано для обнаружения ППК.

Образцы тканей для анализа

В качестве образцов почки для проведения анализа могут быть использованы биоптаты или операционные образцы ткани.

Выделение РНК из образцов тканей

Способы выделения суммарной РНК из образцов тканей млекопитающих хорошо известны специалистам и, как правило, включают следующие стадии: измельчение в жидком азоте образцов опухолевых и нормальных тканей, лизис клеток, выделение РНК и ее очистку, проверку качества РНК электрофорезом в 1%-ном агарозном геле в присутствии красителя бромида этидия или в денатурирующем полиакриламидном геле, а также спектрофотометрическое определение количества РНК. Гомогенизацию кусочков тканей можно проводить вручную, растирая пестиком в керамической ступке, или с помощью механических гомогенизаторов, например, Omni Mixer или Micro-Dismembrator фирмы Sartorius (Германия). Для выделения РНК могут быть использованы различные протоколы, широко известные специалистам в данной области. В классических методах выделения РНК используют сильные хаотропные агенты, такие как гуанидинхлорид и гуанидинизотиоцианат, растворяющие белки, и последовательные экстракции фенолом и хлороформом для денатурации и удаления белков [Sambrook J., Fritsch E.F., Maniatis T. 1989. Molecular Cloning. A laboratory Manual. 2nd Edition ed. Cold Spring Harbour: CSHL Press]. Широко используют также метод с использованием реагента Trizol [GIBCO/Life Technologies]. Для предотвращения разрушения РНК РНКазами могут быть использованы ингибиторы, такие как ингибитор RNAsin плацентарного или рекомбинантного происхождения или, например, ванадил-рибозидный комплекс - неспецифический ингибитор РНКаз широкого спектра действия.

Быстрое и качественное выделение РНК можно проводить с использованием ряда коммерчески доступных наборов (Клоноген, Санкт-Петербург; RNeasy kits, Qiagen, Голландия; SV Total RNA Isolation System, Promega, США и т.д.). Использование различных приборов, например, QuickGene-810 (Life Science, Япония), позволяет исключить работу с агрессивными агентами, ускорить и упростить выделение РНК. Для экстракции РНК в этом приборе используют 80 мкм пористую мембрану, которая в 12,5 раз тоньше обычно используемого в таких приборах стеклянного фильтра (1000 мкм), что позволяет уменьшить деградацию РНК и увеличить ее выход.

Реакция обратной транскрипции: синтез кДНК на матрице РНК, выделенной из образцов тканей

Реакция обратной транскрипции, в результате которой на РНК-матрице синтезируют одноцепочечную цепь ДНК, при необходимости, с достройкой второй цепи, позволяет перейти от нестабильных молекул РНК к более стабильным молекулам ДНК. Дальнейшая ПЦР-амплификация позволяет использовать очень малые количества исходной РНК (на уровне нескольких нанограмм), а следовательно, и количества исследуемых легочных тканей, из которых выделяют РНК.

Реакцию обратной транскрипции можно проводить с использованием коммерчески доступных препаратов обратных транскриптаз, таких как обратная транскриптаза вируса лейкоза мышей Молони (M-MLV), вируса миелобластоза птиц (AMV), PowerScript (точечная мутация M-MLV-RT), C. Therm Polymerase и др., с помощью которых можно получать продукты амплификации длиною до нескольких тысяч и даже несколько десятков тысяч пар нуклеотидов (т.п.н.). Может быть использована термостабильная ДНК-полимераза Thermus thermophilus (Tth), обладающая обратной транскриптазной активностью в присутствии ионов Mn2+.

Для обратной транскрипции могут быть использованы различные праймеры, например:

1) Олиго(dT)n-содержащие праймеры связываются с эндогенным полиА-хвостом на 3′-конце мРНК (число n обычно равно 12-18, но может достигать и большей величины). Эти праймеры наиболее часто используют для получения полноразмерных кДНК. К олиго(dT)-последовательности часто добавляют на 3′-конце нуклеотиды А, С или G, чтобы «заякорить» праймер на границу транскрипта и поли-А тракта;

2) Случайные гексануклеотидные праймеры (статистические затравки) гибридизуются с РНК в многочисленных участках. При обратной транскрипции с этими праймерами получают короткие кДНК. Случайные гексамеры используют для преодоления трудностей, связанных с вторичной структурой РНК, они более эффективны при обратной транскрипции 5′-областей мРНК;

3) Гексамеры или другие короткие олигонуклеотиды (10-12 нуклеотидов) случайного состава могут быть также использованы в комбинации с олиго(dT)-содержащими праймерами;

4) Специфические олигонуклеотидные праймеры используют для транскрипции участка мРНК, представляющего интерес для исследования. Эти праймеры успешно применяют для диагностических целей.

Анализ содержания мРНК гена можно проводить, используя одноцепочечную или двуцепочечную амплифицированную кДНК. Для синтеза второй цепи и ее амплификации наиболее часто используют специфичные праймеры. В продаже имеются наборы для синтеза кДНК, основанные на применении различных обратных транскриптаз и различных праймеров для затравки. Для получения кДНК разработан также SMART-метод (switching mechanism at the 5′ end of RNA templates of reverse transcriptase), в основе которого лежит свойство обратных транскриптаз добавлять на 3′-конец синтезированной первой цепи кДНК несколько нуклеотидных остатков, преимущественно dC. Эта олиго(dC)-последовательность служит местом отжига олигонуклеотидного адаптера, имеющего комплементарную олиго(dG)-последовательность на 3′-конце. Обратная транскриптаза воспринимает праймер как продолжение РНК-матрицы и продолжает синтез первой цепи [Schmidt W.M., Mueller M.W. 1999. CapSelect: a highly sensitive method for 5′ CAP-dependent enrichment of full-length cDNA in PCR-mediated analysis of mRNAs. Nucleic Acids Res. 27, е31]. Таким образом, первая цепь кДНК оказывается фланкирована с одной стороны последовательностью 3′-праймера с олиго(dT) на 3′-конце, а с другой - последовательностью, комплементарной адаптеру. Эти праймеры имеют одинаковые внешние последовательности, отличаясь только на 3′-конце. Затем первую цепь амплифицируют в ПЦР с праймером, соответствующим внешней части 3′-праймера и адаптера. Нуклеотидную последовательность общей части этих праймеров подбирают в зависимости от дальнейших целей, например получения клонотек, применения вычитающей гибридизации и т.д. В результате получают двухцепочечную ДНК, обогащенную полноразмерными последовательностями. За счет использования адаптера с заблокированным 3′-концом достигается существенное снижение фоновой амплификации. При использовании модифицированного SMART-метода за короткое время происходит амплификация исходного материала более чем в 105 раз, что позволяет работать с очень небольшими количествами РНК (меньше 1 нанограмма), а следовательно, и с небольшим количеством исследуемых тканей [Zhu Y.Y., Machleder E.M., Chenchik Α., Li R., Siebert P.D. 2001. Reverse transcriptase template switching: a SMART approach for full-length cDNA library construction. Biotechniques. 30, 892-897]. Наборы для получения кДНК этим способом выпускают различные фирмы, например Евроген, Россия (набор MINT), Clontech, США и т.п.

Выбор специфических праймеров и зондов

Выбор специфических праймеров и зондов осуществляют способом, хорошо известным специалистам в данной области, для чего используют имеющиеся программы, многие из которых находятся в свободном доступе в Интернете. Среди таких программ можно упомянуть Oligo (версия 6.42), PrimerSelect из пакета Lasergene (www.dnastar.com), Primer Express (Applied Biosystems, USA), Primer Designer (ИМБ PAH), FastPCR (http://www.biocenter.helsinki.fi/bi/Programs/fastpcr.htm), PrimerQuest (http://scitools.idtdna.com/Primerquest/) и др. С учетом сложности анализируемого генома длина праймеров может быть выбрана в диапазоне от 18 до 25 н. Оптимальный размер ампликона около 150 н. Подбор зондов для проведения ПЦР-РВ осуществляется в соответствии со стандартными рекомендациями и требованиями метода.

В предпочтительном воплощении используют праймеры и зонд:

CALL_F (SEQ ID NO: 1) 5′ - GAACTATCCTTGCCAATGCCAATAT - 3′;

Оценка содержания мРНК гена CALL методом ПЦР-РВ

Количественная оценка содержания мРНК достигается с помощью параллельного проведения ПЦР-РВ с тестируемым и контрольным образцами. Выбору подходящего контрольного гена для нормализации количественных данных посвящено много обзоров [Radonic A., Thulke S., Mackay I.M., Landt О., Siegert W., Nitsche A. 2004. Guideline to reference gene selection for quantitative real-time PCR. Biochem Biophys Res Commun. 313, 856-862; Huggett J., Dheda K., Bustin S., Zumla A. 2005. Real-time RT-PCR normalisation; strategies and considerations. Genes and Immunity. 6, 279-284; Wong M.L, Medrano J.F. 2005. Real-time PCR for mRNA quantification. BioTechniques. 39, 1-11]. Чаще всего в качестве контрольных выбирают гены «домашнего хозяйства», хотя для этой цели может быть использован любой ген с относительно постоянным уровнем транскрипции в исследуемых образцах. Однако вариабельность содержания мРНК необходимо проверять для каждой исследуемой выборки образцов данного типа тканей. Решение о выборе того или иного гена в качестве контрольного зависит также от степени выбранной/требуемой точности. Согласно предпочтительной форме осуществления количественной оценки содержания мРНК генов необходимо выбрать контрольный ген, имеющий незначительную вариабельность содержания мРНК в опухолевых и нормальных тканях легкого по сравнению с исследуемым геном.

В настоящем изобретении для образцов рака почки и нормальных тканей почки выбраны два контрольных гена - GUSB (глюкуронидаза) и RPN1 (рибофорин 1) ввиду отсутствия в литературе оптимального контрольного гена для этого типа ткани. Нами оценена также вариабельность «классического» контрольного гена GAPDH, однако она оказалась более значительной, чем у генов GUSB и RPN1. Можно использовать каждый из этих генов, но для большей надежности получаемых данных следует использовать не менее двух генов. Это особенно актуально в тех случаях, когда содержание целевого гена изменяется незначительно. Поскольку содержание мРНК гена CALL в опухолях почки изменяется существенно, также допустимо использование одного из двух предложенных контрольных генов - RPN1 или GUSB.

Оценка содержания мРНК генов может быть основана на абсолютном и относительном измерении количества копий исследуемых транскриптов - абсолютный метод (метод абсолютной стандартной прямой) и относительный количественный анализ (ΔΔCt-метод). Согласно предпочтительной форме осуществления количественной оценки содержания мРНК генов в качестве основного метода измерений выбран второй из них. Этот метод позволяет проводить двойное сравнение данных для исследуемого и контрольного генов в опухоли и норме и не требует выравнивания концентраций опухолевых и нормальных образцов РНК/кДНК, которое необходимо при использовании других методов, например ОТ-ПЦР.

Выбор образцов сравнения

Согласно предпочтительной форме осуществления количественной оценки содержания мРНК генов важно проверить пригодность образцов сравнения, в данном случае «условных норм».

«Условной нормой» принято считать образец ткани с отсутствующими макро- и микроскопическими признаками опухолевого роста. При «непригодности» образца условно-нормальной ткани (т.е. в случаях, когда при микроскопии обнаруживали опухолевые клетки, или материал был трудно интерпретируемый) использовали усредненные нормы нескольких имеющихся «условных норм». Поскольку не для всех опухолевых образцов имелись пригодные парные «условные нормы», расчеты относительного количества копий транскрипта гена CALL (RкДНК) проводили, используя разные образцы сравнения - парные «условные нормы» и/или усредненные «условные нормы» от нескольких больных. Для этих образцов усредняли значение ΔCt=Ct(CALL)-Ct(GUSB) и далее проводили расчеты RкДНК.

Учет эффективностей реакций

Согласно предпочтительной форме осуществления количественной оценки изменения содержания мРНК генов необходимо учитывать значения эффективности проводимых реакций, которые могут оказать заметное влияние на конечный результат. Для этого нами разработана программа математической обработки экспериментальных данных ПЦР-РВ с расчетом эффективностей реакций [Программа для ЭВМ «Анализ транскрипции генов». Свидетельство о государственной регистрации №2008612585, 2008, Роспатент]. Программа совместима с файлами экспериментальных данных (Ct, ΔRn и др.) из программного обеспечения RQ, Relative Quantification (Applied Biosystems, ABI Prism SDS Software) и также позволяет проводить статистическую оценку достоверности измеряемых изменений и оценку пригодности выбранного контрольного гена.

Далее настоящее изобретение будет подробно проиллюстрировано со ссылкой на конкретные примеры, представляющие собой наиболее предпочтительные воплощения изобретения. Изобретение не ограничивается описанными воплощениями, напротив, предполагается, что оно включает любые альтернативы, модификации или эквиваленты, допустимые с учетом сущности и объема изобретения.

Пример 1. Образцы тканей

Образцы опухолевых тканей (Т), прилегающие к опухолям морфологически нормальные ткани (N) (т.н. «условные нормы») собраны и охарактеризованы в ФГБУ РОНЦ им Н.Н. Блохина РАМН. Образцы опухолевых тканей (опухоль, «условная норма») получены непосредственно после удаления опухоли. Каждый образец делили примерно на 3 равные части и хранили в жидком азоте.

Коллекция образцов тканей почки, подлежащих исследованию, составила 9 образцов ППК, а также 9 образцов «условной нормы». Средний возраст больных с диагнозом ППК, среди которых 4 мужчины и 5 женщин, составляет 50 лет (17-78 лет).

Пример 2. Выделение РНК из образцов тканей

РНК из нормальных и опухолевых тканей человека выделяли с использованием набора реагентов RNeasy Mini Kit («Qiagen», Голландия) согласно протоколу. Основные этапы включали: 1) разрушение ткани, замороженной в жидком азоте, с использованием микро-десмембратора («Sartorius», Германия) и гомогенизацию разрушенного образца в лизирующем буфере RLT в расчете 600 мкл на 30 мкг ткани. 2) центрифугирование 3 минуты при 14000 об/мин (4°C); 2) добавление равного объема водного 70% этилового спирта к супернатанту; 3) нанесение на колонку; 4) промывание колонки после сорбции РНК один раз буфером RW1 объемом 700 мкл и дважды буфером RPE объемом 500 мкл; 5) элюцию РНК водой, свободной от РНКаз. Концентрацию РНК определяли на спектрофотометре «NanoDrop ND1000», («NanoDrop Technologies Inc.», США) при длине волны 260 нм. Качество выделенной РНК проверяли с помощью электрофореза в 1% агарозе, а т в присутствии бромистого этидия, а также на приборе Bioanalyser Agilent 2100 («Agilent Technologies», США).

Нуклеотидный состав ампликонов подтверждали секвенированием на автоматическом секвенаторе 3730 DNA Analyzer («Applied Biosystems», США). Секвенирование проводили отдельно с 5 ли 3′-концевого праймеров с использованием реактивов DYEnamic ET Terminator Cycler Sequencing Kit («Amersham», UK). Все праймеры и зонды были специфичны в условиях ПЦР-РВ, ампликоны имели ожидаемые нуклеотидные последовательности и размер.

Пример 3. Реакция обратной транскрипции

Для проведения реакции обратной транскрипции брали по 1 мкг РНК, полученной одним из двух вышеописанных методов с использованием наборов реагентов Trizol RNA Prep («Лаборатория Изоген») или реагентов RNeasy Mini Kit («Qiagen», Голландия), предварительно обработанной не содержащей РНКаз ДНКазой I (Invitrogene), 100 нг гексануклеотидных праймеров, 1 мМ dNTP, 1× реакционный буфер («Fermentas», Литва), содержащий 250 мМ Tris-HCl (pH 8.3, 25°C), 250 мМ KCl, 20 мМ MgCl2, 50 мМ DTT, и 200 единиц обратной транскриптазы M-MuLV («Fermentas», Литва). Реакцию проводили в объеме 20 мкл при следующем температурном режиме: 25°C - 10 мин, 42°C - 60 мин, 50°C - 10 мин, 70°C - 10 мин.

Пример 4. Подбор условий для количественной оценки содержания мРНК гена CALL в опухолях почки

Использовали специфичные праймеры и зонды для гена CALL (SEQ ID NO: 1, 2, 3).

Последовательности выбранных праймеров и зондов для контрольных генов:

Для проведения ПЦР-РВ подобраны оптимальные концентрации праймеров и зондов исследуемого и контрольного генов. Концентрации праймеров варьировали в диапазоне 100-500 нМ при постоянной концентрации зондов, равной 100 нМ, затем концентрацию зондов варьировали от 100 до 500 нМ при оптимальной концентрации праймеров. Для гена CALL оптимальные концентрации праймеров составили 300 нМ и зонда 400 нМ, для гена GUSB - концентрация праймеров составила 300 нМ, зонда - 250 нМ, для гена RPN1 - концентрация праймеров - 350 нМ, зонда - 200 нМ.

Пример 5. Количественная оценка содержания мРНК гена CALL

Для количественных измерений использовали прибор ABI PRISM ® 7000 Sequence Detection System, Applied Biosystems, США.

Протокол определения содержания мРНК гена CALL методом ПЦР-РВ

1. Готовили реакционные смеси для генов CALL, RPN1 и GUSB, осторожно смешав все компоненты реакции, кроме матрицы (кДНК), из расчета 1 реакция объемом 25 мкл для каждого образца + 1 дополнительная реакция по 25 мкл.

2. В 96-луночную планшету добавляли по 20 мкл приготовленных реакционных смесей без матрицы.

3. Вносили по 5 мкл матрицы, плотно закрывали планшету пленкой.

4. Помещали планшету в приборное отделение, задавали названия ячеек, температурный режим для 40 циклов: 95°C - 10 мин - денатурация и активация фермента, 95°C - 15 сек - денатурация, 60°C - 1 мин - отжиг зонда и полимеризация, затем запускали прибор.

5. Реакции проводили в режиме относительных количественных измерений (программное обеспечение RQ, Relative Quantification, Applied Biosystems).

6. Нуклеотидный состав ампликонов подтверждали секвенированием на автоматическом секвенаторе 3730 DNA Analyzer (Applied Biosystems, США). Секвенирование проводили отдельно с 5′ и 3′-концевого праймеров с использованием реактивов DYEnamic ЕТ Terminator Cycler Sequencing Kit («Amersham», UK).

7. Проводили математическую обработку данных ПЦР-РВ и представляли результаты в графическом и/или табличном виде.

Пример 6. Математическая обработка данных ПЦР-РВ

Данные ПЦР-РВ переносили в виде текстового файла в Microsoft Excel и проводили математическую обработку данных. Относительное содержание мРНК RкДНК (далее R), представляющее отношение количества копий исследуемой последовательности кДНК к количеству копий контрольной последовательности в опухоли (Т) по сравнению с нормой (N), связаны с основными параметрами ПЦР-РВ пороговым циклом Ct и эффективностью реакции Ε общим выражением [Бюллетень 2, http://docs.appliedbiosystems.com/pebiodocs/04303859.pdf]

Интервал крайних значений R вычисляли с учетом рассчитанных отклонений Е для значений Ct:

, где, i=1, 2, …, n, где n - число повторов реакции (в нашем случае n=3). При суммировании величин отклонения вычисляют по формуле: j=1, 2, …, k, где k - число суммируемых величин.

Сравнивали уровень снижения мРНК генов - LD, равный 1/R и показывающий во сколько раз содержание мРНК каждого гена снижено в опухоли по сравнению с нормой. Эффективность ПЦР-РВ (Е) для генов GUSB, RPN1 и CALL рассчитывалась с помощью программы «Анализ Транскрипции Генов». В данной программе эффективность реакции рассчитывается по тангенсу угла наклона прямой, которая аппроксимирует кинетическую кривую на ее линейном участке с помощью метода наименьших квадратов. При дальнейшей обработке данных учитывали полученные значения эффективностей, которые составили в для гена CALL Еопухольнорма=(87±13)%, для гена GUSB - Еопухольнорма=(80±9)%, для гена RPN1 - Еопухольнорма=(86±9)%. Статистическую значимость наблюдаемых изменений оценивали при помощи непараметрических тестов Уилкоксона. Данные считали достоверными при Р<0,05, где Р - показатель статистической значимости данных.

Оценка содержания мРНК гена CALL при ППК

Во всех анализированных образцах ППК (100%, 9/9, Р<0.001) выявлено значительное снижение содержания мРНК гена CALL по сравнению с парными «условными нормами» (фиг. 1, табл. 1). Для всей выборки значение LDcp составило 21 раз и варьировало от 4-х до 45-ти раз. Вариабельность уровня мРНК контрольных генов и уровня мРНК гена CALL в парных «условных нормах» не превышает 2-х раз, таким образом, снижение уровня мРНК гена CALL от 4-х до 45-ти раз позволяет достоверно детектировать снижение экспрессии в первичных образцах ППК и является надежным диагностическим маркером. Значения LDcp и FD в образцах, соответствующих различным клиническим стадиям, и для всей выборки близки. Корреляций между степенью, частотой снижения содержания мРНК гена CALL и такими характеристиками, как клиническая стадия, локализация и размер первичной опухоли, возраст и пол пациента, не выявлено.

Представленное выше подробное описание изобретения и его конкретных воплощений, приведенных в примерах со ссылкой на фигуры, предназначено исключительно для более полного уяснения сущности заявленного изобретения, но не для его ограничения. Специалисту будет ясно, что могут быть сделаны различные изменения, которые, тем не менее, будут соответствовать сущности и объему настоящего изобретения, которые определяются прилагаемой формулой изобретения.

Перечень последовательностей

1. Способ диагностики папиллярной почечноклеточной карциномы (ППК), включающий следующие стадии:
а) получение исходной пары образцов ткани от пациента, где один из образцов получен из предположительно пораженной раком ткани, а второй получен из прилегающей гистологически нормальной ткани («условной нормы»);
б) выделение и очистка препаратов РНК из исходной пары образцов;
в) синтез одноцепочечной или двуцепочечной кДНК на матрице РНК с использованием олигонуклеотидных праймеров;
г) проведение количественной реакции амплификации фрагмента гена CALL с использованием кДНК, полученной на стадии в), в качестве матрицы, и пары геноспецифичных олигонуклеотидных праймеров SEQ ID NO: 1 и 2;
д) сравнение количества амплифицированного фрагмента ДНК CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани, где указанные количества амплифицированного фрагмента ДНК отражают изменение содержания мРНК гена CALL, причем уменьшение содержания мРНК гена CALL от 4-х до 45-ти раз служит диагностическим признаком ППК.

2. Способ по п. 1, в котором последовательность праймеров и зонда представлена SEQ ID NO: 1, 2 и 3.

3. Способ по п. 1, в котором на стадии г) количественная реакция амплификации фрагмента гена CALL представляет собой ПЦР в режиме реального времени.

4. Способ по п. 1, в котором на стадии д) используется нормирование количества амплифицированного фрагмента гена CALL на количество амплифицированного фрагмента контрольного гена GUSB (кодирует бета-глюкуронидазу) и/или RPN1 (кодирует рибофорин 1).



 

Похожие патенты:

Группа изобретений относится к области медицины, а именно к онкологии, и предназначена для повышения выживаемости без прогрессирования болезни у пациента, страдающего метастатическим раком ободочной и прямой кишок.

Группа изобретений относится к медицине и касается способа анализа биологического образца пациента, страдающего медуллобластомой, включающего определение уровня экспрессии пяти биомаркеров GLI-1, ОТХ-2, SHROOM2, PDLIM3 и SPHK1 в биологическом образце, взятом у пациента, где увеличенный уровень экспрессии биомаркеров GLI-1, SHROOM2, PDLIM3 и SPHK1 и сниженный уровень экспрессии биомаркера ОТХ-2 по сравнению с контролем служит диагностическим индикатором того, имеет ли пациент повышенную вероятность ответа на [6-(цис-2,6-диметилморфолин-4-ил)-пиридин-3-ил]-амид метил-4′-трифторметоксибифенил-3-карбоновой кислоты.

Группа изобретений относится к медицине, а именно к онкологии, и может быть использована для выявления риска развития стадии I/II карциномы яичника. Для этого способ предусматривает определение присутствия или количества человеческих антител против НЕ4 в биологическом образце, полученном от человека.

Предложенная группа изобретений относится к области медицины. Предложен способ прогнозирования реакции пациента, больного немелкоклеточным раком легкого (НМРЛ), на лечение эрлотиниба гидрохлоридом, включающий определение уровня экспрессии гена ILK в образце опухоли пациента и сравнение уровней экспрессии гена ILK со значением экспрессии гена ILK в опухолях популяции пациентов, на которых указанное лечение не произвело благоприятного клинического эффекта, и в образце опухоли пациента, если уровень экспрессии гена ILK в 0,93 раза меньше, то лечение будет производить благоприятный клинический эффект на такого пациента, который не реагирует на лечение гефитинибом.

Изобретение относится к медицине и представляет собой способ прогнозирования ответа онкологического пациента с неходжкинской лимфомой на противораковую терапию, включающую бортезомиб и ритуксимаб, отличающийся тем, что способ включает определение уровня или количества первого прогностического фактора и определение присутствия или количества второго прогностического фактора, причем низкий уровень СD68 или присутствие полиморфизма PSMB1 (P11A) коррелирует по меньшей мере с одним положительным исходом.

Изобретение относится к медицине, а именно к иммунологии, клеточным биотехнологиям, и может быть использовано для восстановления противоопухолевого иммунитета и подавления роста опухоли с последующим применением в клинической практике.

Изобретение относится к области медицины, в частности к медицинской генетике и онкогинекологии, и предназначено для прогнозирования риска развития рака яичников.

Изобретение относится к медицине, а именно к иммунологии, клеточным биотехнологиям, и может быть использовано для восстановления противоопухолевого иммунитета и подавления роста опухоли с последующим применением в клинической практике.

Группа изобретений относится к медицине и касается способа определения присутствия гемопоэтической опухоли или карциномы, включающего стадию измерения концентрации и/или количества растворимого LR11 в образце, полученном у субъекта, для получения значения измерения растворимого LR11 субъекта, стадию применения эталонного значения каждой опухоли, определенного статистической обработкой значений измерений растворимого LR11 в группе здоровых субъектов, для осуществления сравнения эталонного значения каждой опухоли со значением измерения растворимого LR11 субъекта и стадию сравнения значения измерения растворимого LR11 субъекта с эталонным значением каждой опухоли.

Изобретение относится к области биотехнологии и иммунологии Описаны выделенные антитела и их фрагменты, которые связываются с опухолевыми антигенами. Также описаны композиции и агенты для доставки, которые включают раскрываемые антитела; клетки, которые продуцируют эти антитела; способы продуцирования этих антител; способы применения этих антител, нацеливания на опухоли и/или метастатические клетки, образуемые ими, и/или опухолевые стволовые клетки, и лечение опухолей и/или метастатических клеток, образуемых ими, и/или опухолевых стволовых клеток; и способы прогнозирования рецидива рака у субъекта.
Изобретение относится к области медицины и предназначено для оценки риска прогрессирования хронической болезни почек (ХБП) у детей. У ребенка с подозрением на ХБП забирают кровь из периферической вены и с помощью метода аллель-специфичной полимеразной цепной реакции проводят идентификацию однонуклеотидных полиморфизмов генов ангиотензин-превращающего фермента (АСЕ) Alu Ins/Del I>D, ангиотензина (AGT) Thr174Met и Met235Thr, рецепторов 1 типа ангиотензина 2 (R1AGT) С1166С и эндотелина-1 (ЕТ-1) Lys198Asn.

Группа изобретений относится к области биотехнологии. Способы определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки в нуклеиновой кислоте включают: выделение нуклеиновой кислоты из одного образца или порций; приведение нуклеиновой кислоты в контакт с прямым праймером, способным связываться с нуклеиновой кислотой выше сайта вставки; первым обратным праймером, специфичным для вставленной нуклеотидной последовательности, и вторым обратным праймером, способным связываться с нуклеиновой кислотой ниже сайта вставки.

Изобретение относится к молекулярной биологии. Способ включает: экстракцию препаратов суммарной РНК, получение комплементарной ДНК с помощью реакции обратной транскрипции на РНК-матрице и последующую амплификацию в режиме реального времени с использованием высокоспецифичных праймеров для генов PTEN, CYP1B1 и АСТВ (референтный локус), а также расчет коэффициента относительной экспрессии генов PTEN и CYP1B1 (КPTEN и КCYP1B1) методом RT-PCR.

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантных молекул МНС II класса, и может быть использовано в медицине. Рекомбинантная молекула МНС II класса включает: (i) весь или часть внеклеточного участка α-цепи МНС II класса; (ii) весь или часть внеклеточного участка β-цепи МНС II класса; при этом (i) и (ii) обеспечивают функциональный пептид-связующий домен и при этом (i) и (ii) соединены дисульфидной связью между остатками цистеина, расположенными на α2 домене указанной α-цепи и β2 домене указанной β-цепи, при этом указанные остатки цистеина не присутствуют в нативных доменах α2 и β2 МНС II класса и полученная рекомбинантная молекула не включает мотив лейциновой молнии.

Изобретение относится к области биохимии, в частности к агенту для придания растению устойчивости к ингибитору 4-HPPD, включающему ДНК, кодирующую белок, обладающий активностью, придающей растению устойчивость к ингибитору 4-HPPD.

Изобретение относится к биохимии. Описан способ получения гетерогенного набора одноцепочечных фрагментов ДНК для мультиплексного генетического анализа.

Настоящее изобретение относится к области биоинформатики. Предложен способ для приготовления улучшенной вычислительной системы, основанной на нуклеиновых кислотах, включающий синтезирование в водном растворе варианта системы молекулярных вычислений, отличающегося включением химической модификации, изменяющей энергию гибридизации молекул нуклеиновых кислот в системе.

Изобретение относится к области генной инженерии, конкретно к скринингу веществ, оказывающих регулирующее вес действие, и может быть использовано в медицине. Способ скрининга веществ, оказывающих регулирующее вес действие, включает приведение тестируемого вещества в контакт с клетками, экспрессирующими ген синовиолина, и идентификацию того, имеет или нет указанное тестируемое вещество ингибирующее влияние на экспрессию гена синовиолина.

Настоящее изобретение относится к биохимии, в частности к способу определения и секвенирования неизвестных последовательностей ДНК, которые фланкируют известные последовательности в выделенной ДНК.

Изобретение относится к области биохимии. Представлен набор синтетических олигодезоксирибонуклеотидов для детекции гена msp1α риккетсии Anaplasma marginale методом полимеразной цепной реакции в режиме «реального времени».

Группа изобретений относится к области биотехнологии и представлена набором олигонуклеотидных зондов для профилирования микробиоты желудочно-кишечного тракта (ЖКТ), где указанный набор включает в частности (a) олигонуклеотид, состоящий из (ai) нуклеотидной последовательности, выбранной из ACGCTTGCACCCT (SEQ ID NO: 1) необязательно с не более тремя замещенными основаниями или AGGGTGCAAGCGT (SEQ ID NO: 27) необязательно с не более тремя замещенными основаниями, и (aii) 0-5 нуклеотидов в дополнение к (ai), где олигонуклеотид согласно (а) способен гибридизоваться с SEQ ID NO: 27 или SEQ ID NO: 1, соответственно, в строгих условиях гибридизации. Также предоставлены способы профилирования микробиоты ЖКТ индивидуума и способы диагностики или мониторинга заболевания или состояния у индивидуума или прогнозирования или оценки риска развития у индивидуума заболевания или состояния, в которых используют набор олигонуклеотидных зондов. Использование изобретений позволяет выявлять присутствие и количество определенных бактерий среди множества с высокой точностью благодаря комбинированному эффекту используемого набора зондов. 6 н. и 23 з.п. ф-лы, 2 ил., 7 табл., 1 пр.
Наверх