Способ лечения лихорадки денге



Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге
Способ лечения лихорадки денге

 


Владельцы патента RU 2605904:

РИБОСАЙЕНС ЛЛК (US)

Изобретение относится к соединениям, применимым в том числе в фармацевтических композициях для лечения заболеваний, вызванных вирусом денге, формул:

где: R1 представляет собой арил, где указанный арил представляет собой фенил или нафтил, возможно замещенный одним-тремя заместителями, независимо выбранными из группы, состоящей из следующих: С1-6алкокси; R1a представляет собой С1-6алкил; R1b представляет собой -OR1a или -N(R1a)2; R2a и R2b (i) независимо выбраны из группы, состоящей из следующих: водород, С1-10алкил, -(CH2)mC(=O)R1b и арил-С1-3алкил; R3 представляет собой С1-10алкил или арил-С1-3алкил, где указанный арил представляет собой фенил; R4 представляет собой водород; R6 представляет собой А, В, С или D, где R8 представляет собой водород или С1-3алкил; R5 и R7 независимо выбраны из водорода, С(=О)С1-6алкила; m равен от 0 до 3; или его фармацевтически приемлемой соли. 4 н. и 15 з.п. ф-лы, 2 табл., 2 пр.

 

Согласно настоящей заявке предложено применение нуклеозидных соединений Формулы I для лечения лихорадки денге (DF). Согласно настоящей заявке предложены способы лечения лихорадки денге с использованием нуклеозидных соединений Формулы I.

Лихорадка денге представляет собой острое лихорадочное заболевание, вызванное одним из четырех близкородственных серотипов вируса (DEN-1, DEN-2, DEN-3 и DEN-4). Лихорадку денге на основе ее клинических характеристик классифицируют на классическую лихорадку денге или более тяжелые формы - геморрагическую форму лихорадки денге (DHF) и синдром шока денге (DSS). Выздоровление от инфекции от одного серотипа дает пожизненный иммунитет на этот конкретный серотип, но обеспечивает лишь кратковременную и ограниченную защиту против любого из других серотипов. Вирус денге является членом семейства Flaviviridae, которое объединяет оболочечные РНК-вирусы положительной полярности, человеческие патогены которых, среди прочих, также включают вирус Западного Нила (WNV), вирус желтой лихорадки (YFV), вирус японского энцефалита (JEV) и вирус клещевого энцефалита (TBEV).

Передача вируса денге осуществляется через укус инфицированного комара Aedes aegypti, который обитает в тропических и субтропических регионах по всему миру.

Каждый год региональные эпидемии лихорадки денге вызывают значительную заболеваемость и смертность, социальные потрясения и существенные экономические затраты в подверженных ее влиянию обществах в показателях как госпитализации, так и управления численностью комаров. Лихорадка денге считается Всемирной организацией здравоохранения (ВОЗ) самым важным передающимся насекомыми вирусным заболеванием с оценочными 50 миллионами случаев инфекции вирусом денге, включая 500000 случаев DHF и 24000 смертей во всем мире каждый год. ВОЗ оценивает, что сорок процентов мирового населения (2,5 миллиарда людей) подвержено риску DF, DHF и DSS. Вирус денге также представляет собой патоген категории A NIAID (Национальный институт аллергии и инфекционных заболеваний США) в показателях биозащиты, который представляет значительную угрозу для войск Соединенных Штатов за границей. В Северной Америке вирус денге представляет собой находящуюся на стадии становления угрозу с драматическим увеличением числа случаев тяжелого заболевания в последние 25 лет, включая большие эпидемии на Кубе и в Венесуэле и вспышки в Техасе и на Гавайях.

Неспособность контролировать численность комаров-переносчиков и увеличение путешествий на длительные расстояния способствовали увеличению числа случаев и распространению заболевания лихорадкой денге. Характеристики денге в качестве вируса вирусной геморрагической лихорадки (передающегося насекомыми, широко распространенного и способного индуцировать огромное количество клеточных повреждений и вызывать иммунный ответ, который может приводить к тяжелому кровотечению, шоку и смерти) делают данный вирус уникальной угрозой для военного персонала, развернутого по всему миру, а также для путешественников в тропические регионы. Готовность в отношении как биозащиты, так и вызовов для системы здравоохранения, налагаемые вирусом денге, потребуют разработки новых вакцин и антивирусных терапевтических препаратов.

Вирус денге вызывает несколько заболеваний с возрастающей тяжестью, определяемой отчасти предшествующей инфекцией другим серотипом вируса. Классическая лихорадка денге (DF) начинается через 3-8 суток после укуса инфицированного комара и характеризуется внезапным появлением лихорадки, головной боли, боли в спине, боли в суставах, сыпи, подобной коревой, тошноты и рвоты. DF часто называют «костоломной» лихорадкой из-за этих симптомов. Заболевание обычно проходит через две недели, но обычным является длительное выздоровление со слабостью и депрессией.

Более тяжелая форма заболевания геморрагическая лихорадка денге (DHF) имеет аналогичное начало и раннюю фазу заболевания, что и лихорадка денге. Однако вскоре после начала заболевание характеризуется сильной лихорадкой, увеличением печени и геморрагическими явлениями, такими как кровотечение из носа, рта и внутренних органов из-за проницаемости сосудов. При синдроме шока денге (DSS) наблюдаются недостаточность кровообращения и гиповолемический шок, возникающие из-за утечки плазмы, и они могут приводить к смерти за 12-24 часа без замещения плазмы. Показатель летальности DHF/DSS без лечения может составлять вплоть до 20%. DHF стала ведущей причиной госпитализации и смерти у детей во многих странах, с оценочными 500000 случаев каждый год, требующими госпитализации, и показателем летальности примерно 5%.

Патогенез DHF/DSS все еще исследуется, но считается, что он отчасти обусловлен усилением репликации вируса в макрофагах посредством гетеротипических антител, именуемым зависимым от антител усилением (ADE). Во время вторичной инфекции другим серотипом вируса денге перекрестно реагирующие антитела, которые не являются нейтрализующими, образуют комплексы вирус-антитело, которые поглощаются в моноциты и клетки Лангерганса (дендритные клетки) и увеличивают число инфицированных клеток. Это приводит к активации цитотоксических лимфоцитов, что может вызывать утечку плазмы и геморрагические признаки, характерные для DHF и DSS. Это зависимое от антител усиление инфекции является одной причиной того, почему оказалась такой сложной разработка успешной вакцины. Хотя и менее часто, DHF/DSS могут случаться после первичной инфекции, так что считается, что вирулентность вируса и иммунная активация способствуют патогенезу заболевания.

Лихорадка денге является эндемической в более чем 100 странах Африки, Северной и Южной Америки, Восточного Средиземноморья, Юго-Восточной Азии и в западной части Тихого океана. Во время эпидемии показатели заражения могут составлять вплоть до 80-90% чувствительного населения. Все четыре серотипа вируса проявляются по всему миру, увеличивая число случаев заболевания, а также число взрывных вспышек. Например, в 2002 году в одних Северной и Южной Америке было 1015420 описанных случаев лихорадки денге с 14374 случаями DHF, что более чем в три раза превышает число случаев лихорадки денге, описанных Северной и Южной Америке в 1995 году.

Геном вируса денге, имеющий длину приблизительно 11 т.п.н., состоит из линейной одноцепочечной инфекционной РНК положительной полярности, которая транслируется в виде одного длинного полибелка.

Геном состоит из семи генов неструктурных (NS) белков и трех генов структурных белков, которые кодируют белок нуклеокапсида (С), мембраноассоциированный белок (М) и белок оболочки (Е). Неструктурные белки участвуют в репликации вирусной РНК, сборке вируса и воспалительных компонентах заболевания. Структурные белки участвуют, главным образом, в образовании вирусной частицы. Полибелок-предшественник расщепляется клеточными протеиназами с отделением структурных белков, тогда как кодируемая вирусом протеиназа расщепляет неструктурную область полибелка. Геном является кэппированным и не имеет поли(А) хвоста на 3′-конце, но, вместо этого, имеет стабильную структуру «стебель-петля», необходимую для стабильности и репликации геномной РНК. Вирус связывается с клеточными рецепторами через белок Е и подвергается опосредованному рецептором эндоцитозу, с последующим слиянием в лизосомах при низком pH.

Вирусный геном затем покидает оболочку и транслируется в вирусный полибелок-предшественник. Ко- и посттрансляционный протеолитический процессинг разделяет структурные и неструктурные белки. РНК-зависимая РНК-полимераза, наряду с кофакторами, синтезирует минус-нить РНК, которая служит в качестве матрицы для синтеза потомства в виде плюс-нити РНК.

Репликация вируса ассоциирована с мембраной. После репликации геном заключается в капсид, и незрелый вирус, окруженный липидной оболочкой, отпочковывается в полость. Белки оболочки становятся гликозилированными, и зрелые вирусы высвобождаются из клетки. Важные стадии или процессы на протяжении жизненного цикла вируса были бы возможными мишенями для ингибирования противовирусным лекарственным средством, и они включают связывание вируса с клеткой через белок Е, поглощение вируса в клетку, механизм кэппирования, вирусную протеиназу, вирусную РНК-зависимую РНК-полимеразу и вирусную хеликазу.

Современное управление заболеванием, связанным с вирусом денге, полагается исключительно на борьбу с переносчиком заболевания. Нет одобренных противовирусных препаратов или вакцин для лечения или предупреждения лихорадки денге. Было показано, что рибавирин, аналог гуанозина, является эффективным против ряда инфекций РНК-вирусами и работает против вируса денге в культуре ткани путем ингибирования домена NS5 2′-O-метилтрансферазы вируса денге. Однако рибавирин не продемонстрировал защиту против денге в мышиной модели или в модели макака-резуса, вместо этого он индуцировал анемию и тромбоцитоз.

При отсутствии в настоящее время доступных одобренных вакцин мультивалентные вакцины против вируса денге продемонстрировали некоторый ограниченный потенциал у людей. Однако разработка вакцины является сложной из-за присутствия четырех отличных серотипов вируса, каждый из которых вызывает заболевание. Разработка вакцины также сталкивается с вызовом ADE, когда неравная защита против разных штаммов вируса могла бы на самом деле увеличивать риск более серьезного заболевания. Следовательно, существует потребность в антивирусных лекарственных средствах, которые имеют в качестве мишени все серотипы вируса денге. Противовирусное лекарственное средство, введенное во время ранней инфекции вирусом денге, которое ингибирует репликацию вируса, предупреждало бы высокую вирусную нагрузку, ассоциированную с DHF, и было бы привлекательной стратегией в лечении и предупреждении заболевания. Противовирусное лекарственное средство, которое ингибирует репликацию вируса, могло бы вводиться до путешествия в регион, эндемический по вирусу денге, для предупреждения приобретения заболевания или для тех, кто ранее подвергался влиянию вируса денге, могло бы предупреждать инфекцию другим серотипом вируса и снижать вероятность появления угрожающих жизни DHF и DSS. Наличие противовирусного лекарственного средства также помогло бы в разработке вакцины за счет наличия находящегося под рукой инструмента для лечения осложнений, которые могут возникать из-за неодинаковой иммунной защиты против разных серотипов. Несмотря на то что эффективная вакцина могла бы быть критически важным компонентом эффективной биозащиты, типичная задержка появления иммунитета, потенциальные побочные эффекты, цена и логистика, ассоциированные с крупномасштабными вакцинациями гражданского населения против агента, связанного с малой угрозой, свидетельствуют о том, что всеобъемлющая биозащита включает отдельный элемент с быстрым ответом.

Имеется ясная и давно ощущаемая потребность в разработке эффективных терапевтических средств для лечения против вируса денге. Конкретно, имеется потребность в разработке соединений, которые являются полезными для лечения пациентов, инфицированных денге, и соединений, которые селективно ингибируют репликацию вируса денге.

Краткое изложение сущности изобретения

Согласно заявке предложены применение нуклеозидных соединений Формулы I для лечения лихорадки денге (DF) и способ лечения лихорадки денге, включающий введение пациенту, нуждающемуся в этом, соединения Формулы I

где:

R1 представляет собой водород, С1-6галогеналкил или арил, где указанный арил представляет собой фенил или нафтил, возможно замещенный одним-тремя заместителями, независимо выбранными из группы, состоящей из следующих: C1-6алкил, С2-6алкенил, С2-6алкинил, С1-6алкокси, галоген, С1-6галогеналкил, -N(R1a)2, C1-6ациламино, -NHSO2C1-6алкил, -SO2N(R1a)2, -SO2C1-6алкил, -COR1b, нитро и циано;

R1a представляет собой назависимо водород или С1-6алкил;

R1b представляет собой -OR1a или -N(R1a)2;

R2a и R2b (i) независимо выбраны из группы, состоящей из следующих: водород, С1-10алкил, -(CH2)rN(R1a)2, С1-6гидроксиалкил, -CH2SH, -(CH2)S(O)pMe, -(CH2)3NHC(=NH)NH2, (1Н-индол-3-ил)метил, (1H-индол-4-ил)метил, -(CH2)mC(=O)R1b, арил и арил-С1-3алкил, причем указанные арильные группы возможно замещены группой, выбранной из группы, состоящей из гидроксила, C1-10алкила, С1-6алкокси, галогена, нитро и циано; (ii) R2a представляет собой водород, и R2b и R4 вместе представляют собой (СН2)3; (iii) R2a и R2b вместе представляют собой (СН2)n; или (iv) оба R2a и R2b представляют собой С1-6алкил;

R3 представляет собой водород, С1-10алкил, С1-10галогеналкил, арил или арил-С1-3алкил, где указанный арил представляет собой фенил;

R4 представляет собой водород, С1-3алкил, или R2b и R4 вместе представляют собой (СН2)3;

R6 представляет собой А, В, С или D, где R8 представляет собой водород или С1-3алкил;

R5 и R7 независимо выбраны из водорода, С(=O)С1-6алкила, C(=O)R1b;

m равен от 0 до 3;

n равен 4 или 5;

p равен от 0 до 2; и

r равен от 1 до 6;

или их фармацевтически приемлемых солей.

Подробное описание изобретения

Определения

Фраза, относящаяся к элементу в единственном числе, в том виде, в котором она здесь используется, относится к одному или более чем одному такому элементу, например «соединение» относится к одному или более чем одному соединению или по меньшей мере к одному соединению. Термины в единственном числе или предваряемые фразами «один или более чем один» и «по меньшей мере один», как таковые, могут здесь использоваться взаимозаменяемо.

Фраза «как определено здесь выше» относится к самому широкому определению для каждой группы, как приведено в кратком изложении сущности изобретения или в самом широком пункте формулы изобретения. Во всех других воплощениях, приведенных ниже, заместители, которые могут присутствовать в каждом воплощении, и которые прямо не определены, сохраняют самое широкое определение, приведенное в кратком изложении сущности изобретения.

Термины «включают(ет)» и «включающий» в том виде, как они используются в данном описании изобретения, либо в переходной фразе, либо в основной части пункта формулы изобретения, следует интерпретировать как имеющие значение, допускающее поправки. То есть данные термины следует интерпретировать синонимично фразам "имеющий по меньшей мере" или "включающий по меньшей мере". При использовании в контексте способа термин «включающий» означает то, что способ включает по меньшей мере перечисленные стадии, но может включать дополнительные стадии. При использовании в контексте соединения или композиции термин «включающий» означает то, что соединение или композиция включает по меньшей мере перечисленные характеристики или компоненты, но также может включать дополнительные характеристики или компоненты.

Слово «или» в том виде, в котором оно здесь используется, если конкретно не указано иное, используется во «включительном» смысле «и/или», а не в «исключительном» смысле «либо/либо».

Термин «независимо» используется здесь для указания того, что переменная применяется в любом случае безотносительно к присутствию или отсутствию переменной, имеющей такое же или другое определение, в пределах того же самого соединения. Таким образом, в соединении, в котором R″ появляется дважды и определяется как «независимо углерод или азот», оба R″ могут представлять собой углерод, оба R″ могут представлять собой азот, или один R″ может представлять собой углерод, а другой - азот.

Когда любая переменная встречается больше, чем один раз в любой группировке или формуле, отображающей и описывающей соединения, применяемые или заявленные в настоящем изобретении, ее определение при каждом появлении является независимым от ее определения при каждом другом появлении. Также комбинации заместителей и/или переменных являются разрешенными, только если такие соединения приводят к стабильным соединениям.

Каждый из символов «*» в конце связи или «------», нарисованный через связь, относится к точке присоединения функциональной группы или другой химической группировки к остальной молекуле, частью которой она является. Таким образом, например:

.

Связь, нарисованная в системе кольца (в отличие от связи, соединенной с определенной вершиной), указывает на то, что связь может быть присоединена к любому подходящему атому кольца.

Термин «возможный» или «возможно» в том виде, как он здесь используется, означает то, что событие или обстоятельство, описанное далее, может, но не обязательно происходит, и что описание включает случаи, когда событие или обстоятельство происходит, и случаи, в которых оно не происходит. Например, «возможно замещенный» означает то, что возможно замещенная группировка может включать атом водорода или заместитель.

Фраза «возможная связь» означает то, что связь может присутствовать или может не присутствовать, и что описание включает одинарную, двойную или тройную связи. Если заместитель обозначен как «связь» или «отсутствующий», тогда атомы, связанные с заместителями, являются непосредственно связанными.

Термин «примерно» используется здесь для обозначения приблизительно, в районе, грубо или около. При использовании термина «примерно» в сочетании с числовым интервалом он модифицирует данный интервал, расширяя границы выше и ниже изложенных числовых значений. В общем, термин «примерно» используется здесь для модификации числового значения выше и ниже заявленного значения на отклонение 20%.

Определенные соединения могут демонстрировать таутомерию. Таутомерные соединения могут существовать в виде двух или более чем двух соединений, способных к взаимному превращению. Прототропные таутомеры образуются в результате миграции ковалентно связанного атома водорода между двумя атомами. Таутомеры обычно существуют в равновесии, и попытки выделить индивидуальные таутомеры обычно дают смесь, химические и физические свойства которой согласуются со смесью соединений. Положение равновесия зависит от химических свойств в пределах молекулы. Например, у многих алифатических альдегидов и кетонов, таких как ацетальдегид, преобладает кето форма, тогда как у фенолов преобладает енольная форма. Обычные прототропные таутомеры включают кето/енольные , амид/имидную кислоту и амидиновые таутомеры. Последние два являются особенно обычными в гетероарильных и гетероциклических кольцах, и настоящее изобретение охватывает все таутомерные формы соединений.

Используемые здесь технические и научные термины имеют значение, обычно понятное специалисту в области, к которой относится настоящее изобретение, если не определено иначе. Здесь делается ссылка на разные методологии и материалы, известные специалистам в данной области. Стандартные справочные работы, излагающие общие принципы фармакологии, включают Goodman and Gilman, The Pharmacological Basis of Therapeutics, 10th Ed., McGraw Hill Companies Inc., New York (2001). В осуществлении настоящего изобретения могут использоваться любые подходящие материалы и/или методы, известные специалистам. Однако описаны предпочтительные материалы и методы. Материалы, реактивы и тому подобное, ссылка на которые делается в следующем описании и примерах, можно получать из коммерческих источников, если не отмечено иное.

Описанные здесь определения могут быть дополнены с получением химически релевантных комбинаций, таких как «гетероалкиларил», «галогеналкилгетероарил», «арилалкилгетероциклил», «алкилкарбонил», «алкоксиалкил» и тому подобное. При использовании термина «алкил» в качестве суффикса после другого термина, как в «фенилалкиле» или «гидроксиалкиле», подразумевается, что он относится к алкильной группе, как определено выше, замещенной одним-двумя заместителями, выбранными из других конкретно названных групп. Таким образом, например, термин «фенилалкил» относится к алкильной группе, имеющей один или два фенильных заместителя, и, таким образом, включает бензил, фенилэтил и бифенил. «Алкиламиноалкил» представляет собой алкильную группу, имеющую один-два алкиламино заместителя. «Гидроксиалкил» включает 2-гидроксиэтил, 2-гидроксипропил, 1-(гидроксиметил)-2-метилпропил, 2-гидроксибутил, 2,3-дигидроксибутил, 2-(гидроксиметил), 3-гидроксипропил и так далее. Соответственно, термин «гидроксиалкил» в том виде, как он здесь используется, используется для определения поднабора гетероалкильных групп, определенных ниже. Термин (ар)алкил относится либо к незамещенной алкильной, либо к аралкильной группе. Термин (гетеро)арил или (гет)арил относится либо к арильной, либо к гетероарильной группе.

Термин «спироциклоалкил» в том виде, как он здесь используется, означает спироциклическую циклоалкильную группу, такую как, например, спиро[3.3]гептан.

Термин «спирогетероциклоалкил» в том виде, как он здесь используется, означает спироциклический гетероциклоалкил, такой как, например, 2,6-диазаспиро[3.3]гептан.

Термин «ацил» в том виде, как он здесь используется, обозначает группу формулы -C(=O)R, где R представляет собой водород или низший алкил, как здесь определено. Термин «алкилкарбонил» в том виде, как он здесь используется, обозначает группу формулы C(=O)R, где R представляет собой алкил, как здесь определено. Термин С1-6ацил относится к группе C(=O)R, содержащей 6 атомов углерода. Термин «арилкарбонил» в том виде, как он здесь используется, означает группу формулы C(=O)R, где R представляет собой арильную группу; термин «бензоил» в том виде, как он здесь используется, представляет собой «арилкарбонильную» группу, где R представляет собой фенил.

Термин «сложный эфир» в том виде, как он здесь используется, обозначает группу формулы -C(=O)OR, где R представляет собой низший алкил, как здесь определено.

Термин «алкил» в том виде, как он здесь используется, обозначает насыщенный, одновалентный углеводородный остаток с неразветвленной или разветвленной цепью, содержащий от 1 до 10 атомов углерода. Термин «низший алкил» обозначает углеводородный остаток с прямой или разветвленной цепью, содержащий от 1 до 6 атомов углерода. Термин «С1-10алкил» в том виде, как он здесь используется, относится к алкилу, состоящему из 1-10 углеродов. Примеры алкильных групп включают низшие алькильные группы, включающие метил, этил, пропил, изо-пропил, н-бутил, изо-бутил, трет-бутил или пентил, изопентил, неопентил, гексил, гептил и октил, но не ограничиваются ими.

При использовании термина «алкил» в качестве суффикса после другого термина как в «фенилалкиле» или «гидроксиалкиле», подразумевается, что он относится к алкильной группе, как определено выше, замещенной одним-двумя заместителями, выбранными из других конкретно названных групп. Таким образом, например, «фенилалкил» обозначает радикал R′R″-, где R′ представляет собой фенильный радикал, и R″ представляет собой алкиленовый радикал, как здесь определено, при понимании того, что точка присоединения фенилалкильной группировки будет находиться на алкиленовом радикале. Примеры арилалькильных радикалов включают бензил, фенилэтил, 3-фенилпропил, но не ограничиваются ими. Термины «арилалкил» или «аралкил» интерпретируются аналогично, за исключением того, что R′ представляет собой арильный радикал. Термины «(гет)арилалкил» или «(гет)аралкил» интерпретируются аналогично, за исключением того, что R′ возможно представляет собой арильный или гетероарильный радикал.

Термины «галогеналкил» или «галоген-низший алкил», или «низший галогеналкил» относятся к углеводородному остатку с прямой или разветвленной цепью, содержащему от 1 до 6 атомов углерода, где один или более чем один атом углерода замещен одним или более чем одним атомом галогена.

Термин «алкилен» или «алкиленил» в том виде, как он здесь используется, обозначает двухвалентный насыщенный линейный углеводородный радикал из 1-10 атомов углерода (например, (СН2)n) или разветвленный насыщенный двухвалентный углеводородный радикал из 2-10 атомов углерода (например, -CHMe- или -СН2СН(u-Pr)СН2-), если не указано иное. За исключением случая метилена, открытые валентности алкиленовой группы не присоединены к тому же самому атому. Примеры алкиленовых радикалов включают метилен, этилен, пропилен, 2-метил-пропилен, 1,1-диметил-этилен, бутилен, 2-этилбутилен, но не ограничиваются ими.

Термин «алкокси» в том виде, как он здесь используется, означает -О-алкильную группу, где алкил является таким, как определено выше, таким как метокси, этокси, н-пропилокси, изо-пропилокси, н-бутилокси, изо-бутилокси, трет-бутилокси, пентилокси, гексилокси, включая их изомеры. Термин «низший алкокси» в том виде, как он здесь используется, обозначает алкокси группу с группой «низшего алкила», как определено ранее. «C1-10алкокси» в том виде, как он здесь используется, относится к О-алкилу, где алкил представляет собой C1-10.

Термин «PCy3» относится к фосфину, трижды замещенному тремя циклическими группировками.

Термины «галогеналкокси» или «галоген-низший алкокси» или «низший галогеналкокси» относятся к группе низшего алкокси, где один или более чем один атом углерода замещен одним или более чем одним атомом галогена.

Термин «гидроксиалкил» в том виде, как он здесь используется, обозначает алкильный радикал, как здесь определено, где один-три атома водорода на разных атомах углерода замещены гидроксильными группами.

Термины «алкилсульфонил» и «арилсульфонил» в том виде, как они здесь используются, относятся к группе формулы S(=O)2R, где R представляет собой алкил или арил соответственно, и алкил или арил являются такими, как здесь определено. Термин «гетероалкилсульфонил» в том виде, как он здесь используются, относится здесь к группе формулы -S(=O)2R, где R представляет собой «гетероалкил», как здесь определено.

Термины «алкилсульфониламино» и «арилсульфониламино» в том виде, как они здесь используются, относятся к группе формулы -NR′S(=O)2R, где R представляет собой алкил или арил соответственно, R′ представляет собой водород или C1-3алкил, и алкил и арил являются такими, как здесь определено.

Термин «циклоалкил» в том виде, как он здесь используется, относится к насыщенному карбоциклическому кольцу, содержащему от 3 до 8 атомов углерода, т.е. к циклопропилу, циклобутилу, циклопентилу, циклогексилу, циклогептилу или циклооктилу. Термин «C3-7циклоалкил» в том виде, как он здесь используется, относится к циклоалкилу, состоящему из 3-7 углеродов в карбоциклическом кольце.

Термин «карбоксиалкил» в том виде, как он здесь используется, относится к алкильной группировке, где один атом водорода был заменен карбоксилом с пониманием того, что точка присоединения гетероалкильного радикала находится на атоме углерода. Термин «карбокси» или «карбоксил» относится к группировке -CO2H.

Термин «гетероарил» или «гетероароматический» в том виде, как он здесь используется, означает моноциклический или бициклический радикал с 5-12 атомами кольца, имеющий по меньшей мере одно ароматическое или частично ненасыщенное кольцо, содержащее от четырех до восьми атомов на кольцо, включающий один или более чем один гетероатом N, О или S, причем остальные атомы кольца представляют собой углерод, с пониманием того, что точка присоединения гетероарильного радикала будет находиться на ароматическом или частично ненысыщенном кольце. Как хорошо известно специалистам в данной области, гетероарильные кольца имеют менее ароматический характер, чем их аналоги, состоящие целиком из углерода. Таким образом, для целей изобретения гетероарильная группа должна иметь лишь некоторую степень ароматического характера. Примеры гетероарильных группировок включают моноциклические ароматические гетероциклы, имеющие от 5 до 6 атомов кольца и от 1 до 3 гетероатомов, и включают, но не ограничиваются, пиридинилом, пиримидинилом, пиразинилом, оксазинилом, пирролилом, пиразолилом, имидазолилом, оксазолилом, 4,5-дигидро-оксазолилом, 5,6-дигидро-4Н-[1,3]оксазолилом, изоксазолом, тиазолом, изотиазолом, триазолином, тиадиазолом и оксадиаксолином, которые возможно могут быть замещены одним или более чем одним, предпочтительно одним или двумя заместителями, выбранными из гидрокси, циано, алкила, алкокси, тио, низшего галогеналкокси, алкилтио, галогено, низшего галогеналкила, алкилсульфинила, алкилсульфонила, галогена, амино, алкиламино, диалкиламино, аминоалкила, алкиламиноалкила и диалкиламиноалкила, нитро, алкоксикарбонила и карбамоила, алкилкарбамоила, диалкилкарбамоила, арилкарбамоила, алкилкарбониламино и арилкарбониламино. Примеры бициклических группировок включают хинолинил, изохинолинил, бензофурил, бензотиофенил, бензоксазол, бензизоксазол, бензотиазол, нафтиридинил, 5,6,7,8-тетрагидро-[1,6]нафтиридинил и бензизотиазолил, но не ограничиваются ими. Бициклические группировки возможно могут быть замещены на одном из двух колец, однако точка присоединения находится на кольце, содержащем гетероатом.

Термин «гетероциклил», «гетероциклоалкил» или «гетероцикл» в том виде, как он здесь используется, обозначает одновалентный насыщенный циклический радикал, состоящий из одного или более чем одного кольца, предпочтительно из одного или двух колец, включая спироциклические кольцевые системы, из трех-восьми атомов на кольцо, включая один или более чем один гетероатом кольца (выбранный из N, О или S(O)0-2), и который возможно может быть замещен независимо одним или более чем одним, предпочтительно одним или двумя заместителями, выбранными из следующих: гидрокси, оксо, циано, низший алкил, низший алкокси, низший галогеналкокси, алкилтио, галогено, низший галогеналкил, гидроксиалкил, нитро, алкоксикарбонил, амино, алкиламино, алкилсульфонил, арилсульфонил, алкиламиносульфонил, ариламиносульфонил, алкилсульфониламино, арилсульфониламино, алкиламинокарбонил, ариламинокарбонил, алкилкарбониламино, арилкарбониламино и их ионные формы, если не указано иное. Примеры гетероциклических радикалов включают морфолинил, пиперазинил, пиперидинил, азетидинил, пирролидинил, гексагидроазепинил, оксэтанил, тетрагидрофуранил, тетрагидротиофенил, оксазолидинил, тиазолидинил, изоксазолидинил, тетрагидропиранил, тиоморфолинил, хинуклидинил, имидазолинил и их ионные формы, но не ограничиваются ими. Примерами также могут быть бициклические соединения, такие как, например, 3,8-диаза-бицикло[3.2.1]октан, 2,5-диаза-бицикло[2.2.2]октан или октагидро-пиразино[2,1-с][1,4]оксазин.

Ингибиторы вируса денге

Согласно заявке предложен способ лечения лихорадки денге, включающий введение пациенту, нуждающемуся в этом, соединения Формулы I

где:

R1 представляет собой водород, C1-6галогеналкил или арил, где указанный арил представляет собой фенил или нафтил, возможно замещенный одним-тремя заместителями, независимо выбранными из группы, состоящей из следующих: C1-6алкил, С2-6алкенил, С2-6алкинил, С1-6алкокси, галоген, C1-6галогеналкил, -N(R1a)2, C1-6ациламино, -NHSO2C1-6алкил, -SO2N(R1a)2, -SO2C1-6алкил, -COR1b, нитро и циано;

R1a представляет собой назависимо водород или C1-6алкил;

R1b представляет собой -OR1a или -N(R1a)2;

R2a и R2b (i) независимо выбраны из группы, состоящей из следующих: водород, C1-10алкил, -(CH2)rN(R1a)2, C1-6гидроксиалкил, -CH2SH, -(CH2)S(O)pMe, -(CH2)3NHC(=NH)NH2, (1Н-индол-3-ил)метил, (1H-индол-4-ил)метил, (CH2)mC(=O)R1b, арил и арил-С1-3алкил, причем указанные арильные группы возможно замещены группой, выбранной из группы, состоящей из гидроксила, C1-10алкила, C1-6алкокси, галогена, нитро и циано; (ii) R2a представляет собой водород, и R2b и R4 вместе представляют собой (СН2)3; (iii) R2a и R2b вместе представляют собой (СН2)n; или (iv) оба R2a и R2b представляют собой C1-6алкил;

R3 представляет собой водород, C1-10алкил, C1-10галогеналкил, арил или арил-С1-3алкил, где указанный арил представляет собой фенил;

R4 представляет собой водород, C1-3алкил, или R2b и R4 вместе представляют собой (СН2)3;

R6 представляет собой А, В, С или D, где R8 представляет собой водород или C1-3алкил;

R5 и R7 независимо выбраны из водорода, С(=O)С1-6алкила, C(=O)R1b;

m равен от 0 до 3;

n равен 4 или 5;

p равен от 0 до 2; и

r равен от 1 до 6;

или их фармацевтически приемлемые соли.

Согласно заявке предложен способ лечения лихорадки денге, включающий введение пациенту, нуждающемуся в этом, соединения Формулы Ia

где:

R1 представляет собой водород, С1-6галогеналкил или арил, где указанный арил представляет собой фенил или нафтил, возможно замещенный одним-тремя заместителями, независимо выбранными из группы, состоящей из следующих: C1-6алкил, С2-6алкенил, С2-6алкинил, С1-6алкокси, галоген, С1-6галогеналкил, -N(R1a)2, C1-6ациламино, -NHSO2C1-6алкил, -SO2N(R1a)2, -SO2C1-6алкил, -COR1b, нитро и циано;

R1a представляет собой назависимо водород или С1-6алкил;

R1b представляет собой -OR1a или -N(R1a)2;

R2a и R2b (i) независимо выбраны из группы, состоящей из следующих: водород, C1-10алкил, -(CH2)rN(R1a)2, С1-6гидроксиалкил, -CH2SH, -(CH2)S(O)pMe, -(CH2)3NHC(=NH)NH2, (1Н-индол-3-ил)метил, (1H-индол-4-ил)метил, (CH2)mC(=O)R1b, арил и арил-С1-3алкил, причем указанные арильные группы возможно замещены группой, выбранной из группы, состоящей из гидроксила, C1-10алкила, С1-6алкокси, галогена, нитро и циано; (ii) R2a представляет собой водород, и R2b и R4 вместе представляют собой (СН2)3; (iii) R2a и R2b вместе представляют собой (СН2)n; или (iv) оба R2a и R2b представляют собой С1-6алкил;

R3 представляет собой водород, С1-10алкил, С1-10галогеналкил, арил или арил-С1-3алкил, где указанный арил представляет собой фенил;

R4 представляет собой водород, С1-3алкил, или R2b и R4 вместе представляют собой (СН2)3;

R5 и R7 независимо выбраны из водорода, С(=O)С1-6алкила, C(=O)R1b;

m равен от 0 до 3;

n равен 4 или 5;

p равен от 0 до 2; и

r равен от 1 до 6;

или их фармацевтически приемлемые соли.

Согласно заявке предложен приведенный выше способ, где:

R1 представляет собой фенил, нафтил или о-метоксифенил;

R2a и R2b представляют собой независимо водород, метил или бензил;

R3 представляет собой метил, этил или бензил;

R4 представляет собой Н;

оба R5 и R7 представляют собой Н, -C(=O)Et или -C(=O)Bu; и

R8 представляет собой Н.

Согласно заявке предложен приведенный выше способ, где:

R1 представляет собой фенил или нафтил;

R2a представляет собой водород, и R2b представляет собой метил;

R3 представляет собой этил или бензил; и

оба R5 и R7 представляют собой Н или -C(=O)Et.

Согласно заявке предложен приведенный выше способ, где:

R1 представляет собой нафтил;

R2a представляет собой водород, и R2b представляет собой метил;

R3 представляет собой бензил; и

оба R5 и R7 представляют собой Н.

В одном варианте согласно заявке предложен любой из приведенных выше способов, где:

R1 представляет собой нафтил;

R2a представляет собой Н, и R2b представляет собой бензил;

R3 представляет собой этил;

R4 представляет собой Н;

R5 представляет собой Н;

R6 представляет собой А;

R7 представляет собой Н; и

R8 представляет собой Н.

В другом варианте согласно заявке предложен любой из приведенных выше способов, где:

R1 представляет собой нафтил;

R2a представляет собой Н, и R2b представляет собой бензил;

R3 представляет собой бензил;

R4 представляет собой Н;

R5 представляет собой Н;

R6 представляет собой А; и

R7 представляет собой Н.

В другом варианте согласно заявке предложен любой из приведенных выше способов, где:

R1 представляет собой фенил;

R2a представляет собой Н, и R2b представляет собой метил;

R3 представляет собой бензил;

R4 представляет собой Н;

R5 представляет собой Н;

R6 представляет собой С; и

R7 представляет собой Н.

Согласно заявке предложен способ лечения лихорадки денге, включающий введение пациенту, нуждающемуся в этом, соединения, выбранного из группы, состоящей из следующих:

сложный этиловый эфир (S)-2-[[(2R,3S,4R,5R)-5-(6-амино-пурин-9-ил)-2-азидо-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пропионовой кислоты;

сложный бензиловый эфир (S)-2-{[(2R,3S,4R,5R)-5-(6-амино-пурин-9-ил)-2-азидо-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-фенокси-фосфориламино}-пропионовой кислоты;

сложный метиловый эфир (S)-2-{[(2R,3S,4R,5R)-5-(4-амино-2-оксо-2H-пиримидин-1-ил)-2-азидо-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-фенокси-фосфориламино}-пропионовой кислоты;

сложный (2R,3S,4R,5R)-5-(4-амино-2-оксо-2H-пиримидин-1-ил)-2-азидо-2-[((S)-1-бензилоксикарбонил-этиламино)-(2-метокси-фенокси)-фосфорилоксиметил]-4-пентаноилокси-тетрагидро-фуран-3-иловый эфир пентановой кислоты;

сложный бензиловый эфир (S)-2-[[(2R,3S,4R,5R)-5-(4-амино-2-оксо-2H-пиримидин-1-ил)-2-азидо-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пропионовой кислоты;

сложный бензиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пропионовой кислоты;

сложный диэтиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пентадионовой кислоты;

сложный этиловый эфир (S)-2-{[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-бис-пропионилокси-тетрагидро-фуран-2-илметокси]-фенокси-фосфориламино}-пропионовой кислоты;

сложный бензиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-3-фенил-пропионовой кислоты; и

сложный этиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-3-фенил-пропионовой кислоты.

Согласно заявке предложен любой из приведенных выше способов, дополнительно включающий введение по меньшей мере одного другого противовирусного агента.

Согласно заявке предложено соединение, выбранное из группы, состоящей из следующих:

сложный (2R,3S,4R,5R)-5-(4-амино-2-оксо-2H-пиримидин-1-ил)-2-азидо-2-[((S)-1-бензилоксикарбонил-этиламино)-(2-метокси-фенокси)-фосфорилоксиметил]-4-пентаноилокси-тетрагидро-фуран-3-иловый эфир пентановой кислоты;

сложный диэтиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пентадионовой кислоты;

сложный этиловый эфир (S)-2-{[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-бис-пропионилокси-тетрагидро-фуран-2-илметокси]-фенокси-фосфориламино}-пропионовой кислоты;

сложный бензиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-3-фенил-пропионовой кислоты; и

сложный этиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-3-фенил-пропионовой кислоты.

Соединения для способа лечения лихорадки денге

В следующей Таблице I приведены следующие репрезентативные соединения общей формулы I, полезные для лечения лихорадки денге, как здесь описано. Примеры и способы получения, которые следуют далее, приведены для обеспечения более ясного понимания и для воплощения настоящего изобретения на практике специалистами в данной области. Их не следует рассматривать как ограничивающие объем изобретения, но просто как иллюстративные и представляющие его.

В общем, номенклатура, использованная в данной заявке, основана на AUTONOMTM v.4.0, компьютеризированной системе Института Бельштейна для получения систематической номенклатуры IUPAC (Международный союз теоретической и прикладной химии). Если существует расхождение между изображенной структурой и названием, данным этой структуре, изображенной структуре следует придавать больший вес. Кроме того, если стереохимия структуры или части структуры на указана, например, жирными или пунктирными линиями, структуру или часть структуры следует интерпретировать как охватывающую все ее стереоизомеры.

В ТАБЛИЦЕ I проиллюстрированы примеры соединений согласно общей Формуле I.

Синтез

Общие схемы

Фосфорамидатные соединения по настоящему изобретению могут быть получены путем конденсации 4′-азидонуклеозида 4 с подходящим образом замещенным фосфохлоридатным соединением 3 в присутствии сильного основания (Схема 1). Нуклеозиды по настоящему изобретению типично содержат возможно замещенный пиримидин (R6 представляет собой А или В) или пурин (R6 представляет собой С или D), или один или оба R5 и R7 представляют собой водород или ацил, или карбамоил, или алкоксикарбонил. Примеры 4′-азидонуклеозидов, используемых для получения соединений по настоящему изобретению, могут представлять собой 4′-азидоаденозин или 4′-азидоуридин, которые не предназначены для того, чтобы быть ограничивающими, и объем нуклеозидов по настоящему изобретению можно найти в формуле изобретения. Конденсацию можно проводить на незащищенном нуклеозиде или, в качестве альтернативы, 2′,3′-гидроксильные группы нуклеозида можно защищать в виде ацетонида или другой диольной защитной группы, известной в данной области. Снятие защиты с нуклеозида после конденсации проводится с использованием стандартных протоколов для химии нуклеиновых кислот.

Необходимое замещенное фосфохлоридатное соединение 3, используемое для получения соединений по настоящему изобретению, получают посредством двухэтапной последовательности реакций, включающей конденсацию оксихлорида фосфора (1) с подходящим образом замещенным фенолом с получением арилоксифосфородихлоридатов 2, которые затем обрабатывают солью присоединения кислоты сложного эфира α-аминокислоты в присутствии TEA (триэтаноламин) с получением арилоксифосфорохлоридата 3 (относительно репрезентативной методики, см., например, D. Curley et al. Antiviral Res. 1990 14:345-356; С. McGuigan et al. Antiviral Res. 1992 17:311-321; McGuigan et al. Antiviral Chem. Chemother 1990 1(2):107-113).

Проводят конденсацию арилоксифосфорохлоридата 3 с нуклеозидом 4, где R6 возможно замещен уридином, цитидином, аденозином или инозином, и один или оба R5 и R7 представляют собой водород или ацил, или карбамоил, или алкоксикарбонил. Когда оба R5 и R7 представляют собой водород, 2′,3′-диол может образовать ацетальную или кетальную защитную группу. Обработка нуклеозида арилоксифосфорамидатом в присутствии сильного основания дает фосфорамидатные производные по изобретению (относительно репрезентативных методик, см., например, K.S. Gudmundsson, Nucleosides, Nucleotides & Nucleic Acids 2003 22(10):1953-1961). При защите 2′,3′-диола ацетальной или кетальной группой требуется последующая стадия снятия защиты, которая известна в данной области.

Соединения формулы I могут демонстрировать таутомерию. Таутомерные соединения могут существовать в виде двух или более чем двух соединений, способных к взаимному превращению. Прототропные таутомеры образуются в результате миграции ковалентно связанного атома водорода между двумя атомами. Таутомеры обычно существуют в равновесии, и попытки выделить индивидуальные таутомеры обычно дают смесь, химические и физические свойства которой согласуются со смесью соединений. Положение равновесия зависит от химических свойств в пределах молекулы. Например, у многих алифатических альдегидов и кетонов, таких как ацетальдегид, преобладает кето форма, тогда как у фенолов преобладает енольная форма. Обычные прототропные таутомеры включают кето/енольные , амид/имидную кислоту и амидиновые таутомеры. Последние два являются особенно обычными в гетероарильных и гетероциклических кольцах, и настоящее изобретение охватывает все таутомерные формы соединений.

Термин «аминокислота» в том виде, как он здесь используется, относится к встречающимся в природе α-аминокарбоновым кислотам, а также к их оптическим изомерам (энантиомерам и диастереомерам), синтетическим аналогам и производным. α-Аминокислоты включают атом углерода, связанный с карбоксильной группой, аминогруппой, атомом водорода и уникальной группой «боковой цепи». Термин «встречающиеся в природе аминокислоты» означает L-изомеры встречающихся в природе аминокислот. Встречающиеся в природе аминокислоты представляют собой глицин, аланин, валин, лейцин, изолейцин, серии, метионин, треонин, фенилаланин, тирозин, триптофан, цистеин, пролин, гистидин, аспарагиновую кислоту, аспарагин, глутаминовую кислоту, глутамин, γ-карбоксиглутаминовую кислоту, аргинин, орнитин и лизин. Боковые цепи встречающихся в природе аминокислот включают: водород, метил, изо-пропил, изо-бутил, втор-бутил, -СН2ОН, -СН(ОН)СН3, -CH2SH, -CH2CH2SMe, -(CH2)pCOR, где R представляет собой -ОН или -NH2, и p представляет собой 1 или 2, -(CH2)q-NH2, где q равен 3 или 4, -(CH2)3-NHC(=NH)NH2, -СН2С6Н5, -СН2-р-С6Н4-ОН, (3-индолинил)метилен, (4-имидазолил)метилен.

Соединения по настоящему изобретению могут иметь асимметрические центры, расположенные на боковой цепи группировки сложного эфира, образованного с карбоксильной группой, амида или карбоната, которые при связывании с нуклеозидом дают диастереомеры. Рассматриваются все стереоизомеры боковой цепи соединений по настоящему изобретению - либо в смеси, либо в чистой или в по существу чистой форме. Определение соединений согласно изобретению охватывает и все выделенные оптические изомеры, и энантиомеры и их смеси, включая рацемическую форму. Чистый оптический изомер можно получать стереоспецифичным синтезом из α-D-рибозы, или рацемическую форму можно разделять физическими методами, такими как, например, фракционная кристаллизация, разделение или кристаллизация диастереомерных производных или разделение посредством хроматографии на хиральной колонке. Индивидуальные оптические изомеры можно получать из рацематов традиционными способами, такими как, например, образование соли с оптически активной кислотой, с последующей кристаллизацией.

Фармацевтические композиции и введение

Фармацевтические композиции рассматриваемых соединений для введения посредством нескольких путей были получены, как описано в данном Примере.

Ингредиенты смешивают и дозируют в капсулы, каждая из которых содержит примерно 100 мг; одна капсула составляла бы приблизительно полную суточную дозировку.

Ингредиенты объединяют и гранулируют с использованием растворителя, такого как метанол. Композицию затем сушат и формуют в таблетки (содержащие примерно 20 мг активного соединения) подходящей таблетировочной машиной.

Ингредиенты смешивают с получением суспензии для перорального введения.

Активный ингредиент растворяют в части воды для инъекции. Затем добавляют достаточное количество хлорида натрия с перемешиванием для получения изотоничного раствора. Раствор доводят до требующейся массы остатком воды для инъекции, фильтруют через 0,2-мкм мембранный фильтр и упаковывают при стерильных условиях.

Дозировка и введение

Соединения по настоящему изобретению можно готовить с использованием широкого спектра лекарственных форм и носителей для перорального введения. Пероральное введение может осуществляться в форме таблеток, покрытых таблеток, драже, твердых и мягких желатиновых капсул, растворов, эмульсий, сиропов или суспензий. Соединения по настоящему изобретению являются эффективными при введении другими путями введения, включая непрерывное (внутривенная капельница), местное, парентеральное, внутримышечное, внутривенное, подкожное, чрескожное (которое может включать применение агента, усиливающего проникновение), щечное, назальное, посредством ингаляции и введения суппозитория, наряду с другими путями введения. Предпочтительным способом введения обычно является пероральное с использованием удобной схемы ежесуточной дозировки, которую можно корректировать согласно степени недуга и ответу пациента на активный ингредиент.

Соединение или соединения по настоящему изобретению, а также их фармацевтически приемлемые соли, наряду с одним или более чем одним традиционным эксципиентом, носителем или разбавителем, можно помещать в форму фармацевтических композиций и лекарственных форм. Фармацевтические композиции и стандартные лекарственные формы могут состоять из традиционных ингредиентов в традиционных пропорциях, с дополнительными активными соединениями или началами или без них, и стандартные лекарственные формы могут содержать любое подходящее эффективное количество активного ингредиента, соответствующее намеченному суточному интервалу дозировки, который планируется использовать. Фармацевтические композиции можно использовать в виде твердых веществ, таких как таблетки или заполненные капсулы, полутвердых веществ, порошков, композиций с замедленным высвобождением, или жидкостей, таких как растворы, суспензии, эмульсии, эликсиры или заполненные капсулы для перорального применения; или в форме суппозиториев для ректального или вагинального введения; или в форме стерильных инъецируемых растворов для парентерального применения. Типичный препарат будет содержать от примерно 5% до примерно 95% активного соединения или соединений (масс./масс.). Подразумевается, что термин «препарат» или «лекарственная форма» включает как твердые, так и жидкие композиции активного соединения, и специалист в данной области поймет, что активный ингредиент может существовать в разных препаратах, в зависимости от органа или ткани-мишени и от желательной дозы и фармакокинетических параметров.

Термин «эксципиент» в том виде, как он здесь используется, относится к соединению, которое является полезным в получении фармацевтической композиции, в общем безопасным, нетоксичным и ни биологически, ни иным образом нежелательным, и включает эксципиенты, которые являются приемлемыми для ветеринарного применения, а также для фармацевтического применения у человека. Соединения по данному изобретению можно вводить одни, но обычно они будут вводиться в смеси с одним или более чем одним подходящим фармацевтическим эксципиентом, разбавителем или носителем, выбранным, принимая во внимание намеченный путь введения и стандартную фармацевтическую практику.

Фраза «фармацевтически приемлемый» означает такой, который является полезным при получении фармацевтической композиции, которая является в общем безопасной, нетоксичной и ни биологически, ни иным образом нежелательной, и включает композицию, которая является приемлемой для ветеринарного применения, а также для фармацевтического применения у человека.

Форма «фармацевтически приемлемой соли» активного ингредиента также исходно может придавать активному ингредиенту желательные фармакокинетические свойства, которые отсутствовали у несолевой формы, и даже может положительно влиять на фармакодинамику активного ингредиента в отношении его терапевтической активности в организме. Фраза «фармацевтически приемлемая соль» соединения означает соль, которая является фармацевтически приемлемой и которая обладает желательной фармакологической активностью родительского соединения. Такие соли включают: (1) соли присоединения кислоты, образованные с неорганическими кислотами, такими как соляная кислота, бромисто-водородная кислота, серная кислота, азотная кислота, фосфорная кислота и тому подобное; или образованные с органическими кислотами, такими как уксусная кислота, пропионовая кислота, гексановая кислота, циклопентанпропионовая кислота, гликолевая кислота, пировиноградная кислота, молочная кислота, малоновая кислота, янтарная кислота, яблочная кислота, малеиновая кислота, фумаровая кислота, винная кислота, лимонная кислота, бензойная кислота, 3-(4-гидроксибензоил)бензойная кислота, коричная кислота, миндальная кислота, метансульфоновая кислота, этансульфоновая кислота, 1,2-этандисульфоновая кислота, 2-гидроксиэтансульфоновая кислота, бензолсульфоновая кислота, 4-хлорбензолсульфоновая кислота, 2-нафталинсульфоновая кислота, 4-толуолсульфоновая кислота, камфорсульфоновая кислота, 4-метилбицикло[2.2.2]-окт-2-ен-1-карбоновая кислота, глюкогептоновая кислота, 3-фенилпропионовая кислота, триметилуксусная кислота, третичная бутилуксусная кислота, лаурилсерная кислота, глюконовая кислота, глутаминовая кислота, гидроксинафтоевая кислота, салициловая кислота, стеариновая кислота, муконовая кислота и тому подобное; или (2) соли, образующиеся при замене кислотного протона, присутствующего в родительском соединении, либо ионом металла, например ионом щелочного металла, ионом щелочноземельного металла, либо ионом алюминия; или при координации с органическим основанием, таким как этаноламин, диэтаноламин, триэтаноламин, трометамин, N-метилглюкамин и тому подобное.

Препараты в твердой форме включают порошки, таблетки, пилюли, капсулы, крахмальные облатки, суппозитории и диспергируемые гранулы. Твердый носитель может представлять собой одно или более чем одно вещество, которое также может действовать в качестве разбавителей, корригентов, солюбилизаторов, смазок, суспендирующих агентов, связующих веществ, консервантов, разрыхлителей таблеток или инкапсулирующего вещества. В порошках носитель обычно представляет собой мелкоизмельченное твердое вещество, которое представляет собой смесь с мелкоизмельченным активным компонентом. В таблетках активный компонент обычно смешан с носителем, имеющим необходимую способность к связыванию, в подходящих пропорциях и подвергнут прессованию до желательной формы и размера. Подходящие носители включают карбонат магния, стеарат магния, тальк, сахар, лактозу, пектин, декстрин, крахмал, желатин, трагакантовую камедь, метил целлюлозу, карбоксиметилцеллюлозу натрия, легкоплавкий воск, масло какао и тому подобное, но не ограничиваются ими. Препараты в твердой форме, помимо активного компонента, могут содержать красители, корригенты, стабилизаторы, буферы, искусственные и природные подсластители, диспергенты, загустители, солюбилизаторы и тому подобное.

Жидкие композиции также подходят для перорального введения и включают жидкую композицию, включающую эмульсии, сиропы, эликсиры, водные растворы, водные суспензии. Они включают препараты в твердой форме, которые предназначены для превращения в препараты в жидкой форме незадолго до применения. Эмульсии могут быть получены в растворах, например в водных растворах пропиленгликоля, или могут содержать эмульгаторы, такие как лецитин, сорбитана моноолеат или аравийская камедь. Водные растворы можно получать растворением активного компонента в воде и добавлением подходящих красителей, корригентов, стабилизаторов и загустителей. Водные суспензии можно получать диспергированием мелкоизмельченного активного компонента в воде с вязким веществом, таким как природные или синтетические камеди, смолы, метилцеллюлоза, карбоксиметилцеллюлоза натрия и другие хорошо известные суспендирующие агенты.

Соединения по настоящему изобретению можно готовить для парентерального введения (например, посредством инъекции, например, болюсной инъекции, или непрерывной инфузии), и они могут присутствовать в стандартной лекарственной форме в ампулах, предварительно заполненных шприцах, контейнерах малого объема для инфузии или в многодозовых контейнерах с добавлением консерванта. Композиции могут принимать такие формы, как суспензии, растворы или эмульсии в масляных или водных носителях, например растворы в водном полиэтиленгликоле. Примеры масляных или неводных носителей, разбавителей, растворителей или наполнителей включают пропиленгликоль, полиэтиленгликоль, растительные масла (например, оливковое масло) и инъецируемые органические сложные эфиры (например, этилолеат), и они могут содержать агенты для приготовления композиций, такие как консерванты, увлажнители, эмульгаторы или суспендирующие, стабилизирующие и/или диспергирующие агенты. В качестве альтернативы активный ингредиент может находиться в форме порошка, полученного путем асептического выделения стерильного твердого вещества или путем лиофилизации из раствора, для разведения перед применением подходящим носителем, например стерильной апирогенной водой.

Соединения по настоящему изобретению могут быть приготовлены для местного введения на эпидермис в виде мазей, кремов или лосьонов, или в виде чрескожного пластыря. Мази и кремы, например, могут быть приготовлены с водной или масляной основой с добавлением подходящего загустителя и/или гелеобразующего агента. Лосьоны могут быть приготовлены с водной или масляной основой и, в общем, также будут содержать один или более чем один из следующих: эмульгатор, стабилизатор, диспергирующий агент, суспендирующий агент, загуститель или краситель. Подходящие композиции для местного введения в рот включают ромбовидные лепешки, содержащие активные агенты в ароматизированной основе, обычно сахарозе и аравийской камеди или трагакантовой камеди; пастилки, содержащие активный ингредиент в инертном основании, таком как желатин и глицерин или сахароза и аравийская камедь; и полоскания для рта, содержащие активный ингредиент в подходящем жидком носителе.

Соединения по настоящему изобретению могут быть приготовлены для введения в виде суппозиториев. Сначала плавят легкоплавкий воск, такой как смесь глицеридов жирных кислот или масла какао, и гомогенно диспергируют активный компонент, например путем перемешивания. Расплавленную гомогенную смесь затем выливают в формы удобного размера, дают ей охладиться и затвердеть.

Соединения по настоящему изобретению могут быть приготовлены для вагинального введения. Пессарии, тампоны, кремы, гели, пасты, пены или спреи, содержащие такие носители, помимо активного ингредиента, известны в данной области как подходящие.

Соединения по настоящему изобретению могут быть приготовлены для назального введения. Растворы или суспензии наносят непосредственно в полость носа традиционными средствами, например капельницей, пипеткой или в виде спрея. Композиции могут быть предоставлены в форме одиночной дозы или многих доз. В последнем случае при использовании капельницы или пипетки это может достигаться путем введения пациентом подходящего заданного объема раствора или суспензии. В случае спрея это может достигаться, например, посредством дозирующего атомизирующего пульверизатора.

Соединения по настоящему изобретению можно готовить для аэрозольного введения, в частности, в респираторный тракт, и включая интраназальное введение. Соединение обычно будет иметь маленький размер частиц, например порядка пяти (5) микрометров или менее. Такой размер частиц может быть получен средствами, известными в данной области, например микронизацией. Активный ингредиент предоставлен в упаковке под давлением с подходящим пропеллентом, таким как хлорфторуглерод (CFC), например дихлордифторметан, трихлорфторметан или дихлортетрафторэтан, или диоксид углерода, или другой подходящий газ. Аэрозоль также может с удобством содержать поверхностно-активное вещество, такое как лецитин. Дозу лекарственного средства можно контролировать посредством дозирующего клапана. В качестве альтернативы активные ингредиенты могут быть предоставлены в форме сухого порошка, например порошковой смеси соединения в подходящей порошковой основе, такой как лактоза, крахмал, производные крахмала, такие как гидроксипропилметилцеллюлоза и поливинилпирролидин (PVP). Порошковый носитель будет образовать гель в полости носа. Порошковая композиция может присутствовать в стандартной лекарственной форме, например, в капсулах или в картриджах, например, на основе желатина, или в блистерных упаковках, из которых порошок можно вводить посредством ингалятора.

Когда это желательно, композиции можно получать с энтеросолюбильными покрытиями, адаптированными для введения активного ингредиента с замедленным или контролируемым высвобождением. Например, соединения по настоящему изобретению можно готовить в виде приспособлений для чрескожной или подкожной доставки лекарственных средств. Данные системы доставки имеют преимущество, когда необходимо замедленное высвобождение соединения, и когда соблюдение пациентом схемы лечения является решающим. Соединения в чрескожных системах доставки часто присоединены к приклеивающейся на кожу твердой подложке. Интересующее соединение также может быть объединено с усилителем проникновения, например с азоном (1-додецилаза-циклогептан-2-он). Системы доставки с замедленным высвобождением вставляют подкожно в субдермальный слой посредством хирургии или инъекции. Субдермальные импланты инкапсулируют соединение в липидорастворимой мембране, например из силиконовой резины, или в биодеградируемом полимере, например в полимолочной кислоте.

Подходящие композиции, наряду с фармацевтическими носителями, разбавителями и эксципиентами, описаны в Remington: The Science and Practice of Pharmacy 1995, edited by E.W. Martin, Mack Publishing Company, 19th edition, Easton, Pennsylvania. Квалифицированный ученый в области получения композиций может модифицировать композиции в пределах идей данного описания изобретения с получением многочисленных композиций для конкретного пути введения, не делая композиции по настоящему изобретению нестабильными или нарушающими их терапевтическую активность.

Модификации настоящих соединений для того, чтобы сделать их более растворимыми в воде или в другом носителе, например, могут легко осуществляться небольшими модификациями (композиция в виде соли, этерификация и т.д.), которые безусловно находятся в пределах обычной квалификации в данной области. Также безусловно в пределах обычной квалификации в данной области находится модификация пути введения или схемы дозировки конкретного соединения для того, чтобы управлять фармакокинетикой настоящих соединений для максимально полезного эффекта у пациентов.

Термин «терапевтически эффективное количество» в том виде, как он здесь используется, означает количество, требующееся для ослабления симптомов заболевания у индивидуума. Доза будет корректироваться для индивидуальных требований в каждом конкретном случае. Данная дозировка может варьировать в широких пределах, в зависимости от многочисленных факторов, таких как тяжесть заболевания, подлежащего лечению, возраст и общее состояние здоровья пациента, другие лекарственные средства, которыми лечат пациента, путь и форма введения и предпочтения и опыт участвующего практикующего врача. Для перорального введения в монотерапии и/или комбинированной терапии должна быть подходящей суточная дозировка от примерно 0,01 до примерно 1000 мг/кг массы тела в сутки. Предпочтительная суточная дозировка составляет от примерно 0,1 до примерно 500 мг/кг массы тела, более предпочтительная - от 0,1 до примерно 100 мг/кг массы тела, и самая предпочтительная - от 1,0 до примерно 10 мг/кг массы тела в сутки. Таким образом, для введения человеку массой 70 кг интервалом дозировки было бы от примерно 7 мг до 0,7 г в сутки. Суточную дозировку можно вводить в виде однократной дозировки или в раздельных дозировках, типично от 1 до 5 дозировок в сутки. Обычно лечение начинают с меньшими дозировками, которые меньше, чем оптимальная доза соединения. Затем дозировку увеличивают небольшими инкрементами, пока не достигается оптимальный эффект для индивидуального пациента. Обычный специалист в лечении описанных здесь заболеваний сможет, без чрезмерного экспериментирования и опоры на личные знания, опыт и раскрытия данной заявки, выяснить терапевтически эффективное количество соединений по настоящему изобретению для данного заболевания и пациента.

Фармацевтические препараты предпочтительно находятся в стандартных лекарственных формах. В такой форме препарат подразделяется на единичные дозы, содержащие подходящие количества активного компонента. Стандартная лекарственная форма может представлять собой упакованный препарат, причем упаковка содержит дискретные количества препарата, как, например, упакованные таблетки, капсулы и порошки во флаконах или ампулах. Также стандартная лекарственная форма сама может представлять собой капсулу, таблетку, крахмальную облатку или ромбовидную лепешку, или она может представлять собой подходящее число любой из них в упакованной форме.

Показания и способ лечения

Показания

Соединения по изобретению и их изомерные формы и фармацевтически приемлемые соли являются полезными в лечении или предупреждении инфекции вирусом денге.

Согласно данной заявке предложен способ лечения инфекции вирусом денге, включающий введение пациенту, нуждающемуся в этом, терапевтически эффективного количества соединения Формулы I.

Согласно данной заявке предложен способ ингибирования репликации вируса денге в клетке, включающий введение соединения Формулы I.

ПРИМЕРЫ

Сокращения

Обычно используемые сокращения включают: ацетил (Ас), азо-бис-изобутирилнитрил (AIBN), атмосферы (атм), 9-борбицикло[3.3.1]нонан (9-BBN или BBN), 2,2′-бис(дифенилфосфино)-1,1′-бинафтил (BINAP), трет-бутоксикарбонил (Boc), ди-трет-бутилпирокарбонат или Boc ангидрид (BOC2O), бензил (Bn), бутил (Bu), номер регистрации Chemical Abstracts (CASRN), бензилоксикарбонил (CBZ или Z), карбонилдиимидазол (CDI), 1,4-диазабицикло[2.2.2]октан (DABCO), диэтиламиносеры трифторид (DAST), дибензилиденацетон (dba), 1,5-диазабицикло[4.3.0]нон-5-ен (DBN), 1,8-диазабицикло[5.4.0]ундец-7-ен (DBU), N,N′-дициклогексилкарбодиимид (DCC), 1,2-дихлорэтан (DCE), дихлорметан (DCM), 2,3-дихлор-5,6-дициано-1,4-бензохинон (DDQ), диэтилазодикарбоксилат (DEAD), ди-изо-пропилазодикарбоксилат (DIAD), ди-изо-бутилалюминия гидрид (DIBAL или DIBAL-H), ди-изо-пропилэтиламин (DIPEA), N,N-диметилацетамид (DMA), 4-N,N-диметиламинопиридин (DMAP), N,N-диметилформамид (DMF), диметилсульфоксид (DMSO), 1,1′-бис-(дифенилфосфино)этан (dppe), 1,1′-бис-(дифенилфосфино)ферроцен (dppf), 1-(3-диметиламинопропил)-3-этилкарбодиимида гидрохлорид (EDCI), 2-этокси-1-этоксикарбонил-1,2-дигидрохинолин (EEDQ), этил (Et), этилацетат (EtOAc), этанол (EtOH), сложный этиловый эфир 2-этокси-2H-хинолин-1-карбоновой кислоты (EEDQ), диэтиловый эфир (Et2O), этилизопропиловый эфир (EtOiPr), O-(7-азабензотриазол-1-ил)-N, N,N′N′-тетраметилурония гексафторфосфат уксусная кислота (HATU), уксусная кислота (НОАс), 1-N-гидроксибензотриазол (HOBt), высокоэффективая жидкостная хроматография (ВЭЖХ), изо-пропанол (IPA), изопропилмагния хлорид (iPrMgCl), гексаметилдисилазан (HMDS), жидкостная хроматография-масс-спектрометрия (ЖХ-МС), гексаметилдисилазан лития (LiHMDS), мета-хлорпероксибензойная кислота (m-СРВА), метанол (МеОН), температура плавления (Т пл.), MeSO2 - (мезил или Ms), метил (Me), ацетонитрил (MeCN), м-хлорпербензойная кислота (МСРВА), масс-спектр (МС), метил-трет-бутиловый эфир (МТВЕ), метилтетрагидрофуран (MeTHF), N-бромсукцинимид (NBS), н-бутиллитий (nBuLi), N-карбоксиагидрид (NCA), N-хлорсукцинимид (NCS), N-метилморфолин (NMM), N-метилпирролидон (NMP), пиридиния хлорхромат (РСС), дихлор-((бис-дифенилфосфино)ферроценил) палладия(II) (Pd(dppf)Cl2), палладия(II) ацетат (Pd(OAc)2), трис(дибензилиденацетон)дипалладий(0) (Pd2(dba)3), пиридиния дихромат (PDC), фенил (Ph), пропил (Pr), изо-пропил (i-Pr), фунты на квадратный дюйм (psi), пиридин (pyr), 1,2,3,4,5-пентафенил-1′-(ди-трет-бутилфосфино)ферроцен (Q-Phos), комнатная температура (температура окружающей среды, rt или RT), втор-бутиллитий (sBuLi), трет-бутилдиметилсилил или t-NBuMe2Si (TBDMS), тетра-н-бутиламмония фторид (TBAF), триэтиламин (TEA или Et3N), 2,2,6,6-тетраметилпиперидин-1-оксил (TEMPO), трифлят или CF3SO2- (Tf), трифторуксусная кислота (TFA), 1,1′-бис-2,2,6,6-тетраметилгептан-2,6-дион (TMHD), O-бензотриазол-1-yl-N,N,N′,N′-тетраметилурония тетрафторборат (TBTU), тонкослойная хроматография (ТСХ), тетрагидрофуран (THF), триметилсилил или Me3Si (TMS), пара-толуолсульфоновой кислоты моногидрат (TsOH или pTsOH), 4-Me-C6H4SO2- или тозил (Ts), и N-уретан-N-карбоксиангидрид (UNCA). Традиционная номенклатура, включающая приставки нормальный (н), изо (и-), вторичный (втор-), третичный (трет-) и нео, при использовании с алкильной группировкой, имеет ее традиционное значение. (J. Rigaudy and D.P. Klesney, Nomenclature in Organic Chemistry, IUPAC 1979 Pergamon Press, Oxford).

Соединения по изобретению можно получать целым рядом способов, показанных в иллюстративных синтетических реакциях, описанных ниже в разделе Примеров. В патенте США 7608599 раскрыто получение противовирусных нуклеозидных фосфорамидатов, и он включен сюда посредством ссылки во всей его полноте.

Исходные вещества и реактивы, используемые при получении данных соединений, обычно либо доступны от коммерческих поставщиков, таких как Aldrich Chemical Co., либо их получают способами, известными специалистам в данной области, следуя методикам, изложенным в ссылках, таких как Fieser and Fieser, Reagents for Organic Synthesis; Wiley & Sons: New York, 1991, Тома 1-15; Rodd, Chemistry of Carbon Compounds, Elsevier Science Publishers, 1989, Тома 1-5 и Приложения и Organic Reactions, Wiley & Sons: New York, 1991, Тома 1-40. Следует понимать, что схемы синтетических реакций, показанные в разделе Примеров, являются просто иллюстративными в отношении некоторых способов, посредством которых можно синтезировать соединения по изобретению, и в данных схемах синтетических реакций можно делать разные модификации, и они будут предложены специалисту в данной области со ссылкой на описание, содержащееся в данной заявке.

Исходные вещества и промежуточные соединения схем синтетических реакций могут быть выделены и очищены, если это желательно, с использованием традиционных методик, включающих фильтрование, перегонку, кристаллизацию, хроматографию и тому подобное, но не ограничивающихся ими. Такие вещества можно характеризовать с использованием традиционных способов, включающих определение физических констант и спектральные данные.

Если не определено противоположное, описанные здесь реакции типично проводят в инертной атмосфере при атмосферном давлении в интервале температур реакции от примерно -78°C до примерно 150°C, часто от примерно 0°C до примерно 125°C и еще чаще и с удобством при примерно комнатной температуре (или температуре окружающей среды), например примерно 20°C.

В исходных соединениях на соединениях по изобретению могут присутствовать разные заместители, добавленные к любому из промежуточных соединений или добавленные после образования конечных продуктов известными методами реакций замещения или превращения. Если заместители сами по себе являются реакционноспособными, тогда сами заместители можно защищать согласно методикам, известным в данной области. В данной области известен и может применяться целый ряд защитных групп. Примеры многих из возможных групп можно найти в "Protective Groups in Organic Synthesis" by Green et al., John Wiley and Sons, 1999. Например, нитрогруппы можно добавлять нитрированием, и нитрогруппу можно превращать в другие группы, такие как амино, посредством восстановления и галогено - посредством диазотирования аминогруппы и замены диазо группы галогеном. Ацильные группы можно добавлять ацилированием по Фриделю-Крафтсу. Ацильные группы можно затем превращать в соответствующие алкильные группы разными методами, включая восстановление по Вольфу-Кишнеру и восстановление по Клемменсону. Аминогруппы могут быть алкилированы с образованием моно- и диалкиламино групп; и меркапто и гидрокси группы могут быть алкилированы с образованием соответствующих эфиров. Первичные спирты могут быть окислены окислителями, известными в данной области, с образованием карбоновых кислот или альдегидов, и вторичные спирты могут быть окислены с образованием кетонов. Таким образом, для получения множества заместителей во всей молекуле исходного вещества, промежуточных соединений или конечного продукта, включая выделенные продукты, можно использовать реакции замещения или изменения.

Общая методология

ТСХ проводили на предварительно покрытых пластинках с алюминиевой подложкой (60 F-54, толщина 0,2 мм; поставлены Е. Merck AG, Darmstad, Германия) и проявляли восходящим способом. После выпаривания растворителя соединения детектировали облучением УФ (ультрафиолетовый) лампой при 254 нм или 366 нм, наблюдая гашение флуоресценции. Хроматографические колонки упаковывали суспензией силикагеля (60А, 40-60 мкм, Phase Sep, Великобритания) в подходящем элюенте под давлением. Образцы наносили в виде концентрированного раствора в том же самом элюенте или предварительно адсорбировали на силикагеле. Спектры 1H и 13C ЯМР записывали на спектрометре Bruker Advance DPX300 (300 МГц и 75 МГц соответственно) и автокалибровали к контрольному пику дейтерированного растворителя. Для всех 13C ЯМР осуществляли декомпозицию протонов. При обозначении сигналов ЯМР использовали следующие сокращения: s (синглет), d (дублет), t (триплет), qu (квартет), q (квинтет), m (мультиплет), bs (широкий сигнал), dd (двойной дублет), dt (двойной триплет). Масс-спектры низкого разрешения получали на установке VG Platform II Fisons (ионизация при атмосферном давлении, электрораспылительная масс-спектрометрия) в режиме либо отрицательных, либо положительных ионов.

Использованные растворители были безводными и использовались в том виде, в котором были приобретены у Aldrich. Всю стеклянную посуду сушили в печи при 130° в течение нескольких часов и давали ей охлаждаться под струей сухого азота.

Примеры получения

Пример 1

4′-Азидоаденозин-5′-O-[фенил(бензилокси-L-аланил)]фосфат

Получение соединения, указанного в заголовке (I-2), было раскрыто McGuigan, Christopher, et al в Journal of Medicinal Chemistry (2007), 50(22), 5463-5470.

MCBP (масс-спектрометрия высокого разрешения) (Э/И) (электрораспылительная ионизация) m/e 648,1696 (MNa+). Точная масса: C26H28N9O8NaP требует 648, 1696.

Пример 2

4′-Азидоаденозин-5′-O-[нафта-1-ил(бензилокси-L-фенилаланил)]фосфат

Соединение, указанное в заголовке (I-9), получали аналогично способам, описанным McGuigan, Christopher et al в Journal of Medicinal Chemistry (2007), 50(8), 1840-1849.

Пример 3

4′-Азидоаденозин-5′-O-[нафта-1-ил(этокси-L-фенилаланил)]фосфат

Соединение, указанное в заголовке (1-10), получали аналогично способам, описанным McGuigan, Christopher et al в Journal of Medicinal Chemistry (2007), 50(8), 1840-1849.

Биологические примеры

Антивирусный анализ с клетками Huh7

Линию клеток человеческой гепатомы Huh-7 (Университет Майнца, Германия) культивировали в DMEM (среда Игла, модифицированная по Дульбекко) без фенольного красного (Cellgro Mediatech, кат. №10-013-CV, содержащая 4,5 г/л глюкозы, L-глутамин и пируват натрия). Данную среду, кроме того, дополняли 10% (об./об.) FBS (фетальная коровья сыворотка) (ATLAS кат. № F-0500-A, № партии 850114 А) и 1% (об./об.) пенициллина/стрептомицина (Cellgro Mediatech №30-022-Cl). Клетки поддерживали при 37°C в увлажненной атмосфере 5% CO2. Все репрезентативные штаммы вируса денге четырех серотипов DENV-1 (Th-Sman), DENV-2 (Th-36), DENV-3 (Н-87) и DENV-4 (Н-241) были получены в АТСС (Американская коллекция типовых культур) (Manassas, VA). Титры вируса измеряли на клетках ВНК-21, используя стандартную методику бляшечного анализа. Для определения ЭК50 (эффективная концентрация) нуклеозида в антивирусном анализе клетки Huh-7 высаживали в белые 96-луночные планшеты в среды MEM, дополненные 10% FBS и 1% пенициллина/стрептомицина. После инкубации в течение 24 ч клетки инфицировали при множественности инфекции (MOI) 0,5 в течение 2 ч при 37°C. В тех же самых средах, дополненных 1% DMSO, получали десять трехкратных разведений соединений. После 2 ч фазы поглощения вирус отсасывали, и разведенное соединение добавляли в каждые четыре лунки. Клетки Huh-7 переносили на планшеты, как описано выше, и подвергали воздействию одинаковых интервалов концентрации соединений. Необработанные клетки наносили рядом с ними в качестве контроля. После 3-суточной инкубации при 37°C определяли жизнеспособность клеток с использованием реактива Cell-titer Glo™ (Promega, Madison, WI), который добавляли в каждую лунку и инкубировали в течение 5 мин. Планшеты анализировали с использованием планшет-ридера Thermo Luminoskan (Waltham, MA).

Анализ инфекции дендритных клеток

Криоконсервированные дендритные клетки, происходящие от незрелых человеческих моноцитов (iDC), от индивидуальных доноров приобретали у Stemcell Technologies (Кат. № PB-DC001F). iDC подсчитывали и инкубировали при концентрации 15000 клеток/лунку (96-луночный планшет) в средах RPMI 1640, содержащих 10% (об./об.) фетальной коровьей сыворотки (FBS), 1% (об./об.) пенициллина/стрептомицина (Invitrogen™), в течение 48 ч при 37°C в увлажненной до 90% атмосфере 5% CO2 до начала эксперимента.

В 96-луночном плоскодонном планшете 15000 iDC от индивидуальных доноров инфицировали вирусом денге при множественности инфекции (MOI) 2 в объеме 50 мкл в течение 2 ч. После инфекции iDC промывали и культивировали в полных средах RPMI в присутствии серийно разведенных соединений. Каждую комбинацию вируса/лекарственного средства тестировали либо в двойной, либо в тройной повторности (в зависимости от доступности iDC от индивидуальных доноров). Планшеты инкубировали в течение 24 ч при 37°C в увлажненной до 90% атмосфере 5% CO2. Через 24 ч клетки промывали и выделяли клеточную РНК. Вирусную РНК и контроль в виде эндогенной 18S рРНК (Applied Bio Systems) количественно измеряли посредством анализа ПЦР (полимеразная цепная реакция) в реальном времени. Жизнеспособность iDC с имитацией инфекции и инфицированных отслеживали в описанные моменты времени с использованием анализа CellTiter Glo® (Promega) согласно рекомендации производителя.

Клеточную РНК выделяли посредством набора для клеток PerfectPure™ RNA 96 (5 PRIME) согласно рекомендации производителя. Для получения кДНК с использованием случайных гексамерных праймеров использовали набор для синтеза первой нити кДНК Transcriptor (Roche). 5 мкл полученной кДНК подвергали анализу ПЦР в реальном времени (Roche) с использованием праймеров, направленных на 3′UTR (3′ нетранслируемая область) вируса денге, и следующих праймеров: обратный праймер для вируса денге (общий для всех серотипов): 5′-GATCTCTGGTCTTTCCCAGCGTCAA-3′, прямой праймер для серотипа 1 вируса денге: 5′-GAGCCCCGTCCAAGGACGTAAAATGAA-3′, прямой праймер для серотипов 2 или 3 вируса денге: 5′-GAGCCCCGTCCAAGGACGTTAAAAGAA-3′, прямой праймер для серотипа 4 вируса денге: 5′-TATTGAAGTCAGGCCACTTGTGCC-3′ и зонд для вируса денге (общий для всех серотипов): 5′-/56 FAM/AAGGACTAGAGGTTAGAGGAGACCCCCCGC/3BHQI/-3′. Все праймеры приобретали у Integrated DNA Technologies. Taqman проводили в двойной повторности. Процент ингибирования получали с использованием следующих расчетов. Во-первых, рассчитывали ΔСТ путем вычитания значения СТ для 18S рРНК из значения СТ РНК вируса денге. ΔCt из анализа Taqman в двойной повторности усредняли. Затем получали ΔΔCt путем вычитания среднего ΔCt необработанного образца из среднего ΔCt обработанного образца. Относительную количественную оценку рассчитывали с использованием следующей формулы.

Относительная количественная оценка = 2-среднееΔΔCt. 50%-ные ингибирующие концентрации (ИК50) рассчитывали с использованием сигмоидной модели дозы-ответа в Microsoft XLfit.

Репрезентативный анализ данных можно найти в Таблице II, приведенной ниже:

Приведенное выше изобретение было описано с некоторыми подробностями посредством иллюстрации и примера в целях ясности и лучшего понимания. Для специалиста в данной области будет очевидно, что в пределах объема приложенной формулы изобретения можно осуществлять на практике изменения и модификации. Поэтому следует понимать, что приведенное выше описание предназначено для того, чтобы быть иллюстративным и не ограничивающим. Объем изобретения поэтому следует определять не со ссылкой на приведенное выше описание, но вместо этого следует определять со ссылкой на следующую приложенную формулу изобретения, наряду с полным объемом эквивалентов, которым дает право такая формула изобретения.

Все патенты, патентные заявки и публикации, процитированные в данной заявке, являются тем самым включенными посредством ссылки во всей их полноте для всех целей в той же самой степени, как если бы каждый индивидуальный патент, патентная заявка или публикация были, таким образом, отмечены индивидуально.

1. Способ лечения лихорадки денге, включающий введение пациенту, нуждающемуся в этом, соединения Формулы I

где:
R1 представляет собой арил, где указанный арил представляет собой фенил или нафтил, возможно замещенный одним-тремя заместителями, независимо выбранными из группы, состоящей из следующих: С1-6алкокси;
R1a представляет собой С1-6алкил;
R1b представляет собой -OR1a или -N(R1a)2;
R2a и R2b (i) независимо выбраны из группы, состоящей из следующих: водород, С1-10алкил, -(CH2)mC(=O)R1b и арил-С1-3алкил;
R3 представляет собой С1-10алкил или арил-С1-3алкил, где указанный арил представляет собой фенил;
R4 представляет собой водород;
R6 представляет собой А, В, С или D, где R8 представляет собой водород или С1-3алкил;
R5 и R7 независимо выбраны из водорода, С(=О)С1-6алкила;
m равен от 0 до 3;
или его фармацевтически приемлемой соли.

2. Способ по п. 1, включающий введение пациенту, нуждающемуся в этом, соединения Формулы Ia

где:
R1 представляет собой арил, где указанный арил представляет собой фенил или нафтил, возможно замещенный одним-тремя заместителями, независимо выбранными из группы, состоящей из следующих: С1-6алкокси;
R1a представляет собой С1-6алкил;
R1b представляет собой -OR1a или -N(R1a)2;
R2a и R2b (i) независимо выбраны из группы, состоящей из следующих: водород, С1-10алкил, -(CH2)mC(=O)R1b и арил-С1-3алкил;
R3 представляет собой С1-10алкил или арил-С1-3алкил, где указанный арил представляет собой фенил;
R4 представляет собой водород;
R5 и R7 независимо выбраны из водорода, С(=O)С1-6алкила;
R8 представляет собой водород или С1-3алкил;
m равен от 0 до 3;
или его фармацевтически приемлемых солей.

3. Способ по п. 2, где:
R1 представляет собой фенил, нафтил или о-метоксифенил;
R2a и R2b представляют собой независимо водород, метил или бензил;
R3 представляет собой метил, этил или бензил;
R4 представляет собой Н;
оба R5 и R7 представляют собой Н, -C(=O)Et или -С(=O)Bu; и
R8 представляет собой Н.

4. Способ по п. 3, где:
R1 представляет собой фенил или нафтил;
R2a представляет собой водород, и R2b представляет собой метил;
R3 представляет собой этил или бензил; и
оба R5 и R7 представляют собой Н или -C(=O)Et.

5. Способ по п. 4, где:
R1 представляет собой нафтил;
R2a представляет собой водород, и R2b представляет собой метил;
R3 представляет собой бензил; и
оба R5 и R7 представляют собой Н.

6. Способ по п. 4, где:
R1 представляет собой нафтил;
R2a представляет собой Н, и R2b представляет собой бензил;
R3 представляет собой этил; и
оба R5 и R7 представляют собой Н.

7. Способ по п. 4, где:
R1 представляет собой нафтил;
R2a представляет собой Н, и R2b представляет собой бензил;
R3 представляет собой бензил; и
оба R5 и R7 представляют собой Н.

8. Способ по п. 1, где:
R1 представляет собой фенил;
R2a представляет собой Н, и R2b представляет собой метил;
R3 представляет собой бензил;
R5 представляют собой Н;
R6 представляет собой С, и
R7 представляет собой Н.

9. Способ по любому из пп. 1-8 для лечения лихорадки денге, включающий введение пациенту, нуждающемуся в этом, соединения, выбранного из группы, состоящей из следующих:
сложный этиловый эфир (S)-2-[[(2R,3S,4R,5R)-5-(6-амино-пурин-9-ил)-2-азидо-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пропионовой кислоты;
сложный бензиловый эфир (S)-2-{[(2R,3S,4R,5R)-5-(6-амино-пурин-9-ил)-2-азидо-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-фенокси-фосфориламино}-пропионовой кислоты;
сложный метиловый эфир (S)-2-{[(2R,3S,4R,5R)-5-(4-амино-2-оксо-2H-пиримидин-1-ил)-2-азидо-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-фенокси-фосфориламино}-пропионовой кислоты;
сложный (2R,3S,4R,5R)-5-(4-амино-2-оксо-2H-пиримидин-1-ил)-2-азидо-2-[((S)-1-бензилоксикарбонил-этиламино)-(2-метокси-фенокси)-фосфорилоксиметил]-4-пентаноилокси-тетрагидро-фуран-3-иловый эфир пентановой кислоты;
сложный бензиловый эфир (S)-2-[[(2R,3S,4R,5R)-5-(4-амино-2-оксо-2H-пиримидин-1-ил)-2-азидо-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пропионовой кислоты;
сложный бензиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пропионовой кислоты;
сложный диэтиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пентадионовой кислоты;
сложный этиловый эфир (S)-2-{[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-бис-пропионилокси-тетрагидро-фуран-2-илметокси]-фенокси-фосфориламино}-пропионовой кислоты;
сложный бензиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-3-фенил-пропионовой кислоты; и
сложный этиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-3-фенил-пропионовой кислоты.

10. Применение соединения Формулы I для лечения лихорадки денге,

где:
R1 представляет собой арил, где указанный арил представляет собой фенил или нафтил, возможно замещенный одним-тремя заместителями, независимо выбранными из группы, состоящей из следующих: C1-6алкокси;
R1a представляет собой C1-6алкил;
R1b представляет собой -OR1a или -N(R1a)2;
R2a и R2b (i) независимо выбраны из группы, состоящей из следующих: водород, C1-10алкил, -(CH2)mC(=O)R1b и арил-С1-3алкил;
R3 представляет собой C1-10алкил или арил-С1-3алкил, где указанный арил представляет собой фенил;
R4 представляет собой водород;
R6 представляет собой А, В, С или D, где R8 представляет собой водород или C1-3алкил;
R5 и R7 независимо выбраны из водорода, С(=O)С1-6алкила;
m равен от 0 до 3;
или его фармацевтически приемлемых солей.

11. Применение по п. 10; включающее введение пациенту, нуждающемуся в этом, соединения Формулы Ia

где:
R1 представляет собой арил, где указанный арил представляет собой фенил или нафтил, возможно замещенный одним-тремя заместителями, независимо выбранными из группы, состоящей из следующих: С1-6алкокси;
R1a представляет собой С1-6алкил;
R1b представляет собой -OR1a или -N(R1a)2;
R2a и R2b (i) независимо выбраны из группы, состоящей из следующих: водород, С1-10алкил, -(CH2)mC(=O)R1b и арил-С1-3алкил;
R3 представляет собой С1-10алкил или арил-С1-3алкил, где указанный арил представляет собой фенил;
R4 представляет собой водород;
R5 и R7 независимо выбраны из водорода, С(=O)С1-5алкила;
R8 представляет собой водород или С1-3алкил;
m равен от 0 до 3;
или его фармацевтически приемлемых солей.

12. Применение по п. 11, где:
R1 представляет собой фенил, нафтил или о-метоксифенил;
R2a и R2b представляют собой независимо водород, метил или бензил;
R3 представляет собой метил, этил или бензил;
R4 представляет собой Н;
оба R5 и R7 представляют собой Н, -C(=O)Et или -С(=O)Bu; и
R8 представляет собой Н.

13. Применение по п. 12, где:
R1 представляет собой фенил или нафтил;
R2a представляет собой водород, и R2b представляет собой метил;
R3 представляет собой этил или бензил; и
оба R5 и R7 представляют собой Н или -C(=O)Et.

14. Применение по п. 13, где:
R1 представляет собой нафтил;
R2a представляет собой водород, и R2b представляет собой метил;
R3 представляет собой бензил; и
оба R5 и R7 представляют собой Н.

15. Применение по п. 12, где:
R1 представляет собой нафтил;
R2a представляет собой Н, и R2b представляет собой бензил;
R3 представляет собой этил; и
оба R5 и R7 представляют собой Н.

16. Применение по п. 10, где:
R1 представляет собой фенил;
R2a представляет собой Н, и R2b представляет собой метил;
R3 представляет собой бензил;
R5 представляют собой Н;
R6 представляет собой С, и
R7 представляет собой Н.

17. Применение по любому из пп. 10-16 для лечения лихорадки денге, включающий введение пациенту, нуждающемуся в этом, соединения, выбранного из группы, состоящей из следующих:
сложный этиловый эфир (S)-2-[[(2R,3S,4R,5R)-5-(6-амино-пурин-9-ил)-2-азидо-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пропионовой кислоты;
сложный бензиловый эфир (S)-2-{[(2R,3S,4R,5R)-5-(6-амино-пурин-9-ил)-2-азидо-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-фенокси-фосфориламино}-пропионовой кислоты;
сложный метиловый эфир (S)-2-{[(2R,3S,4R,5R)-5-(4-амино-2-оксо-2H-пиримидин-1-ил)-2-азидо-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-фенокси-фосфориламино}-пропионовой кислоты;
сложный (2R,3S,4R,5R)-5-(4-амино-2-оксо-2H-пиримидин-1-ил)-2-амино-2-[((S)-1-бензилоксикарбонил-этиламино)-(2-метокси-фенокси)-фосфорилоксиметил]-4-пентаноилокси-тетрагидро-фуран-3-иловый эфир пентановой кислоты;
сложный бензиловый эфир (S)-2-[[(2R,3S,4R,5R)-5-(4-амино-2-оксо-2H-пиримидин-1-ил)-2-азидо-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пропионовой кислоты;
сложный бензиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пропионовой кислоты;
сложный диэтиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пентадионовой кислоты;
сложный этиловый эфир (S)-2-{[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-бис-пропионилокси-тетрагидро-фуран-2-илметокси]-фенокси-фосфориламино}-пропионовой кислоты;
сложный бензиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-314-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-3-фенил-пропионовой кислоты; и
сложный этиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-3-фенил-пропионовой кислоты.

18. Применение соединения Формулы I для получения лекарственного средства для лечения лихорадки денге,

где:
R1 представляет собой арил, где указанный арил представляет собой фенил или нафтил, возможно замещенный одним-тремя заместителями, независимо выбранными из группы, состоящей из следующих: С1-6алкокси;
R1a представляет собой С1-6алкил;
R1b представляет собой -OR1a или -N(R1a)2;
R2a и R2b (i) независимо выбраны из группы, состоящей из следующих: водород, С1-10алкил, -(CH2)mC(=О)R1b и арил-С1-3алкил;
R3 представляет собой С1-10алкил или арил-С1-3алкил, где указанный арил представляет собой фенил;
R4 представляет собой водород;
R6 представляет собой А, В, С или D, где R8 представляет собой водород или C1-3алкил;
R5 и R7 независимо выбраны из водорода, С(=О)С1-6алкила;
m равен от 0 до 3;
или его фармацевтически приемлемых солей.

19. Соединение, выбранное из группы, состоящей из следующих: сложный (2R,3S,4R,5R)-5-(4-амино-2-оксо-2H-пиримидин-1-ил)-2-азидо-2-[((S)-1-бензилоксикарбонил-этиламино)-(2-метокси-фенокси)-фосфорилоксиметил]-4-пентаноилокси-тетрагидро-фуран-3-иловый эфир пентановой кислоты;
сложный диэтиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-пентадионовой кислоты;
сложный этиловый эфир (S)-2-{[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-бис-пропионилокси-тетрагидро-фуран-2-илметокси)-фенокси-фосфориламино}-пропионовой кислоты;
сложный бензиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-3-фенил-пропионовой кислоты; и
сложный этиловый эфир (S)-2-[[(2R,3S,4R,5R)-2-азидо-5-(2,4-диоксо-3,4-дигидро-2Н-пиримидин-1-ил)-3,4-дигидрокси-тетрагидро-фуран-2-илметокси]-(нафталин-1-илокси)-фосфориламино]-3-фенил-пропионовой кислоты.



 

Похожие патенты:

Изобретение относится к производным нуклеозидов, композициям на их основе и способам лечения расстройств печени, опосредованных инфекцией Flaviviridae, включая гепатит С.

Изобретение относится к комбинации, по меньшей мере, двух описанных здесь пролекарств. .

Изобретение относится к новому меченому аналогу физиологически активного соединения - меченному тритием ацил-коензиму А общей формулы I: где: Acyl - [5,6-3Н](5,6-дигидро)арахидоноил или [6,7-3Н]линолеил.

Изобретение относится к области фармакологии и медицины и касается применения эффективного количества -L-2'дезокси-нуклеозида формулы I или II для производства лекарственного средства для лечения гепатита В, содержащих их фармацевтических композиций и способов лечения гепатита В.

Изобретение относится к С3алкиловым эфирам (S)-2-{[(2R,3R,5R)-5-(4-амино-2-оксо-2Н-пиримидин-1-ил)-4,4-дифтор-3-гидрокси-тетрагидрофуран-2-илметокси]фенокси-фосфориламино}-пропионовой кислоты общей формулы 1 и их фармацевтически приемлемым солям.

Изобретение относится к соединениям для лечения гепатита С формулы I: его стереоизомерным формам, фармацевтически приемлемым солям или сольватам, где R1 представляет собой водород; R2 представляет собой водород, нафтил или фенил, необязательно замещенный 1, 2 или 3 заместителями, выбранными из галогена и C1-C6алкила; R3 и R4 представляют собой водород или C1-C6алкил; R5 представляет собой C1-C10алкил, необязательно замещенный C1-C6алкоксигруппой, C3-C7циклоалкил или бензил; R8 представляет собой водород.

Изобретение относится к новым соединениям общей формулы 1 или их стереоизомерам или фармацевтически приемлемым солям, обладающим свойствами ингибитора РНК полимеразы HCV NS5B, и к способам их получения.

Изобретение относится к области молекулярной биологии, вирусологии и медицины и касается новых биологически активных соединений, а именно солей 5'-аминокарбонилфосфоната 3'-азидо-3'-дезокситимидина.

Изобретение относится к динуклеозидным эфирам фосфоновых кислот, которые могут быть использованы как антивирусные агенты формулы: где Azt - остаток 3'-азидо-3'-дезокситимидина, 3ТС - остаток 2',3'-дидезокси-3'-тиацитидина, R = электронно-акцепторная группа, например СlСН 2-, CH3C(O)CH2-, H2NCO, PhCH2CH2HNCO-, PhOCH2, СН3ОСН 2-, N3CH2-.

Изобретение относится к 5'-фосфорсодержащим производным 2',3'-дидезокси-3'-тиацитидина общей структурной формулы, приведенной ниже, где R=Н, NH2-C(O)-. .

Изобретение относится к комбинации, по меньшей мере, двух описанных здесь пролекарств. .

Изобретение относится к новым адамантансодержащим аминам нижеуказанной общей формулы, конкретно к 2-(адамант-2-ил)пентан-1-амину и 2-(адамант-2-ил)фенилэтил-1-амину, Новые соединения проявляют антивирусную активность.
Наверх