Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта



Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта
Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта

 


Владельцы патента RU 2605913:

ДЖЕНЕТИК ЭНЭЛИСИЗ АС (NO)

Группа изобретений относится к области биотехнологии и представлена набором олигонуклеотидных зондов для профилирования микробиоты желудочно-кишечного тракта (ЖКТ), где указанный набор включает в частности (a) олигонуклеотид, состоящий из (ai) нуклеотидной последовательности, выбранной из ACGCTTGCACCCT (SEQ ID NO: 1) необязательно с не более тремя замещенными основаниями или AGGGTGCAAGCGT (SEQ ID NO: 27) необязательно с не более тремя замещенными основаниями, и (aii) 0-5 нуклеотидов в дополнение к (ai), где олигонуклеотид согласно (а) способен гибридизоваться с SEQ ID NO: 27 или SEQ ID NO: 1, соответственно, в строгих условиях гибридизации. Также предоставлены способы профилирования микробиоты ЖКТ индивидуума и способы диагностики или мониторинга заболевания или состояния у индивидуума или прогнозирования или оценки риска развития у индивидуума заболевания или состояния, в которых используют набор олигонуклеотидных зондов. Использование изобретений позволяет выявлять присутствие и количество определенных бактерий среди множества с высокой точностью благодаря комбинированному эффекту используемого набора зондов. 6 н. и 23 з.п. ф-лы, 2 ил., 7 табл., 1 пр.

 

Настоящее изобретение относится к набору олигонуклеотидных зондов и их применению для профилирования микробиоты желудочно-кишечного тракта (ЖКТ). Микробиота ЖКТ является показателем заболеваний или состояний или риска развития заболеваний или состояний, которые можно таким образом идентифицировать. Эти характерные профили микробиоты затем можно применять для диагностики или мониторинга таких заболеваний и состояний. Набор зондов можно предоставлять в форме готового набора.

ЖКТ, также обозначаемый как желудочно-кишечный тракт (этот термин можно использовать взаимозаменяемо с ЖКТ), представляет собой ряд связанных между собой органов, начинающийся ртом и заканчивающийся анальным отверстием. На всем протяжении своей длины ЖКТ населен микроорганизмами различных видов. Все микроорганизмы ЖКТ составляют микробиоту ЖКТ, а относительные количества составляющих ее микроорганизмов можно рассматривать как профиль микробиоты. Также можно определять микробиоту и профили микробиоты различных отделов ЖКТ.

Считается, что многие заболевания и состояния или их этапы связаны с характерными профилями микробиоты ЖКТ или его отделов. В некоторых случаях заболевание или состояние может вызываться или усиливаться нарушениями профиля микробиоты ЖКТ. В других случаях заболевание или состояние вызывает или обусловливает смещение определенного профиля микробиоты ЖКТ. Таким образом, посредством анализа профилей микробиоты в образцах из ЖКТ можно получать информацию, которая помогает в диагностике или мониторинге заболевания или состояния, или которая позволяет установить риск развития заболевания или состояния, которое, как было показано, характеризуется определенным профилем микробиоты.

Заболевания и состояния, поражающие ЖКТ, с высокой вероятностью приводят к характерным изменениям профилей микробиоты, например, воспалительное заболевание кишечника (ВЗК), болезнь Крона (БК), язвенный колит (ЯК), синдром раздраженного кишечника (СРК) и злокачественные опухоли ЖКТ (например, злокачественная опухоль ротовой полости, глотки, пищевода, желудка, двенадцатиперстной кишки, тонкого кишечника, подвздошной кишки, слепой кишки, толстого кишечника, прямой кишки или анального канала), а также существуют данные, доказывающие связь микробиоты ЖКТ с заболеваниями и состояниями, которые считаются не связанными с ЖКТ, например, аллергическими заболеваниями, например, экземой, астмой, атопическим дерматитом, аллергическим конъюнктивитом, аллергическим ринитом и пищевыми аллергиями; нарушениями обмена веществ, например, сахарным диабетом (типа 1 и типа 2), ожирением и метаболическим синдромом; нейрологическими нарушениями, например, депрессией, рассеянным склерозом, деменцией и болезнью Альцгеймера; и аутизмом.

Сегодня известен набор зондов, который позволяет с высокой чувствительностью и точностью диагностировать относительные количества ключевых бактерий микробиоты ЖКТ и, таким образом, предоставлять профили микробиоты ЖКТ, которые являются достаточно детализированными и точными, чтобы характеризовать различные заболевания или состояния или риск развития различных заболеваний или состояний. Таким образом, недавно предложенный набор зондов представляет собой эффективное средство диагностики с высокой чувствительностью и точностью.

Таким образом, в одном из аспектов предоставлен набор олигонуклеотидных зондов, включающий:

(a) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из ACGCTTGCACCCT (SEQ ID NO: 1), последовательности, комплементарной (AGGGTGCAAGCGT; SEQ ID NO: 27), или последовательности, способной гибридизоваться с обеими последовательностями в строгих условиях гибридизации;

(b) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из CGATCCGAAAACCTTCTTCACT (SEQ ID NO: 2), последовательности, комплементарной (AGTGAAGAAGGTTTTCGGATCG; SEQ ID NO: 28), или последовательности, способной гибридизоваться с обеими последовательностями в строгих условиях гибридизации;

(c) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из GGACAACGCTTGCCAC (SEQ ID NO: 3), последовательности, комплементарной (GTGGCAAGCGTTGTCC; SEQ ID NO: 29), или последовательности, способной гибридизоваться с обеими последовательностями в строгих условиях гибридизации;

(d) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из CGTAGGCGGTTCGTCGCGT (SEQ ID NO: 4), последовательности, комплементарной (ACGCGACGAACCGCCTACG; SEQ ID NO: 30), или последовательности, способной гибридизоваться с обеими последовательностями в строгих условиях гибридизации; и

(e) один или несколько олигонуклеотидов, содержащих нуклеотидную последовательность, выбранную из приведенных в таблице 1 или последовательности, способной гибридизоваться с любой из нуклеотидных последовательностей, приведенных в таблице 1, в строгих условиях гибридизации; и необязательно

(f) один или несколько олигонуклеотидов, содержащих нуклеотидную последовательность, выбранную из приведенных в таблице 2 и таблице 3 или последовательности, способной гибиридизоваться с любой нуклеотидной последовательностью, приведенной в таблице 2 и таблице 3, в строгих условиях гибридизации.

В предпочтительных вариантах осуществления в наборе зондов присутствует компонент (f) и один или несколько олигонуклеотидов, содержащих нуклеотидную последовательность, выбранную из приведенных в таблице 2.

Также изобретение предоставляет и раскрывает любые комбинации различных индивидуальных вариаций для каждого компонента.

Таким образом, в других определенных вариантах осуществления набор олигонуклеотидных зондов включает компоненты от (a) до (d) и необязательно компонент (f), как определено выше, и, по меньшей мере, один из следующих компонентов:

(i) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную SEQ ID NO: 5, SEQ ID NO: 31 или последовательности, способной гибридизоваться с этими последовательностями в строгих условиях гибридизации,

(ii) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 6, SEQ ID NO: 32 или последовательности, способной гибридизоваться с этими последовательностями в строгих условиях гибридизации,

(iii) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 7, SEQ ID NO: 33 или последовательности, способной гибридизоваться с этими последовательностями в строгих условиях гибридизации,

(iv) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 8, SEQ ID NO: 34 или последовательности, способной гибридизоваться с этими последовательностями в строгих условиях гибридизации.

Набор зондов может включать и, как правило, включает более одной копии каждого типа выбранного олигонуклеотидного зонда.

В наборе зондов могут содержаться дополнительные олигонуклеотидные зонды. Предпочтительно дополнительные олигонуклеотидные зонды позволяют получать информацию о составе микробиоты ЖКТ, которую предоставляет набор зондов. Это могут быть дополнительные зонды, которые предоставляют достоверные сведения о микробиоте ЖКТ или предоставляют информацию, которая может использоваться в качестве контроля для одного или нескольких других зондов в наборе зондов, или предоставляют стандартную информацию, которая может позволять количественно оценивать данные, полученные от одного или нескольких других зондов в наборе зондов. Дополнительные зонды могут быть ориентированы на те же самые или другие бактерии, что и один или несколько зондов из набора зондов, описанных выше.

Изобретение также относится к олигонуклеотидному зонду, содержащему нуклеотидную последовательность, выбранную из любой из SEQ ID NO: 1-52, или нуклеотидную последовательность, способную гибридизоваться с указанной нуклеотидной последовательностью в строгих условиях гибридизации. Применение таких зондов в композициях по изобретению и их получение, и применение таких зондов в способах по изобретению представляют собой дополнительные аспекты изобретения.

В дальнейшем, ссылки на "нуклеотидную последовательность SEQ ID NO: X" также будут включать ссылки на нуклеотидные последовательности, способные гибридизоваться в строгих условиях гибридизации с SEQ ID NO: X, если контекст не указывает на иное.

Олигонуклеотиды из набора зондов по изобретению могут варьировать по размеру в зависимости от того, какую нуклеотидную последовательность они содержат. Как правило, олигонуклеотиды могут содержать до 100 нуклеотидов, предпочтительно до 80, 60, 50, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 или до 10 нуклеотидов. Олигонуклеотиды из набора зондов по изобретению могут содержать, по меньшей мере, 9, предпочтительно, по меньшей мере, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 60 или, по меньшей мере, 80 нуклеотидов. В определенных вариантах осуществления олигонуклеотиды из набора зондов по изобретению могут содержать, по меньшей мере, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, 60 или, по меньшей мере, 80 нуклеотидов в дополнение к количеству нуклеотидов, содержащемуся в последовательности SEQ ID NO: 1-52.

Нуклеотиды олигонуклеотидов из набора зондов могут быть нуклеотидами любого типа при условии, что специфичность или эффективность гибридизации и, при необходимости, эффективность полимеризации нуклеиновой кислоты или эффективность амплификации нуклеиновой кислоты с помощью праймеров не ухудшается. Олигонуклеотиды, таким образом, могут представлять собой дезоксирибонуклеотиды, рибонуклеотиды, их модификации (например, ПНК, морфолино-, ЗНК) и их смеси. ДНК-олигонуклеотиды и ЗНК-модифицированные ДНК-олигонуклеотиды являются предпочтительными.

Нуклеотиды, относящиеся к SEQ ID NO: 1-52, могут находиться в любом участке олигонуклеотидных зондов при условии, что олигонуклеотиды могут гибридизоваться с комплементарной последовательностью-мишенью нужной SEQ NO и, при необходимости, участвовать в реакции достройки нуклеиновой кислоты. В некоторых вариантах осуществления 3'-нуклеотид любой последовательности SEQ ID NO: 1-52, которая содержится в олигонуклеотиде, представляет собой 3'-нуклеотид олигонуклеотида.

В других вариантах осуществления олигонуклеотиды состоят в основном из последовательностей, выбранных из SEQ ID NO: 1-52. Таким образом, олигонуклеотиды содержат нуклеотидную последовательность, выбранную из SEQ ID NO: 1-52 и 1, 2, 3, 4 или 5 дополнительных нуклеотидов. В других вариантах осуществления олигонуклеотиды состоят из последовательности, выбранной из SEQ ID NO: 1-52.

Если не указано иначе, или если на иное не указывает конкретный контекст, все нуклеотидные последовательности приведены в настоящем документе от 5'-конца к 3'-концу в соответствии с традиционными обозначениям в данной области техники.

Строгие условия гибридизации определяют как 2×SSC/50% формамида при 50°C для этапа связывания и 2×SSC при 65°C для условий отмывания (где SSC=0,15 M NaCl, 0,015 M цитрата натрия, pH 7,2).

В предпочтительных вариантах осуществления нуклеотидные последовательности, которые могут гибридизоваться с одной из SEQ ID NO: 1-52 в строгих условиях гибридизации, гибридизуются со всеми, или по существу всеми, нуклеотидами в последовательности SEQ ID NO: 1-52, например, с рядом смежных нуклеотидов с количеством нуклеотидов, которое составляет, по меньшей мере, 50%, предпочтительно, по меньшей мере, 55, 60, 65, 70, 75, 80, 85, 90 или 95% общего числа нуклеотидов в рассматриваемой последовательности SEQ ID NO.

Альтернативно, нуклеотидные последовательности, которые могут гибридизоваться с нуклеотидными последовательностями одной из SEQ ID NO: 1-26 или 27-52 с строгих условиях гибридизации, могут представлять собой нуклеотидные последовательности, которые соответствуют нуклеотидной последовательности SEQ ID NO: 27-52 или 1-26, соответственно, но содержат до 40% оснований (аденин, тимин/урацил, гуанин или цитозин) нуклеотидных последовательностей SEQ ID NO: 27-52 или 1-26, замененных на другие основания. Предпочтительно замененными являются до 35, 30, 25, 20, 15, 10 или 5% оснований. Другими словами, нуклеотидные последовательности, которые могут гибридизоваться с нуклеотидными последовательностями одной из SEQ ID NO: 1-26 или 27-52 в строгих условиях гибридизации, могут представлять собой нуклеотидные последовательности, соответствующие нуклеотидной последовательности SEQ ID NO: 27-52 или 1-26, соответственно, но с замененными 5, 4, 3 или 2 основаниями или только с одним замененным основанием. Замененное основание в последовательности может представлять собой любое стандартное или нестандартное, природное или синтетическое основание.

Нуклеотидные последовательности, которые могут гибридизоваться с SEQ ID NO: 1-26 или 27-52 в строгих условиях гибридизации, предпочтительно составляют в длину 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 или 28 нуклеотидов и представляют собой непрерывный участок нуклеотидной последовательности SEQ ID NO: 27-52 или 1-26, соответственно, с описанными выше заменами.

Предпочтительно замену основания(ий) проводят либо вблизи 5'-конца нуклеотидной последовательности, например, в последних 15, 10 или 5 нуклеотидах 5'-конца последовательности. Иными словами, замену основания(ий) предпочтительно не проводят на 3'-конце нуклеотидной последовательности или вблизи него, например, в последних 2, 3, 4, 5, 10 или 15 нуклеотидах 3'-конца. В других вариантах осуществления 3'-конец не содержит замененных оснований.

В определенных вариантах осуществления любые олигонуклеотиды набора зондов, содержащие нуклеотидную последовательность любой SEQ ID NO: 1-26, могут содержать C-остаток непосредственно на 3'-конце указанной нуклеотидной последовательности, или любые олигонуклеотиды, содержащие нуклеотидную последовательность любой из SEQ ID NO: 27-52, могут содержать G-остаток непосредственно на 5'-конце указанной нуклеотидной последовательности.

Олигонуклеотиды из набора зондов могут быть помечены фрагментом для облегчения обнаружения и манипуляций. Большое количество подходящих фрагментов и способов мечения известны в данной области и описаны в литературе. Многие фрагменты могут выполнять обе функции. Можно использовать любые поддающиеся обнаружению или генерирующие сигнал молекулы или репортерные молекулы. К подходящим меткам относятся колориметрические, хемилюминесцентные, хромогенные, радиоактивные и флуоресцентные метки, однако также можно использовать белковые (например, колориметрические, люминесцентные, хромогенные) или основанные на антителах способы мечения и генерирующие сигнал системы. Таким образом, термин "метка" в рамках изобретения включает не только непосредственно обнаруживаемые генерирующие сигнал или пассивные фрагменты, но также и любые фрагменты, которые генерируют сигнал или участвуют в реакции генерации сигнала и могут быть обнаружены непрямым способом. Например, фрагмент может представлять собой биотин, и непрямое обнаружение может проводиться с помощью стрептавидина, несущего колориметрический, хемилюминесцентный, хромогенный, радиоактивный или флуоресцентный фрагмент.

В некоторых вариантах осуществления метка может содержать множество фрагментов, которые вносят вклад в общую функциональность метки. Путем комбинирования различных фрагментов и/или варьирования их относительного содержания можно создавать широкий спектр уникальных меток. Например, можно использовать множество красителей, например, люминесцентных (например, биолюминесцентных, хемилюминесцентных, фотолюминесцентных, радиолюминесцентных, сонолюминесцентных и т.д.), которые в сочетании дают уникальную электромагнитную спектральную характеристику. Путем варьирования относительного содержания выбранных красителей можно получать дальнейшую дифференциацию спектральных характеристик. Также предусмотрено применение характеристик, основанных на поглощении волн электромагнитной радиации определенной длины.

Меченные флуоресцеином или иные флуоресцентно меченные нуклеотиды являются особенно подходящими для включения в праймеры и позволяют обнаруживать их непосредственно за счет флуоресценции или косвенно за счет взаимодействия антител. Они являются коммерчески доступными. Праймеры можно метить, например, [35S], [3H] или [32P], как описано в Syvänen, A.C. et al. Genomics 8, [1990], 684-692. В качестве метки можно использовать любой связывающийся фрагмент, например, фрагмент антитела, His-метку, биотин или стрептавидин. Эти группы можно включать в форме меченых нуклеотидов.

Некоторые или все олигонуклеотиды набора зондов могут быть предоставлены в иммобилизованной форме на одной или нескольких твердых подложках для применения в изобретении. В других вариантах осуществления олигонуклеотиды из набора зондов могут быть иммобилизованы на одной или нескольких твердых подложках перед применением. Одна или предпочтительно множество копий олигонуклеотидных зондов закреплены на указанных твердых подложках в количестве, например, 10 или более, например, в количестве, по меньшей мере, 100 копий каждого уникального зонда.

Один или несколько олигонуклеотидных зондов из набора зондов, каждый имеющий определенную последовательность, могут быть закреплены на отдельных твердых подложках, которые в сочетании образуют набор зондов, иммобилизованных на многочисленных твердых подложках, например, один или несколько олигонуклеотидных зондов из набора зондов могут быть иммобилизованы на многочисленных гранулах, мембранах, фильтрах, биочипах и т.д. Твердые подложки из различных участков набора зондов размещают в пространстве подходящим способом, хотя сигналы, ассоциированные с каждым зондом (которые генерируются способом, описанным ниже в настоящем документе), должны обнаруживаться по отдельности.

Альтернативно, зонды можно иммобилизовать на отдельных участках одной твердой подложки, например, каждый олигонуклеотидный зонд с определенной последовательностью, как правило, в многочисленных копиях, можно иммобилизовать на отдельном дискретном участке или области конкретного чипа, пластинки, фильтра или мембраны, например, с получением ряда.

Также можно использовать комбинацию таких способов, например, можно использовать несколько твердых подложек, на каждой из которых иммобилизованы несколько зондов с различными последовательностями.

Фраза "твердая подложка" обозначает любой твердый материал, способный связывать олигонуклеотиды, например, посредством гидрофобного, ионного или ковалентного взаимодействия.

"Иммобилизация" в рамках изобретения относится к обратимому или необратимому связыванию зондов с указанной твердой подложкой. В случае обратимого связывания зонды остаются связанными с твердой подложкой в течение времени, необходимого для осуществления способов по изобретению.

Подходящие подложки для иммобилизации, на которые можно наносить олигонуклеотиды, известны в данной области и включают любые из хорошо известных подложек или матриц, которые широко используются в настоящее время для иммобилизации, разделения и т.д. олигонуклеотидов. Такие материалы в качестве неограничивающих примеров включают любые синтетические органические полимеры, такие как полистирол, поливинилхлорид, полиэтилен; или нитроцеллюлозу и ацетат целлюлозы; или агарозу, целлюлозу, альгинат, тефлон или латекс; или тозиловые активированные поверхности; или стекло или нейлон или любую поверхность, несущую группу, подходящую для ковалентного связывания нуклеиновых кислот. Они могут быть представлены в форме частиц, полосок, гелей, фильтров, мембран, волокон, капилляров, чипов или микротитровальных полосок, пластинок, трубочек, плиток или камер и т.д. Способы иммобилизации или прикрепления олигонуклеотидов к твердым подложкам также известны в данной области. Особенно предпочтительны ДНК-чипы (микрочипы, стеклянные чипы), которые в настоящее время часто применяются в молекулярной биологии. В других вариантах осуществления можно использовать мембранные полоски, на которые отдельными точками наносят олигонуклеотиды, после чего сшивают их с помощью УФ-излучения. Альтернативно, прикрепление можно проводить косвенно с помощью фрагмента для прикрепления, который несут олигонуклеотидные зонды и/или твердая подложка. Таким образом, например, можно использовать аффинные пары, такие как авидин, стрептавидин или биотин, ДНК или ДНК-связывающий белок (например, репрессор lac I или последовательность оператора lac, с которой он связывается), антитела (которые могут быть моно- или поликлональными), фрагменты антител или эпитопы или гаптены антител. В этих случаях один участник пары прикрепляется к твердой подложке (или является ее частью), а другой участник прикрепляется к молекуле нуклеиновой кислоты (или является ее частью).

В рамках изобретения "аффинная пара" относится к двум компонентам, которые распознают друг друга и специфично связываются друг с другом (т.е. предпочтительно перед другими молекулами).

Прикрепление подходящих функциональных групп к твердой подложке можно проводить способами, хорошо известными в данной области, которые включают, например, присоединение посредством гидроксильных, карбоксильных, альдегидных или аминогрупп, что обеспечивается обработкой твердой подложки для получения подходящих поверхностных покрытий. Твердые подложки, несущие подходящие фрагменты для присоединения участника аффинной пары, можно получать стандартными способами, известными в данной области.

Присоединение подходящих функциональных групп к олигонуклеотидным зондам по изобретению можно проводить посредством лигирования, синтеза или амплификации, например, с применением праймеров, несущих подходящий фрагмент, такой как биотин или определенная последовательность для захвата.

В определенных вариантах осуществления каждый олигонуклеотидный зонд с определенной последовательностью можно связывать с отдельной твердой подложкой, например, гранулой или микросферой, несущей определенную метку, с получением группы или ряда групп частиц, несущих одинаковую метку и одинаковый зонд. Обнаружение гибридизации частицы с определенной меткой предоставляет информацию о последовательности зонда, вовлеченного в такую гибридизацию.

Частицы можно метить общепринятым способом, например, посредством одной или нескольких меток, описанных выше. В одном из вариантов осуществления метка частицы не является олигонуклеотидом или нуклеиновой кислотой или меченым олигонуклеотидом или меченой нуклеиновой кислотой или не содержит его. Подходящим способом мечения твердой подложки по этим вариантам осуществления является мечение красителем, например, люминесцентным (например, биолюминесцентным, хемилюминесцентным, фотолюминесцентным, радиолюминесцентным, сонолюминесцентным и т.д.) красителем или множеством красителей (или их комбинациями), которые вместе дают уникальную электромагнитную спектральную характеристику при возбуждении. Также возможно применением спектральных характеристик, полученных на основе поглощения волн электромагнитной радиации определенной длины.

Подходящим красителем является флуоресцентный краситель, например, содержащий красные или инфракрасные флуорофоры, например, фикоэритрин.

Метку можно иммобилизовать на и/или в частице, например, посредством прямого ковалентного связывания с субстратом частицы, или ее можно связывать с другой молекулой, которую, в свою очередь, иммобилизуют на и/или в частице. Метку также можно встраивать в и/или на частицы посредством нековалентных способов, например, посредством захвата, абсорбции или адсорбции молекул, составляющих метку, в или на поверхность субстрата частицы, или посредством захвата в полость(и) в субстрате и/или на его поверхности.

В других вариантах осуществления частица содержит наночастицы, на которые и/или в которые метку можно иммобилизовать или встраивать.

Метку можно прикреплять к частице после ее получения, или метку можно помещать или иммобилизовать в и/или на частицу во время ее получения, например, во время сшивания полимерного субстрата.

Предпочтительно метка зонда(ов) является отличимой от метки частиц(ы). В предпочтительных вариантах осуществления метка частиц обнаруживается за то же время, что и метка зонда(ов). Предпочтительно меченые частицы также являются магнетиками, например, парамагнетиками или супермагнетиками.

Подходящие твердые подложки выпускает Luminex Corp. См. например, WO 01/13120, WO 01/13119, WO 97/14028 и WO 99/19515, содержание которых включено в настоящий документ в качестве ссылки. Дополнительные частицы, которые можно использовать в работе по изобретению, предоставлены в US 4267234, US 4267235, US 4552812, US 4677138, US 5194300, US 4774189, US 5073498, US 4717655, US 5723218, US 5326692, US 5716855, US 5573909 и US5786219, содержание которых включено в настоящий документ в качестве ссылки. Другие подходящие твердые подложки выпускает Illumina, Inc. См. например, WO 00/39587, WO 01/18524, WO 01/59432 и WO 02/00336, содержание которых включено в настоящий документ в качестве ссылки.

Предпочтительно подложка является магнетиком (предпочтительно парамагнетиком или супермагнетиком), например, представляет собой магнитные частицы, например магнитные гранулы.

В других вариантах осуществления ни один из олигонуклеотидов не используют в иммобилизованной форме, и, как правило, это является предпочтительным.

В предпочтительном варианте осуществления набор олигонуклеотидных зондов, описанный в настоящем документе, включает:

(a) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 1 или последовательности, способной гибридизоваться с SEQ ID NO: 27 в строгих условиях гибридизации;

(b) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 2 или последовательности, способной гибридизоваться с SEQ ID NO: 28 в строгих условиях гибридизации;

(c) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 3 или последовательности, способной гибридизоваться с SEQ ID NO: 29 в строгих условиях гибридизации;

(d) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 4 или последовательности, способной гибридизоваться с SEQ ID NO: 30 в строгих условиях гибридизации; и

(e) один или несколько олигонуклеотидов, содержащих нуклеотидную последовательность, выбранную из SEQ ID NO: 5-8 или последовательности, способной гибридизоваться с SEQ ID NO: 31-34 в строгих условиях гибридизации; и необязательно

(f) один или несколько олигонуклеотидов, содержащих нуклеотидную последовательность, выбранную из SEQ ID NO: 9-18, последовательности, способной гибридизоваться с SEQ ID NO: 35-44 в строгих условиях гибридизации, нуклеотидной последовательности, выбранной из SEQ ID NO: 19-26, или последовательности, способной гибридизоваться с SEQ ID NO: 45-52 в строгих условиях гибридизации. Предпочтительно в этом варианте осуществления ни один из олигонуклеотидов не иммобилизован на твердой подложке.

В других предпочтительных вариантах осуществления набор олигонуклеотидных зондов, представленный в настоящем документе, включает:

(a) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 27 или последовательности, способной гибридизоваться с SEQ ID NO: 1 в строгих условиях гибридизации;

(b) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 28 или последовательности, способной гибридизоваться с SEQ ID NO: 2 в строгих условиях гибридизации;

(c) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 29 или последовательности, способной гибридизоваться с SEQ ID NO: 3 в строгих условиях гибридизации;

(d) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 30 или последовательности, способной гибридизоваться с SEQ ID NO: 4 в строгих условиях гибридизации, и

(e) один или несколько олигонуклеотидов, содержащих нуклеотидную последовательность, выбранную из SEQ ID NO: 31-34 или последовательности, способной гибридизоваться с SEQ ID NO: 5-8 в строгих условиях гибридизации; и необязательно

(f) один или несколько олигонуклеотидов, содержащих нуклеотидную последовательность, выбранную из SEQ ID NO: 35-44, последовательности, способной гибридизоваться с SEQ ID NO: 9-18 в строгих условиях гибридизации, SEQ ID NO: 45-52 или последовательности, способной гибридизоваться с SEQ ID NO: 19-26 в строгих условиях гибридизации. Предпочтительно в этом варианте осуществления все олигонуклеотидные зонды иммобилизованы на твердой подложке или множестве твердых подложек.

В еще одном дополнительном предпочтительном варианте осуществления набор олигонуклеотидных зондов по изобретению представляет собой комбинацию двух предыдущих предпочтительных вариантов осуществления, в частности, где последний предпочтительный набор зондов не иммобилизован на твердой подложке. Другими словами, предоставлен набор, который включает в качестве двух отдельных частей два предпочтительных набора зондов, описанных выше.

Олигонуклеотидные зонды из набора зондов по изобретению способны к гибридизации с последовательностями в бактериальной 16S рРНК и рДНК, специфичными для определенных бактерий или групп бактерий. SEQ ID NO: 1 и 27 предназначены для взаимодействия с последовательностями в 16S рРНК и рДНК Proteobacteria. SEQ ID NO: 2 и 28 предназначены для взаимодействия с последовательностями в 16S рРНК и рДНК Firmicutes (Lactobacillales, Clostridium perfringens, Staphylococcus). SEQ ID NO: 3 и 29 предназначены для взаимодействия с последовательностями в 16S рРНК и рДНК Firmicutes (Clostridia, Bacillales, Enterococcus, Lactobacillus). SEQ ID NO: 4 и 30 предназначены для взаимодействия с последовательностями в 16S рРНК и рДНК Actinobacteria. Организмы, содержащие последовательности-мишени для SEQ ID NO: 5-26 и 31-52, приведены в таблицах 1, 2 и 3. Эти бактерии представляют собой бактерии, которые обычно существуют в ЖКТ.

Набор олигонуклеотидных зондов по изобретению, таким образом, можно применять для анализа образцов из ЖКТ и получения профиля микробиоты ЖКТ.

Таким образом, в другом аспекте изобретение относится к способу профилирования микробиоты ЖКТ индивидуума, где указанный способ включает:

(i) взаимодействие образца из ЖКТ указанного индивидуума с набором олигонуклеотидных зондов, как определено выше;

(ii) воздействие на образец и набор зондов условиями, которые обеспечивают гибридизацию зондов с их нуклеотидной последовательностью-мишенью в составе молекулы нуклеиновой кислоты в указанном образце; и

(iii) для каждого олигонуклеотида в указанном наборе зондов определение количества нуклеотидной последовательности-мишени в указанном образце.

Затем по относительному количеству указанной последовательности-мишени можно определять профиль микробиоты ЖКТ индивидуума.

В этом аспекте по изобретению нуклеотидные последовательности-мишени для SEQ ID NO: 1-26 представляют собой последовательности, полностью им комплементарные, т.е. SEQ ID NO: 27-52, соответственно. Аналогично, нуклеотидные последовательности-мишени для SEQ ID NO: 27-52 представляют собой последовательности, полностью им комплементарные, т.е. SEQ ID NO: 1-26, соответственно. В определенных вариантах осуществления нуклеотидные последовательности-мишени для SEQ ID NO: 1-26 представляют собой последовательности SEQ ID NO: 27-52, соответственно, с G-остатком непосредственно на 5'-конце указанной нуклеотидной последовательности. Аналогично, нуклеотидные последовательности-мишени для SEQ ID NO: 27-52 представляют собой последовательности SEQ ID NO: 1-26, соответственно, с C-остатком непосредственно на 3'-конце указанной нуклеотидной последовательности.

Количество последовательности-мишени можно определять посредством любых удобных способов, и многие из них знакомы специалистам в данной области. Это может быть частично, полу- или полностью количественное измерение, однако также может быть качественное (или относительное) измерение, в котором результаты для каждой мишени напрямую сравниваются друг с другом без применения численных значений. Как будет указано ниже, в некоторых вариантах осуществления проводят количественное измерение, и полученные данные анализируют с помощью способов статистики для определения статистически значимых характеристик профиля микробиоты.

В одном из вариантов осуществления количество каждой последовательности-мишени определяют с применением олигонуклеотидов из набора зондов по изобретению, к которым прикреплены метки, позволяющие обнаруживать их напрямую или косвенно. Другими словами, олигонуклеотидные зонды по изобретению используют просто как обычные олигонуклеотидные зонды. Подходящие метки описаны выше. После взаимодействия таких зондов с образцом в условиях, обеспечивающих гибридизацию зондов с их последовательностями-мишенями, и, как правило, проведения последующего этапа (или этапов) удаления не связавшихся меченых олигонуклеотидов и/или неспецифично связавшихся олигонуклеотидов, сила сигнала метки каждого зонда, исходящего от образца при рассмотрении (т.е. количество метки, связавшейся с образцом), является пропорциональной количеству гибридизованного олигонуклеотида, и, соответственно, его последовательности-мишени. В предпочтительных вариантах осуществления метку выбирают с тем, чтобы ее можно было обнаружить только после гибридизации зонда с его мишенью. В таких вариантах осуществления необходимость удаления не связавшихся зондов отсутствует.

Для удаления не связавшихся или неспецифично связавшихся зондов можно применять любые подходящие способы, например способы с одним или несколькими этапами отмывания (например, водой или буферным раствором, который может содержать формамид и/или детергент), электрофорез, центрифугирование, связывание с твердыми подложками, хроматографию или любое их сочетание. Подходящие твердые подложки описаны выше. В другом варианте осуществления зонды могут нести связывающий фрагмент, или метка может представлять собой связывающий фрагмент, который позволяет манипулировать с зондами и любой частью гибридизованного с ними образца. Подходящие связывающие фрагменты описаны выше.

Таким образом, изобретение относится к способу профилирования микробиоты ЖКТ индивидуума, где указанный способ включает:

(i) взаимодействие образца из ЖКТ указанного индивидуума с набором олигонуклеотидных зондов, как определено выше, где к каждому нуклеотиду прикреплена метка;

(ii) воздействие на образец и набор зондов условиями, которые обеспечивают гибридизацию зондов с их нуклеотидной последовательностью-мишенью в составе молекулы нуклеиновой кислоты в указанном образце; и

(iii) для каждого олигонуклеотида в указанном наборе зондов, определение количества нуклеотидной последовательности-мишени в указанном образце посредством измерения силы сигнала метки, исходящего от образца. Количество связавшейся с образцом метки является показателем количества последовательности-мишени для меченого олигонуклеотида в указанном образце.

В предпочтительном варианте осуществления способ включает этап между этапами (i) и (ii), на котором удаляют не связавшиеся олигонуклеотиды и/или неспецифично связавшиеся олигонуклеотиды.

В другом варианте осуществления количество каждой нуклеотидной последовательности-мишени в образце определяют с применением набора олигонуклеотидных зондов по изобретению, в частности, наборов, включающих олигонуклеотидные зонды, которые содержат нуклеотидные последовательности, выбранные из SEQ ID NO: 1-26, в качестве наборов зондов, меченных только при гибридизации с их последовательностями-мишенями. В некоторых вариантах осуществления олигонуклеотиды из набора зондов могут уже нести метку, которая отличается от метки, применяемой для специфичного мечения зондов. Сила сигнала от специфично меченных зондов, исходящего от рассматриваемого образца (т.е. количество меток, связанных с образцом), является пропорциональной количеству гибридизованного олигонуклеотида и, соответственно, количеству последовательности-мишени.

Как указано выше, в зависимости от применяемых условий это может быть частично, полу- или полностью количественное измерение, но также это может быть качественное (или относительное) измерение, в котором результаты для каждой мишени напрямую сравнивают друг с другом без применения численных значений.

Подходящим способом селективного мечения является использование меченых нуклеотидов, т.е. включение в олигонуклеотидный зонд нуклеотидов, несущих метку. Другими словами, селективное мечение можно проводить посредством удлинения цепи олигонуклеотидного зонда с применением фермента полимеразы, который встраивает меченый нуклеотид, предпочтительно меченый дидезоксинуклеотид (например, ддАТФ, ддЦТФ, ддГТФ, ддТТФ, ддУТФ), более предпочтительно меченный ддЦТФ, наиболее предпочтительно флуоресцентно меченый, например меченный TAMRA, ддЦТФ или меченный биотином ддЦТФ. Этот подход к обнаружению специфичных нуклеотидных последовательностей иногда называют анализом методом удлинения праймера. Подходящие способы проведения анализа методом удлинения праймера хорошо известны специалистам, например способы, описанные в WO 99/50448, содержание которой включено в настоящий документ в качестве ссылки. Подходящие метки описаны выше. В частности, упомянуты флуоресцентные метки и биотин.

В случае олигонуклеотидных зондов, содержащих SEQ ID NO: 1-26 на 3'-конце, метка предпочтительно представляет собой меченный ддЦТФ, например меченный TAMRA или биотином ддЦТФ. Наиболее предпочтительно в этом варианте осуществления набор зондов по изобретению включает олигонуклеотиды, состоящие из SEQ ID NO: 1-26, а метка представляет собой меченный ддЦТФ, например меченный TAMRA или биотином ддЦТФ.

Обнаружение меченых зондов можно проводить любыми способами, подходящими для используемой метки. Специалисты могут предлагать подходящие способы, исходя их набора меток. В предпочтительных вариантах осуществления метки представляют собой флуоресцентные метки (например, TAMRA), и в таких вариантах осуществления флуоресцентно меченые зонды можно обнаруживать и, при необходимости, количественно оценивать с применением устройства, которое измеряет интенсивность (или силу) флуоресцентных сигналов. Биотиновую метку можно обнаруживать косвенно посредством взаимодействия метки со стрептавидином или другой биотин-связывающей молекулой, которая несет поддающийся обнаружению фрагмент, например колориметрическую, хемилюминесцентную, хромогенную, радиоактивную или флуоресцентную метку. В некоторых вариантах осуществления обнаружение происходит после удаления меченых зондов, по меньшей мере, частичного, контаминирующих веществ (например, немеченых проб, избыточной метки и других реагентов, использовавшихся в реакции мечения). Специалисты также должны быть знакомы со способами выполнения этой задачи, в качестве примера включающими электрофорез (например, гелевый, например, капиллярный электрофорез в геле), центрифугирование, хроматографию и основанные на фильтрации способы, связывание с твердыми подложками или любое их сочетание.

В других предпочтительных вариантах осуществления селективно меченые олигонуклеотидные зонды обнаруживают после этапа, на котором олигонуклеотидные зонды из этапа селективного мечения (т.е. меченые и немеченые) или только селективно меченые олигонуклеотидные зонды гибридизуют с нуклеотидными последовательностями, которые частично или предпочтительно полностью комплементарны олигонуклеотидным зондам.

Комплементарные нуклеотидные последовательности можно предоставлять на одной или нескольких твердых подложках, например тех, которые описаны выше.

В особенно предпочтительных вариантах осуществления набор олигонуклеотидных зондов, который подвергают селективному мечению, включает:

(a) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 1 или последовательности, способной гибридизоваться с SEQ ID NO: 27 в строгих условиях гибридизации;

(b) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 2 или последовательности, способной гибридизоваться с SEQ ID NO: 28 в строгих условиях гибридизации;

(c) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 3 или последовательности, способной гибридизоваться с SEQ ID NO: 29 в строгих условиях гибридизации;

(d) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 4 или последовательности, способной гибридизоваться с SEQ ID NO: 30 в строгих условиях гибридизации; и

(e) один или несколько олигонуклеотидов, содержащих нуклеотидную последовательность, выбранную из SEQ ID NO: 5-8 или последовательности, способной гибридизоваться с SEQ ID NO: 31-34 в строгих условиях гибридизации; и необязательно

(f) один или несколько олигонуклеотидов, содержащих нуклеотидную последовательность, выбранную из SEQ ID NO: 9-18, последовательности, способной гибридизоваться с SEQ ID NO: 35-44 в строгих условиях гибридизации, SEQ ID NO: 19-26 или последовательности, способной гибридизоваться с SEQ ID NO: 45-52 в строгих условиях гибридизации.

После селективного мечения приведенного выше набора зондов селективно меченые зонды наносят на твердую подложку, связанную с набором зондов, включающим:

(a) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 27 или последовательности, способной гибридизоваться с SEQ ID NO: 1 в строгих условиях гибридизации;

(b) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 28 или последовательности, способной гибридизоваться с SEQ ID NO: 2 в строгих условиях гибридизации;

(c) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 29 или последовательности, способной гибридизоваться с SEQ ID NO: 3 в строгих условиях гибридизации;

(d) олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из SEQ ID NO: 30 или последовательности, способной гибридизоваться с SEQ ID NO: 4 в строгих условиях гибридизации; и

(e) один или несколько олигонуклеотидов, содержащих нуклеотидную последовательность, выбранную из SEQ ID NO: 31-34 или последовательности, способной гибридизоваться с SEQ ID NO: 5-8 в строгих условиях гибридизации; и необязательно

(f) один или несколько олигонуклеотидов, содержащих нуклеотидную последовательность, выбранную из SEQ ID NO: 35-44, последовательности, способной гибридизоваться с SEQ ID NO: 9-18 в строгих условиях гибридизации, SEQ ID NO: 45-52 или последовательности, способной гибридизоваться с SEQ ID NO: 19-26 в строгих условиях гибридизации. Предпочтительно в этом варианте осуществления все олигонуклеотидные зонды иммобилизованы на одной или нескольких твердых подложках.

Предпочтительно компоненты (e) и (f) каждого набора зондов выбраны так, чтобы они соответствовали друг другу (т.е. каждый зонд компонентов (e) и (f) из каждого набора зондов содержит комплементарную последовательность компонентов (e) и (f) из другого набора зондов).

Таким образом, изобретение относится к способу профилирования микробиоты ЖКТ индивидуума, где указанный способ включает:

(i) взаимодействие образца из ЖКТ указанного индивидуума с набором олигонуклеотидных зондов, как определено выше;

(ii) воздействие на образец и набор зондов условиями, которые обеспечивают гибридизацию зондов с их нуклеотидной последовательностью-мишенью в составе молекулы нуклеиновой кислоты в указанном образце; и

(iii) селективное мечение олигонуклеотидных зондов из набора зондов после гибридизации с их нуклеотидной последовательностью-мишенью; и

(iv) определение количества каждого меченого олигонуклеотидного зонда, полученного на этапа (iii).

Количество каждого меченого олигонуклеотидного зонда является показателем количества последовательности-мишени для этого меченого олигонуклеотида в указанном образце.

В некоторых вариантах осуществления этап (iv) включает гибридизацию олигонуклеотидных зондов из этапа мечения с нуклеотидными последовательностями, комплементарными этим олигонуклеотидам.

В дополнительном варианте осуществления количество каждой нуклеотидной последовательности-мишени в образце определяют посредством мечения нуклеиновых кислот в образце перед этапом взаимодействия образца с набором олигонуклеотидных зондов по изобретению. Посредством определения количества меченой нуклеиновой кислоты, гибридизованной с зондами из набора зондов, можно оценивать количество нуклеотидной последовательности-мишени для каждого олигонуклеотидного зонда в указанном образце. В этих вариантах осуществления бактериальная 16S рРНК или 16S рДНК, в частности, участки, содержащие последовательности-мишени для олигонуклеотидов из набора зондов, или нуклеиновые кислоты, содержащие указанные последовательности, метят перед их взаимодействием с набором зондов. Подходящие метки описаны выше. Мечение происходит, когда нуклеиновые кислоты в образце амплифицируют и/или обратно транкрибируют перед их взаимодействием с набором зондов, как более подробно описано ниже. Подходящим способом мечения нуклеиновых кислот является мечение включением меченых нуклеотидов во время реакции амплификации и/или обратной транскрипции нуклеиновой кислоты.

В дополнительных вариантах осуществления олигонуклеотиды из набора зондов и нуклеиновые кислоты в образце, как описано выше, метят фрагментами, которые предоставляют сигнал только находясь в непосредственной близости, например, когда зонды гибридизуют с их последовательностями-мишенями в нуклеиновой кислоте.

В другом варианте осуществления количество каждой нуклеотидной последовательности-мишени в образце определяют посредством применения олигонуклеотидов из набора зондов по изобретению в качестве праймеров в одной или нескольких реакциях амплификации нуклеиновых кислот, например мультиплексной реакции амплификации. Если выбраны подходящие условия, такая реакция проходит так, что количество продукта амплификации, полученного для каждого олигонуклеотида из набора зондов, является пропорциональным количеству каждой нуклеотидной последовательности-мишени в образце. Таким образом, количество продукта реакции амплификации для каждого олигонуклеотида из набора зондов является мерой количества олигонуклеотида, который гибридизовался с образцом от рассматриваемого индивидуума и также является пропорциональным количеству последовательности-мишени для этого олигонуклеотида в образце и пропорциональным количеству бактерий в образце, для взаимодействия с которыми предназначен олигонуклеотид. Таким образом, количество продукта амплификации можно использовать для определения уровней этих бактерий в ЖКТ индивидуума.

Как указано выше, в зависимости от применяемых условий это может быть частично, полу- или полностью количественное измерение, но также это может быть качественное (или относительное) измерение, результаты которого для каждой последовательности-мишени напрямую сравнивают друг с другом без применения численных значений.

Амплификацию можно проводить посредством любой подходящей реакции амплификации нуклеиновой кислоты с применением праймеров. Самым подходящим способом является полимеразная цепная реакция (ПЦР), хотя специалистам известны и другие способы. Например, LAR/LCR, SDA, можно использовать изотермическую амплификацию с формированием петель и амплификацию, основанную на последовательности нуклеиновой кислоты (NASBA)/3SR (самоподдерживающаяся реакция репликации последовательностей).

Известно много вариантов ПЦР, например ПЦР в реальном времени (также известная как количественная ПЦР, кПЦР), ПЦР с горячим стартом, конкурентная ПЦР и т.д., и эти варианты специалисты могут при необходимости применять.

В одном основном варианте осуществления изобретения с применением основанной на ПЦР амплификации олигонуклеотиды из набора зондов по изобретению взаимодействуют с реакционной смесью, содержащей образец, подходящий набор вторых праймеров для образования рабочих пар праймеров, и свободные нуклеотиды в подходящем буфере в условиях, обеспечивающих гибридизацию. Циклическая термическая обработка полученной смеси в присутствии ДНК-полимеразы приводит к амплификации последовательностей-мишеней для каждого олигонуклеотида, т.е. последовательностей, характерных для бактерий, с которыми должны взаимодействовать олигонуклеотиды из набора зондов по изобретению.

Оптимальный режим реакции ПЦР зависит от выбора температуры, времени температурной обработки, продолжительности интервала между температурной обработкой каждого этапа цикла. Типичный профиль ПЦР-амплификации представляет собой (a) 15 минут плавления ДНК при 95°C; (b) 30 секунд отжига праймеров при 50-65°C; (c) 90 секунд удлинения праймеров при 68-72°C; (d) 30 секунд плавления ДНК при 95°C; и этапы (b)-(d) повторяют необходимое количество раз с получением необходимого уровня амплификации.

Известны модификации основного способа ПЦР, такие как кПЦР (ПЦР в реальном времени), которые могут предоставлять количественную информацию об амплифицируемой матрице. Разработаны многочисленные подходы, но в двух самых распространенных способах используют связывание двухцепочечной ДНК с флуоресцентными красителями или селективными флуоресцентными репортерными зондами.

Связывающие двухцепочечную ДНК флуоресцентные красители, например SYBR Green, связываются с продуктом амплификации по мере его образования и флуоресцируют при связывании. Таким образом, посредством измерения флуоресценции после каждого цикла ПЦР можно отслеживать относительное количество продукта амплификации в реальном времени. Посредством применения внутренних стандартов и контролей эту информацию можно переводить в количественную форму, оценивая количество матрицы в начале реакции.

Флуоресцентные репортерные зонды, применяемые в кПЦР, представляют собой специфичные к последовательностям олигонуклеотиды, как правило, РНК или ДНК, которые содержат флуоресцентную репортерную молекулу на одном конце и молекулу-гаситель на другом конце (например, репортерная молекула на 5'-конце и молекула-гаситель на 3'-конце или наоборот). Зонд сконструирован таким образом, что репортерная молекула гасится молекулой-гасителем. Также зонд сконструирован для селективной гибридизации с определенными участками комплементарной последовательности, которая может содержаться в матрице. Если эти участки находятся между отожженными ПЦР-праймерами, полимераза, если она обладает экзонуклеазной активностью, разрушит (деполимеризует) связанный зонд по мере удлинения образующейся цепи нуклеиновой кислоты. Это выключит молекулу-гаситель, и возникнет флуоресценция. Таким образом, посредством измерения флуоресценции после каждого цикла ПЦР можно отслеживать относительное количество продукта амплификации в реальном времени. Посредством применения внутренних стандартов и контролей эту информацию можно переводить в количественную форму.

Таким образом, в другом аспекте изобретение относится к способу профилирования микробиоты ЖКТ индивидуума, где указанный способ включает:

(i) взаимодействие образца из ЖКТ указанного индивидуума с набором олигонуклеотидных зондов, как определено выше;

(ii) воздействие на образец и набор зондов условиями, которые обеспечивают гибридизацию зондов с их нуклеотидной последовательностью-мишенью в составе молекулы нуклеиновой кислоты в указанном образце; и

(iii) проведение реакции амплификации нуклеиновой кислоты с применением праймеров; и

(iv) для каждого олигонуклеотида из набора зондов определение количества продукта амплификации, полученного на его основе в ходе указанной реакции амплификации нуклеиновой кислоты с применением праймеров.

Количество указанного продукта для каждого олигонуклеотида является показателем количества последовательности-мишени для каждого олигонуклеотида в образце.

В предпочтительном варианте осуществления этап (i) также включает взаимодействие образца с набором олигонуклеотидов, которые способны взаимодействовать с набором олигонуклеотидов по изобретению в реакции амплификации нуклеиновой кислоты, например, ПЦР, с получением продукта амплификации для каждого олигонуклеотида из набора зондов, при условии наличия подходящей матрицы в образце. В этом варианте осуществления при связывании со второй парой подходящих для амплификации праймеров олигонуклеотиды, содержащие SEQ ID NO: 1-26, выполняют функцию прямых праймеров, а олигонуклеотиды, содержащие SEQ ID NO: 27-52, выполняют функцию обратных праймеров.

В этом варианте осуществления способ может включать множество реакций амплификации нуклеиновой кислоты с применением праймеров, которые проводят параллельно, где каждая реакция включает отдельный зонд, или одну или несколько реакций мультиплексной амплификации нуклеиновой кислоты с применением праймеров, которые проводят с двумя или более зондами в одной реакции.

Посредством подходящих способов можно обнаруживать продукт амплификации каждого олигонуклеотида и определять количества продуктов амплификации. В некоторой степени возможные способы определяются количеством олигонуклеотидов из набора зондов, которые используют в каждой реакции амплификации (например, тем, является ли реакция мультиплексной, и степенью мультиплексности). Специалисты могут выбирать подходящие способы.

В качестве стандартных лабораторных способов применяют большое количество способов, и в литературе есть описания более специализированных подходов. В самом простом варианте количество продукта амплификации можно определять посредством визуального контроля реакционной смеси в конце реакции или в выбранный момент. Как правило, продукт амплификации можно заметить благодаря метке, которая может предпочтительно связываться с продуктом амплификации. Как правило, используют красящее вещество, например колориметрический, хромометрический, флуоресцентный или люминесцентный краситель (например, бромистый этидий или SYBR Green). В других вариантах осуществления используют меченый олигонуклеотидный зонд, который предпочтительно связывает продукт амплификации, в частности, зонд, который предпочтительно связывается с по существу всеми отдельными амплифицированными нуклеиновыми кислотами в продукте амплификации. Подходящий зонд может быть основан на нуклеотидной последовательности одной или нескольких из SEQ ID NO: 1-52. Подходящие метки для зондов описаны выше. В некоторых вариантах осуществления зонд можно предоставлять в немеченой форме, когда мечение происходит после предпочтительного связывания с продуктом амплификации, или предпочтительного связывания с по существу всеми отдельными амплифицированными нуклеиновыми кислотами в продукте амплификации.

Однако в некоторых случаях осадитель нуклеиновой кислоты (например, соль и/или спирт) можно непосредственно использовать для выделения продукта амплификации из раствора, с тем, чтобы он был заметен без мечения.

Для улучшения визуализации компоненты продукта амплификация можно наносить на или в твердую подложку, например, посредством электрофореза (например, с применением агарозного или полиакриламидного геля), хроматографии (например, ВЭЖХ, тонкослойной хроматографии, аффинной хроматографии, гель-фильтрации) или фильтрации или их сочетания, перед или после взаимодействия с меткой.

В зависимости от применяемой метки обнаружение можно проводить более точно посредством применения доступных способов обнаружения, например радиационно-чувствительных пленок и способов цифровой съемки в комбинации с компьютерным анализом изображений, фотометров, флуориметров, колориметров, сцинтилляционных счетчиков и т.п.

Предпочтительно продукт амплификации отделяют от оставшейся реакционной смеси перед взаимодействием с меткой, например, в форме меченого олигонуклеотидного зонда. Это можно проводить посредством подходящих способов, например способов с применением одного или нескольких этапов отмывания (например, водой или буферным раствором, который может содержать формамид и/или детергент), электрофореза, центрифугирования, захвата связывающими нуклеиновые кислоты твердыми подложками, хроматографией или любым их сочетанием. Зонд можно наносить на твердую подложку, тем самым обеспечивая отделение продукта амплификации от оставшейся реакционной смеси в один этап. В другом варианте осуществления зонд может нести связывающий фрагмент или зонд может представлять собой связывающий фрагмент, что позволяет проводить манипуляции с зондом и любым продуктом амплификации, гибридизованным с ним. Подходящие связывающие фрагменты приведены выше.

Предпочтительно любую несвязавшуюся метку, например, в форме немеченого олигонуклеотидного зонда, отделяют от продукта амплификации перед этапом обнаружения. Это можно проводить посредством подходящих способов, например способов с применением одного или нескольких этапов отмывания (например, водой или буферным раствором, который может содержать формамид и/или детергент), электрофореза, центрифугирования, захвата на твердые подложки, хроматографии или любого их сочетания. Подходящие твердые подложки описаны выше.

Если применяемый способ амплификации является количественным, как, например, способы амплификации, в которые включены внутренние стандарты и контроли (например, кПЦР), то способ по данному аспекту изобретения также может предоставлять количественную информацию. В этих вариантах осуществления способ может даже предоставлять численные значения количества последовательности-мишени в образце и, соответственно, количества бактерий в образце, содержащих последовательность-мишень. Один такой внутренний стандарт заключается в амплификации одного или нескольких (например, по меньшей мере, 2, 3, 5 или 10) образцов с известными количествами бактерий, с которыми взаимодействуют олигонуклеотиды из набора зондов, или известных количеств последовательности-мишени в тех же условиях, что и тестируемый образец, с получением стандартной кривой зависимости количества продукта амплификация от количества организмов или количества последовательностей-мишеней. Количество продукта амплификации, полученного для тестируемого образца, затем можно переводить в численные значения, оценивая количество последовательности-мишени и/или бактерий, содержащих последовательность-мишень для олигонуклеотидов из набора зондов в образце.

В других вариантах осуществления ход реакции амплификации можно отслеживать в реальном времени и сравнивать профиль амплификации с профилями амплификации для образцов, которые содержат известные количества бактерий, с которыми взаимодействуют олигонуклеотиды из набора зондов, или известные количества последовательности-мишени. В других вариантах осуществления можно использовать пороговый цикл (CT) для подсчета количества последовательности-мишени и, соответственно, количества бактерий, с которыми взаимодействуют олигонуклеотиды из набора зондов в образце. Во всех кПЦР существует пороговый уровень, при достижении которого флуоресценция продукта амплификации становится выше фонового. Цикл, на котором достигается этот пороговый уровень, представляет собой CT. В экспоненциальной фазе реакции количество ДНК теоретически удваивается в каждом цикле, поэтому можно подсчитать относительные количества ДНК в образцах посредством сравнения значений CT в экспоненциальной фазе. Если проводить сравнение образцов с известным количеством матрицы, можно подсчитать количество матрицы в тестируемом образце и количество последовательности-мишени олигонуклеотидов из набора зондов и, соответственно, можно определить количество бактерий в образце, содержащих последовательность-мишень олигонуклеотидов из набора зондов.

В практическом осуществлении изобретения можно использовать комбинацию одного или нескольких описанных выше способов для определения количества нуклеотидной последовательности-мишени.

Индивидуум может представлять собой любого человека или не являющегося человеком животного, но более конкретно, может представлять собой позвоночное, например млекопитающее, включая домашний скот и домашних животных. Предпочтительно индивидуум является человеком. Индивидуум может быть любого возраста, например быть младенцем, ребенком, подростком или взрослым, предпочтительно взрослым. У людей взрослый человек должен быть не младше 16 лет, а младенец должен быть не старше 2 лет. В определенных вариантах осуществления индивидуум может быть младенцем, в других случаях он является ребенком или взрослым.

Способы по изобретению представляют собой способы in vitro, которые проводят с применением любого образца из ЖКТ. ЖКТ, также обозначаемый как желудочно-кишечный тракт (этот термин можно использовать взаимозаменяемо с ЖКТ), представляет собой ряд связанных между собой органов, начинающийся ртом и заканчивающийся анальным отверстием. Более конкретно этот ряд состоит из ротовой полости, глотки, пищевода, желудка, двенадцатиперстной кишки, тонкого кишечника, толстой кишки и анального канала.

Эти органы можно разделять на верхний ЖКТ, состоящий из ротовой полости, глотки, пищевода, желудка и двенадцатиперстной кишки, и нижний ЖКТ, состоящий из тонкого кишечника, подвздошной кишки (вместе с тонким кишечником), слепой кишки, толстой кишки, прямой кишки (вместе с толстой кишкой) и анального канала.

Образец из ЖКТ для применения по изобретению может включать в качестве неограничивающих примеров любой жидкий или твердый образец, полученный из полости или поверхности ЖКТ, или любой образец любых тканей органов ЖКТ. Таким образом, образец может представлять собой любое содержимое полости ЖКТ (например, содержимое желудка, содержимое кишечника, слизь и фекалии или их сочетания), а также образцы, механически полученные из ЖКТ, например, посредством мазка, промывания, отсасывания или скобления полости или поверхности ЖКТ или посредством биопсии ткани/органа ЖКТ. Образцы фекалий являются предпочтительными. Образец также можно получать из части ткани/органа ЖКТ, удаленной хирургическим путем. Образец может представлять собой участок удаленной ткани/органа. В вариантах осуществления, где образец представляет собой образец ткани/органа ЖКТ, образец может содержать части слизистой оболочки, подслизистой оболочки, наружного мышечного слоя, адвентициальной оболочки и/или серозной оболочки ткани/органа ЖКТ. Такие образцы ткани можно получать посредством биопсии во время эндоскопической процедуры. Предпочтительно образец получают из нижнего ЖКТ, т.е. из тонкой кишки, подвздошной кишки, слепой кишки, толстой кишки, прямой кишки или анального канала. Более предпочтительно образец представляет собой образец слизи или образец из просвета ЖКТ. Образцы фекалий можно получать посредством мазка, промывания, отсасывания или скобления прямой кишки или анального канала или, в самом простом случае, сбора фекалий после дефекации.

Образец можно использовать в способах по изобретению в форме, в которой он был изначально получен. Образец можно также подвергать манипуляциям, обработке или очистке перед применением в способах по изобретению. Таким образом, термин "образец" также включает препараты, например, относительно чистые или частично очищенные исходные вещества, такие как получистые препараты упомянутых выше образцов. Термин "образец" также включает препараты из упомянутых выше образцов, в которых РНК, включая 16S рРНК, подверглась обратной транскрипции.

Очистка может быть легкой, например может сводиться только к концентрированию твердых веществ или клеток из образца с получением меньшего объема, или к отделению клеток от остатка образца. Типичные способы изоляции клеток описаны в W098/51693 и WO 01/53525.

В других вариантах осуществления изобретения применяют препараты нуклеиновой кислоты из упомянутых выше образцов, предпочтительно препараты, в которых нуклеиновые кислоты помечены. К таким препаратам относятся также продукты обратной транскрипции и/или продукты амплификации этих образцов или содержащихся в них нуклеиновых кислот. Предпочтительно преобладающая нуклеиновая кислота препарата нуклеиновой кислоты представляет собой ДНК.

Способы изоляции нуклеиновой кислоты из образцов, включая составные образцы, многочисленны и хорошо известны в данной области и подробно описаны в литературе. Способы, описанные в WO 98/51693 и WO 01/53525, также можно применять для получения нуклеиновых кислот из описанных выше образцов. Эти способы включают способы получения относительно чистой или частично очищенной нуклеиновой кислоты.

Предпочтительно реакция амплификации, которую проводят с образцом, является универсальной, или по существу универсальной, в том, что нуклеиновая кислота, подлежащая амплификации, т.е. участок 16S рРНК или 16S рДНК, включающий описанные выше последовательности-мишени, амплифицируют из всех, или, по меньшей мере, по существу всех, прокариотических клеток, которые могут присутствовать в образце. Термин "амплификация из по существу всех прокариотических клеток, присутствующих в образце" относится к числу разных видов прокариотических клеток образце, которые содержат нуклеиновую кислоту, подлежащую амплификации. Таким образом, в этом варианте осуществления нуклеиновую кислоту, подлежащую амплификации, амплифицируют из, по меньшей мере, одного типичного из по существу всех видов прокариотических клеток в образце.

Под "прокариотической клеткой" подразумевают любой организм, у которого отсутствует клеточное ядро, т.е. любой организм из доменов Bacteria и Archaea.

Такую универсальную амплификацию можно проводить с применением прямого праймера, связывающегося с консервативной областью между V2 и V3 (например, как описано в Nadkarni et al., 2002. Microbiology 148, 257-266), и обратного праймера, связывающегося с 3'-концом гена 16S рРНК (например, как описано в Weisburg et al., 1991, J Bacteriol 173, 697-703). В других вариантах осуществления такую универсальную амплификацию можно проводить с применением пары праймеров с последовательностями TCC TAC GGG AGG CAG CAG (SEQ ID NO: 53), также обозначаемого как MangalaF-1, и CGG TTA CCT TGT TAC GAC TT (SEQ ID NO: 54), также обозначаемого как 16SU1510R. Эта пара праймеров более подробно описана в US 2011/0104692.

Нуклеотидная последовательность-мишень, подлежащая амплификации в этом варианте осуществления, таким образом, содержится в 16S рРНК и соответствующем гене 16S рРНК (рДНК). Таким образом, амплификация этой нуклеотидной последовательности-мишени представляет собой увеличение количества нуклеиновых кислот, содержащих эту последовательность нуклеотидов, без ограничения по типу нуклеиновых кислот, содержащих нуклеотидную последовательность. Предпочтительно эти нуклеиновые кислоты являются мечеными. Как правило, нуклеиновая кислота, которая образуется в качестве продукта амплификации, представляет собой ДНК, хотя нуклеотидная последовательность, содержащаяся в этой нуклеиновой кислоте, будет такой же, что и для нуклеотидной последовательности-мишени, или комплементарной ей.

В целях удобства этот вариант осуществления изобретения проводят с 16S рДНК, например с геном 16S рРНК, в качестве матрицы.

В других вариантах осуществления 16S рРНК может быть источником нуклеотидной последовательности-мишени, подлежащей амплификации. Когда нуклеотидную последовательность из 16S рРНК амплифицируют в этом варианте осуществления способа по изобретению, на одном из этапов РНК-зависимая ДНК-полимераза катализирует образование молекулы ДНК, комплементарной матрице 16S рРНК (кДНК). Такой процесс называют "обратной транскрипцией". Более конкретно, РНК-зависимая ДНК-полимераза катализирует полимеризацию дезоксирибонуклеозидтрифосфатов с образованием последовательности, комплементарной (т.е. образованной по правилу спаривания оснований по Уотсону-Крику) исходной матричной последовательности рРНК.

Известны многочисленные ферменты, которые способны катализировать эту реакцию, и неограничивающие примеры включают обратную транскриптазу ВИЧ, обратную транскриптазу AMV, обратную транскриптазу M-MLV, полимеразу C. therm. и полимеразу Tth. В самом простом варианте полная реакционная смесь для обратной транскрипции содержит фермент обратной транскрипции, матрицу рРНК, подходящие праймеры, которые могут связываться с матрицей и с которых обратная транскриптаза может начинать полимеризацию, dNTP и подходящий буфер. Инкубация смеси при рабочей температуре обратной транскриптазы приводит к образованию кДНК.

После завершения реакции обратной транскрипции кДНК можно использовать в качестве матрицы в одном из вариантов осуществления способа по изобретению, описанном выше. Таким образом, нуклеотидная последовательность кДНК комплементарна молекуле рРНК, которая использовалась в качестве матрицы. Кроме того, нуклеотидная последовательность кДНК совпадает с нуклеотидной последовательностью, содержащейся в одной нити гена матрицы рРНК, и эта кДНК комплементарна нуклеотидной последовательности, содержащейся в другой нити гена матрицы рРНК.

Как указано выше, в вариантах осуществления способа по изобретению, в котором нуклеиновую кислоту амплифицируют на предыдущем этапе, если 16S рРНК используют в качестве источника нуклеотидной последовательности-мишени (в противоположность 16S рДНК, например гену 16S рРНК), необходимо проведение начального этапа обратной транскрипции. Связанные с обратной транскрипцией реакции амплификации, в частности ПЦР, можно проводить за один этап или за два этапа. В одноэтапном способе компоненты реакции обратной транскрипции и реакции амплификации нуклеиновой кислоты помещают в один реакционный сосуд, и, как правило, начальные условия реакции выбирают с тем, чтобы позволить реакции обратной транскрипции продолжаться до завершения, после чего условия реакции меняют на подходящие для реакции амплификации нуклеиновой кислоты.

В двухэтапном способе сначала собирают компоненты реакции обратной транскрипции и проводят обратную транскрипцию. Затем продукт обратной транскрипции объединяют с компонентами реакции амплификации и проводят реакцию амплификации. В двухэтапном способе с одним реакционным сосудом компоненты реакции амплификации добавляют в тот же реакционный сосуд, в котором проводили реакцию обратной транскрипции. В двухэтапном способе с двумя реакционными сосудами реакцию амплификации проводят в отдельном реакционном сосуде.

Многие заболевания и состояния или их этапы связаны с характерными профилями микробиоты ЖКТ или микробиоты его отделов/участков, как описано выше. В некоторых случаях заболевание или состояние может вызываться или усиливаться нарушениями профиля микробиоты ЖКТ или его отделов/участков. В других случаях заболевание или состояние вызывает или обусловливает смещение определенного профиля микробиоты ЖКТ или его отделов/участков. Таким образом, посредством анализа профилей микробиоты в образцах ЖКТ можно получать информацию, которая помогает в диагностике или мониторинге заболевания или состояния, или которая позволяет установить риск развития заболевания или состояния, которое, как было показано, характеризуется определенным профилем микробиоты. Набор зондов по изобретению, таким образом, можно использовать для получения стандартных профилей микробиоты ЖКТ, которые характеризуют заболевания или состояния или их этапы или риск развития заболевания или состояния. Профиль также можно использовать для прогнозирования заболевания и мониторинга заболевания.

Таким образом, в другом аспекте изобретение относится к способу получения стандартных профилей микробиоты ЖКТ, которые являются характеристиками заболевания или состояния или их этапов или риска развития заболевания или состояния, где указанный способ включает:

(i) идентификацию индивидуума с указанным заболеванием или состоянием или их этапами или индивидуума, характеризующегося риском развития указанного заболевания или состояния, и взаимодействие образца из ЖКТ указанного индивидуума с набором олигонуклеотидных зондов, как определено выше;

(ii) воздействие на образец и набор зондов условиями, которые обеспечивают гибридизацию зондов с их нуклеотидными последовательностями-мишенями в составе молекулы нуклеиновой кислоты в указанном образце; и

(iii) для каждого олигонуклеотида в указанном наборе зондов определение количества его нуклеотидной последовательности-мишени в указанном образце.

Профиль микробиоты ЖКТ индивидуума, таким образом, составляют на основе количества последовательностей-мишеней для каждого олигонуклеотида, присутствующих в указанном образце, и этот профиль служит характеристикой указанного заболевания или состояния (или их этапов) или риска развития указанного заболевания или состояния.

После получения стандартного профиля для определенного заболевания или состояния или риска их развития, как правило, после профилирования множества образцов от множества индивидуумов с одним и тем же заболеванием или состоянием или их этапами, этот профиль можно использовать в качестве основы диагностики для определения, страдает ли другой индивидуум от указанного заболевания или состояния или характеризуется ли он риском его развития, или для определения прогресса или степени проявления указанного заболевания или состояния с целью прогнозирования. Стандартный профиль можно получать в цифровом виде, например на цифровом носителе или посредством передачи пользователю с применением электронных способов связи. В других вариантах осуществления используют систему, в которой профиль, полученный от рассматриваемого индивидуума, вносит вклад в составление стандартного профиля.

В дополнительном аспекте изобретение относится к способу диагностики или мониторинга заболевания или состояния у индивидуума или прогнозирования или оценки риска развития у индивидуума заболевания или состояния, где указанный способ включает:

(a) профилирование микробиоты ЖКТ индивидуума, как описано выше;

(b1) сравнение указанного профиля со стандартным профилем микробиоты ЖКТ, характерным для заболевания или состояния или их этапов или риска развития заболевания или состояния; и/или

(b2) сравнение указанного профиля с более ранним профилем микробиоты ЖКТ индивидуума; и

(c) определение степени корреляции указанных профилей.

В этом варианте осуществления указанная степень корреляции является показателем наличия или отсутствия указанного заболевания или состояния или риска развития указанного заболевания или состояния или прогресса заболевания или состояния.

В дополнительном аспекте изобретение также относится к способу диагностики или мониторинга заболевания или состояния у индивидуума или прогнозирования или оценки риска развития у индивидуума заболевания или состояния, где указанный способ включает:

(a) сравнение результатов способа, описанного выше, со стандартным профилем микробиоты ЖКТ, характерным для заболевания или состояния или его стадии или риска развития заболевания или состояния, и/или

(a2) сравнение результатов способа, описанного выше, с более ранним профилем микробиоты ЖКТ индивидуума, и

(b) определение степени корреляции указанных профилей,

где степень корреляции является показателем наличия или отсутствия указанного заболевания или состояния или риска развития указанного заболевание или состояния, или прогресса заболевания или состояния.

Предпочтительно профиль, с которым сравнивают профиль рассматриваемого индивидуума, является профилем, полученным способом по изобретению. Это может быть предварительно полученный профиль или профиль, полученный одновременно или по существу одновременно с изучением рассматриваемого образца.

"Диагностика" относится к определению наличия или отсутствия заболевания или состояния или их этапов в организме. "Мониторинг" относится к определению степени или возможных изменений в течении заболевания или состояния, в частности, когда известно, что индивидуум страдает от заболевания или состояния, например, для определения эффекта лечения или развития заболевания или состояния, например, для определения пригодности лечения, получения прогноза и/или определения стадии ремиссии или рецидива у пациента.

"Установление риска развития у индивидуума заболевания или состояния" относится к определению вероятности или шансов развития у индивидуума заболевания или состояния. В некоторых вариантах осуществления это можно выражать в виде численной вероятности. Определение риска может быть связано со степенью корреляции профиля образца рассматриваемого индивидуума и профиля заболевания или состояния, или корреляции профиля образца рассматриваемого индивидуума и профиля, который считают характерным для образца индивидуума с определенным риском развития заболевания или состояния.

"Заболевание" относится к состоянию патологического отклонения от нормы, которое может быть вызвано, например, инфекцией или приобретенным или врожденным генетическим нарушением.

"Состояние" относится к состоянию сознания или тела организма, которое не относится к заболеванию, например к присутствию агента в организме, такого как токсин, лекарственное средство или загрязняющий агент, или к беременности.

"Их этапы" относится к различным этапам заболевания или состояния, которые необязательно могут характеризоваться определенными физиологическими или метаболическими изменениями, но не характеризуются изменениями профиля микробиоты ЖКТ. В некоторых вариантах осуществления наблюдаемые различия профиля микробиоты ЖКТ могут позволять классифицировать заболевания или состояния, не замеченные ранее.

Данные, полученные с применением приведенных выше способов, можно анализировать посредством различных способов, от самой простой визуализации (например, применительно к интенсивности сигнала) до более сложных способов обработки данных, которые можно оценивать количественно и выражать в численных значениях, с получением профилей микробиоты ЖКТ, которые отражают взаимосвязь относительных уровней каждой последовательности-мишени, с которой связываются различные зонды (и, соответственно, относительных уровней бактерий, содержащих последовательность-мишень, с которой связываются различные зонды). Исходные данные, полученные таким образом, можно обрабатывать посредством способов обработки данных и статистических способов, в частности, нормализации и стандартизации данных и статистической обработки, что позволяет определить, отражают ли указанные данные профиль определенного заболевания, состояния или их этапов. Специалистам известны подходящие статистические способы. Предпочтительно статистический способ предоставляет "значение P" в качестве критерия, указывающего на то, что наблюдаемая тенденция не является случайной. Статистически значимый результат, т.е. результат, который при сравнении с контролем не объясняется случайными вариациями, имеет значение P<0,05, предпочтительно <0,01, <0,005 или <0,001. В качестве примера, подходящие способы определения статистической значимости в способах по изобретению включают ANOVA, критерий Манна-Уитни-Вилкоксона (MWW), критерий Крускала-Уоллиса и критерий подлинной значимости (HSD). Специалистам известны многие другие способы. В некоторых вариантах осуществления можно применять критерий перестановки, например, описанный в Langsrud (2002, Journal Of The Royal Statistical Society Series D 51, 305-317).

Заболевания и состояния, которые можно изучать способами по изобретению, не ограничены, хотя диагностические аспекты изобретения зависят от наличия подходящих профилей микробиоты ЖКТ, характерных для заболевания или состояния, подлежащего изучению. Заболевания и состояния, затрагивающие ЖКТ, с высокой вероятностью приводят к появлению характерных профилей микробиоты, например воспалительное заболевание кишечника (ВЗК), болезнь Крона (БК), язвенный колит (ЯК), синдром раздраженного кишечника (СРК) и злокачественные опухоли ЖКТ (ротовой полости, глотки, пищевода, желудка, двенадцатиперстной кишки, тонкого кишечника, подвздошной кишки, слепой кишки, толстого кишечника, прямой кишки или анального канала), а также существуют данные, доказывающие связь микробиоты ЖКТ с заболеваниями и состояниями, которые считаются несвязанными с ЖКТ, например аллергическими заболеваниями, например экземой, астмой, атопическим дерматитом, аллергическим конъюнктивитом, аллергическим ринитом и пищевыми аллергиями; нарушениями обмена веществ, например сахарным диабетом (типа 1 и типа 2), ожирением и метаболическим синдромом; нейрологическими нарушениями, например депрессией, рассеянным склерозом, деменцией и болезнью Альцгеймера; и аутизмом. Любые из этих заболеваний или состояний можно диагностировать или подвергать мониторингу по изобретению.

Способ диагностики можно использовать отдельно в качестве альтернативного другим способам диагностики или в качестве дополнения к таким способам. Например, способы по изобретению можно использовать в качестве альтернативных или дополнительных диагностических мер для постановки диагноза с применением способов визуализации, таких как магнитно-резонансная томография (MRI), ультразвуковая визуализация, радионуклидная визуализация, рентгенография или эндоскопия.

Таким образом, в дополнительном аспекте настоящее изобретение относится к способу получения информации, относящейся к диагностике или мониторингу заболеваний или состояний или оценке риска развития заболевания или состояния, который включает способ профилирования микробиоты ЖКТ индивидуума, как определено выше.

В дополнительном аспекте изобретение относится к наборам, включающим набор зондов, как определено в настоящем документе.

В дополнительном аспекте изобретение относится к применению набора зондов, описанных в настоящем документе, для получения наборов, как определено в настоящем документе.

Наборы по изобретению можно составлять для применения в способах по изобретению, и они могут включать дополнительные компоненты. Каждый компонент можно предоставлять в отдельных отсеках или сосудах. В тех случаях, когда это удобно, можно предоставлять смеси компонентов. Компоненты можно предоставлять в сухой, например кристаллизованной, высушенной сублимацией или лиофилизированной форме или в форме раствора, где, как правило, такие жидкие композиции являются водными и разведены стандартным буфером, таким как Tris, HEPES и т.д.

Набор можно также предоставлять с инструкциями для применения набора или с указанием того, как можно получить инструкции.

Дополнительные компоненты могут быть любыми из различных компонентов, которые можно использовать для осуществления способов по изобретению, например любыми из компонентов, описанных выше. В предпочтительном варианте осуществления набор дополнительно содержит средства для селективного мечения олигонуклеотидных зондов. В предпочтительном варианте осуществления набор дополнительно содержит подходящие твердые подложки, на которых можно иммобилизовать олигонуклеотиды из набора зондов по изобретению, например любые из твердых подложек, описываемых в настоящем документе. В других вариантах осуществления некоторые или все олигонуклеотиды из набора зондов по изобретению добавлены в набор в иммобилизованной форме.

Дополнительные компоненты могут необязательно включать некоторые или все средства для проведения реакции амплификации и/или удлинения праймеров с олигонуклеотидами по изобретению, например буферы, ферменты и т.д. Например, наборы могут необязательно содержать буфер для реакции ПЦР, нуклеотидтрифосфаты, дополнительные олигонуклеотидные праймеры или ДНК-полимеразы, предпочтительно термостабильные полимеразы, такие как Taq-полимераза.

Дополнительные компоненты могут необязательно включать некоторые или все средства для проведения реакции обратной транскрипции, например буферы, ферменты и т.д. Например, обратная транскриптаза, РНК-специфичные праймеры, буфер для ПЦР в реальном времени и нуклеотидтрифосфаты.

Дополнительные компоненты могут необязательно включать некоторые или все средства для получения образца. Например, такие средства включают индикаторные полоски, устройства для биопсии, устройства для получения мазка, пакеты или сосуды. Предпочтительно эти средства предоставляют в стерильной форме.

Дополнительные компоненты могут необязательно включать некоторые или все средства для очистки или модификации образца. Например, средства для изоляции или концентрации клеток образца, например связывающие клетки твердые подложки или устройства для фильтрации. В других вариантах осуществления средства для очистки или модификации образца могут включать некоторые или все средства для выделения нуклеиновой кислоты из образца. Например, реагенты для клеточного лизиса (например, хаотропные соли, спирты, детергенты, изменяющие мембрану соединения), связывающие нуклеиновую кислоту твердые подложки (например, как описано выше) или осаждающие нуклеиновую кислоту вещества (например, соли, спирты).

Дополнительные компоненты могут необязательно включать некоторые или все средства для обнаружения амплифицированной нуклеиновой кислоты. Например, метки, описываемые в настоящем документе (например, связывающиеся с двухцепочечной ДНК красители, меченые олигонуклеотидные зонды), устройства для обнаружения этих меток, материалы и устройства для электрофореза или материалы и устройства для хроматографии.

Дополнительные компоненты могут необязательно включать дополнительные олигонуклеотиды, которые селективно гибридизуются с нуклеиновыми кислотами-мишенями, служащими индикаторами любых других заболеваний или медицинских состояний, в частности, состояний, ассоциированных с желудочно-кишечной микробиотой (например, БК, ВЗК, ЯК, СЗК), и которые, таким образом, можно использовать так же, как олигонуклеотиды по изобретению, для получения информации, относящейся к диагностике любых других заболеваний или медицинских состояний, в частности, состояний, ассоциированных с желудочно-кишечной микробиотой (например, БК, ВЗК, ЯК, СЗК). Эти олигонуклеотиды можно считать частью набора зондов по изобретению.

Изобретение далее будет описано со ссылками на неограничивающие примеры, в которых:

На фиг. 1 представлено развитие во времени бактериальных таксонов у сенсибилизированных и несенсибилизированных детей. Средний логарифмический сигнал для каждого зонда показан в виде сплошной линии, в то время как логарифмический сигнал для всех рассмотренных моментов времени показан точками (уровни выше порогового значения 50, обозначенного пунктирной линией). Темно-серые линии и точки соответствуют сенсибилизированным детям, в то время как светло-серые линии относятся к несенсибилизированным детям. Значения <0 приведены к 0,001 перед логарифмическим преобразованием.

На фиг. 2 представлено развитие во времени бактериальных родов/видов у сенсибилизированных и несенсибилизированных детей. Средний логарифмический сигнал для каждого зонда показан в виде сплошной линии, в то время как логарифмический сигнал для всех рассмотренных моментов времени показан точками (уровни выше порогового значения 50, обозначенного пунктирной линией). Темно-серые линии и точки соответствуют сенсибилизированным детям, в то время как светло-серые линии относятся к несенсибилизированным детям. Значения <0 приведены к 0,001 перед логарифмическим преобразованием. Зонды с пиковым сигналом ниже порогового значения не показаны.

ПРИМЕР 1

Целью настоящей работы является проспективное сравнение развития доминантной микробиоты у IgE-сенсибилизированных детей и несенсибилизированных детей во время первых двух лет жизни. Для выполнения этой задачи и других задач, связанных с кишечной микробиотой, необходим инструмент для быстрого скрининга состава и композиции бактерий в образцах кала по мере необходимости. Авторы, таким образом, предложили детскую высокопроизводительную микропанель для гена 16S рРНК, названную детским анализом GA-map. Анализы с применением микропанели проводили на выбранной подгруппе из когорты IM-PACT. В качестве маркеров атопии выбирали специфичный IgE, поскольку авторы ранее показали, что этот маркер коррелирует с кишечными бактериями (неопубликованные результаты).

Основное отличие анализа GA-map у детей от альтернативного анализа гена 16S рРНК заключается в использовании зондов для высокоспецифичной однонуклеотидной достройки праймера (SNuPE) для различения мишени/не-мишени. Высокая специфичность анализа SNuPE достигается благодаря основанному на ДНК-полимеразе включению флуоресцентно меченого дидезоксинуклеотида. Зонды SNuPE конструируют таким образом, чтобы зонды гибридизовались рядом с подлежащими различению генами. Для уменьшения сложности и повышения эффективности детский анализ GA-map направлен на бактерии, которые, как ожидается, колонизируют кишечник ребенка. Зонды выбирали на основе критерия минимального количества зондов, охватывающих предполагаемое разнообразие бактерий в кишечнике ребенка.

Материалы и способы

Когорта

Исследование "Предотвращение аллергии у детей Тронхейма" (The Prevention of Allergy Among Children in Trondheim, PACT) представляет собой обширное популяционное интервенционное исследование, проведенное в Норвегии и сфокусированное на детской аллергии. Образцы, использованные в настоящем изобретении, представляют собой подгруппу исследования PACT, в котором авторы проводили иммунологические и микробиологические измерения. В качестве дополнительного вспомогательного исследования семейные врачи и акушеры в Тронхейме участвовали в наборе случайной группы женщин во время регулярных осмотров на ранних этапах беременности, пока не набрали 720 участников. Женщины заполняли анкеты по факторам риск во время беременности, через шесть недель после родов и через один и два года после родов. Вопросы касались аллергии в семье, бытовых условий, питания и образа жизни, а после родов вопросы касались грудного вскармливания, пищевых добавок, питания, инфекций, прививок, антибиотиков, пребывания детей в детских центрах и их взаимодействия с никотином. Когда детям исполнялось два года, женщинам предлагали другие анкеты по здоровью и заболеваниям. Аллергическую сенсибилизацию оценивали по повышенному уровню специфичного IgE (≥0,35 кМЕ/мл) в сыворотке посредством анализа на ряд аллергенов (система аллерген-специфических IgE Immulite 2000, Siemens Medical Solutions Diagnostics). Исходно когорту анализировали на двенадцать определенных бактерий посредством количественной ПЦР (неопубликованные результаты). В настоящем документе авторы выбрали ряд детей для подробного тестирования посредством анализа GA-map у детей на основе числа образцов и аллергического состояния. Всего выбрали 16 сенсибилизированных и 31 несенсибилизированных ребенка, которым соответствовало в общей сложности 216 образцов кала.

Получение образца и амплификация способом ПЦР

Родители собирали кал из подгузников и переносили на транспортную среду Carry Blair и немедленно помещали в домашние условия хранения с температурой -18°C, после чего переносили в место долговременного хранения с -80°C до проведения анализа. Для разрушения клеток применяли механический лизис, а для очистки ДНК применяли автоматический способ, основанный на магнитных микроносителях.

Авторы комбинировали применение прямого праймера, связывающегося с консервативной областью между V2 и V3 (Nadkarni et al., 2002. Microbiology 148, 257-266), с применением обратного праймера, связывающегося с 3'-концом гена 16S рРНК (Weisburg et al., 1991, J Bacteriol 173, 697-703). Авторы применяли 1,5 U HotFirePol (Solis Biodyne, Tartu, Estonia), буфер 1 х B2 (Solis Biodyne), 2,5 мМ MgCl2 (Solis Biodyne), 200 мкМ dNTP (Thermo Fisher Scientific, Waltham, USA), по 0,2 мкМ прямого и обратного праймеров и приблизительно от 10 до 50 нг матрицы в общем объеме 25 мкл. Один из образцов амплифицировали три раза, чтобы оценить воспроизводимость ПЦР (более подробно описано в разделе Капиллярный электрофорез). Протокол амплификации включал 15-минутный этап активации при 95°C с последующими 30 циклами, включающими 30 секунд денатурации при 95°C, 30 секунд отжига при 55°C и 90 секунд удлинения при 72°C. Для достройки всех продуктов ПЦР проводили конечную элонгацию в течение 7 минут при 72°C.

Для начальных тестов анализа ПЦР для гена 16S рРНК проводили на бактериальной ДНК из чистых культур 26 штаммов, приведенных в таблице 4, и продукты ПЦР тестировали в ходе последующего анализа GA-map у детей. Штаммы секвенировали для подтверждения их идентичности и возможных мутаций (номера доступа последовательностей приведены в таблице 4). Положительный контроль, состоящий из смеси ДНК из чистых культур 8 подходящих бактериальных штаммов, и отрицательный контроль, состоящий из H20, использовали во время реакции ПЦР для гена 16S рРНК и последующего анализа GA-map у детей. Положительные контроли использовали в качестве контроля качества реакции мечения и гибридизации микропанелей (результаты не показаны).

План анализа GA-map у детей

Анализ GA-map основан на принципе высокоспецифичной однонуклеотидной достройки праймера (SNupE) в комбинации с гибридизацией микропанелей (Rudi et al., 1998, Appl Environ Microbiol 64, 2639-2643).

Бактериальные штаммы, представленные в таблице 4, использовали для проверки зондов. Для конструирования зондов авторы использовали комбинированный набор данных, включающий в общей сложности 3580 последовательностей гена 16S рРНК (Palmer et al., 2007, PLoS Biology 5, e177; Rudi et al., 2007, Appl Environ Microbiol 73, 2727-2734), в дополнение к набору известных патогенов.

Конструирование зондов авторы проводили в четыре этапа. 1) Сначала авторы определяли набор целевых и нецелевых групп на основании согласованной системы классификации. 2) Следующий этап заключался в идентификации зондов, которые удовлетворяют критериям обнаружения мишеней и исключения нецелевых групп. Он был основан на комбинированном критерии гибридизации и мечения. Все зонды были сконструированы с минимальной Tm 60°C для целевой группы, в то время как для нецелевой группы использовали Tm<30°C или отсутствие цитозина на месте нуклеотида, прилежащего к 3'-концу зонда. Все зонды, удовлетворяющие критерию, идентифицировали. 3) Затем оценивали возможность образования перекрестных меток и автометок, а также возможность перекрестной гибридизации на микропанели. 4) Наконец, посредством комбинирования данных относительно целевых/нецелевых групп и совместимости зондов конструировали окончательные микропанели с применением иерархического подхода.

Универсальный зонд для гена 16S рРНК (UNI01) включали в набор зондов для измерения общего количества бактериальной ДНК в образце. На этапе гибридизации добавляли один дополнительный зонд: смесь 1:4 предварительно меченого и немеченого зонда для контроля гибридизации (HYC01). HYC01 использовали для оценки эффективности этапа гибридизации на стекле и стандартизации сигналов зондов от разных стекол. Микропанели, использованные в детском анализе GA-map, были получены от Arraylt (Arraylt, Sunnyvale, USA). Одно предметное стекло несет 24 отдельных идентичных микропанели, и зонды (комплементарные зондам, приведенным в таблице 5) распределяли по три копии на каждую микропанель. Кроме того, микропанели также содержат два несвязывающихся контрольных зонда (NBC01, NBC02) (Sanguin et al., 2006, Environmental Microbiology 8, 289-307).

Достройка праймера и гибридизация с микропанелью

Перед реакцией мечения продукты ПЦР 16S (амплифицированные, как описано выше) обрабатывали 3U экзонуклеазой I (New England Biolabs, Ipswich, USA) и 8U щелочной фосфатазой креветки (USB, Cleveland, USA) при 37°C в течение 2 часов и инактивировали при 80°C в течение 15 минут. Обработанные ExoSAP ПЦР-продукты затем количественно оценивали с применением программного обеспечения Kodak Molecular Imaging (Version 4,0) на основе изображений, полученных для электрофореза в геле. Во все гели добавляли по 1 kB лестничного маркера ДНК (N3232, New England Biolabs) с определенными концентрациями. На основании количественных данных, полученных посредством обработки гель-электрофоретических изображений, продукты ПЦР разбавляли до равной концентрации, составляющей 50 нг/мкл на образец, и приблизительно 100 нг матрицы использовали в следующей реакции мечения: в общем объеме реакционной смеси, составляющем 10 мкл, 2,5 U HOT TERMIPol (Solis Biodyne), 1x буфера C (Solis Biodyne), 4 мМ MgCl2 (Solis Biodyne), 0,4 мкΜ ддЦТФ-tamra (Jena Bioscience, Jena, Germany) и 2,9 мкΜ набора зондов 3 (таблица 5). Протокол мечения включал 12 минут этапа активации при 95°C с последующими 10 циклами с 20-секундной денатурацией при 96°C и 35-секундным отжигом при 60°C. 44 образца выбрали случайным образом для анализа воспроизводимости. Эти 44 образца обрабатывали дважды, начиная с реакции мечения. Кроме того, в качестве теста количественного диапазона анализа продукты ПЦР чистых культур 5 различных видов (приведены в таблице 4) разбавляли от 100 до 10-4 и включали в реакцию мечения и последующий анализ на микропанели.

Микропанели предварительно гибридизовали для предотвращения фонового сигнала посредством погружения предметных стекол в Blocklt (Arraylt) при комнатной температуре. Через два часа стекла отмывали в течение 2 минут в промывочном буфере, содержащем 2x SSC (Sigma-Aldrich, St. Louis, USA) + 0,1% Sarkosyl (RT) (VWR, International Ltd., Poole, United Kingdom), а затем в течение 2 мин в 2xSSC (Sigma-Aldrich). Затем стекла помещали в лабораторный стакан с особо чистой H2O (100°C) на 2 минуты и немедленно переносили в стакан с 100% этанолом (-20°C ) на 20 секунд, после чего сушили посредством центрифугирования при 91 G в центрифуге Multifuge 3 S-R (Heraeus, Buckinghamshire, United Kingdom) в течение 12 минут и использовали в течение часа.

Непосредственно перед гибридизацией микропанели к образцам добавляли 60 мкл гибридизационного буфера, содержащего 7,2% полиэтиленгликоля 8000 (Sigma-Aldrich), 1,2x SSC (Sigma-Aldrich) и 0,17 мкΜ смеси зонда для контроля гибридизации смеси HYC01 (смесь 1:4 меченного tamra HYC01 и немеченого HYC01 ). Образцы денатурировали при 95°C в течение 2 минут, а затем оставляли при 45°C на 2 минуты. Предметные стекла помещали в 96-луночную камеру для гибридизации (Arraylt), после чего образцы помещали на панели. Две панели на каждом стекле использовали для образцов положительного и отрицательного контролей. Камеру для гибридизации помещали во влажную камеру и гибридизовали в течение 16 часов в инкубатор-шейкер Innova 4000 (New Brunswick Scientific, Champaign, USA) при 45°C и 60 об./мин.

После гибридизации микропанели отмывали в течение 5 минут в промывочном буфере, содержащем 2x SSC (Sigma-Aldrich) и 0,1% Sarkosyl (VWR, International Ltd.), затем в течение 5 минут в 2xSSC (Sigma-Aldrich) и наконец в течение 10 секунд в 0,2x SSC (Sigma-Aldrich), после чего сушили посредством центрифугирования при 91 G в течение 12 мин в центрифуге Multifuge 3 S-R (Heraeus). Гибридизованные панели сканировали при длине волны 532 нм посредством перезаряженного сканера Tecan LS (Tecan, Mannedorf, Austria). Интенсивность флуоресценции и точечную морфологию анализировали с применением Axon GenePix Pro 6,0.

Капиллярный электрофорез

Для анализа специфичности зондов отдельные зонды тестировали на взаимодействие с их бактериями-мишенями (ДНК из чистых культур) посредством ПЦР-амплификации 16S и реакций мечения, как описано выше (с 1 мкΜ отдельных проб вместо набора зондов 3), и эффективность зондов оценивали посредством капиллярного электрофореза. Воспроизводимость ПЦР гена 16S рРНК анализировали на одном из образцов (амплифицированном в трех независимых ПЦР) посредством капиллярного электрофореза. Два зонда (6_1_4 и 5_1_2) выбирали для анализа сигнала для каждого из трех продуктов ПЦР, кроме того, тройную реакцию совокупности трех продуктов ПЦР анализировали с применением тех же зондов. После мечения образцы обрабатывали 8U SAP (USB) и инкубировали при 37°C в течение 1 часа и инактивировали при 80°C в течение 15 минут. Затем 1 мкл обработанных SAP и меченых зондов смешивали с 9 мкл Hi-Di формамида (Applied Biosystems, Warrington, United Kingdom) и 0,5 мкл GeneScan 120 Liz Size Standard (Applied Biosystems), и образцы инкубировали при 95°C в течение 5 минут и немедленно помещали на лед. Затем образцы помещали на 50 см 3130xl капиллярный блок (Applied Biosystems) в секвенатор ABI Genetic Analyzer 3130xl (Applied Biosystems), содержащий оптимизированный полимер 7 (POP-7, Applied Biosystems). Время ввода пробы составляло 16-22 секунд, а электрофоретические условия были следующими: время прогона 1500 секунд при 15000 В, сила тока 100 мкΑ и рабочая температура 60°C. Для анализа результатов использовали программное обеспечение GeneMapper 4.0.

Продукты ПЦР гена 16S рРНК от 26 бактериальных штаммов, использованные для оценки зондов, секвенировали для подтверждения их характеристик и для оценки наличия мутаций в последовательностях гена по сравнению с последовательностями, использованными для конструирования зондов. Обработанные ExoSAP продукты ПЦР разбавляли в 10 раз и использовали 1 мкл раствора в реакции секвенирования с применением набора для циклического секвенирования BigDye® Terminator v1.1 (Applied Biosystems). По 0,32 мкΜ прямого и обратного праймеров, использованных для ПЦР 16S рРНК, как описано выше, использовали в двух отдельных реакциях секвенирования. Набор для очистки BigDye XTerminator® (Applied Biosystems, Warrington, United Kingdom) использовали согласно рекомендациям производителя для очистки реакций секвенирования. Образцы анализировали на 36 см 3130xl капиллярном блоке (Applied Biosystems) в секвенаторе ABI Genetic Analyzer 3130×l (Applied Biosystems), содержащем оптимизированный полимер 7 (POP-7, Applied Biosystems). Время ввода пробы составляло 3 секунды, а электрофоретические условия были следующими: время пробега 2780 секунд при 8500 В, сила тока 5,0 мкΑ и рабочая температура 60°C. Последовательности анализировали с применением программного обеспечения Sequence Scanner v1.0 (Applied Biosystems). Последовательности помещали в GenBank, и соответствующие номера доступа приведены в таблице 4.

Предварительная обработка и анализ данных

Для сигналов зондов делали поправку на нежелательные вариации гибридизации, которые наблюдаются для разных стекол. В каждом эксперименте меченый зонд (HYC01) добавляют к смеси зондов для оценки этапа гибридизации. Чтобы внести поправку на вариации гибридизации между стеклами, авторы делили все сигналы образцов на средний сигнал от всех копий зонда. Кроме того, фоновый сигнал от отдельных зондов устраняли посредством вычитания средних сигналов от образцов отрицательного контроля, помещенных на все стекла, использованные в данном эксперименте.

Для оценки зондов для всех 26 бактериальных штаммов строили филогенетическое древо, полученное способом поиска ближайшего соседа посредством программы Mega 4, и его надежность оценивали с применением бутстреппинга.

Статистические анализы

Специфичность зондов оценивали посредством сравнения теоретических значений для целевых/нецелевых групп с экспериментальными результатами для отдельных штаммов, используя экспериментально установленное пороговое значение фонового сигнала, составляющее 50.

Данные микропанелей, как правило, включают как пороговые значения, так и величины насыщения, и, таким образом, редко демонстрируют нормальное распределение. Поэтому для анализа статистической значимости данных микропанелей часто применяют основанные на перестановке подходы вместо стандартных статистических тестов, таких как ANOVA и t-тесты (для проведения которых необходимо нормальное распределение). Тест на перестановку представляет собой точный статистический тест, даже для данных со сложным распределением. Таким образом, p-значения для групповых различий в каждой возрастной категории рассчитывали посредством теста на перестановку (Langsrud, 2002, Journal Of The Royal Statistical Society Series D 51, 305-317), используя 50 в качестве фонового пороговое значение.

Результаты

Конструирование и оценка зондов

Набор из 88 зондов конструировали на основе критерия, описанного в Материалах и способах. Шесть зондов для основных таксонов охватывали 88% клонов базы данных авторов. Анализ отдельных зондов с применением капиллярного электрофореза в геле и штаммов в таблице 4 в качестве матриц показал, что 76% зондов удовлетворяют критерию обнаружения мишеней, что указывает на относительно высокий показатель эффективности. На основании этих результатов и ряда биоинформатических критериев авторы предоставили 10 наборов зондов. Каждый набор зондов состоит из 25 зондов, которые выбирали на основании их совместимости друг с другом in silico. Оценки совместимости были основаны на подсчетах температуры плавления и термодинамических характеристик зонда - самогибридизации, гибридизации с другими зондами из набора зондов или с их бактериями-мишенями. Экспериментальная проверка посредством капиллярного электрофореза в геле показала, что набор зондов 3 демонстрирует самый низкий уровень перекрестных реакций, что определяли посредством мечения без матрицы (результаты не показаны). Данный набор зондов, таким образом, был выбран для конструирования микропанелей (таблица 5).

Специфичность, воспроизводимость и количественный диапазон детского биочипа GA-map

Первую оценку биочипа проводили на чистых штаммах. Оценка была основана на сравнении определенных in silico мишеней/не-мишеней с определенными посредством экспериментальных сигналов. Данный анализ показал хороший уровень соответствия между теоретической и экспериментальной специфичностью зондов. Используя пороговый уровень, составляющий 50 ОФУ, авторы показали отсутствие ложноотрицательных результатов, в то время как число ложноположительных результатов было довольно вариабельным (таблица 5).

Следующий этап оценки заключался в определении точности классификации смешанных образцов. Это осуществляли посредством анализа набора определенных смесей. Оценка этих данных показала, что большинство зондов точно идентифицировали соответствующие им бактерии-мишени. В данном случае авторы использовали пороговый сигнал, составляющий 50. В общей сложности наблюдали 96,5% верных результатов с 9,0% ложноположительных результатов и 1,6% ложноотрицательных результатов. Количественный диапазон выбранных зондов затем оценивали посредством разведений матрицы. В большинстве случаев эти анализы указывали на насыщение сигнала зонда при концентрации мишени >10% относительно неразведенного продукта ПЦР. Все рассмотренные зонды также демонстрировали одинаковый приблизительный предел детекции от 0,1 до 0,01%. Значение коэффициента детерминации также было очень высоким и составляло R2>0,9 для всех рассмотренных зондов. Воспроизводимость анализа оценивали посредством двойного анализа 43 образцов. Среднее относительное изменение и R2 индивидуально определяли для каждого зонда и подтверждали воспроизводимость анализа.

Развитие кишечной микробиоты на уровне типов

Авторы показали, что Actinobacteria (зонд 6_2) и Firmicutes (зонд 5_1) были в значительной степени доминирующими в возрасте 4 месяца и один год, соответственно, у IgE-сенсибилизированных детей (таблица 6 и фиг. 1). Также наблюдалась общая тенденция повозрастной колонизации на уровне типов, независимая от статуса сенсибилизации. Общая тенденция включала начальное доминирование Firmicutes и Proteobacteria через десять суток. В возрасте четырех месяцев доминирование Proteobacteria/Firmicutes заменялось доминированием Bacteroides/Actinobacteria, в то время как в возрасте одного года и двух лет исходные доминировавшие типы становились менее распространенными.

Развитие кишечной микробиоты на уровне родов и видов

Основное различие между сенсибилизированной и несенсибилизированной группами заключалось том, что B. longum (зонд 6_1_4) в возрасте одного года был в значительной степени доминирующим в сенсибилизированной группе по сравнению с несенсибилизированной группой. Авторы также показали, что Enterococcus (зонд 4_4_2) был в значительной степени доминирующим в возрасте четырех месяцев. Также авторы полагают, что стрептококки ассоциированы с сенсибилизацией, поскольку Streptococcus sanguinis (зонд 4_6_1) является в значительной степени доминирующим в возрасте одного года, а S. pneumonia (зонд 4_8_1) находится на границе значимости в возрасте 10 суток (таблица 7 и фиг. 2).

Бактериальные группы с самыми стабильными паттернами колонизации, коррелирующими с возрастом, включали Staphylococcus (зонд 5_1_2) и Bifidobacterium breve (зонд 6_2_2). Staphylococcus доминировал вначале, в то время как B. breve демонстрировал пик доминирования в возрасте 4 месяцев.

Обсуждение

Посредством основанного на SNuPE анализа GA-map авторы получали микропанель со всего несколькими зондами для гена 16S рРНК с высокой специфичностью чувствительностью. Очевидное преимущество заключается в том, что данный анализ предоставляет способы применения с высокой производительностью.

Самый неожиданный биологический результат данной работы заключается в том, что B. longum является в значительной степени доминирующим в IgE-сенсибилизированной группе в возрасте 360 суток, в дополнение к низким p-значениям для возрастов в 10 суток и 120 суток. Этот результат был также независимо подтвержден посредством кПЦР для данных IM-PACT (неопубликованные результаты). В совокупности многочисленные независимые корреляции поддерживают достоверность наблюдений. Результат был неожиданным потому, что предыдущие работы указывали на то, что B. longum является протективным в отношении сенсибилизации. Эксперименты на мышах, однако, показали, что время и порядок заселения бифидобактерий важны для иммуномодуляторного эффекта. Это может объяснять различия результатов различных исследований.

Авторы также показали, что подгруппа Firmicutes, включающая стрептококки и энтерококки, является в значительной степени доминирующей в IgE-сенсибилизированной группе. О сенсибилизации для этой группы бактерий известно сравнительно немного. Однако было выдвинуто предположение о том, что инфицирование S. pneumonia может коррелировать с увеличенными уровнями IgE в хроническом бронхите. Таким образом, сенсибилизация у детей и сенсибилизация при бронхите может быть основана на одних и тех же механизмах.

Вкратце, данная работа демонстрирует пригодность анализа GA-map у детей для определение изменений состава кишечной микробиоты. Эти данные можно использовать для ранней диагностики заболеваний и повышения эффективности профилактического или терапевтического лечения различных кишечных заболеваний.

1. Набор олигонуклеотидных зондов для профилирования микробиоты желудочно-кишечного тракта (ЖКТ), где указанный набор включает:
(a) олигонуклеотид, состоящий из (ai) нуклеотидной последовательности, выбранной из ACGCTTGCACCCT (SEQ ID NO: 1) необязательно с не более тремя замещенными основаниями или AGGGTGCAAGCGT (SEQ ID NO: 27) необязательно с не более тремя замещенными основаниями, и (aii) 0-5 нуклеотидов в дополнение к (ai), где олигонуклеотид согласно (а) способен гибридизоваться с SEQ ID NO: 27 или SEQ ID NO: 1, соответственно, в строгих условиях гибридизации;
(b) олигонуклеотид, состоящий из (bi) нуклеотидной последовательности, выбранной из CGATCCGAAAACCTTCTTCACT (SEQ ID NO: 2) необязательно с не более тремя замещенными основаниями или AGTGAAGAAGGTTTTCGGATCG (SEQ ID NO: 28) необязательно с не более тремя замещенными основаниями, и (bii) 0-5 нуклеотидов в дополнение к (bi), где олигонуклеотид согласно (b) способен гибридизоваться с SEQ ID NO: 28 или SEQ ID NO: 2, соответственно, в строгих условиях гибридизации;
(c) олигонуклеотид, состоящий из (ci) нуклеотидной последовательности, выбранной из GGACAACGCTTGCCAC (SEQ ID NO: 3) необязательно с не более тремя замещенными основаниями или GTGGCAAGCGTTGTCC (SEQ ID NO: 29) необязательно с не более тремя замещенными основаниями, и (cii) 0-5 нуклеотидов в дополнение к (ci), где олигонуклеотид согласно (с) способен гибридизоваться с SEQ ID NO: 29 или SEQ ID NO: 3, соответственно, в строгих условиях гибридизации;
(d) олигонуклеотид, состоящий из (di) нуклеотидной последовательности, выбранной из CGTAGGCGGTTCGTCGCGT (SEQ ID NO: 4) необязательно с не более тремя замещенными основаниями или ACGCGACGAACCGCCTACG (SEQ ID NO: 30) необязательно с не более тремя замещенными основаниями, и (dii) 0-5 нуклеотидов в дополнение к (di), где олигонуклеотид согласно (d) способен гибридизоваться с SEQ ID NO: 30 или SEQ ID NO: 4, соответственно, в строгих условиях гибридизации; и
(e) один или несколько олигонуклеотидов, состоящих из (ei) нуклеотидной последовательности, выбранной из приведенных в таблице 1 SEQ ID NO: 5-8 и 31-34 необязательно с не более тремя замещенными основаниями, и (eii) 0-5 нуклеотидов в дополнение к (ei), где олигонуклеотид согласно (е) способен гибридизоваться с нуклеотидной последовательностью, комплементарной SEQ ID NO: 5-8 и 31-34, соответственно, в строгих условиях гибридизации; и необязательно
(f) один или несколько олигонуклеотидов, состоящих из (fi) нуклеотидной последовательности, выбранной из приведенных в таблице 2 и таблице 3 SEQ ID NO: 9-26 и 35-52 необязательно с не более тремя замещенными основаниями, и (fii) 0-5 нуклеотидов в дополнение к (fi), где олигонуклеотид согласно (f) способен гибридизоваться с нуклеотидной последовательностью, комплементарной SEQ ID NO: 9-26 и 35-52, соответственно, в строгих условиях гибридизации.

2. Набор олигонуклеотидных зондов по п. 1, где указанный набор включает:
(a) олигонуклеотид, состоящий из (ai) нуклеотидной последовательности SEQ ID NO: 1 или SEQ ID NO: 27 и (aii) 0-5 нуклеотидов в дополнение к (ai), где олигонуклеотид согласно(а) способен гибридизоваться с SEQ ID NO: 27 или SEQ ID NO: 1, соответственно, в строгих условиях гибридизации;
(b) олигонуклеотид, состоящий из (bi) нуклеотидной последовательности SEQ ID NO: 2 или SEQ ID NO: 28 и (bii) 0-5 нуклеотидов в дополнение к (bi), где олигонуклеотид согласно (b) способен гибридизоваться с SEQ ID NO: 28 или SEQ ID NO: 2, соответственно, в строгих условиях гибридизации;
(c) олигонуклеотид, состоящий из (ci) нуклеотидной последовательности SEQ ID NO: 3 или SEQ ID NO: 29 и (cii) 0-5 нуклеотидов в дополнение к (ci), где олигонуклеотид согласно (с) способен гибридизоваться с SEQ ID NO: 29 или SEQ ID NO: 3, соответственно, в строгих условиях гибридизации;
(d) олигонуклеотид, состоящий из (di) нуклеотидной последовательности SEQ ID NO: 4 или SEQ ID NO: 30 и (dii) 0-5 нуклеотидов в дополнение к (di), где олигонуклеотид согласно (d) способен гибридизоваться с SEQ ID NO: 30 или SEQ ID NO: 4, соответственно, в строгих условиях гибридизации; и
(e) один или несколько олигонуклеотидов, состоящих из (ei) нуклеотидной последовательности, выбранной из приведенных в таблице 1 SEQ ID NO: 5-8 и 31-34 и (eii) 0-5 нуклеотидов в дополнение к (ei), где олигонуклеотид согласно (е) способен гибридизоваться с нуклеотидной последовательностью, комплементарной SEQ ID NO: 5-8 и 31-34, соответственно, в строгих условиях гибридизации; и необязательно
(f) один или несколько олигонуклеотидов, состоящих из (fi) нуклеотидной последовательности, выбранной из приведенных в таблице 2 и таблице 3 SEQ ID NO: 9-26 и 35-52 и (fii) 0-5 нуклеотидов в дополнение к (fi), где олигонуклеотид согласно (f) способен гибридизоваться с нуклеотидной последовательностью, комплементарной SEQ ID NO: 9-26 и 35-52, соответственно, в строгих условиях гибридизации.

3. Набор олигонуклеотидных зондов по п. 1, где указанный набор включает:
(a) олигонуклеотид, состоящий из нуклеотидной последовательности, выбранной из SEQ ID NO: 1 необязательно с не более тремя замещенными основаниями или SEQ ID NO: 27 необязательно с не более тремя замещенными основаниями, где олигонуклеотид согласно (а) способен гибридизоваться с SEQ ID NO: 27 или SEQ ID NO: 1, соответственно, в строгих условиях гибридизации;
(b) олигонуклеотид, состоящий из нуклеотидной последовательности, выбранной из SEQ ID NO: 2 необязательно с не более тремя замещенными основаниями или SEQ ID NO: 28 необязательно с не более тремя замещенными основаниями, где олигонуклеотид согласно (b) способен гибридизоваться с SEQ ID NO: 28 или SEQ ID NO: 2, соответственно, в строгих условиях гибридизации;
(c) олигонуклеотид, состоящий из нуклеотидной последовательности, выбранной из SEQ ID NO: 3 необязательно с не более тремя замещенными основаниями или SEQ ID NO: 29 необязательно с не более тремя замещенными основаниями, где олигонуклеотид согласно (с) способен гибридизоваться с SEQ ID NO: 29 или SEQ ID NO: 3, соответственно, в строгих условиях гибридизации;
(d) олигонуклеотид, состоящий из нуклеотидной последовательности, выбранной из SEQ ID NO: 4 необязательно с не более тремя замещенными основаниями или SEQ ID NO: 30 необязательно с не более тремя замещенными основаниями, где олигонуклеотид согласно (d) способен гибридизоваться с SEQ ID NO: 30 или SEQ ID NO: 4, соответственно, в строгих условиях гибридизации; и
(e) один или несколько олигонуклеотидов, состоящих из нуклеотидной последовательности, выбранной из приведенных в таблице 1 SEQ ID NO: 5-8 и 31-34 необязательно с не более тремя замещенными основаниями, где олигонуклеотид согласно (е) способен гибридизоваться с нуклеотидной последовательностью, комплементарной SEQ ID NO: 5-8 и 31-34, соответственно, в строгих условиях гибридизации; и необязательно
(f) один или несколько олигонуклеотидов, состоящих из нуклеотидной последовательности, выбранной из приведенных в таблице 2 и таблице 3 SEQ ID NO: 9-26 и 35-52 необязательно с не более тремя замещенными основаниями, где олигонуклеотид согласно (f) способен гибридизоваться с нуклеотидной последовательностью, комплементарной SEQ ID NO: 9-26 и 35-52, соответственно, в строгих условиях гибридизации.

4. Набор олигонуклеотидных зондов по п. 1, где указанный набор включает:
(а) олигонуклеотид, состоящий из нуклеотидной последовательности, выбранной из SEQ ID NO: 1, SEQ ID NO: 1 с дополнительным 3′С остатком, SEQ ID NO: 27 или SEQ ID NO: 27 с дополнительным 5′G остатком;
(b) олигонуклеотид, состоящий из нуклеотидной последовательности, выбранной из SEQ ID NO: 2, SEQ ID NO: 2 с дополнительным 3′С остатком, SEQ ID NO: 28 или SEQ ID NO: 28 с дополнительным 5′G остатком;
(c) олигонуклеотид, состоящий из нуклеотидной последовательности, выбранной из SEQ ID NO: 3, SEQ ID NO: 3 с дополнительным 3′С остатком, SEQ ID NO: 29 или SEQ ID NO: 29 с дополнительным 5′G остатком;
(d) олигонуклеотид, состоящий из нуклеотидной последовательности, выбранной из SEQ ID NO: 4, SEQ ID NO: 4 с дополнительным 3′С остатком, SEQ ID NO: 30 или SEQ ID NO: 30 с дополнительным 5′G остатком; и
(e) один или несколько олигонуклеотидов, состоящих из нуклеотидной последовательности, выбранной из приведенных в таблице 1 SEQ ID NO: 5-8 и 31-34 или SEQ ID NO: 5-8 с дополнительным 3′С остатком, или SEQ ID NO: 31-34 с дополнительным 5′G остатком; и необязательно
(f) один или несколько олигонуклеотидов, состоящих из нуклеотидной последовательности, выбранной из приведенных в таблице 2 и таблице 3 SEQ ID NO: 9-26 и 35-52 или SEQ ID NO: 9-26 с дополнительным 3′С остатком, или SEQ ID NO: 35-52 с дополнительным 5′G остатком.

5. Набор олигонуклеотидных зондов по п. 1, где указанный набор включает:
(a) олигонуклеотид, состоящий из нуклеотидной последовательности SEQ ID NO: 1 или SEQ ID NO: 27;
(b) олигонуклеотид, состоящий из нуклеотидной последовательности SEQ ID NO: 2 или SEQ ID NO: 28;
(c) олигонуклеотид, состоящий из нуклеотидной последовательности SEQ ID NO: 3 или SEQ ID NO: 29;
(d) олигонуклеотид, состоящий из нуклеотидной последовательности SEQ ID NO: 4 или SEQ ID NO: 30; и
(e) один или несколько олигонуклеотидов, состоящих из нуклеотидной последовательности, выбранной из приведенных в таблице 1 последовательностей; и необязательно
(f) один или несколько олигонуклеотидов, состоящих из нуклеотидной последовательности, выбранной из приведенных в таблице 2 и таблице 3 последовательностей.

6. Набор олигонуклеотидных зондов по любому из пп. 1-5, где один или несколько из указанных олигонуклеотидов мечены фрагментом для обеспечения обнаружения или манипуляций.

7. Набор олигонуклеотидных зондов по п. 6, где указанный фрагмент является колориметрической, хемилюминесцентной, хромогенной, радиоактивной, флуоресцентной, ферментом, фрагментом антитела, His-меткой, биотином или стрептавидином.

8. Набор олигонуклеотидных зондов по любому из пп. 1-5, 7, где один или несколько из указанных олигонуклеотидов иммобилизованы на одной или нескольких твердых подложках, предпочтительно выбранных из частиц, полосок, гелей, фильтров, мембран, волокон, капилляров, чипов, микротитровальных полосок, стекол, трубочек, пластинок или камер.

9. Набор олигонуклеотидных зондов по п. 8, где указанная твердая подложка представляет собой магнитную частицу, предпочтительно магнитный микроноситель.

10. Набор олигонуклеотидных зондов по п. 8, где указанная твердая подложка мечена красителем или множеством красителей, предпочтительно люминесцентным красителем.

11. Способ профилирования микробиоты ЖКТ индивидуума, где указанный способ включает:
(i) взаимодействие образца из ЖКТ указанного индивидуума с набором олигонуклеотидных зондов, как указано в любом из пп. 1-10;
(ii) воздействие на образец и набор зондов условиями, обеспечивающими гибридизацию зондов с их нуклеотидными последовательностями-мишенями в составе молекул нуклеиновой кислоты в указанном образце;
(iii) для каждого олигонуклеотида в указанном наборе зондов определение количества его нуклеотидной последовательности-мишени, которая присутствует в указанном образце, и
(iv) получение профиля микробиоты ЖКТ индивидуума из относительных количеств нуклеотидных последовательностей-мишеней, присутствующих в образце.

12. Способ по п. 11, где каждый олигонуклеотид несет прикрепленную к нему метку, а этап (iii) включает определение для каждого меченого олигонуклеотида количества указанной метки, связанной с указанным образцом, посредством определения силы сигнала метки, исходящего от образца.

13. Способ по п. 11, где этап (iii) включает
(a) селективное мечение олигонуклеотидных зондов из набора зондов при гибридизации с их нуклеотидной последовательностью-мишенью; и
(b) определение количества каждого меченого олигонуклеотидного зонда, полученного на этапа (а).

14. Способ по п. 13, где селективное мечение проводят посредством удлинения цепи олигонуклеотидного зонда меченым нуклеотидом, предпочтительно меченым дидезоксинуклеотидом.

15. Способ по п. 11, где указанный меченый нуклеотид мечен ддЦТФ, предпочтительно ддЦТФ, меченным биотином.

16. Способ по пп. 13-15, где этап (b) включает гибридизацию олигонуклеотидов, полученных на этапе мечения (а), с нуклеотидными последовательностями, комплементарными олигонуклеотидным зондам.

17. Способ по п. 16, где одна или несколько указанных нуклеотидных последовательностей, комплементарных олигонуклеотидным зондам, иммобилизованы на одной или нескольких твердых подложках, предпочтительно выбранных из частиц, полосок, гелей, фильтров, мембран, волокон, капилляров, чипов, микротитровальных полосок, стекол, трубочек, пластинок или камер.

18. Способ по п. 17, где указанная твердая подложка представляет собой магнитную частицу, предпочтительно магнитный микроноситель.

19. Способ по п. 17 или 18, где указанная твердая подложка помечена красителем или множеством красителей, предпочтительно люминесцентным красителем.

20. Способ по п. 11, где этап (iii) включает
(a) проведение реакции амплификации нуклеиновой кислоты с применением праймеров; и
(b) для каждого олигонуклеотида из набора зондов определение количества продукта амплификации, полученного в ходе указанной реакции амплификации нуклеиновой кислоты с применением праймеров.

21. Способ по п. 20, где указанная реакция амплификации нуклеиновой кислоты с применением праймеров представляет собой ПЦР.

22. Способ по п. 20 или 21, где указанная реакция амплификации нуклеиновой кислоты с применением праймеров представляет собой множество реакций амплификации нуклеиновой кислоты с применением праймеров, которые проводят параллельно, где в каждой параллельной реакции амплификации применяют один олигонуклеотидный зонд, или одну или несколько мультиплексных реакций амплификации нуклеиновой кислоты с применением праймеров, которые проводят параллельно с применением двух или более олигонуклеотидных зондов, применяемых в одной мультиплексной реакции амплификации.

23. Способ по любому из пп. 11-15, 17, 18, 20, 21, где указанный образец из ЖКТ выбран из
(a) содержимого полости ЖКТ, предпочтительно содержимого желудка, содержимого кишечника, слизи и фекалий/кала или их сочетания,
(b) участков слизистой оболочки, подслизистой оболочки, наружного мышечного слоя, адвентициальной оболочки и/или серозной оболочки ткани/органа ЖКТ,
(с) нуклеиновой кислоты, полученной из (а) или (b), предпочтительно посредством обратной транскрипции и/или амплификации нуклеиновой кислоты.

24. Способ по любому из пп. 11-15, 17, 18, 20, 21, где указанный образец из ЖКТ получен из тонкой кишки, подвздошной кишки, слепой кишки, толстой кишки, прямой кишки или анального канала.

25. Способ получения стандартного профиля микробиоты ЖКТ, характерного для заболевания или состояния или их этапов или риска развития заболевания или состояния, где указанное заболевание или состояние связано с характерными профилями микробиоты ЖКТ или его областями или частями, где указанный способ включает:
(i) идентификацию индивидуума с указанным заболеванием или состоянием или их этапами или характеризующегося риском развития указанного заболевания или состояния, и
(ii) осуществление способа по любому из пп. 11-24 с применением образца из ЖКТ указанного индивидуума.

26. Способ диагностики или мониторинга заболевания или состояния у индивидуума или прогнозирования или оценки риска развития у индивидуума заболевания или состояния, где указанное заболевание или состояние связано с характерными профилями микробиоты ЖКТ или его областями или частями, где указанный способ включает:
(а) профилирование микробиоты ЖКТ индивидуума способом, указанным в любом из пп. 11-24;
(b1) сравнение указанного профиля со стандартным профилем микробиоты ЖКТ, характерным для заболевания или состояния или их этапов или риска развития заболевания или состояния; и/или
(b2) сравнение указанного профиля с более ранним профилем микробиоты ЖКТ индивидуума; и
(с) определение степени корреляции указанных профилей.

27. Способ диагностики или мониторинга заболевания или состояния у индивидуума или прогнозирования или оценки риска развития у индивидуума заболевания или состояния, где указанное заболевание или состояние связано с характерными профилями микробиоты ЖКТ или его областями или частями, где указанный способ включает:
(a1) сравнение результатов способа, указанного в любом из пп. 11-24, со стандартным профилем микробиоты ЖКТ, характерным для указанного заболевания или состояния или их этапов или риска развития указанного заболевания или состояния, и/или
(а2) сравнение результатов способа, указанного в любом из пп. 11-24, с более ранним профилем микробиоты ЖКТ индивидуума, и
(b) определение степени корреляции указанных профилей,
где степень корреляции является показателем наличия или отсутствия указанного заболевания или состояния, или риска развития указанного заболевания или состояния, или прогресса заболевания или состояния.

28. Способ по любому из пп. 25-27, где указанное заболевание или состояние выбраны из воспалительного заболевания кишечника, болезни Крона, язвенного колита, синдрома раздраженного кишечника, злокачественных опухолей ЖКТ, предпочтительно злокачественной опухоли ротовой полости, глотки, пищевода, желудка, двенадцатиперстной кишки, тонкого кишечника, подвздошной кишки, слепой кишки, толстого кишечника, прямой кишки или анального канала, аллергических заболеваний, например экземы, астмы, атопического дерматита, аллергического конъюнктивита, аллергического ринита и пищевых аллергий; нарушений обмена веществ, например сахарного диабета (типа 1 и типа 2), ожирения и метаболического синдромома; нейрологических нарушений, например депрессии, рассеянного склероза, деменции и болезни Альцгеймера; и аутизма.

29. Набор для профилирования микробиоты желудочно-кишечного тракта (ЖКТ), где набор включает набор олигонуклеотидных зондов по пп. 1-10 и, по меньшей мере, одно из следующего:
(a) средства для селективного мечения одного или нескольких олигонуклеотидов из набора зондов,
(b) твердые подложки, на которых можно иммобилизовать один или несколько олигонуклеотидов из набора зондов,
(c) средства для проведения амплификации и/или реакции удлинения праймера для одного или нескольких олигонуклеотидов из набора зондов,
(d) средства для проведения реакции обратной транскрипции,
(e) средства для получения образца из ЖКТ,
(f) средства для очистки или модификации образца из ЖКТ,
(g) средства для выделения нуклеиновой кислоты из образца из ЖКТ,
(h) средства для обнаружения амплифицированной нуклеиновой кислоты,
(i) один или несколько олигонуклеотидов, которые селективно гибридизуются с нуклеиновыми кислотами-мишенями, которые служат индикаторами любого другого заболевания или медицинского состояния, ассоциированного с желудочно-кишечной микробиотой, предпочтительно болезни Крона, воспалительного заболевания кишечника, язвенного колита и синдрома раздраженного кишечника.



 

Похожие патенты:

Изобретение относится к области медицины, в частности к онкологии, и молекулярной биологии. Предложен способ диагностики папиллярной почечноклеточной карциномы (ППК), включающий стадии получения исходной пары образцов ткани от пациента, выделение и очистку препаратов РНК, синтез кДНК на матрице РНК с использованием олигонуклеотидных праймеров, проведение количественной реакции амплификации фрагмента гена CALL и сравнение количества амплифицированного фрагмента CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани.
Изобретение относится к области медицины и предназначено для оценки риска прогрессирования хронической болезни почек (ХБП) у детей. У ребенка с подозрением на ХБП забирают кровь из периферической вены и с помощью метода аллель-специфичной полимеразной цепной реакции проводят идентификацию однонуклеотидных полиморфизмов генов ангиотензин-превращающего фермента (АСЕ) Alu Ins/Del I>D, ангиотензина (AGT) Thr174Met и Met235Thr, рецепторов 1 типа ангиотензина 2 (R1AGT) С1166С и эндотелина-1 (ЕТ-1) Lys198Asn.

Группа изобретений относится к области биотехнологии. Способы определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки в нуклеиновой кислоте включают: выделение нуклеиновой кислоты из одного образца или порций; приведение нуклеиновой кислоты в контакт с прямым праймером, способным связываться с нуклеиновой кислотой выше сайта вставки; первым обратным праймером, специфичным для вставленной нуклеотидной последовательности, и вторым обратным праймером, способным связываться с нуклеиновой кислотой ниже сайта вставки.

Изобретение относится к молекулярной биологии. Способ включает: экстракцию препаратов суммарной РНК, получение комплементарной ДНК с помощью реакции обратной транскрипции на РНК-матрице и последующую амплификацию в режиме реального времени с использованием высокоспецифичных праймеров для генов PTEN, CYP1B1 и АСТВ (референтный локус), а также расчет коэффициента относительной экспрессии генов PTEN и CYP1B1 (КPTEN и КCYP1B1) методом RT-PCR.

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантных молекул МНС II класса, и может быть использовано в медицине. Рекомбинантная молекула МНС II класса включает: (i) весь или часть внеклеточного участка α-цепи МНС II класса; (ii) весь или часть внеклеточного участка β-цепи МНС II класса; при этом (i) и (ii) обеспечивают функциональный пептид-связующий домен и при этом (i) и (ii) соединены дисульфидной связью между остатками цистеина, расположенными на α2 домене указанной α-цепи и β2 домене указанной β-цепи, при этом указанные остатки цистеина не присутствуют в нативных доменах α2 и β2 МНС II класса и полученная рекомбинантная молекула не включает мотив лейциновой молнии.

Изобретение относится к области биохимии, в частности к агенту для придания растению устойчивости к ингибитору 4-HPPD, включающему ДНК, кодирующую белок, обладающий активностью, придающей растению устойчивость к ингибитору 4-HPPD.

Изобретение относится к биохимии. Описан способ получения гетерогенного набора одноцепочечных фрагментов ДНК для мультиплексного генетического анализа.

Настоящее изобретение относится к области биоинформатики. Предложен способ для приготовления улучшенной вычислительной системы, основанной на нуклеиновых кислотах, включающий синтезирование в водном растворе варианта системы молекулярных вычислений, отличающегося включением химической модификации, изменяющей энергию гибридизации молекул нуклеиновых кислот в системе.

Изобретение относится к области генной инженерии, конкретно к скринингу веществ, оказывающих регулирующее вес действие, и может быть использовано в медицине. Способ скрининга веществ, оказывающих регулирующее вес действие, включает приведение тестируемого вещества в контакт с клетками, экспрессирующими ген синовиолина, и идентификацию того, имеет или нет указанное тестируемое вещество ингибирующее влияние на экспрессию гена синовиолина.

Настоящее изобретение относится к биохимии, в частности к способу определения и секвенирования неизвестных последовательностей ДНК, которые фланкируют известные последовательности в выделенной ДНК.

Изобретение относится к области биотехнологии и может быть использовано для получения вариантов плазминогена и плазмина. Получают вариант плазминогена, содержащий сайт активации и каталитический домен, в котором каталитический домен содержит замену валина на изолейцин в положении 1 каталитического домена плазмина человека или в положении, соответствующем таковому в каталитическом домене плазмина, отличном от плазмина человека, где указанный каталитический домен плазмина человека начинается с аминокислоты валин в положении 1, которая является той же аминокислотой валин, которая находится в положении 562 Glu-плазминогена человека с SEQ ID NO: 1.

Изобретение относится к области биотехнологии и может быть использовано для получения вариантов плазминогена и плазмина. Получают вариант плазминогена, содержащий в своем каталитическом домене замену глутаминовой кислоты на глутамин в положении 138 каталитического домена плазмина человека или в положении, соответствующем таковому в каталитическом домене плазмина, отличного от плазмина человека, где указанный каталитический домен плазмина человека начинается с аминокислоты валин в положении 1, которая является такой же аминокислотой валин, что встречается в положении 562 Glu-плазминогена человека с SEQ ID NO: 1.

Изобретение относится к области биохимии. Предложен антисмысловой олигонуклеотид, содержащий по меньшей мере одну модифицированную межнуклеотидную связь, который гибридизуется с природным антисмысловым полинуклеотидом аполипопротеина A1 (ApoA1) и повышает экспрессию молекул ApoA1 по сравнению с нормальным контролем.

Изобретение относится к области биохимии, в частности к ДНК конструкту для экспрессии генов в эукариотических клетках, где конструкт представляет линейную с открытой цепью двухцепочечную ДНК, содержащую промоторную последовательность, кодирующую последовательность и сигнал терминации, где конструкт содержит по меньшей мере один L-ДНК нуклеотид и где по меньшей мере один L-ДНК нуклеотид расположен в последних 2-5 нуклеотидах 5′- и/или 3′-конца, а также к фармацевтической композиции его содержащей.

Настоящее изобретение относится к области иммунологии. Предложен выделенный пептид, обладающий способностью индуцировать цитотоксические Т-лимфоциты (CTL) против белка NEIL3 в присутствии антигенпредставляющей клетки (АРС), несущей HLA-A*0201 и/или HLA-A*0206.

Изобретения относятся к области генетики, молекулярной биологии и медицины и касаются способа для анализа генетического полиморфизма в локусах ДНК ApoE, ApoJ и GAB2 и набора олигонуклеотидных праймеров и зондов.

Данное изобретение относится к области биотехнологии и медицины. Предложено применение гантелеподобной линейной, ковалентно замкнутой экспрессионной конструкции ДНК с двухцепочечной основой и одноцепочечными петлями, расположенными на обоих концах основы, где основа комплементарных дезоксирибонуклеиновых кислот кольцевой цепочки ДНК включает промоторную последовательность, кодирующую последовательность и сигнал терминации, где конструкция ДНК кодирует TNF-α, для лечения меланомы, причем указанная конструкция ДНК вводится путем безыгольной инъекции и указанная конструкция вводится одновременно или последовательно с виндесином.

Настоящее изобретение относится к биотехнологии. Предложены соединение, способное ингибировать экспрессию рецептора глюкагона (GCGR), состоящее из 12-30 соединенных нуклеозидов, композиция, снижающая экспрессию GCGR, способы лечения метаболического заболевания, снижения или задержки начала повышения уровней глюкозы в крови, профилактики заболевания, ассоциированного с GCGR, применение предложенного соединения для приготовления лекарственного средства.

Изобретение относится к области биотехнологии, конкретно к способу повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA), и может быть использовано в медицине.

Изобретение относится к биохимии. Описана пара изолированных молекул нуклеиновой кислоты, предназначенная для определения вируса гепатита A (HAV) и состоящая из нуклеотидных последовательностей или ее комплементов, как представлено в: 5′-GCGCCCGGCGGGGTCAACTCCAT-3′ (SEQ ID NO: 1); и 5′-AGCCAAGTTAACACTGCAAGG-3′ (SEQ ID NO: 2.
Наверх