Олигонуклеотидные праймеры и флюоресцентный зонд с внутренним гасителем, комплементарные участку гена р30 (cp204l) вируса африканской чумы свиней, для использования в полимеразной цепной реакции в режиме реального времени

Изобретение относится к области биотехнологии, а именно к синтетическим олигонуклеотидным зондам и праймерам для выявления ДНК вируса африканской чумы свиней. Предложенные синтетические олигонуклеотидные праймеры и флуоресцентно меченый зонд с внутренним гасителем комплементарны консервативной области гена Р30 (CP204L) вируса африканской чумы свиней и имеют следующий нуклеотидный состав:

F1 р30 5'-GTTACGACCGCTATAAAAACA-3' R1 р30 5'-TTCCATTCTTCTTGAGACCTG-3' Z1 (int) p30 5'-(FAM)TACTGTT(RTQ1)AAGTATGATATTGTGA(BHQ1)-3'

Предложенное изобретение может быть использовано в генодиагностике инфекционных болезней свиней и ветеринарной вирусологии. 4 табл., 2 пр.

 

Изобретение относится к области биотехнологии, а именно к синтетическим олигонуклеотидным зондам и праймерам, комплементарным консервативной области гена P30 (CP204L) вируса африканской чумы свиней, для выявления ДНК вируса африканской чумы свиней. Предложенное изобретение может быть использовано в генодиагностике инфекционных болезней свиней и ветеринарной вирусологии. Способ выявления вируса АЧС основан на постановке полимеразной цепной реакции (ПЦР) в режиме реального времени с использованием олигонуклеотидных праймеров и флюоресцентного зонда с внутренним гасителем, комплементарных участку гена P30 (CP204L) вируса АЧС. Разработанный зонд и олигонуклеотидные праймеры позволяют повысить чувствительность и специфичность ПЦР для выявления ДНК вируса АЧС по сравнению с системой, основанной на выявлении гена р72 (B646L) вируса АЧС. Изобретение относится к ветеринарной вирусологии, а именно к средствам диагностики.

Африканская чума свиней - контагиозная вирусная болезнь, характеризующаяся лихорадкой, цианозом кожных покровов, тяжелыми дистрофическими и некротическими поражениями клеток ретикулоэндотелиальной системы. Восприимчивы домашние и дикие свиньи независимо от породы и возраста. Различают сверхострое, острое, хроническое и бессимптомное течение болезни [1, 2].

Заболеванию подвержены свиньи всех возрастных групп. Естественным резервуаром вируса являются дикие свиньи Африканского континента [3].

Предварительный диагноз устанавливают комплексно на основании эпизоотологического обследования, клинических признаков, патоморфологических изменений. Окончательный диагноз на АЧС устанавливают с учетом лабораторных исследований, включающих в себя полимеразную цепную реакцию [4], реакцию прямой иммунофлюоресценции [5], реакцию гемадсорбции [6] и биопробу на восприимчивых животных [7].

Существуют функциональные аналоги предложенного изобретения, основанные на «классическом» TaqMan зонде и паре праймеров на ген р72 (B646L) для выявления генома вируса АЧС. Однако флюоресцентных зондов с внутренним гасителем и праймеров на ген P30 (CP204L) для выявления вируса АЧС в России не зарегистрировано. Ране сотрудниками ГНУ ВНИИВВиМ Россельхозакадемии был получен патент на тест-систему для выявления ДНК вируса АЧС методом ПЦР с электрофоретической детекцией. Как известно, технология ПЦР в режиме реального времени, для проведения которой и предназначены олигонуклеотидный зонд и праймеры, комплементарные консервативной области гена P30 (CP204L) вируса АЧС, позволяет значительно увеличить чувствительность и специфичность теста. На российском рынке представлены несколько диагностикумов АЧС методом ПЦР в режиме реального времени, в состав которых входят синтетические олигонуклеотидные праймеры и зонды, которые могут служить прототипами данного изобретения. Примерами таких диагностикумов могут служить тест-система «АЧС» для выявления вируса африканской чумы свиней методом полимеразной цепной реакции (ФБУН ЦЦНИИ Эпидемиологии Роспотребнадзора, г. Москва), тест-система для выявления вируса африканской чумы свиней методом полимеразной цепной реакции (АНО «НИИ ДПБ», г. Москва, тест-система для выявления ДНК вируса АЧС методом ПЦР в реальном времени (ГНУ Всероссийский НИИ Ветеринарной Вирусологии и Микробиологии Россельхозакадемии, п. Вольгинский). В данных тест-системах используются классические зонды (краситель и гаситель на 5' и 3' концах), что может приводить к образованию ложноположительных результатов за счет высокого уровня фоновой флюоресценции. Предложенные олигонуклеотидный зонд с внутренним гасителем флюоресценции и олигонуклеотидные праймеры, комплементарные участку гена P30 (CP204L) вируса АЧС, позволяют выявлять геном вируса АЧС с более высокой чувствительностью, чем запатентованные и представленные на рынке тест-системы и наборы.

Целью изобретения является дизайн олигонуклеотидного зонда с внутренним гасителем и двух олигонуклеотидных праймеров, комплементарных консервативной области гена p30 (CP204L) вируса АЧС, для выявления генома вируса АЧС методом ПЦР в режиме реального времени.

Для достижения поставленной цели были подобраны и синтезированы специфические олигонуклеотидные праймеры и зонд, которые используются в ПЦР для идентификации вируса АЧС (Таблица 1).

Способ обнаружения ДНК вируса АЧС в пробах органов, образцах крови инфицированных свиней методом ПЦР в режиме реального времени с использованием предложенных олигонуклеотидного зонда с внутренним гасителем и двух олигонуклеотидных праймеров, комплементарных к консервативной области гена p30 (CP204L) вируса АЧС, включает предварительный этап денатурации ДНК при 94°C в течение 2 мин. ПЦР включает 35 циклов амплификации: 94°C - 30 с, 56°C - 30 с, 68°C - 30 с. Затем проводят оценку и учет результатов реакции.

Техническим результатом изобретения является общедоступность, безопасность, высокая диагностическая чувствительность (100% по сравнению с применением олигонуклеотидных праймеров и зонда на ген Р72), а также сокращение времени проведения диагностической работы (на 5-10 минут) с целью выявления генома вируса африканской чумы свиней.

Сущность изобретения заключается в том, что выявление генома вируса АЧС проводят методом полимеразной цепной реакции в режиме реального времени, с использованием олигонуклеотидного зонда с внутренним гасителем флюоресценции. Применение зонда с внутренним гасителем позволяет увеличить эффективность накопления флуоресценции в ходе ПЦР в реальном времени.

Существенным отличием заявляемого способа является то, что применение зонда с двумя гасителями позволяет значительно снизить фоновую флуоресценцию и повысить четкость флуоресцентного сигнала при учете результатов ПЦР в режиме реального времени.

Пример 1. Постановка ПЦР в режиме реального времени с использованием олигонуклеотидного зонда с внутренним гасителем и двух олигонуклеотидных праймеров, комплементарных консервативной области гена p30 (CP204L) вируса АЧС.

Состав реакционной смеси для постановки ПЦР в режиме реального времени представлен в таблице 2. В отдельной пробирке готовят общую реакционную смесь на N образцов, в число которых входят положительный контроль (с водным раствором ДНК вируса АЧС) и отрицательный контроль (с бидистиллированной водой). Реактивы вносят в последовательности, приведенной в таблице 2. Фермент добавляют в последнюю очередь. В пробирке объемом 0,2 мл вносят общую реакционную смесь в объеме 20 мкл.

В реакции используют 5 мкл ДНК, полученной при выделении.

ПЦР проводят в амплификаторах ДТ-96 (ДНК-Технология, Россия), Rotor-Gene Q (QIAGEN, Германия) и других приборах с флуоресцентной детекцией по каналу FAM/Green. При следующих режимах (Таблица 3):

Пример 2. Определение специфичности и чувствительности метода выявления генома вируса АЧС с использованием олигонуклеотидного зонда с внутренним гасителем и двух олигонуклеотидных праймеров, комплементарных консервативной области гена p30 (CP204L) вируса АЧС.

Синтетические олигонуклеотидные зонды были проверены на специфичность и чувствительность. Установлено, что в ПЦР с использованием разработанных праймеров и зондов не амплифицируется ДНК других бактерий и вирусов, что показывает диагностическую специфичность и чувствительность 100%.

Диагностическая чувствительность. Была подтверждена на панели 20 (14 положительных и 6 отрицательных) проб патологического материала (легкое, селезенка, лимфоузлы), полученных от павших от АЧС (Таблица 4).

Диагностическая специфичность. В результате исследований было показано, что отсутствуют неспецифические реакции при тестировании образцов геномной ДНК свиньи и следующих микроорганизмов: вирус классической чумы свиней (штаммы Ши-Мынь, ЛК-ВНИИВВиМ, ЛК-К), вирус болезни Ауески (интактный), цирковирус свиней-1 и цирковирус свиней 2.

Выделение нуклеиновых кислот. ДНК выделяют из вируссодержащего материала с использованием коммерческих наборов.

Постановка ПЦР в режиме реального времени. На N количество образцов готовят реакционную смесь согласно таблице 2. Амплификация и детекция флюоресценции производятся согласно температурным режимам, указанным в таблице 3.

Учет результатов амплификации. Результаты интерпретируются на основании наличия (или отсутствия) пересечения кривой флуоресценции с установленной на соответствующем уровне (0.05) пороговой линии - значение Ct.

Образец считается положительным на наличие генома вируса АЧС при значении Ct<33. Образцы, не пересекающие пороговую линию, и образцы со значением Ct>33 считаются отрицательными.

Источники информации

1. Бакулов, И.А. Проблемы современной эволюции африканской чумы свиней / И.А. Бакулов, В.В. Макаров // Вестник сельскохозяйственных наук. - 1990. - №12. - С. 122-128.

2. Бакулов, И.А. Эпизоотология: африканская чума свиней / И.А. Бакулов. - Москва: Колос, 1969. - С. 267-290.

3. Козлова, Д.И. Современные проблемы африканской чумы свиней / Д.И. Козлова, В.А. Бесхлебнов. - М.: ВНИИТЭИСХ, 1980. - 60 с.

4. A highly sensitive and specific gel-based multiplex RT-PCR assay for the simultaneous and differential diagnosis of African swine fever and Classical swine fever in clinical samples / M. Aguero, J. Fernandez, L.J. Romero, M.J. Zamora, C. Sanchez, S. Belak, M. Arias, J.M. Sanchez-Vizcaino // Vet Res. - 2004. - Vol. 35. - P. 551-563.

5. Heuschele, W.P. Fluorescent antibody studies on African swine fever virus / W.P. Heuschele, L. Coggins, S.S. Stone // Amer. J. vet. Res. - 1966. - №27. - 477-484.

6. Malmquist, W.A. Hemadsorption and cytopathic effect produced by African swine fever virus in swine bone marrow and buffy coat cultures/ W.A. Malmquist, D. Hay // Am J Vet Res. - 1960. - №21. - P. 104-108.

7. Sanchez - Botija, C. African swine fever / C. Sanchez- Botija, A. Ordas // Seminar in the EEC Programme. Madrid, 1976. - P. 658-668.

Синтетические олигонуклеотидные праймеры и флуоресцентно меченый зонд с внутренним гасителем, комплементарные консервативной области гена Р30 (CP204L) вируса африканской чумы свиней и имеющие следующий нуклеотидный состав:

F1 р30 5'-GTTACGACCGCTATAAAAACA-3'
R1 р30 5'-TTCCATTCTTCTTGAGACCTG-3'
Z1 (int) p30 5'-(FAM)TACTGTT(RTQ1)AAGTATGATATTGTGA(BHQ1)-3'



 

Похожие патенты:

Группа изобретений относится к области биотехнологии и представлена набором олигонуклеотидных зондов для профилирования микробиоты желудочно-кишечного тракта (ЖКТ), где указанный набор включает в частности (a) олигонуклеотид, состоящий из (ai) нуклеотидной последовательности, выбранной из ACGCTTGCACCCT (SEQ ID NO: 1) необязательно с не более тремя замещенными основаниями или AGGGTGCAAGCGT (SEQ ID NO: 27) необязательно с не более тремя замещенными основаниями, и (aii) 0-5 нуклеотидов в дополнение к (ai), где олигонуклеотид согласно (а) способен гибридизоваться с SEQ ID NO: 27 или SEQ ID NO: 1, соответственно, в строгих условиях гибридизации.

Изобретение относится к области медицины, в частности к онкологии, и молекулярной биологии. Предложен способ диагностики папиллярной почечноклеточной карциномы (ППК), включающий стадии получения исходной пары образцов ткани от пациента, выделение и очистку препаратов РНК, синтез кДНК на матрице РНК с использованием олигонуклеотидных праймеров, проведение количественной реакции амплификации фрагмента гена CALL и сравнение количества амплифицированного фрагмента CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани.
Изобретение относится к области медицины и предназначено для оценки риска прогрессирования хронической болезни почек (ХБП) у детей. У ребенка с подозрением на ХБП забирают кровь из периферической вены и с помощью метода аллель-специфичной полимеразной цепной реакции проводят идентификацию однонуклеотидных полиморфизмов генов ангиотензин-превращающего фермента (АСЕ) Alu Ins/Del I>D, ангиотензина (AGT) Thr174Met и Met235Thr, рецепторов 1 типа ангиотензина 2 (R1AGT) С1166С и эндотелина-1 (ЕТ-1) Lys198Asn.

Группа изобретений относится к области биотехнологии. Способы определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки в нуклеиновой кислоте включают: выделение нуклеиновой кислоты из одного образца или порций; приведение нуклеиновой кислоты в контакт с прямым праймером, способным связываться с нуклеиновой кислотой выше сайта вставки; первым обратным праймером, специфичным для вставленной нуклеотидной последовательности, и вторым обратным праймером, способным связываться с нуклеиновой кислотой ниже сайта вставки.

Изобретение относится к молекулярной биологии. Способ включает: экстракцию препаратов суммарной РНК, получение комплементарной ДНК с помощью реакции обратной транскрипции на РНК-матрице и последующую амплификацию в режиме реального времени с использованием высокоспецифичных праймеров для генов PTEN, CYP1B1 и АСТВ (референтный локус), а также расчет коэффициента относительной экспрессии генов PTEN и CYP1B1 (КPTEN и КCYP1B1) методом RT-PCR.

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантных молекул МНС II класса, и может быть использовано в медицине. Рекомбинантная молекула МНС II класса включает: (i) весь или часть внеклеточного участка α-цепи МНС II класса; (ii) весь или часть внеклеточного участка β-цепи МНС II класса; при этом (i) и (ii) обеспечивают функциональный пептид-связующий домен и при этом (i) и (ii) соединены дисульфидной связью между остатками цистеина, расположенными на α2 домене указанной α-цепи и β2 домене указанной β-цепи, при этом указанные остатки цистеина не присутствуют в нативных доменах α2 и β2 МНС II класса и полученная рекомбинантная молекула не включает мотив лейциновой молнии.

Изобретение относится к области биохимии, в частности к агенту для придания растению устойчивости к ингибитору 4-HPPD, включающему ДНК, кодирующую белок, обладающий активностью, придающей растению устойчивость к ингибитору 4-HPPD.

Изобретение относится к биохимии. Описан способ получения гетерогенного набора одноцепочечных фрагментов ДНК для мультиплексного генетического анализа.

Настоящее изобретение относится к области биоинформатики. Предложен способ для приготовления улучшенной вычислительной системы, основанной на нуклеиновых кислотах, включающий синтезирование в водном растворе варианта системы молекулярных вычислений, отличающегося включением химической модификации, изменяющей энергию гибридизации молекул нуклеиновых кислот в системе.

Изобретение относится к области генной инженерии, конкретно к скринингу веществ, оказывающих регулирующее вес действие, и может быть использовано в медицине. Способ скрининга веществ, оказывающих регулирующее вес действие, включает приведение тестируемого вещества в контакт с клетками, экспрессирующими ген синовиолина, и идентификацию того, имеет или нет указанное тестируемое вещество ингибирующее влияние на экспрессию гена синовиолина.

Группа изобретений относится к области биотехнологии и представлена набором олигонуклеотидных зондов для профилирования микробиоты желудочно-кишечного тракта (ЖКТ), где указанный набор включает в частности (a) олигонуклеотид, состоящий из (ai) нуклеотидной последовательности, выбранной из ACGCTTGCACCCT (SEQ ID NO: 1) необязательно с не более тремя замещенными основаниями или AGGGTGCAAGCGT (SEQ ID NO: 27) необязательно с не более тремя замещенными основаниями, и (aii) 0-5 нуклеотидов в дополнение к (ai), где олигонуклеотид согласно (а) способен гибридизоваться с SEQ ID NO: 27 или SEQ ID NO: 1, соответственно, в строгих условиях гибридизации.

Изобретение относится к области биотехнологии и может быть использовано для получения вариантов плазминогена и плазмина. Получают вариант плазминогена, содержащий сайт активации и каталитический домен, в котором каталитический домен содержит замену валина на изолейцин в положении 1 каталитического домена плазмина человека или в положении, соответствующем таковому в каталитическом домене плазмина, отличном от плазмина человека, где указанный каталитический домен плазмина человека начинается с аминокислоты валин в положении 1, которая является той же аминокислотой валин, которая находится в положении 562 Glu-плазминогена человека с SEQ ID NO: 1.

Изобретение относится к области биотехнологии и может быть использовано для получения вариантов плазминогена и плазмина. Получают вариант плазминогена, содержащий в своем каталитическом домене замену глутаминовой кислоты на глутамин в положении 138 каталитического домена плазмина человека или в положении, соответствующем таковому в каталитическом домене плазмина, отличного от плазмина человека, где указанный каталитический домен плазмина человека начинается с аминокислоты валин в положении 1, которая является такой же аминокислотой валин, что встречается в положении 562 Glu-плазминогена человека с SEQ ID NO: 1.

Изобретение относится к области биохимии. Предложен антисмысловой олигонуклеотид, содержащий по меньшей мере одну модифицированную межнуклеотидную связь, который гибридизуется с природным антисмысловым полинуклеотидом аполипопротеина A1 (ApoA1) и повышает экспрессию молекул ApoA1 по сравнению с нормальным контролем.

Изобретение относится к области биохимии, в частности к ДНК конструкту для экспрессии генов в эукариотических клетках, где конструкт представляет линейную с открытой цепью двухцепочечную ДНК, содержащую промоторную последовательность, кодирующую последовательность и сигнал терминации, где конструкт содержит по меньшей мере один L-ДНК нуклеотид и где по меньшей мере один L-ДНК нуклеотид расположен в последних 2-5 нуклеотидах 5′- и/или 3′-конца, а также к фармацевтической композиции его содержащей.

Настоящее изобретение относится к области иммунологии. Предложен выделенный пептид, обладающий способностью индуцировать цитотоксические Т-лимфоциты (CTL) против белка NEIL3 в присутствии антигенпредставляющей клетки (АРС), несущей HLA-A*0201 и/или HLA-A*0206.

Изобретения относятся к области генетики, молекулярной биологии и медицины и касаются способа для анализа генетического полиморфизма в локусах ДНК ApoE, ApoJ и GAB2 и набора олигонуклеотидных праймеров и зондов.

Данное изобретение относится к области биотехнологии и медицины. Предложено применение гантелеподобной линейной, ковалентно замкнутой экспрессионной конструкции ДНК с двухцепочечной основой и одноцепочечными петлями, расположенными на обоих концах основы, где основа комплементарных дезоксирибонуклеиновых кислот кольцевой цепочки ДНК включает промоторную последовательность, кодирующую последовательность и сигнал терминации, где конструкция ДНК кодирует TNF-α, для лечения меланомы, причем указанная конструкция ДНК вводится путем безыгольной инъекции и указанная конструкция вводится одновременно или последовательно с виндесином.

Настоящее изобретение относится к биотехнологии. Предложены соединение, способное ингибировать экспрессию рецептора глюкагона (GCGR), состоящее из 12-30 соединенных нуклеозидов, композиция, снижающая экспрессию GCGR, способы лечения метаболического заболевания, снижения или задержки начала повышения уровней глюкозы в крови, профилактики заболевания, ассоциированного с GCGR, применение предложенного соединения для приготовления лекарственного средства.

Изобретение относится к области биотехнологии, конкретно к способу повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA), и может быть использовано в медицине.

Изобретения относятся к ветеринарной вирусологии и биотехнологии, а именно к генетической инженерии. Предложены синтетические олигонуклеотидные праймеры для выявления РНК атипичного пестивируса крупного рогатого скота и способ их применения. Предсавленные синтетические олигонуклеотидные праймеры имеют нуклеотидные последовательности: SEQ ID NO: 1 - 5' tttgcagccgagcgtag 3', SEQ ID NO: 2 - 5' cctcctgcatactgtcacctt 3'. Предложенный способ включает выделение РНК из образцов эмбриональных сывороток и биоматериала, проведение обратной транскрипции и ПЦР с синтетическими олигонуклеотидными праймерами, перенос продукта амплификации на гель и оценку проведения реакции. ПЦР проводят в 1 раунд. В случае положительной реакции синтезируется фрагмент, соответствующий размеру 320 п.н. Изобретения могут быть использованы в ветеринарии для выявления возможных контаминаций эмбриональных сывороток, используемых для культивирования культур клеток и производства биопрепаратов, атипичным пестивирусом крупного рогатого скота, а также для диагностики инфекционных заболеваний сельскохозяйственных животных, в частности инфекции, вызванной атипичным пестивирусом крупного рогатого скота. 2 н.п. ф-лы, 1 ил., 3 табл., 4 пр.

Изобретение относится к области биотехнологии, а именно к синтетическим олигонуклеотидным зондам и праймерам для выявления ДНК вируса африканской чумы свиней. Предложенные синтетические олигонуклеотидные праймеры и флуоресцентно меченый зонд с внутренним гасителем комплементарны консервативной области гена Р30 вируса африканской чумы свиней и имеют следующий нуклеотидный состав: F1 р30 5-GTTACGACCGCTATAAAAACA-3 R1 р30 5-TTCCATTCTTCTTGAGACCTG-3 Z1 p30 5-TACTGTTAAGTATGATATTGTGA-3 Предложенное изобретение может быть использовано в генодиагностике инфекционных болезней свиней и ветеринарной вирусологии. 4 табл., 2 пр.

Наверх