Агент, повышающий экспрессию редокс-факторов



Агент, повышающий экспрессию редокс-факторов
Агент, повышающий экспрессию редокс-факторов
Агент, повышающий экспрессию редокс-факторов
Агент, повышающий экспрессию редокс-факторов
Агент, повышающий экспрессию редокс-факторов
Агент, повышающий экспрессию редокс-факторов
Агент, повышающий экспрессию редокс-факторов
Агент, повышающий экспрессию редокс-факторов
Агент, повышающий экспрессию редокс-факторов
Агент, повышающий экспрессию редокс-факторов
Агент, повышающий экспрессию редокс-факторов

 


Владельцы патента RU 2606856:

ТЕ ДЖЕНЕРАЛ ХОСПИТАЛ КОРПОРЕЙШН (US)
СИСЕЙДО КОМПАНИ, ЛТД. (JP)

Настоящее изобретение осуществляет поддержание существования гомеостаза организмов и касается: агента для снижения экспрессии IL-1β в коже объекта и для повышения экспрессии редокс-ассоциированного фактора в человеческой эпидермальной клетке. Агент может включать кемферол, где редокс-фактор выбирают из группы, состоящей из одного или нескольких из числа тиоредоксина, тиоредоксинредуктазы, глутатионредуктазы и глутаредоксина. Агент может включать экстракт листьев гинкго, полученный растворением 50% этанольного экстракта листьев Ginkgo biloba L. в 1,3-бутиленгликоле, где редокс-ассоциированным фактором является тиоредоксин и/или тиоредоксинредуктаза. Агент может включать экстракт галанги Kaempferia galanga, полученный экстракцией 50% 1,3-бутиленгликолем, где редокс-ассоциированный фактор выбирают из группы, состоящей из одного или нескольких из числа тиоредоксина, тиоредоксинредуктазы, глутатионредуктазы и глутаредоксина. 3 н. и 13 з.п. ф-лы, 6 пр., 6 ил.

 

Область техники, к которой относится изобретение

Данное изобретение относится к агенту, повышающему экспрессию редокс-фактора (фактора окислительно-восстановительного потенциала), который в качестве активного ингредиента содержит кемпферол, кверцетин, их гликозиды или любые их комбинации, и к агенту, повышающему экспрессию редокс-фактора, который в качестве активного ингредиента содержит экстракт из листьев гинкго, экстракт галанги (Kaempferia galanga) или любые их комбинации.

Предпосылки создания изобретения

В организмах регуляции посредством окислительно-восстановительных реакций (редокс-регуляции) осуществляются для поддержания существования и гомеостаза организмов. В основном, такие редокс-регуляции основаны на обратимых окислительно-восстановительных реакциях в тиольной группе цистеинового остатка во внутриклеточных белках, которые могут регулировать различные клеточные функции. Известно, что фактор, связанный с редокс-регуляциями (т.е. редокс-фактор), поддерживает восстановительное состояние среды внутри клетки и, следовательно, редокс-фактор может играть важную роль в жизнедеятельности клетки и значимую роль в удалении активных форм кислорода. Если же такой редокс-фактор не функционирует должным образом, то в избыточном количестве продуцируются эндогенные активные формы кислорода и, следовательно, клетки могут подвергаться воздействию избыточного оксидативного стресса. Такой избыточный оксидативный стресс может окислять биологические макромолекулы, такие как ДНК, белки и жиры, и разрушать их, тем самым вызывая различные заболевания и старение. Таким образом, недавно были изучены редокс-факторы, которые могут обладать эффектом удаления активных форм кислорода, вызывающих оксидативный стресс.

В качестве редокс-фактора, который обладает эффектом предохранения организма от оксидативного стресса, известно суперсемейство глутатионов. Глутатион является трипептидом млекопитающих и, как сообщалось, оказывает восстановительное действие, обусловленное наличием в нем внутримолекулярных тиольных групп, обладает присущей коэнзимам функцией, функцией синтезирования меркаптуровой кислоты и другими механизмами детоксикации, защитным действием на тиольные ферменты и другие клеточные компоненты, функцией, способствующей удалению вредных материалов, антиаллергическим действием, обусловленным усиленной активностью холинэстеразы, активирующим ферменты действием и подобными функциями. Однако, поскольку в составе глутатион формирует кристаллический преципитат, клетки не могут прямо абсорбировать молекулу глутатиона. Таким образом, очень полезным может быть ингредиент, усиливающий внутриклеточную абсорбцию глутатиона. В качестве такого ингредиента известен γ-токоферол или δ-токоферол и описаны усиливающие продукцию глутатиона агенты, которые содержат такой ингредиент (Японская нерассмотренная патентная публикация (Kokai) №2007-284430 (Патентная публикация 1)).

В дополнение, в качестве другого редокс-фактора известно суперсемейство тиоредоксинов, которое также обладает эффектом предохранения организма от оксидативного стресса (Saibou Kougaku, vol.25. No.2, 2006, p.143-148 (Непатентная публикация 1)). Сообщалось, что тиоредоксин-трансгенные мыши имеют более длинную продолжительность жизни (Mitsui A, et al.: Antioxid Redox Signal (2002) 4: 693-696 (Непатентная публикация 2)), что тиоредоксин обеспечивает устойчивость против церебрального инфаркта, диабета или подобных (Takagi Y, et al.: Proc Nati Acad Sci USA (1999) 96: 4131-4136 (Непатентная публикация 3), Hotta M, et al.: J Exp Med (1998) 188:1445-1451 (Непатентная публикация 4)) и что тиоредоксин эффективен для аллергического дерматита (Японская нерассмотренная патентная публикация (Kokai) №2007-269671 (Патентная публикация 2)). В дополнение, тиоредоксин широко используется в качестве агента, удаляющего активный кислород (Японская нерассмотренная патентная публикация (Kokai) №9-157153 (Патентная публикация 3)). Однако, поскольку суперсемейство тиоредоксинов является макромолекулярным белком, даже если такое соединение непосредственно вводится субъекту, оно не может поглощаться клетками. Вследствие чего, желательным является повысить экспрессию суперсемейства тиоредоксинов in vivo. Однако в качестве ингредиента, который может усиливать экспрессию семейства, известен только экстракт из полыни (Artemisia) или экстракт из green perilla (Международная публикация WO 2006/033351 (Патентная публикация 4)).

Как указано выше, даже если редокс-фактор, т.е. соединение, принадлежащее суперсемейству глутатионов или суперсемейству тиоредоксинов, непосредственно вводить субъекту, оно не может эффективно абсорбироваться клетками и, следовательно, редокс-регуляционная или антиоксидативная функция не может быть достигнута у субъекта. При этом известно, что стресс, такой как УФ-излучение, повышает экспрессию редокс-фактора, также известно несколько химических веществ, действующих безопасно и эффективно на организм, при этом механизм экспрессии редокс-фактора in vivo недостаточно изучен. Таким образом, существует необходимость в обнаружении безопасного и эффективного ингредиента для усиления экспрессии редокс-фактора in vivo.

Список ссылок

СПИСОК ПАТЕНТНЫХ ПУБЛИКАЦИЙ

Патентная публикация 1: JP 2007-284430

Патентная публикация 2: JP 2007-269671

Патентная публикация 3: JP 9-157153

Патентная публикация 4: Международная публикация №2006/033351

СПИСОК НЕПАТЕНТНЫХ ПУБЛИКАЦИЙ

Непатентная публикация 1: Saibou Kougaku, vol.25, No.2, 2006, pl43-148

Непатентная публикация 2: Mitsui A, et aL: Antioxid Redox Signal (2002) 4: 693-696

Непатентная публикация 3: Takagi Y, et aL: Proc Nati Acad Sci USA (1999) 96: 4131-4136

Непатентная публикация 4: Hotta M, et aL: J Exp Med (1998) 188: 1445-1451

Сущность изобретения

Проблемы, решаемые изобретением

Проблемы, которые решаются настоящим изобретением, заключаются в безопасном и эффективном снижении оксидативного стресса в организме (у субъекта), в поддержании у субъекта хорошего состояния здоровья и предотвращении различных заболеваний и симптомов, возникающих вследствие оксидативного стресса, что достигается за счет усиления экспрессии редокс-фактора in vivo.

Способы решения проблем

Изобретатели обнаружили, что кемпферол и кверцетин, принадлежащие к флавонолам, могут усиливать экспрессию in vivo и активность редокс-фактора, т.е. соединения, принадлежащие к суперсемейству глутатионов и суперсемейству тиоредоксина. Неожиданно обнаружили, что среди флавонолов такая функция специфична для кемпферола и кверцетина, при этом мирицетин, который имеет аналогичное химическое строение, не обладает такой функцией. По сравнению со случаем непосредственного применения молекулы суперсемейства глутатионов или суперсемейства тиоредоксинов, применение кемпферола или кверцетина может эффективно повысить экспрессию и активность эндогенных редокс-факторов, т.е. соединений, принадлежащих к суперсемейству глутатионов и суперсемейству тиоредоксинов. Следовательно, посредством настоящего изобретения могут быть уменьшены различные эндогенные оксидативные стрессы. Флавонолы, включая кемпферол и кверцетин, являются безвредными и безопасными соединениями для организма и широко распространены в растениях, таких как чайные листья или подобные. Следовательно, эндогенные избыточные активные формы кислорода могут быть удалены без оказания какого-либо стресса на организм с помощью кемпферола и кверцетина, используемых в качестве активного ингредиента для усиления экспрессии редокс-фактора in vivo.

Таким образом, настоящая заявка включает следующие воплощения:

[1] Агент, повышающий экспрессию редокс-фактора, который в качестве активного ингредиента содержит кемпферол, кверцетин, их гликозиды или любые их комбинации.

[2] Агент, повышающий экспрессию редокс-фактора в соответствии с [1], где редокс-фактор представляет собой одно или более веществ, выбранных из группы, состоящей из тиоредоксина, тиоредоксинредуктазы, глутатионредуктазы и глутаредоксина.

[3] Агент, повышающий экспрессию редокс-фактора, который в качестве активного ингредиента содержит экстракт из листьев гинкго, экстракт галанги (Kaempferia galanga) или любые их комбинации.

[4] Агент, повышающий экспрессию редокс-фактора в соответствии с [3], где редокс-фактор представляет собой одно или более веществ, выбранных из группы, состоящей из тиоредоксина, тиоредоксинредуктазы, глутатионредуктазы и глутаредоксина.

[5] Применение кемпферола, кверцетина, их гликозидов или любых их комбинаций для приготовления агента, повышающего экспрессию редокс-фактора.

[6] Применение экстракта из листьев гинкго, экстракта галанги (Kaempferia galanga) или любых их комбинаций для приготовления агента, повышающего экспрессию редокс-фактора.

Техническое преимущество изобретения

Повышение экспрессии редокс-фактора in vivo может безопасно и эффективно понижать уровень эндогенных активных форм кислорода и защищать организм от оксидативного стресса, вследствие чего организм может сохранять здоровое состояние и можно избежать развитие различных заболеваний и симптомов, возникающих из-за оксидативного стресса.

Краткое описание чертежей

Фиг.1 показывает усиление экспрессии редокс-фактора in vivo под влиянием кемпферола.

Фиг.2 показывает усиление экспрессии редокс-фактора на моделях эквивалентов кожи под влиянием кемпферола.

Фиг.3 показывает сравнение усиливающего действия под влиянием флавоноидных соединений на экспрессию суперсемейства тиоредоксинов.

Фиг.4 показывает усиление экспрессии тиоредоксинредуктазы под влиянием экстракта из листьев гинкго и экстракта галанги (Kaempferia galanga).

Фиг.5 показывает усиливающее действие тиоредоксинредуктазы под влиянием кемпферола и кверцетина.

Фиг.6 показывает подавляющее действие на продукцию воспалительного цитокина (IL1β) под влиянием кемпферола, экстракта из листьев гинкго и экстракта галанги (Kaempferia galanga).

Описание воплощений

Первое воплощение настоящего изобретения обеспечивает агент, повышающий экспрессию редокс-фактора, который в качестве активного ингредиента содержит кемпферол, кверцетин, их гликозиды или любые их комбинации.

Термин "редокс-фактор" в используемом здесь значении относится к фактору, который оксидативно или редуктивно взаимодействует с тиольной группой цистеинового остатка белка в организме, таком как млекопитающее, предпочтительно человек, и поддерживает условие редукции среды внутри клетки. В активированных клетках и образующих сигналы мессенжерах, т.е. в механизме сигнальной трансдукции, модификации белок-белковое взаимодействие за счет оксидирования тиольной группы цистеинового остатка во внутриклеточном белке играют важную роль. Такая оксидация/редукция (редокс) тиольной группы цистеинового остатка связана с регуляциями различных жизненных феноменов, таких как транскрипция генов, регуляции внутриклеточного расположения, синтез и разрушение белков, клеточная пролиферация и клеточная смерть. В качестве эндогенного редокс-семейства известны суперсемейство глутатиона и суперсемейство тиоредоксина и каждый из них включает серии соединений. Известно, что редокс-фактор участвует в процессе удаления активных форм кислорода, которые продуцируются и представлены in vivo.

Суперсемейство тиоредоксинов включает, в частности, тиоредоксин, тиоредоксинредуктазу и подобные. Тиоредоксин (TRX) был обнаружен как коэнзим, представляющий водород для рибонуклеотидредуктазы, которая является ферментов, необходимым для синтеза ДНК в Е. coli. TRX является белком с молекулярной массой около 12 кДа, который присутствует в ряде организмов, таких как прокариоты и человек, имеет стерическую структуру, состоящую из четырех β-цепей и трех α-спиралей и имеет активный сайт -Cys-Gly-Pro-Cys-. TRX имеет оксидированную форму (S-S), которая имеет дисульфидную связь между двумя цистеиновыми остатками активного сайта, и редуцированную форму (-SH, SH-), которая расщепляет дисульфидную связь субстратного белка и возвращается обратно в оксидированную форму per se. Оксидированная форма TRX преобразуется за счет NADPH и тиоредоксинредуктазы, и редуцированная форма восстанавливается. В качестве одного из субстратных белков известен Н2O2, отщепляющий суперсемейство ферментов, которое в общем относится к пероксиредоксинам. Редуцированная форма пероксиредоксина восстанавливает Н2О2. Оксидированный пероксиредоксин функционирует как субстрат и восстанавливается тиоредоксином. Оксидированный тиоредоксин восстанавливает тиоредоксинредуктазу. Следовательно, суперсемейство тиоредоксинов играет важную роль в качестве нейтрализирующего механизма для активных форм кислорода.

Суперсемейство глутатионов включает, в частности, глутатион, глутатионредуктазу, глутаредоксин и подобные. Глутатион является трипептидом, который состоит из глутаминовой кислоты, цистеина и глицина, и большое количество глутатиона найдено в клетках в качестве небелкового тиольного ингредиента. Также, он известен как основной антиоксидант в гидрофильной фракции клеток. Глутатион вступает в реакцию с активными формами кислорода (напр., с супероксидом или пероксидом водорода) с получением стабильного глутатионового радикала и формированием димера (GSSG: оксидированная форма глутатиона), который далее восстанавливается как GSH (редуцированная форма глутатиона) после переноса глутатионредуктазой электронов из NADPH в GSSG. Глутаредоксин имеет активный сайт -Cys-Pro-Tyr-Cys-, который общий с тиоредоксином и, следовательно, принадлежит к суперсемейству тиоредоксинов. Глутаредоксин также имеет оксидированную форму (S-S), содержащую дисульфидную связь между двумя остатками цистеина активного сайта и редуцированную форму (-SH, SH-). Аналогично тиоредоксину, редуцированная форма расщепляет дисульфидную связь субстратного белка и возвращается обратно в оксидированную форму per se. Хотя его биологические активности еще не достаточно изучены, известно, что глутаредоксин связан с редокс-регуляцией in vivo и ответными реакциями на оксидативный стресс.

Следовательно, избыточные количества эндогенных активных форм кислорода могут быть снижены путем активации редокс-фактора(ов), таких как тиоредоксин, тиоредоксинредуктаза, глутатионредуктаза и глутаредоксин, повышая их экспрессию, и тем самым организм может быть защищен от оксидативного стресса.

Как описано выше, изобретатели недавно и неожиданно обнаружили, что кемпферол и кверцетин могут активировать вышеуказанные редокс-факторы и усиливать их экспрессию. Флавонолы, включая кемпферол и кверцетин, имеют следующую формулу.

Кемпферол: R1=H; R2=H

Кверцетин: R1=OH; R2=H

Мирицетин: R1=OH; R2=OH

Они являются флавоноидными соединениями, которые широко распространены в растениях. Известно, что эти флавонолы обладают антиоксидантным действием и оказывают укрепляющее действие на кровеносные сосуды и противовоспалительное действие. Однако до сих пор не было известно, что флавонолы могут усиливать экспрессию редокс-фактора in vivo. Кроме того, удивительным является то, что среди этих флавонолов кемпферол и кверцетин могут усиливать экспрессию редокс-фактора, при этом они являются почти аналогичными по химической структуре. Принимая к сведению эти знания, очевидно, что кемпферол и кверцетин являются подходящими в качестве активного ингредиента для усиления экспрессии редокс-фактора.

В данном контексте, поскольку хорошо известно, что флавонолы могут образовывать различные гликозиды, то гликозиды кемпферола или кверцетина также могут применяться в качестве активного ингредиента в заявленном агенте для повышения экспрессии редокс-фактора. Сахариды, образующие гликозиды, согласно изобретению включают, но не ограничиваются альдозы, напр. глюкозу, маннозу, галактозу, фукозу, рамнозу, арабинозу и ксилозу, и кетозы, напр. фруктозу.

Как описано выше, поскольку кемпферол, кверцетин и их гликозиды являются ингредиентами, которые широко представлены в растениях, растительные экстракты, содержащие ингредиенты, также являются эффективными для повышения экспрессии редокс-фактора in vivo. Среди многих растительных экстрактов, изобретатели обнаружили, что, в особенности, экстракт из листьев гинкго и экстракт галанги (Kaempferia galanga) обладают значимым эффектом по усилению экспрессии редокс-фактора. Следовательно, другое воплощение изобретения обеспечивает агент, повышающий экспрессию редокс-фактора, который содержит в качестве активного ингредиента экстракт из листьев гинкго, экстракт галанги (Kaempferia galanga) или любые их комбинации.

Суммарное количество кемпферола, кверцетина или их гликозидов или любых их комбинаций, которые используются в качестве активного ингредиента в заявляемом агенте для усиления экспрессии редокс-фактора, не ограничено, но обычно составляет от 0,00001 до 0,5 масс.%, предпочтительно от 0,0001 до 0,001 масс.% и наиболее предпочтительно от 0,0001 до 0,0005 масс.%. Также, суммарное количество экстракта из листьев гинкго, экстракта галанги (Kaempferia galanga) или любых их комбинаций, которые используются в качестве активного ингредиента в заявляемом агенте для усиления экспрессии редокс-фактора, составляет, например, от 0,00001 до 0,5 масс.%, предпочтительно от 0,0001 до 0,1 масс.% и наиболее предпочтительно от 0,0001 до 0,01 масс.% как масса сухого вещества.

В заявляемом агенте для усиления экспрессии редокс-фактора, вышеуказанные активные ингредиенты можно вводить орально или парентерально и агенты могут быть приготовлены в качестве, например, композиции для орального или наружного применения. Также, заявляемый агент для усиления экспрессии редокс-фактора может поддерживать здоровое состояние организма и предотвращать развитие различных заболеваний и симптомов, возникающих вследствие оксидативного стресса. Такими симптомами и заболеваниями являются, без ограничения, рак; диабеты; аутоиммунное заболевание, такое как ревматоидный артрит, красная волчанка, антифосфолипидный синдром, дерматомиозиты, склеродермия, синдром Шегрена, синдром Гийена - Барре, хронический атрофический гастрит, синдром аортита, синдром Гудпасчера, быстропрогрессирующий гломерулонефрит, болезнь Грейвса, хроническая дискоидная красная волчанка или хроническая фетальная потеря; ишемическое заболевания, такое как стенокардия, инфаркт миокарда, церебральный инфаркт или облитерирующий артериосклероз; аллергическое заболевание, такое как бронхиальная астма, аллергический ринит, сенная лихорадка, аллергический энтерогастрит, крапивница, контактный дерматит или атопический дерматит; старение кожи; локализация пигмента в клетке; морщины; себорея; солнечный ожог; ожог; акне; обвисание кожи; ожирение; высокое кровяное давление; метаболический синдром и анемия. Следовательно, агент, повышающий экспрессию редокс-фактора, согласно настоящему изобретению может без ограничения использоваться в качестве сырья или добавки к продуктам питания, напиткам, косметике, лекарственным средствам и квазилекарственным средствам или подобным.

В качестве оральной композиции, например, включены обычные продукты питания, а также продукты питания с укрепляющим здоровье действием, добавки, продукты питания для определенного применения по состоянию здоровья, модифицированное молоко для недоношенных детей, питание для грудных детей, питание для беременных женщин, питание для пожилых людей, напитки и лекарственные средства. Оральная композиция может быть приготовлена в виде пилюли, порошка, гранулы, пастилки, орального раствора, суспензии, эмульсии, сиропа или подобных.

Кроме того, в дополнение к активному ингредиенту(ам) заявляемый агент для усиления экспрессии редокс-фактора может содержать любые носители и добавки, которые обычно применяются в продуктах питания/напитках, лекарственных средствах или квазилекарственных средствах, таких как антиоксиданты. Например, в дополнение к активному ингредиенту настоящего изобретения агент, повышающий экспрессию редокс-фактора, может дополнительно содержать различные субстраты носителей, разбавители, растворители, объемообразующие агенты, диспергирующие агенты, эксципиенты, растворители связующих агентов (напр., вода, этанол, растительное масло), солюбилизирующие агенты, буферы, промоторы растворения, желирующие агенты, суспендирующие агенты, пшеничную муку, рисовую муку, крахмал, кукурузный крахмал, полисахариды, белки молока, коллаген, рисовое масло, лецитин или подобные. В качестве добавок, без ограничения, служат, например, витамины, подсластители, органические кислоты, красители, отдушки, предотвращающие увлажнение агенты, волокна, электролиты, минералы, нутриенты, антиоксиданты, консерванты, ароматизаторы, увлажнители и экстракты из натуральных продуктов и растительные экстракты. В дополнение, примеры антиоксидантов включают, например, природные антиоксиданты, такие как токоферолы, производные флавонов, соединения филлодульцина, койевую кислоту, производные галловой кислоты, соединения катехина, фукийевую кислоту, госсипол, производные пиразина, сесамол, гваякол, гваяковую кислоту, п-кумалиновую кислоту, нордигидрогвайаретовую кислоту, соединения стерола, соединения терпенов, соединения на основе нуклеиновых кислот, соединения каротеноидов и соединения лигнана; и синтетические антиоксиданты, такие как аскорбиновый пальмитат, аскорбиновый стеарат, бутилгидроксианизол (ВНА), бутилгидрокситолуол (ВНТ), моно-т-бутилгидрохинон (TBHQ) и 4-гидроксиметил-2,6-дт-т-бутилфенол (НМВР).

В качестве композиции для наружного применения включены, например, мазь, крем, защитное средство, трансдермальный лейкопластырь, маска, тоник, молочко, лосьон, средство для ванны, лосьон для волос, жидкость для волос, шампунь и ополаскиватель. Также, ингредиент, обычно используемый для агента наружного применения, например отбеливающий агент, увлажнитель, масляный ингредиент, УФ-абсорбер, сурфактант, загуститель, спирты, порошковый компонент, окрашивающий материал, водный ингредиент, вода и различные питательные вещества для кожи, может быть, при необходимости, примешан к заявляемому агенту для усиления экспрессии редокс-фактора. В дополнение, вспомогательный агент, обычно используемый для препаратов для наружного применения, например, металл-хелатный агент, такой как динатрия эдетат, тринатрия эдетат, натрия цитрат, натрия фосфаты, глюконовая кислота; кофеин, танин, верапамил, транексамовая кислота и их производные; лекарственный агент, такой как экстракт из корня солодки, глабридин, горячий экстракт из китайской айвы, различные препараты растительного происхождения, токоферола ацетат, глицеризинат и их производные или их соли; отбеливающий агент, такой как витамин С, аскорбиновая кислота, фосфат магния, глюкозид аскорбиновой кислоты, арбутин, койевая кислота; сахарид, такой как глюкоза, фруктоза, манноза, сахароза и трегалоза; витамин А, такой как ретиноевая кислота, ретинол, ретинола ацетат и ретинола пальмитат, может быть, при необходимости примешан к заявляемому агенту для усиления экспрессии редокс-фактора.

Типичные составы заявляемых агентов для усиления экспрессии редокс-фактора представлены ниже.

Защитное средство А

Состав Соотношение компонентов в смеси(масс.%)
Декам етилциклопентасилоксан 3
Метилфенилполисилоксан 3
Бегениловый спирт 1
1,3-бутиленгликоль 5
Полиоксиэтиленглицерин изостеарат 1,5
Полиоксиэтилен-глицеринмоностеарат 1
Экстракт из листьев гинкго (сухой остаток) в качестве 0
агента, повышающего экспрессию редокс-факторов
Кверцетин в качестве агента, повышающего-экспрессию 0
редокс-факторов
Тринатрия эдентат 0,1
2-этилгексил п-метоксициннамат 7
Ксантановая камедь 0,1
Карбоксивинильный полимер 0,3
Феноксиэтанол достаточное
Очищенная вода достаточное
Отдушка достаточное

Защитное средство В
Состав Соотношение компонентов в смеси (масс.%)
Вазелин 1
Диметилполисилоксан 3
Метилфенилполисилоксан 3
Стеариновый спирт 0,5
Глицерин 7
Дипропиленгликоль 3
1,3-бутиленгликоль 7
Ксилитол 3
Сквалан 1
Изостеариновая кислота 0,5
Стеариновая кислота 0,5
Полиоксиэтилен-глицерин моностеарат 1
Глицерин моностеарат 2
Гидроксид калия 0,05
Экстракт К.galanga (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0
Кемпферол в качестве агента, повышающего экспрессию редокс-факторов 0
Натрия ацетилгиалуронат 0,1
Тринатрия EDTA 0,05
4-т-бутил-4'-метоксидибензоилметан 2
2-этилгексил п-метоксициннамат 5
Карбоксивинильный полимер 0,1
Феноксиэтанол достаточное
Очищенная вода достаточное
Отдушка достаточное
Двухслойный крем
Состав Соотношение компонентов в смеси (масс.%)
Диметилполисилоксан 5
Декаметилциклопентасилоксан 25
Триметилсилоксисиликат 5
Сополимер 2
Полиоксиэтилен/метилполисилоксан Дипропиленгликоль 5
Оксид цинка в виде частиц (60 нм), покрытый пальмитат декстрина- 15
Экстракт из листьев гинкго (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0,01
Кемпферол в качестве агента, повышающего экспрессию редокс-факторов 0
Парабен достаточное
Феноксиэтанол достаточное
Тринатрия эдетат достаточное
2-этилгексил п-метоксициннамат 7,5

Диметил дистеарил аммония гекторит 0,5
Гранулированный порошок алкил полиакрилата 5
Бутилэтилпропандиол 0,5
Очищенная вода достаточное
Отдушка достаточное
Мазь
Состав Соотношение компонентов в смеси (масс.%)
Экстракт из листьев гинкго (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0,01
Кемпферол в качестве агента, повышающего экспрессию редокс-факторов 0
Кверцетин в качестве агента, повышающего экспрессию редокс-факторов 0
Стеариловый спирт 18
Растительный воск 20
Эфир полиоксиэтилен (20) моноолеата 0,25
Эфир моностеарат глицерина 0,3
Вазелин 40
Очищенная вода остальное
Трансдермальный лейкопластырь
Состав Соотношение компонентов в смеси (масс.%)
Экстракт К. galanga (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0
Кемпферол в качестве агента, повышающего экспрессию редокс-факторов 0
Кверцетин в качестве агента, повышающего экспрессию редокс-факторов 0
Кротамитон 3,2
Panasate 875® 2,5
Сквалан 1
dl-камфора 0,07
Полиоксиэтилен (60 Е.О.) гидрогенизированное касторовое масло 1,2
Концентрированный глицерин 5
Желатин 1,2
Поливинилпирролидон К.-90 0,6
Метилпарабен достаточное
Раствор d-сорбитола 35
Гидроксид алюминия 0,2-
Мочевина 1,3
Сульфит натрия достаточное
Натрия эдетат достаточное
Лимонная кислота Достаточное
Hivis Wako 104® 0,22

Натрия полиакрилат 0,24
Натрия карбоксиметилцеллюлоза 2,8
Каолин 1
Очищенная вода остальное
Агент для ионтофореза
Состав Соотношение компонентов в смеси (масс.%)
Экстракт из листьев гинкго (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0
Экстракт К. galanga (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0
Кемпферол в качестве агента, повышающего экспрессию редокс-факторов 0
Кверцетин в качестве агента, повышающего экспрессию редокс-факторов 0
Глицерин 5
1,3-бутиленгликоль 5
Гиалуроновая кислота 0,05
Лимонная кислота (пищевая) 0,35
Ионообменная вода остальное
Карамель А
Состав Соотношение компонентов в смеси (масс.%)
Экстракт из листьев гинкго (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0,5
Сахар 50
Глюкоза остальное
Ароматизатор 1
Таблетка С
Состав Соотношение компонентов в смеси (масс.%)
Экстракт К. galanga (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0,1
Кверцетин в качестве агента, повышающего экспрессию редокс-факторов 0,5
Эфиры сахарозы 4,67
Метилцеллюлоза 2,4
Глицерин 1,67
N-ацетилглюкозамин 24,8
Гиалуроновая кислота 20
Витамин Е 12
Витамин В6 1,33
Витамин В2 0,67

α-липоевая кислота 1,33
Коэнзим Q10 2,67
Церамид (экстракт из аморфофаллюс коньяк) 3,33
L-пролин 20
Кристаллическая целлюлоза остальное
Мягкая капсула В Состав Соотношение компонентов в смеси (масс.%)
Экстракт из листьев гинкго (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0,1
Кемпферол в качестве агента, повышающего экспрессию редокс-факторов 0
Кверцетин в качестве агента, повышающего экспрессию редокс-факторов 0
Соевое масло пищевое 35,33
Маточное молочко 16,47
Мака 2
GABA 2
Пчелиный воск 4
Желатин остальное
Глицерин 8
Эфиры глицерина и жирной кислоты 7
Гранула А-В
Состав Соотношение компонентов в смеси (масс.%)
Экстракт из листьев гинкго (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0,01
Экстракт К. galanga (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0,02
Кемпферол в качестве агента, повышающего экспрессию редокс-факторов 0
Соевые изофлавоны 42,3
Гидрогенизированная лактоза 45
Соевые олигосахариды 3
Эритритол 3
Декстрин 2,5
Лимонная кислота 2
Ароматизатор остальное

Напиток А
Состав Соотношение компонентов в смеси (масс.%)
Экстракт из листьев гинкго (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0
Экстракт К.galanga (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0
Кемпферол в качестве агента, повышающего экспрессию редокс-факторов 0
Кверцетин в качестве агента, повышающего экспрессию редокс-факторов 0
Гидрогенизированный мальтозный сироп 65,4
Эритритол 16
Лимонная кислота 4
Ароматизатор 2,6
N-ацетилглюкозамин 2
Гиалуроновая кислота 1
Витамин Е 0,6
Витамин В6 0,4
Витамин В2 0,2
α-липоевая кислота 0,4
Коэнзим Q10 2,4
Церамид (экстракт из аморфофаллюс коньяк) 0,8
L-пролин 4
Очищенная вода остальное
Печенье
Состав Соотношение компонентов в смеси (масс.%)
Экстракт из листьев гинкго (сухой остаток) в качестве агента, повышающего экспрессию редокс-факторов 0,5
Кемпферол в качестве агента, повышающего экспрессию редокс-факторов 0,5
Мука из мягких сортов пшеницы 48,8
Сливочное масло 17,5
Гранулированный сахар 20
Яйцо 12,5
Ароматизатор остальное

Гранулированный сахар постепенно добавляют к размешанному сливочному маслу, затем добавляют яйцо, экстракт из листьев гинкго, экстракт К. galanga, кемпферол, кверцетин и ароматизирующий ингредиент и дополнительно перемешивают. После достаточного перемешивания смеси добавляют однородно-просеянную муку из мягких сортов пшеницы, смесь аккуратно перемешивают и смешанную густую массу помещают в холодильник. Затем охлажденной массе придают форму и выпекают при температуре 170°С в течение 15 минут с получением печенья.

Примеры

Пример 1. Поиск агента, повышающего экспрессию семейства тиоредоксинов

Нормальные человеческие эпидермальные кератиноциты (КК-4009, K.URABO) культивировали в среде определенного состава Defined Keratinocyte-SFM (10744-019, GIBCO) с 5% CO2 при высокой влажности при температуре 37°С. Для клеток с 100% конечной плотностью среду заменяли средой EpiLife™ Calcium-Free Phenol Red Free (M-EPICF/PRF-500, KURABO), концентрацию кальция в которой доводили до 1,5 мМ. Через двадцать четыре часа добавляли кемпферол (К-0018, Tokyo Chemical Industry Co., Ltd), витамин Е (95240, FULKA) или липоевую кислоту((+/-)-α-липоевую кислоту (Т 13 95, SIGMA) до конечной концентрации 10 мкМ.

Через двадцать четыре часа после добавления вышеуказанных агентов изолировали РНК с помощью лизирующего реагента QIAZOL (79306, QIAGEN) и очищали с помощью набора Rneasy (74106, QIAGEN). Затем подсчитывали мРНК тиоредоксинредуктазы, тиоредоксина, глутатионредуктазы, глутаредоксина и рибосомального белка в качестве внутреннего стандарта с помощью программного обеспечения LightCycler (Roche), используя набор для проведения ПЦР в реальном времени QuantiTect SYBR Green RT-PCR (204243, QIAGEN). Последовательности используемых праймеров показаны ниже.

Тиоредоксинредуктаза/Прямой праймер:

TGCTGGCAATAGGAAGAGATGGCTTGCAC

Тиоредоксинредуктаза/Обратный праймер:

GCAATCTTCCTGCCTGCCTGGATTGCAACTGG

Тиоредоксин/Прямой праймер:

TCGGTCCTTACAGCCGCTCGTCAGACTCCA

Тиоредоксин/Обратный праймер:

AGGCCCACACCACGTGGCTGAGAAGTCAAC

Глутатионредуктаза/Прямой праймер:

GATCCTGTGAGGGCTGGGTTCTAAGACATC\

Глутатионредуктаза/Обратный праймер:

TAACCATGCTGACTTCCAAGCCCGACAA

Глутаредоксин/Прямой праймер:

ATCACAGCCACCAACCACACTAACGAGA

Глутаредоксин/Обратный праймер:

GTTACTGCAGAGCTCCAATCTGCTTTAGCC

Рибосомальный белок/Прямой праймер:

ACAGAGGAAACTCTGCATTCTCGCTTCCTG

Рибосомальный белок/Обратный праймер:

CACAGACAAGGCCAGGACTCGTTTGTACC

Количества мРНК тиоредоксинредуктазы, тиоредоксина, глутатионредуктазы и глутаредоксина делили на количество мРНК рибосомального белка с получением уровня экспрессии мРНК.

В результате, кемпферол значительно повышал экспрессию редокс-факторов по сравнению с витамином Е и липоевой кислотой, которые, как известно, обладают антиоксидантным действием (фиг.1).

Пример 2. Эффект кемпферола в повышении экспрессии редокс-факторов в модели эквивалента кожи

Модели эквивалентов кожи изготавливали из нормальных человеческих кератиноцитов (Invitrogen), нормальных человеческих фибробластов (АТСС) и коллагена I (Sigma) и культивировали в модифицированной по способу Дульбекко среде Игла (D-МЕМ) (Invitrogen) с 5% СО2 при высокой влажности при 37°С. В культуральную среду добавляли 2 мкМ или 10 мкМ кемпферола и модели культивировали в течение двадцати четырех часов. Затем из эпидермального слоя моделей эквивалентов кожи изолировали РНК с помощью набора для выделения мРНК QIAGEN. Затем определяли количество мРНК тиоредоксинредуктазы и глутатионредуктазы и 36 В4 в качестве внутреннего стандарта с помощью кПЦР (количественная ПЦР, проводимая с помощью системы детектирования в режиме реального времени Bio-Rad MyiQ), используя набор для проведения ПЦР в режиме реального времени (Bio-Rad). Праймеры были приобретены у QIAGEN (TXNRD2: #QT00070371; GSR; #QT00038325). Количества тиоредоксинредуктазы и глутатионредуктазы делили на количество мРНК 36 В4 с получением уровня экспрессии мРНК.

В результате, кемпферол значительно повышал экспрессию редокс-факторов в моделях-эквивалентов-кожи-(фиг. 2).

Пример 3. Поиск агента, повышающего экспрессию суперсемейства тиоредоксинов, среди флавоноидных соединений

Нормальные человеческие эпидермальные кератиноциты (КК-4009, K.URABO) культивировали в среде Defined Keratmocyte-SFM (10744-019, GIBCO) с 5% СO2 при высокой влажности при температуре 37°С. Для клеток с 100% конечной плотностью среду заменяли средой EpiLife™ Calcium-Free Phenol Red Free (M-EPICF/PRF-500, KURABO), концентрацию кальция в которой доводили до 1,5 мМ. Через двадцать четыре часа добавляли каждый из нижеследующих агентов с получением конечной концентрации 10 мкМ.

Кемпферол (К0018, Tokyo Chemical Industry Co., Ltd)

Кверцетин (173-00403, Wako Pure Chemical Industries, Ltd.)

Мирицетин (70050, FLUKA)

Галлат эпигаллокатехина (Е4143, CIAL)

Гесперидин (086-07342, Wako Pure Chemical Industries, Ltd.)

Апигенин (012-18913, Wako Pure Chemical Industries, Ltd.)

Генистеин (070-04681, Wako Pure Chemical Industries, Ltd.)

Через двадцать четыре часа после добавления вышеуказанных агентов количественно определяли уровень экспрессии мРНК редокс-факторов аналогичным способом, указанным в примере 1.

В результате, среди вышеуказанных флавоноидных соединений только кемпферол и кверцетин значительно повышали экспрессию суперсемейства тиоредоксинов (фиг.3).

Пример 4. Поиск агента, повышающего экспрессию суперсемейства, - поиск растительного экстракта

Нормальные человеческие эпидермальные кератиноциты (КК-4009, KURABO) культивировали в среде Defined Keratinocyte-SFM (10744-019, GIBCO) с 5% СO2 при высокой влажности при температуре 37°С. Для клеток с 100% конечной плотностью среду заменяли средой EpiLife™ Calcium-Free Phenol Red Free (M-EPICF/PRF-500, KURABO), концентрацию кальция в которой доводили до 1,5 мМ. Через двадцать четыре часа добавляли каждый из нижеследующих агентов с получением конечной концентрации 0,1%.

Экстракт К. galanga: который получали путем экстракции ризом Kaempferia galanga 50% 1,3-бутиленгликолем;

Экстракт из листьев гинкго: который получали путем растворения 50%-ного этанолового экстракта из листьев Ginkgo biloba L. в 1,3-бутиленгликоле;

Экстракт малины Rubus suavissimus: который получали путем растворения водного экстракта из Rubus suavissimus Shugan Lee. (Розоцветные) в 50% 1,3-бутиленгликоле.

Через двадцать четыре часа после добавления вышеуказанных агентов количественно определяли уровень экспрессии мРНК редокс-факторов аналогичным способом, указанным в примере 1.

В результате, среди растительных экстрактов, содержащих кемпферол, кверцетин и/или их гликозиды, только экстракт из листьев гинкго и экстракт К. galanga, в особенности, повышали экспрессию суперсемейства тиоредоксинов (фиг.4).

Пример 5. Активность тиоредоксинредуктазы - усиливающий эффект

Нормальные человеческие эпидермальные кератиноциты (КК-4009, KURABO) культивировали в среде Defined Keratinocyte-SFM (10744-019, GIBCO) с 5% CO2 при высокой влажности при температуре 37°С. Для клеток с 100% конечной плотностью, среду заменяли средой EpiLife™ Calcium-Free Phenol Red Free (M-EPICF/PRF-500, KURABO), концентрацию кальция в которой доводили до 1,5 мМ. Через двадцать четыре часа добавляли кемпферол (К0018, Tokyo Chemical Industry Co., Ltd) или кверцетин (173-00403, Wako Pure Chemical Industries, Ltd.) до конечной концентрации 10 мкМ. Через двадцать четыре часа после добавления агентов, клетки растворяли в лизирующем буфере и нерастворенные фракции удаляли путем центрифугирования при 14000 rpm, 4°C в течение 15 мин. Определяли количество общего белка в растворенной фракции и затем измеряли активность тиоредоксинредуктазы с помощью метода, предложенного Аrnе Holmgren et al. (METHODS IN ENZYMOLOGY, 1995, 252, 199).

В результате, было подтверждено, что кемпферол и кверцетин усиливали активность тиоредоксинредуктазы (фиг.5).

Пример 6. Подавляющие эффекты кемпферола, экстракта К. galanga и экстракта из листьев гинкго на экспрессию воспалительного цитокина (IL 1β)

Нормальные человеческие эпидермальные кератиноциты (КК-4009, KURABO) культивировали в среде Defined Keratinocyte-SFM (10744-019, GIBCO) с 5% СО2 при высокой влажности при температуре 37°С. Для клеток с 100% конечной плотностью среду заменяли средой EpiLife™ Calcium-Free Phenol Red Free (M-EPICF/PRF-500, KURABO), концентрацию кальция в которой доводили до 1,5 мМ. Через двадцать четыре часа добавляли кемпферол до получения конечной концентрации 10 мкМ и каждый из следующих растительных экстрактов до получения конечной концентрации 0,1%.

Кемпферол (К0018, Tokyo Chemical Industry Co., Ltd);

Экстракт К. galanga: который получали путем экстракции ризом Kaempferia galanga 50% 1,3-бутиленгликолем;

Экстракт из листьев гинкго: который получали путем растворения 50% этанолового экстракта из листьев Ginkgo biloba L. в 1,3-бутиленгликоле.

Через двадцать четыре часа после добавления вышеуказанных агентов изолировали РНК аналогичным способом, указанным в примере 1, и определяли уровень экспрессии мРНК связанного с воспалением фактора (IL 1β). Используемые праймеры представлены ниже.

IL 2β/прямой праймер

GGCCATGGACAAGCTGAGGAAGATGCTG

IL 1β/Обратный праймер TGCATCGTGCACATAAGCCTCGTTATCCC

Количество мРНК IL 1β делили на количество мРНК рибосомального белка с получением уровня экспрессии мРНК.

В результате, подтвердили, что кемпферол, экстракт К. galanga и экстракт из листьев гинкго обладают противовоспалительным действием, поскольку продукция воспалительного цитокина IL 1β подавлялась под действием этих ингредиентов (фиг.6).

1. Агент для снижения экспрессии IL-1β в коже объекта и для повышения экспрессии редокс-ассоциированного фактора в человеческой эпидермальной клетке, который включает кемферол, где редокс-фактор выбирают из группы, состоящей из одного или нескольких из числа тиоредоксина, тиоредоксинредуктазы, глутатионредуктазы и глутаредоксина.

2. Агент для снижения экспрессии IL-1β в коже объекта и для повышения экспрессии редокс-ассоциированного фактора в человеческой эпидермальной клетке, который включает экстракт листьев гинкго, полученный растворением 50% этанольного экстракта листьев Ginkgo biloba L. в 1,3-бутиленгликоле, где редокс-ассоциированным фактором является тиоредоксин и/или тиоредоксинредуктаза.

3. Агент для снижения экспрессии IL-1β в коже объекта и для повышения экспрессии редокс-ассоциированного фактора в человеческой эпидермальной клетке, который включает экстракт галанги Kaempferia galanga, полученный экстракцией 50% 1,3-бутиленгликолем, где редокс-ассоциированный фактор выбирают из группы, состоящей из одного или нескольких из числа тиоредоксина, тиоредоксинредуктазы, глутатионредуктазы и глутаредоксина.

4. Агент по п. 1, где редокс-ассоциированным фактором является тиоредоксин.

5. Агент по п. 1, где редокс-ассоциированным фактором является тиоредоксинредуктаза.

6. Агент по п. 1, где редокс-ассоциированным фактором является глутатионредуктаза.

7. Агент по п. 1, где редокс-ассоциированным фактором является глутаредоксин.

8. Агент по п. 2, где редокс-ассоциированным фактором является тиоредоксином.

9. Агент по п. 2, где редокс-ассоциированным фактором является тиоредоксинредуктаза.

10. Агент по п. 2, где редокс-ассоциированным фактором является глутатионредуктаза.

11. Агент по п. 2, где редокс-ассоциированным фактором является глутаредоксин.

12. Агент по п. 2, где количество экстракта листьев гинкго в агенте составляет от около 0,00001 до 0.5 масс. %.

13. Агент по п. 3, где редокс-ассоциированным фактором является тиоредоксин.

14. Агент по п. 3, где редокс-ассоциированным фактором является тиоредоксинредуктаза.

15. Агент по п. 3, где редокс-ассоциированным фактором является глутатионредуктаза.

16. Агент по п. 3, где редокс-ассоциированным фактором является глутаредоксин.



 

Похожие патенты:

Изобретение относится к новому соединению формулы I-1, характеризующемуся эффектами тромболизиса, акцептирования свободных радикалов и направленного действия на тромб.

Изобретение относится к фармацевтической промышленности, в частности к способу получения средства, обладающего противоишемической и антиоксидантной активностью.

Изобретение относится к химико-фармацевтической промышленности и представляет собой способ получения водорастворимого лиофилизата, включающий получение совместного раствора активной субстанции и соединения, содержащего гидроксильные и амино-группы (аминоспирт), отличающийся тем, что активная субстанция представляет собой 4-((3-оксо-3-этоксипропаноил)амино)бензойную кислоту (ЭПАБК), обладающую антиишемической и антиоксидантной активностью.
Изобретение относится к фармацевтической промышленности, а именно средству, обладающему общеукрепляющим, антиоксидантным действием. Средство содержит яблочный пектин, источник биологически активных веществ (БАВ), глутатион, аминокислоты, сорбат калия, воду с отрицательным окислительно-восстановительным потенциалом от -200 до -240 мВ, взятые в определенном количестве.

Предлагаемое средство, обладающее антиоксидантным, противоопухолевым, иммуномодулирующим, антидиабетическим и антибактериальным действиями, относится к медицине.

Изобретение относится к фармацевтической промышленности и представляет собой применение антибактериальной и антивирусной фармацевтической композиции, обладающей выраженными противоопухолевыми, антибактериальными и антиоксидантными свойствами, содержащей азотнокислое серебро, гексаметилентетрамин, тиосульфат натрия, альфа-аспарагиновую кислоту или аспарагин, никотиновую кислоту и воду, причем компоненты в композиции находятся в определенном соотношении в мас.

Изобретение относится к химико-фармацевтической промышленности и представляет собой антиоксидантную композицию, содержащую аспартат лития в количестве 40-60 мас.% и сукцинат лития в количестве 40-60 мас.%.

Изобретение относится к ветеринарии, в частности к способу профилактики стресса у цыплят мясного направления продуктивности при дебикировании. Способ включает использование фармакологических средств, обладающих антистрессовым действием.

Изобретение относится к способу приготовления жидкого антиоксиданта. Сущность предлагаемого способа заключается в том, что в пресную воду, находящуюся в сосуде в равновесном состоянии с окружающей средой, насыпают картофельный крахмал в весовом соотношении крахмал : вода - 1:(50-100), затем перемешивают жидкость и оставляют ее в сосуде на 16-24 часа, перемешивая содержимое сосуда за это время 4-8 раз.

Изобретение относится к селенсодержащему фенольному соединению - бис-(3-(3,5-ди-трет-бутил-4-гидроксифенил)пропил)селениду формулы: . Заявляемое соединение обладает высокой антиоксидантной активностью, низкой токсичностью и гипогликемическим действием на фоне сахарного диабета, и может найти применение в медицине, ветеринарии и экспериментальной биологии.

Группа изобретений относится к фармацевтической области и касается медицинского продукта, содержащего комбинацию N-ацетил-L-цистеина, селена в форме селенометионина и мелатонина.
Изобретение относится к медицине, а именно к физиотерапии и дерматокосметологии, и может быть использовано для эстетической коррекции инволютивных изменений кожи лиц.

Группа изобретений относится к медицине, а именно к дерматологии, и может быть использована для лечения акне. Способ по изобретению включает одновременное или последовательное введение пациенту терапевтически эффективного количества от 5 до 10 мг S-эквола или его фармацевтически приемлемой соли, или гидрата и от 50 до 100 мг доксициклин гиклата.

Изобретение относится к фармацевтической композиции для местного применения, содержащей в качестве терапевтически активного ингредиента кальципотриол или моногидрат кальципотриола, включенный в виде твердого раствора или дисперсии в липидные наночастицы, причем указанные липидные наночастицы являются твердыми при комнатной температуре и содержат 60-92% по массе первого липида с температурой плавления выше температуры тела, где указанный первый липид представляет собой воск, выбранный из группы, состоящей из цетилпальмитата, жирного С14-28 спирта, гидрогенизированного пальмового масла и триглицеридов с кислотным числом, равным 0,1 или ниже, и 1-40% по массе липидных наночастиц второго липида, который представляет собой масло при комнатной температуре, способное смешиваться с первым липидом, причем указанный второй липид выбран из группы, состоящей из среднецепочечных триглицеридов, таких как триглицериды каприловой/каприновой кислоты, или длинноцепочечных триглицеридов, таких как касторовое масло, где указанные липидные наночастицы дополнительно содержат 2-22% по массе фармацевтически приемлемого поверхностно-активного вещества, выбранного из группы, состоящей из полоксамеров.

Изобретение относится к области ветеринарии и предназначено для лечения дерматитов у животных. Способ включает применение препарата, содержащего мас.
Изобретение относится к медицине и раскрывает не содержащий пропеллентов фармацевтический состав для местного введения, содержащий в качестве активного ингредиента тонкоизмельченные частицы беклометазондипропионата (BDP), взвешенные в водной фазе, для применения для профилактики и/или лечения дерматологического заболевания, где указанная водная фаза состоит из эмульгирующего средства, выбранного из класса полисорбатов, в количестве, составляющем от 0,1 до 0,3% масс./об., сахара или сахарного спирта в качестве средства придания тоничности в количестве, составляющем от 5,0 до 5,2% масс./об., смеси микрокристаллической целлюлозы и карбоксиметилцеллюлозы натрия в качестве сгущающего средства в количестве, составляющем от 0,5 до 1,0% масс./об., одного или более консервантов и воды до 100%.

Изобретение относится к области ветеринарии и предназначено для лечения отодектоза и милиарного дерматита плотоядных животных. Способ включает использование масляного раствора дегтя соснового.

Группа изобретений относится к медицине, а именно к офтальмологии, и может быть использована для лечения болезни сухого глаза. Для этого пациенту вводят агонист альфа-2В рецепторов, который выбирают из группы, состоящей из: имидазолина или имидазола.

Представленные изобретения касаются применения средства, стимулирующего регенерацию тканей, и способа стимуляции регенерации мезенхимальных, эпителиальных или неврологических тканей путем введения такого средства.
Изобретение относится к фармацевтической промышленности, а именно к средству для лечения заболеваний, выбранных из нейродермита, микозов и укусов москитов. Растительный экстракт из цветов и/или прилегающих к цветам листьев Cannabis sativa subspecies sativa сорта с содержанием тетрагидроканнабинола (ТГК), составляющим менее чем 5%, предназначенный для лечения заболеваний, выбранных из нейродермита, микозов и укусов москитов.

Изобретение относится к области нанотехнологии, в частности к способу получения нанокапсул сухого экстракта шпината в натрий карбоксиметилцеллюлозе. Способ включает диспергирование сухого экстракта шпината в раствор натрий карбоксиметилцеллюлозы в бензоле в соотношении 1:1-3 в присутствии E472c в качестве поверхностно-активного вещества при перемешивании со скоростью 1000 об/сек.
Наверх