Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых днк-зондов для идентификации рнк энтеровирусов, ротовирусов, вирусов гепатита а и е, аденовирусов, норовирусов и астровирусов из водной среды методом мультиплексной пцр

Изобретение относится к наборам олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации генетического материала методом мультиплексной ПЦР. Представленный набор содержит олигодезоксирибонуклеотидные праймеры и флуоресцентно-меченые ДНК-зонды для идентификации таких РНК вирусов, как энтеровирусы, ротовирусы, вирусы гепатита А и Е, аденовирусы, норовирусы и астровирусы. Изобретение может быть использовано в исследовании проб водной среды с целью выявления в них энтеровирусов, ротовирусов, вирусов гепатита А и Е, аденовирусов, норовирусов и астровирусов. 2 з.п. ф-лы, 3 табл., 7 ил.

 

Изобретение относится к наборам олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации генетического материала энтеровирусов, ротовирусов, вирусов гепатита А и Е, аденовирусов, норовирусов и астровирусов в образцах воды из окружающей среды методом мультиплексной полимеразной цепной реакции и может быть использовано в вирусологии и эпидемиологии для обеспечения эпидемической безопасности населения при различных видах водопользования.

Известно, что для индикации цитопатогенных вирусов, распространяющихся водным путем, в практической лабораторной службе используется метод их выделения на чувствительных культурах клеток. Однако данный метод имеет ряд недостатков, снижающих его практическую значимость: длительность процесса (3-4 недели), невозможность выделения нецитолитических и поврежденных вирусных агентов, не способных вызывать продуктивную цитолитическую инфекцию в системе in vitro, но, тем не менее, представляющих эпидемическую опасность для живого организма (Проблема лабораторной диагностики острых кишечных инфекций неустановленной этиологии у детей / Т.В. Амвросьева, Н.В. Поклонская, Е.П. Кишкурно, Н.Л. Клюйко, О.Н. Казинец, А.А. Безручко, О.И. Камяк // Перспективы сотрудничества государств-членов ШОС в противодействии угрозе инфекционных болезней: материалы междунар. науч.-практ. конф. / ФГУН «Государственный научный центр вирусологии и биотехнологии «Вектор» Роспотребнадзора. – Новосибирск, 2009. – С. 52-55). Эти проблемы, возникающие при изучении вирусологического качества вод различных водных объектов, могут быть решены путем использования метода детекции, представляющего собой полимеразную цепную реакцию с этапом обратной транскрипции (ОТ-ПЦР), который позволяет в течение 3-6 часов обнаружить в исследуемом материале вирусную РНК.

Метод полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) является наиболее распространенным методом, используемым в лабораторной практике для дифференциальной диагностики инфекционных заболеваний. В основе метода лежат две реакции – обратная транскрипция и полимеразная цепная реакция. В реакции обратной транскрипции на матрице вирусной РНК строится комплиментарная ДНК (кДНК). В следующей за реакцией обратной транскрипции ПЦР происходит многократное избирательное удвоение целевого участка кДНК (амплификация). Амплифицируемый участок кДНК является маркерным, так как строго ограничен последовательностями ДНК-затравок (праймеров) без которых не возможно протекание ПЦР. Для детекции накопления продуктов амплификации в режиме реального времени помимо пары праймеров необходим также флуорисцентно-меченый ДНК-зонд. Сложность выбора праймеров и зонда обусловлена требованием их строгой видоспецифичности. В случае если выбранные олигонуклеотиды не обладают видовой специфичностью к целевому объекту, либо не обладают достаточной гомологией к целевой нуклеотидной последовательности, возможны ложноотрицательные результаты исследования. В случае если выбранные праймеры и зонды демонстрируют сродство к нецелевым последовательностям ДНК, то возможны ложноположительные результаты исследования. Правильный выбор сочетания пары праймеров и флуоресцентно-меченого ДНК-зонда позволяет осуществить строго специфическую амплификацию целевого фрагмента кДНК и провести детекцию накопления продуктов ПЦР в режиме реального времени.

В настоящее время на территории Российской Федерации существует единственный коммерческий набор для детекции кДНК ротовируса человека методом ПЦР "АмплиСенс®ОРВИ-скрин-FL" (ЦНИИ Эпидемиологии, г. Москва) - набор реагентов для выявления возбудителей острых респираторных вирусных инфекций человека (ОРВИ) (РНК респираторно-синцитиального вируса, метапневмовируса, вирусов парагриппа 1-4 типов, коронавирусов, ротовирусов, ДНК аденовирусов групп B, C и E и бокавируса в клиническом материале методом полимеразной цепной реакции (ПЦР) с гибридизационно-флуоресцентной детекцией).

Для ПЦР диагностики энтеровирусов используются ПЦР-тест-системы с детекцией методом электрофореза таких компаний, как ЗАО «БиоХимМак» (http://www.biochemmack.ru/product/moleculardiagnostics/infectious/), ЗАО «Литех» и наборы реагентов для ПЦР производства "ИзоГен" (http://www.lytech.ru/ catalog_69.htm). Набор с гибридизационно-флуоресцентной детекцией производит компания «ИнтерЛабСервис» (http://www.interlabservice.ru/catalog/ reagents/index.php?sid=678).

Для диагностики вирусов гепатита А методом ПЦР используется набор реагентов для выявления РНК вируса гепатита A (HAV) в клиническом материале и объектах окружающей среды методом полимеразной цепной реакции (ПЦР) с гибридизационно-флуоресцентной детекцией "АмплиСенс® HAV-FL.

Для диагностики вируса гепатита Е методом ПЦР используется набор реагентов для выявления РНК вируса гепатита E (HEV) в клиническом материале ООО «Лаборатория ИзоГен».

Наборы для диагностики аденовирусов, астро- и норовирусов методом ПЦР выпускаются компанией «ИнтерЛабСервис».

Наиболее близким аналогом (прототипом) является набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации РНК энтеровирусов, риновирусов, вирусов гепатита А и Е из водной среды методом мультиплексной полимеразной цепной реакции (патент РФ №2542968, МПК С12Q1/68, опубл. 27.02.2015 г.).

Однако и такой набор для мультиплексной ПЦР не обеспечивает идентификацию проб из водной среды с целью диагностики энтеровирусов, ротовирусов, вирусов гепатита А и Е, аденовирусов, норовирусов и астровирусов.

Таким образом, из уровня техники не известны мультиплексные ПЦР тест-системы для идентификации проб из водной среды с целью диагностики энтеровирусов, ротовирусов, вирусов гепатита А и Е, аденовирусов, норовирусов и астровирусов.

Техническим результатом является создание набора для мультиплексной ПЦР, обеспечивающего исследование проб водной среды с целью одновременного выявления в них энтеровирусов, ротовирусов, вирусов гепатита А и Е, аденовирусов, норовирусов и астровирусов.

Указанный технический результат достигается созданием набора олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации РНК ротовирусов, вирусов гепатита А и Е, энтеровирусов, аденовирусов, норовирусов и астровирусов из водной среды методом мультиплексной полимеразной цепной реакции, имеющих следующую структуру:

для выявления РНК ротовирусов:

- прямой (F1) и обратный (R1) праймеры:

F1: 5`- GATATTGGACCNTCTGATTCTGC -3`

R1: 5`- ATTGCTGTNGATGAATCCATAGACAC -3`

- флуоресцентно-меченый ДНК-зонд (Z1):

Z1: ROX-TTAGATCGAATGCAGTTAAGACAAACGC-BHQ2

для выявления РНК вируса гепатита А:

- прямой (F2) и обратный (R2) праймеры:

F2: 5`- GTAGGCTACGGGTGAAACCTCTT -3`

R2: 5`- CGGCGTTGAATGGTTTTTGT -3`

- флуоресцентно-меченый ДНК-зонд (Z2):

Z2: R6G-AGGGTAACAGCGGCGGATATTGGT-BHQ2

для выявления РНК вируса гепатита Е:

- прямой (F3) и обратный (R3) праймеры:

F3: 5`- CGGCRGTGGTTTCTGGGGT -3’

R3: 5`- GGTTGGTTGGATGAATATAGGG -3’

- флуоресцентно-меченый ДНК-зонд (Z3):

Z3: Cy5-TGATTCTCAGCCCTTCGCCCTCC-BHQ2

для выявления РНК энтеровирусов:

- прямой (F4) и обратный (R4) праймеры:

F4: 5`- AGTCTATTGAGCTARTTGGT -3’

R4: 5`- ACACGGACACCCAAAGTAGT -3’

- флуоресцентно-меченый ДНК-зонд (Z4):

Z4: FAM-CCTGAATGCGGCTAATCC-BHQ1

для выявления РНК аденовирусов:

- прямой (F5) и обратный (R5) праймеры:

F5: 5`- CCACGGTGGGGTTTCTAAACTT -3`

R5: 5`- CCCAGTGGTCTTACATGCACATC -3`

- флуоресцентно-меченый ДНК-зонд (Z1):

Z5: ROX-TGCACCAGACCCGGGCTCAG-BHQ2

для выявления РНК норовирусов:

- прямой (F6) и обратный (R6) праймеры:

F6: 5`- CAAGARACNATGTTCAGRTGGATGA -3`

R6: 5`- TCGACGCCATCTTCATTCACA -3`

- флуоресцентно-меченый ДНК-зонд (Z6):

Z6: R6G-TGGGAGGGCGATCGCAATCT-BHQ2

для выявления РНК астровирусов:

- прямой (F7) и обратный (R7) праймеры:

F7: 5`- AGTTGCTTGCTGCGTTCA -3’

R7: 5`- TTGCTAGCCATCACACTTCT -3’

- флуоресцентно-меченый ДНК-зонд (Z7):

Z7: Cy5-ACAGAAGAGCAACTCCATCGC-BHQ2,

где: присутствие в нуклеотидной последовательности пуринового основания R=A или G;

присутствие в нуклеотидной последовательности пиримидинового основания Y=T или C;

следующий альтернативный порядок следования нуклеотидов: N=A или C или G или T.

Олигодезоксирибонуклеотидные праймеры и флуоресцентно-меченые ДНК-зонды для идентификации ротовирусов, вирусов гепатита А и Е и энтеровирусов приготовлены в виде смеси в одной пробирке, а олигодезоксирибонуклеотидные праймеры и флуоресцентно-меченые ДНК-зонды для идентификации аденовирусов, норовирусов и астровирусов приготовлены в виде смеси в другой пробирке.

Перечень графических материалов. Фиг. 1. Результаты анализа энтеровирусов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал FAM). Фиг. 2. Результаты анализа вируса гепатита Е методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал Cy5). Фиг. 3. Результаты анализа вируса гепатита А методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал R6G). Фиг. 4. Результаты анализа ротовирусов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал ROX). Фиг. 5. Результаты анализа аденовирусов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал ROX). Фиг. 6. Результаты анализа астровирусов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал Cy5). Фиг. 7. Результаты анализа норовирусов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал R6G).

Апробация олигонуклеотидов была осуществлена с использованием лабораторной коллекции энтеровирусов, ротовирусов, вирусов гепатита А и Е, норовирусов, астровирусов и аденовирусов человека ФБУН ГНЦ ВБ «Вектор» (порядок проведения исследования одобрен этическим комитетом ФБУН ГНЦ ВБ «Вектор» (IRB 00001360)). Выбранные праймеры и ДНК-зонды обеспечивают надежный синтез целевых ДНК-фрагментов. Специфичность амплификации вирусной кДНК была подтверждена секвенированием.

Характеристика набора праймеров и участка амплифицируемой геномной РНК ротовирусов. Предлагаемые к патентованию праймеры фланкируют участок гена, кодирующего вирусный гликопротеин 1 (VP1-ген). В ПЦР амплифицируется фрагмент генома с 28117 по 28630 нуклеотид (513 п.н.). Использование в комплекте с диагностическими праймерами флуоресцентно-меченого ДНК-зонда позволяет производить детекцию накопления продуктов амплификации в режиме реального времени.

Характеристика набора праймеров и участка амплифицируемой геномной РНК энтеровирусов. Предлагаемые к патентованию праймеры комплементарны не кодирующей части геномной РНК (5”-UTR). В ПЦР амплифицируется фрагмент генома с 72 по 521 нуклеотид (449 п.н.). Использование в комплекте с диагностическими праймерами флуоресцентно-меченого ДНК-зонда позволяет производить детекцию накопления продуктов амплификации в режиме реального времени.

Характеристика набора праймеров и участка амплифицируемой геномной РНК вируса гепатита А. Предлагаемые к патентованию праймеры в ПЦР амплифицируют фрагмент генома с 311 по 421 нуклеотид (110 п.н.). Использование в комплекте с диагностическими праймерами флуоресцентно-меченого ДНК-зонда позволяет производить детекцию накопления продуктов амплификации в режиме реального времени.

Характеристика набора праймеров и участка амплифицируемой геномной РНК вируса гепатита Е. Предлагаемые к патентованию праймеры в ПЦР амплифицируют фрагмент генома с 5298 по 5370 нуклеотид (72 п.н.). Использование в комплекте с диагностическими праймерами флуоресцентно-меченого ДНК-зонда позволяет производить детекцию накопления продуктов амплификации в режиме реального времени.

Характеристика набора праймеров и участка амплифицируемой геномной РНК норовирусов. Предлагаемые к патентованию праймеры в ПЦР амплифицируют фрагмент генома с 4986 по 5084 нуклеотид (98 п.н.). Использование в комплекте с диагностическими праймерами флуоресцентно-меченого ДНК-зонда позволяет производить детекцию накопления продуктов амплификации в режиме реального времени.

Характеристика набора праймеров и участка амплифицируемой геномной РНК астровирусов. Предлагаемые к патентованию праймеры в ПЦР амплифицируют фрагмент генома с 4168 по 4349 нуклеотид (181 п.н.). Использование в комплекте с диагностическими праймерами флуоресцентно-меченого ДНК-зонда позволяет производить детекцию накопления продуктов амплификации в режиме реального времени.

Характеристика набора праймеров и участка амплифицируемой геномной РНК аденовирусов человека. Предлагаемые к патентованию праймеры в ПЦР амплифицируют фрагмент генома (hexon protein gene) с 21 по 152 нуклеотид (132 п.н.). Использование в комплекте с диагностическими праймерами флуоресцентно-меченого ДНК-зонда позволяет производить детекцию накопления продуктов амплификации в режиме реального времени.

В результате научных исследований достигнут следующий технический результат, а именно: разработан набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов, обеспечивающих надежную детекцию энтеровирусов, ротовирусов, вирусов гепатита А и Е, норовирусов, астровирусов и аденовирусов человека в образцах воды из окружающей среды методом мультиплексной полимеразной цепной реакцией (см. таблицу 1).

Таблица 1

Высокоспецифичные праймеры и зонды для детекции энтеровирусов человека, ротавирусов, вируса гепатита А, вируса гепатита Е, норовирусов, астровирусов и аденовирусов человека с помощью метода ПЦР в реальном времени.

Ротовирусы

Праймеры и зонд Последовательность (5` → 3`) Тm
(°С)
Размер ампликона, п.н.
F1 GATATTGGACCNTCTGATTCTGC 55 117
R1 ATTGCTGTNGATGAATCCATAGACAC 55
Z1 ROX-TTAGATCGAATGCAGTTAAGACAAACGC-BHQ2 61

Вирус гепатита А


Праймеры и зонд

Последовательность (5’ → 3’)
Тm
(°С)
Размер ампликона, п.н.
F2 GTAGGCTACGGGTGAAACCTCTT 54 162
R2 CGGCGTTGAATGGTTTTTGT 54
Z2 R6G-AGGGTAACAGCGGCGGATATTGGT-BHQ2 63

Вирус гепатита Е


Праймеры и зонд

Последовательность (5’ → 3’)
Тm
(°С)
Размер ампликона, п.н.
F3 CGGCRGTGGTTTCTGGGGT 57 200
R3 GGTTGGTTGGATGAATATAGGG 54
Z3 Cy5-TGATTCTCAGCCCTTCGCCCTCC-BHQ2 66

Энтеровирусы


Праймеры и зонд

Последовательность (5’ → 3’)
Тm
(°С)
Размер ампликона, п.н.
F4 AGTCTATTGAGCTARTTGGT 55 449
R4 ACACGGACACCCAAAGTAGT 55
Z4 FAM-CCTGAATGCGGCTAATCC-BHQ1 65

Аденовирусы

Праймеры и зонд Последовательность (5` → 3`) Тм,
(°С)
Размер ампликона, п.н.
F1 CCACGGTGGGGTTTCTAAACTT 55 117
R1 CCCAGTGGTCTTACATGCACATC 55
Z1 ROX-TGCACCAGACCCGGGCTCAG-BHQ2 61

Норовирусы


Праймеры и зонд

Последовательность (5’ → 3’)
Тm
(°С)
Размер ампликона, п.н.
F2 CAAGARACNATGTTCAGRTGGATGA 54 162
R2 TCGACGCCATCTTCATTCACA 54
Z2 R6G-TGGGAGGGCGATCGCAATCT-BHQ2 66

Астровирусы


Праймеры и зонд

Последовательность (5’ → 3’)
Тm
(°С)
Размер ампликона, п.н.
F3 AGTTGCTTGCTGCGTTCA 55 200
R3 TTGCTAGCCATCACACTTCT 55
Z3 Cy5-ACAGAAGAGCAACTCCATCGC-BHQ2 66

Примечание. Где:

присутствие в нуклеотидной последовательности пуринового основания R=A или G;

присутствие в нуклеотидной последовательности пиримидинового основания Y=T или C;

следующий альтернативный порядок следования нуклеотидов: N=A или C или G или T.

Конструирование внутреннего контрольного образца. В качестве внутреннего контрольного образца была использована защищенная двухцепочечная РНК фага MS-2. Псевдофаг получали клонированием под T5 фаговый промотер фрагмента 370 п.н. кДНК фага MS-2 в вектор pQE31. Синтез матричной РНК индуцировали IPTG. Фаговые частицы очищали центрифугированием.

Внутренний контрольный образец (ВКО), позволяет компенсировать ингибирование и контролировать процессы пробоподготовки и амплификации, что обеспечивает более точное определение РНК в каждом анализируемом образце. ВКО представляет собой неинфекционную защищенную РНК бактериофага MS2 (концентрация 105 копий РНК MS2/мл).

Выделение вируссодержащего материала из образцов воды.

Пробу воды готовили 1000-кратным разведением клинического образца, содержащего вирус, в дистилированной и автоклавированнной воде. Пробы подвергались фильтрации через подобранную оптимальную фильтрационную систему. Используемые в работе системы для фильтрации воды с целью дальнейшего исследования на наличие вирусного генетического материала:

1. Мембранный фильтрующий модуль МФМ-0142.

2. Фильтрационная система Midisart 2000 (Sartorius, Германия).

3. Система вакуумной фильтрации (Sartorius, Германия).

4. Система вакуумной фильтрации с приставкой предварительной фильтрации (Sartorius, Германия).

Для концентрирования вирусов с фильтрационными системами использовали мембраны марки ММПА+-020-142 (ООО НПП «Технофильтр», Россия). В качестве системы сравнения использовали адсорбирующее картриджи из набора для отбора проб и индикации вирусов в питьевой воде ГУ «Республиканский научно-практический центр эпидемиологии и микробиологии» (Республика Беларусь).

Фильтрацию воды проводили после предварительного добавления в нее 10-кратных разведений вируссодержащих образцов с известной концентрацией вируса, после чего проводили элюцию концентрированного вируссодержащего материала из мембраны и затем проводили выделение вирусной РНК (ДНК). Выделение РНК проводили методом фенол-хлороформной экстракции (Евроген, Россия), после чего в реакции обратной транскрипции (наборы для обратной транскрипции, Изоген, Россия) получали кДНК и проводили ПЦР в режиме реального времени, используя мультиплексный вариант тест-системы. Оптимальными считались те способы фильтрации воды и выделения вирусной РНК, при которых достигалась наибольшая чувствительность.

Пробу воды готовили 1000-кратным разведением клинического образца, содержащего ротавирус в дистилированной и автоклавированнной воде. Пробы подвергались фильтрации через подобранную оптимальную фильтрационную систему. После чего производилась элюция с мембраны, выделение РНК, обратная транскрипция и ПЦР в режиме реального времени с использованием мультиплексного варианта тест-систем. Наиболее удобной в работе оказалась система вакуумной фильтрации с приставкой предварительной фильтрации (Sartorius, Германия), поскольку одновременно позволяла проводить отсечку бактериального компонента из образцов воды (на первый 0.22 мкм фильтр) и сорбцию вирусного материала на мембрану марки ММПА+-020-142 (ООО НПП «Технофильтр», Россия). Мембраны обладают повышенной сорбционной способностью по отношению к вирусам, колифагам и пирогенам. Мембраны микропористые полиамидные с положительным дзета-потенциалом изготовленные на основе полиамида (Nylon-6 и Nylon-66). Мембраны ММПА+ имеют крупноячеистое строение с тонкими микропористыми перегородками, что предопределяет непрерывность структуры мембран и обеспечивает прочность и эластичность в сухом и смоченном виде. Благодаря высокой пористости и контролируемому размеру пор мембраны обладают высокой эффективностью удержания микрочастиц при большой скорости фильтрации.

Экстракция вирусной РНК

Предварительную инактивацию образцов и выделение вирусной РНК проводили в условиях, регламентированных МУ 1.3. 2569 -09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности».

Вирусную РНК выделяли из 100 мкл вируссодержащей жидкости фенол-хлороформным реагентом, с использованием набора «Евроген» (г. Москва) согласно инструкции производителя.

Реакция обратной транскрипции

Синтез комплементарной ДНК (кДНК) проводили на матрице суммарной РНК с использованием набора реагентов «ИзоГен» (г. Москва) согласно инструкции производителя.

Проведение полимеразной цепной реакции

Условия проведения амплификации оптимизировали по концентрации ионов магния, концентрации праймеров и зондов в реакционной смеси, а также, по температуре отжига праймеров.

Реакцию амплификации проводили в 30 мкл смеси для ПЦР (таб. 1), содержащей 1×Taq буфер для амплификации, 2.5 мМ MgCl2, 0.17 мМ каждого из нуклеозидтрифосфатов, 1.5 активных единиц Smart Taq ДНК-полимеразы (все компоненты ООО «Лаборатория МЕДИГЕН»), 20 пМ прямого и обратного праймеров и 8 пМ флуоресцентного ДНК-зонда.

Таблица 2

ПЦР-смесь А (из расчета на одну пробирку)

Компонент Объем, мкл
ПЦР-буфер×10 3
дНТФ (5 мМ) 1
MgCl2 (50 мМ) 1.5
Hot Start Taq ДНК-полимераза 0.3
Смесь прямых праймеров – F1 (по 10 нМ) 2
Смесь обратных праймеров – R1 (по 10 нМ) 2
Смесь ДНК-зондов – Z1 (по 15 нМ) 0.5
Образец (кДНК) 3
diH2O 16.7

ПЦР-смесь В (из расчета на одну пробирку)

Компонент Объем, мкл
ПЦР-буфер×10 3
дНТФ (5 мМ) 1
MgCl2 (50 мМ) 1.5
Hot Start Taq ДНК-полимераза 0.3
Смесь прямых праймеров – F2 (по 10 нМ) 2
Смесь обратных праймеров – R3 (по 10 нМ) 2
Смесь ДНК-зондов – Z2 (по 15 нМ) 0.5
Образец (кДНК) 3
diH2O 16.7

ПЦР в режиме реального времени проводили согласно программе амплификации Таблицы 3. Детекцию интенсивности флуоресценции проводили по каналам – Green (FAM, 470 nm /510 nm), Yellow (R6G, 530 нм / 560 нм), Red (Cy5, 625 нм / 660 нм) и Orange (ROX, 585 нм / 605 нм), в двух пробирках:

Пробирка А: смесь олигонуклеотидных праймеров и флуоресцентно-меченых зондов, обеспечивающих детекцию энтеровирусов, ротовирусов, вирусов гепатита А и Е.

Пробирка В: смесь олигонуклеотидных праймеров и флуоресцентно-меченых зондов, обеспечивающих детекцию норовирусов, астровирусов, аденовирусов и ВКО (внутренний контольный образец).

Результаты оценивали по наличию флюоресценции до 30 цикла (фиг. 1-7).

Таблица 3

Программа амплификации

Операция T, °C T, мин:с
1 Hold/Активация HotStart-Taq-ДНК-полимеразы 95 05:00
2 Cycling 1/Циклирование 1 (10 циклов), без детекции флюоресценции. 95 00:10
55 00:30
72 00:20
3 Cycling 2/Циклирование 2 (40 циклов), с детекцией флюоресценции по каналам FAM, ROX, Cy5 и R6G. 95 00:10
55 00:30 детекция
72 00:20

На фиг. 1-7 представлены результаты анализа образцов методом ПЦР в реальном времени. В эксперименте методом ПЦР в реальном времени были проанализированы последовательные десятикратные разведения кДНК энтеровирусов, ротовирусов, вирусов гепатита А и Е, аденовирусов, норовирусов и астровирусов.

На фиг. 1 приведены результаты анализа энтеровирусов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал FAM).

Примечание:

1 - положительный контрольный образец (плазмидная конструкция, содержащая кДНК энтеровирусов);

2 - кДНК энтеровируса, (разведение 1:100);

3 - кДНК энтеровируса, (разведение 1:1000);

4 - кДНК энтеровируса, (разведение 1:10000);

5 - отрицательный контрольный образец (однократный ТЕ-буфер).

На фиг. 2 приведены результаты анализа вируса гепатита Е методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал Cy5).

Примечание:

1. положительный контрольный образец (плазмидная конструкция, содержащая кДНК гепатита Е);

2. кДНК гепатита Е, (разведение 1:100);

3. кДНК гепатита Е, (разведение 1:1000);

4. кДНК гепатита Е, (разведение 1:10000);

5. отрицательный контрольный образец (однократный ТЕ-буфер)

На фиг. 3 представлены езультаты анализа вируса гепатита А методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал R6G).

Примечание:

1 - положительный контрольный образец (плазмидная конструкция, содержащая кДНК вируса гепатита А);

2 - кДНК вируса гепатита А, (разведение 1:100);

3 - кДНК вируса гепатита А, (разведение 1:1000);

4 - кДНК вируса гепатита А, (разведение 1:10000);

5 - отрицательный контрольный образец (однократный ТЕ-буфер).

На фиг. 4 приведены результаты анализа ротовирусов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал ROX).

Примечание:

1. положительный контрольный образец (плазмидная конструкция, содержащая кДНК ротовируса);

2. кДНК ротовируса, (разведение 1:100);

3. кДНК ротовируса, (разведение 1:1000);

4. кДНК ротовируса, (разведение 1:10000);

5. отрицательный контрольный образец (однократный ТЕ-буфер).

На фиг. 5 представлены результаты анализа аденовирусов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал ROX).

Примечание:

1 - положительный контрольный образец (плазмидная конструкция, содержащая кДНК аденовирусов);

2 - кДНК аденовирусов, (разведение 1:102);

3 - кДНК аденовирусов, (разведение 1:103);

4 - кДНК аденовирусов, (разведение 1:104);

5 - кДНК аденовирусов, (разведение 1:105);

6 - кДНК аденовирусов, (разведение 1:106);

7 - кДНК аденовирусов, (разведение 1:107);

8 - кДНК аденовирусов, (разведение 1:108);

9 - отрицательный контрольный образец (однократный ТЕ-буфер).

На фиг. 6 представлены результаты анализа астровирусов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал Cy5).

Примечание:

1 - кДНК астровирусов, (разведение 1:101);

2 - кДНК астровирусов, (разведение 1:102);

3 - кДНК астровирусов, (разведение 1:103);

4 - кДНК астровирусов, (разведение 1:104);

5 - кДНК астровирусов, (разведение 1:106);

6 - кДНК астровирусов, (разведение 1:107);

7 - кДНК астровирусов, (разведение 1:108);

8 - отрицательный контрольный образец (однократный ТЕ-буфер).

На фиг. 7 приведены результаты анализа норовирусов методом ПЦР в реальном времени с использованием патентуемых олигонуклеотидов (канал R6G).

Примечание:

1 - положительный контрольный образец (плазмидная конструкция, содержащая кДНК норовирусов);

2 - кДНК норовирусов, (разведение 1:102);

3 - кДНК норовирусов, (разведение 1:103);

4 - кДНК норовирусов, (разведение 1:104);

5 - кДНК норовирусов, (разведение 1:105);

6 - кДНК норовирусов, (разведение 1:106);

7 - кДНК норовирусов, (разведение 1:107);

8 - отрицательный контрольный образец (однократный ТЕ-буфер).

Заявленная чувствительность известных наборов (аналогов и прототипа) не более 103 геномных эквивалентов (ГЭ) в образце. Разработанный авторами заявляемый набор реагентов для одновременного выявления энтеровирусов, ротовирусов, вирусов гепатита А и Е, аденовирусов, норовирусов и астровирусов методом ПЦР в реальном времени также имеет чувствительность – не более 103 геномных эквивалентов (ГЭ) в образце, но при этом позволяет реализовать большую мультиплексность – 7 инфекционных агентов (передающихся через воду) в одном образце, что подтверждает получение заявленного технического результата.

1. Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации РНК ротовирусов, вирусов гепатита А и Е, энтеровирусов, аденовирусов, норовирусов и астровирусов из водной среды методом мультиплексной полимеразной цепной реакциии, имеющих следующую структуру:

для выявления ротовирусов:

- прямой (F1) и обратный (R1) праймеры:

F1: 5`- GATATTGGACCNTCTGATTCTGC -3`

R1: 5`- ATTGCTGTNGATGAATCCATAGACAC -3`

- флуоресцентно-меченый ДНК-зонд (Z1):

Z1: ROX-TTAGATCGAATGCAGTTAAGACAAACGC-BHQ2

для выявления вируса гепатита А:

- прямой (F2) и обратный (R2) праймеры:

F2: 5`- GTAGGCTACGGGTGAAACCTCTT -3`

R2: 5`- CGGCGTTGAATGGTTTTTGT -3`

- флуоресцентно-меченый ДНК-зонд (Z2):

Z2: R6G-AGGGTAACAGCGGCGGATATTGGT-BHQ2

для выявления вируса гепатита Е:

- прямой (F3) и обратный (R3) праймеры:

F3: 5`- CGGCRGTGGTTTCTGGGGT -3`

R3: 5`- GGTTGGTTGGATGAATATAGGG -3`

- флуоресцентно-меченый ДНК-зонд (Z3):

Z3: Cy5-TGATTCTCAGCCCTTCGCCCTCC-BHQ2

для выявления энтеровирусов:

- прямой (F4) и обратный (R4) праймеры:

F4: 5`- AGTCTATTGAGCTARTTGGT -3`

R4: 5`- ACACGGACACCCAAAGTAGT -3`

- флуоресцентно-меченый ДНК-зонд (Z4):

Z4: FAM-CCTGAATGCGGCTAATCC-BHQ1

для выявления аденовирусов:

- прямой (F5) и обратный (R5) праймеры:

F5: 5`- CCACGGTGGGGTTTCTAAACTT -3`

R5: 5`- CCCAGTGGTCTTACATGCACATC -3`

- флуоресцентно-меченый ДНК-зонд (Z1):

Z5: ROX-TGCACCAGACCCGGGCTCAG-BHQ2

для выявления норовирусов:

- прямой (F6) и обратный (R6) праймеры:

F6: 5`- CAAGARACNATGTTCAGRTGGATGA -3`

R6: 5`- TCGACGCCATCTTCATTCACA -3`

- флуоресцентно-меченый ДНК-зонд (Z6):

Z6: R6G-TGGGAGGGCGATCGCAATCT-BHQ2

для выявления астровирусов:

- прямой (F7) и обратный (R7) праймеры:

F7: 5`- AGTTGCTTGCTGCGTTCA -3`

R7: 5`- TTGCTAGCCATCACACTTCT -3`

- флуоресцентно-меченый ДНК-зонд (Z7):

Z7: Cy5-ACAGAAGAGCAACTCCATCGC-BHQ2,

где: присутствие в нуклеотидной последовательности пуринового основания R=A или G;

присутствие в нуклеотидной последовательности пиримидинового основания Y=T или C;

следующий альтернативный порядок следования нуклеотидов: N=A или C или G или T.

2. Набор по п. 1, отличающийся тем, что олигодезоксирибонуклеотидные праймеры и флуоресцентно-меченые ДНК-зонды для идентификации ротовирусов, вирусов гепатита А и Е и энтеровирусов приготовлены в виде смеси реагентов в одной пробирке.

3. Набор по п. 1, отличающийся тем, что олигодезоксирибонуклеотидные праймеры и флуоресцентно-меченые ДНК-зонды для идентификации аденовирусов, норовирусов и астровирусов приготовлены в виде смеси реагентов в одной пробирке.



 

Похожие патенты:

Изобретение относится к биохимии. Описана популяция панкреатических эндокринных клеток, которые соэкспрессируют NKX6.1 и инсулин, и где менее 10% клеток в популяции экспрессируют глюкагон, где популяцию панкреатических эндокринных клеток получают дифференцировкой плюрипотентных стволовых клеток человека, полученных из устойчивых линий эмбриональных стволовых клеток человека, где указанная дифференцировка включает первую стадию культивирования плюрипотентных стволовых клеток в среде, содержащей агонист рецептора TGF-β, выбранный из группы, состоящей из активина А, активина В, TGFβ-I, TGFβ-II, GDF-8 и GDF-11, в концентрации от около 2 нг/мл до 100 нг/мл, и дополнительную стадию культивирования клеток панкреатической эндодермы в среде, содержащей от 20 нМ до 500 нМ (2S,5S)-(Е,Е)-8-(5-(4-(трифторметил)фенил)-2,4-пентадиеноиламино)бензолактам.

Настоящее изобретение относится к биохимии, в частности к способу модификации гена LacZ из Escherichia coli. Для осуществления способа фрагмент ДНК, содержащий кодирующую область гена LacZ, нарабатывают с помощью полимеразной цепной реакции с использованием олигонуклеотидного праймера, позволяющего ввести дополнительный кодон GGA, кодирующий глицин, непосредственно после инициаторного кодона ATG.

Изобретение относится к области биохимии, а именно к способу определения последовательности молекулы нуклеиновой молекулы-мишени. Получают олигонуклеотидный зонд захвата, присоединенный к кодированному микроносителю.

Изобретение относится к области медицины. Предложен способ определения вероятности рецидивирования рака молочной железы у субъекта - млекопитающего, включающий измерение уровня экспрессии РНК-транскриптов KI67, CCND1, PTEN, NDRG1, TERT в биологическом образце, содержащем опухолевые клетки и определение показателя рецидивирования для указанного субъекта с учетом измеренных уровней экспрессии генов как точки на графике с двумя координатами X и Y.

Изобретение относится к области биохимии, в частности к трансгенной растительной клетке сои, семени и растению сои, которые предназначены для получения растения, имеющего устойчивость к гербициду, выбранному из группы, состоящей из 2,4-D, глифосата, глюфосината и их комбинаций.

Изобретение относится к медицине и касается способа прогнозирования возникновения рецидива вульвы I и II стадии. Предложенный способ заключается в определении в ткани опухоли ДНК вируса папилломы человека методом полимеразной цепной реакции.

Изобретение относится к области молекулярной биологии и биотехнологии. Изобретение представляет собой набор 5'-фосфорилированных олигонуклеотидных праймеров для амплификации методом полимеразной цепной реакции (ПЦР) полной кодирующей последовательности гена мембранного протеина системы секреции III типа (TTSS) HrcV возбудителя мелиоидоза.

Изобретение относится к области молекулярной биологии и биотехнологии. Изобретение представляет собой набор 5'-фосфорилированных олигонуклеотидных праймеров для амплификации методом полимеразной цепной реакции гена ompA/motB, кодирующего поверхностный протеин OmpA/MotB возбудителя мелиоидоза.

Группа изобретений относится к области биотехнологии, в частности к детекции нуклеиновокислотной последовательности-мишени в анализе с PCE-SH (гибридизацией сигнального олигонуклеотида, зависящей от расщепления и удлинения зондирующего и метящего олигонуклеотида (РТО)).

Изобретение относится к биохимии. Описаны способы повышения экспрессии полинуклеотида NANOG с помощью олигонуклеотидов длиной от 19 до 30 нуклеотидов.

Изобретение относится к биохимии. Описаны олигонуклеотиды, модулирующие экспрессию фактора роста гепатоцитов (ФРГ), в частности, посредством нацеленного взаимодействия с природными антисмысловыми полинуклеотидами фактора роста гепатоцитов (ФРГ).

Изобретение относится к области молекулярной биологии. Предложены рекомбинантная генетическая конструкция, клонированная в лентивирусный или ретровирусный вектор по сайтам рестрикции XpaI и XhoI и направленная на подавление экспрессии онкогена C-KIT в клетках нейробластом, и применение указанной конструкции для регуляции активности гена C-KIT и его белкового продукта.

Изобретение относится к биохимии. Описан способ повышения экспрессии полинуклеотида пирролин-5-карбоксилатредуктазы 1(PYCR1) в клетках или тканях пациента in vivo или in vitro, включающий: приведение указанных клеток или тканей в контакт с олигонуклеотидом, в частности с олигонуклеотидом малой интерферирующей РНК (миРНК), составляющим в длину от 20 до 30 нуклеотидов, который специфически гибридизуется с и нацелен на участок природного антисмыслового PYCR1.

Изобретение относится к биохимии. Описаны способы повышения экспрессии полинуклеотида NANOG с помощью олигонуклеотидов длиной от 19 до 30 нуклеотидов.

Настоящее изобретение относится к области биотехнологии, конкретно к получению вариантов альбумина, у которых изменен период полужизни в плазме по сравнению с исходным альбумином, и может быть использовано в медицине.

Изобретение относится к области биохимии и медицины, в частности к способу выявления кандидатных генов для проведения популяционных исследований генетического полиморфизма у детей, проживающих в условиях стронциевой геохимической провинции.

Изобретения относятся к ветеринарной вирусологии и биотехнологии, а именно к генетической инженерии. Предложены синтетические олигонуклеотидные праймеры для выявления РНК атипичного пестивируса крупного рогатого скота и способ их применения.

Изобретение относится к области биотехнологии, а именно к синтетическим олигонуклеотидным зондам и праймерам для выявления ДНК вируса африканской чумы свиней. Предложенные синтетические олигонуклеотидные праймеры и флуоресцентно меченый зонд с внутренним гасителем комплементарны консервативной области гена Р30 (CP204L) вируса африканской чумы свиней и имеют следующий нуклеотидный состав: F1 р30 5'-GTTACGACCGCTATAAAAACA-3' R1 р30 5'-TTCCATTCTTCTTGAGACCTG-3' Z1 (int) p30 5'-(FAM)TACTGTT(RTQ1)AAGTATGATATTGTGA(BHQ1)-3' Предложенное изобретение может быть использовано в генодиагностике инфекционных болезней свиней и ветеринарной вирусологии.

Группа изобретений относится к области биотехнологии и представлена набором олигонуклеотидных зондов для профилирования микробиоты желудочно-кишечного тракта (ЖКТ), где указанный набор включает в частности (a) олигонуклеотид, состоящий из (ai) нуклеотидной последовательности, выбранной из ACGCTTGCACCCT (SEQ ID NO: 1) необязательно с не более тремя замещенными основаниями или AGGGTGCAAGCGT (SEQ ID NO: 27) необязательно с не более тремя замещенными основаниями, и (aii) 0-5 нуклеотидов в дополнение к (ai), где олигонуклеотид согласно (а) способен гибридизоваться с SEQ ID NO: 27 или SEQ ID NO: 1, соответственно, в строгих условиях гибридизации.

Изобретение относится к области биотехнологии и может быть использовано для получения вариантов плазминогена и плазмина. Получают вариант плазминогена, содержащий сайт активации и каталитический домен, в котором каталитический домен содержит замену валина на изолейцин в положении 1 каталитического домена плазмина человека или в положении, соответствующем таковому в каталитическом домене плазмина, отличном от плазмина человека, где указанный каталитический домен плазмина человека начинается с аминокислоты валин в положении 1, которая является той же аминокислотой валин, которая находится в положении 562 Glu-плазминогена человека с SEQ ID NO: 1.

Изобретение относится к биохимии. Описаны олигонуклеотиды, повышающие экспрессию гена фактора роста фибробластов 21 (FGF21), путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами фактора роста фибробластов 21 (FGF21). Настоящее изобретение также относится к применению описанных олигонуклеотидов для лечения заболеваний и расстройств, связанных с экспрессией FGF21. Изобретение расширяет арсенал средств, направленных на лечение заболеваний и расстройств, связанных с экспрессией FGF21. 5 н. и 21 з.п. ф-лы, 2 ил., 3 пр., 1 табл.

Изобретение относится к наборам олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации генетического материала методом мультиплексной ПЦР. Представленный набор содержит олигодезоксирибонуклеотидные праймеры и флуоресцентно-меченые ДНК-зонды для идентификации таких РНК вирусов, как энтеровирусы, ротовирусы, вирусы гепатита А и Е, аденовирусы, норовирусы и астровирусы. Изобретение может быть использовано в исследовании проб водной среды с целью выявления в них энтеровирусов, ротовирусов, вирусов гепатита А и Е, аденовирусов, норовирусов и астровирусов. 2 з.п. ф-лы, 3 табл., 7 ил.

Наверх