Набор олигонуклеотидов для диагностики частых мутаций в гене capn3, ответственном за поясно-конечностную мышечную дистрофию 2а типа

Изобретение относится к области биохимии. Предложен набор олигонуклеотидов для детекции мутаций c.598_612del и c.550delA гена CAPN3. Обе или одна из данных мутаций встречается хотя бы на одной из хромосом в 81% случаев среди всех российских больных поясно-конечностной мышечной дистрофией 2А типа (ПКМД 2А). Изобретение позволяет провести эффективную диагностику двух наиболее частых мутаций (c.598_612del и c.550delA) гена CAPN3. 1 ил.

 

Изобретение относится к области медицины и биотехнологии, конкретно к молекулярной биологии и генетике.

Поясно-конечностные прогрессирующие мышечные дистрофии (ПКМД) - группа клинически полиморфных и генетически гетерогенных заболеваний, характеризующихся преимущественным поражением мышц тазового и плечевого поясов. Частота всех ПКМД колеблется в различных популяциях от 5 до 70 больных на 1 млн населения. Вследствие того, что белковые продукты генов, мутации в которых приводят к развитию аутосомно-рецессивных ПКМД, участвуют в одном патогенетическом процессе, клинические проявления всех генетических вариантов этой группы заболеваний характеризуются значительным сходством, что затрудняет их дифференциальную диагностику и снижает эффективность медико-генетического консультирования. Показано, что в большинстве европейских популяций наиболее распространенным генетическим вариантом ПКМД с аутосомно-рецессивным типом наследования является 2А тип (OMIM: 253600), обусловленный мутациями в гене кальпаина 3 (CAPN3), на долю которого приходится от 30% до 40% всех случаев этой группы заболеваний (Canki-Klain N. et al (2004). Prevalence of the 550delA mutation in calpainopathy (LGMD 2A) in Croatia // Am J Med Genet - 2004 - 125A: 152-6; Duno M. et al cDNA analyses of CAPN3 enhance mutation detection and reveal a low prevalence of LGMD2A patients in Denmark // Eur J Hum Genet - 2008 - 16: 935-40).

Показано, что у жителей РФ с ПКМД 2А наиболее часто встречаются мутации c.598_612del и c.550delA - обе или одна из которых встречается хотя бы на одной из хромосом в 81% случаев среди всех больных ПКМД2А (56% хромосом с мутациями) (Рыжкова О.П. и др. Клинико-генетические характеристики поясно-конечностной прогрессирующей мышечной дистрофии 2А типа // Медицинская генетика. - 2011. - Т. 10, №1: 15-21).

На сегодняшний день для детекции мутаций гена CAPN3 у больных ПКМД 2А применяются следующие методики.

Метод анализа конформационного полиморфизма одноцепочечных фрагментов ДНК (SSCP) (Fanin М. et al How to tackle the diagnosis of limb-girdle muscular dystrophy 2A. // Eur J Hum Genet. - 2009 - 17(5):598-603). Недостатки: низкая точность, высокая трудоемкость исследования, необходимость подтверждения выявленных изменений прямым автоматическим секвенированием по Сенгеру.

Секвенирование по Сенгеру (Saenz A. et al. LGMD2A: genotype-phenotype correlations based on a large mutation al survey on the calpain 3 gene. // Brain. - 2005 - 128(Pt 4):732-742.; K. et al Autosomal recessive limb-girdle muscular dystrophies in the Czech Republic. // BMC Neurol. - 2014 - Aug 19; 14:154). Недостатки: высокая стоимость исследования, трудоемкость проведения анализа, необходимость специальной высокотехнологичной аппаратуры.

Полногеномное/экзомное секвенирование нового поколения (NGS) (Nigro V, Savarese М. Genetic basis of limb-girdle muscular dystrophies: the 2014 update. // Acta Myol. - 2014 - May; 33(1):1-12). Недостатки: высокая стоимость исследования, трудоемкость проведения анализа, необходимость специальной высокотехнологичной аппаратуры, необходимость биоинформационной платформы для обработки результатов, необходимость проверки выявленных изменений прямым автоматическим секвенированием по Сенгеру.

Задачей заявляемого изобретения является создание оптимального набора последовательностей олигонуклеотидов для анализа мутаций гена CAPN3, ответственного за ПКМД 2А исходя из частот мутаций среди пациентов в Российской Федерации.

Задача решается путем создания оптимального набора последовательностей олигонуклеотидов для детекции мутаций c.598_612del и c.550delA гена CAPN3.

Техническим результатом заявленного изобретения является создание оптимального набора последовательностей олигонуклеотидов для детекции мутаций c.598_612del и c.550delA гена CAPN3 с использованием мультиплексной полимеразной цепной реакции (ПЦР) с визуализацией результата методом электрофореза в полиакриамидном геле.

Технический результат достигается подбором оптимального набора последовательностей олигонуклеотидов для мультиплексной ПЦР мутаций c.598_612del и c.550delA гена CAPN3, имеющих следующий нуклеотидный состав:

SEQ ID NO 1 5'-GGTGAAAACCAGTTGATTGTTGTAC-3'

SEQ ID NO 2 5'-GAACTCATTGCGGTGGTTGGAC-3'

SEQ ID NO 3 5'-CGTGGTTATAGATGACTGCCTGC-3'.

На первом этапе на основе нуклеотидной последовательности гена CAPN3 (NCBI Reference Sequence: NM_000070.2) были подобраны три праймера SEQ ID NO 1-3. Так как мутации c.598_612del и c.550delA находятся друг от друга на расстоянии 48 н.п. для их детекции в одной реакции была подобрана одна последовательность прямого и две последовательности обратных праймеров, фланкирующих области интересующих мутаций, таким образом, чтобы продукты амплификации с нормальных и мутантных аллелей имели разницу длин, достаточную для детекции в ПААГ.

Изобретение поясняется фигурой. На фигуре представлены результаты электрофоретического разделения продуктов мультиплексной ПЦР. При отсутствии в образце ДНК мутаций c.598_612del и c.550delA в ПААГ визуализируются два фрагмента с длинами 51 и 179 пар нуклеотидов (п.н.), в случае присутствия в образце мутации c.598_612del в гетерозиготном состоянии и отсутствия мутации c.550delA - три фрагмента длиной 51, 164 и 179 п.н., при наличии мутации c.598_612del в гомозиготном состоянии и отсутствии мутации c.550delA - два фрагмента 51 и 164 п.н., при мутации c. 550delA в гетерозиготном состоянии и отсутствии c.598_612del - три фрагмента длиной 50, 51 и 179 н.п., при мутации c.550delA в гомозиготном состоянии и отсутствии c.598_612del - два фрагмента длиной 50 и 179 н.п, при наличии в образце мутаций c.598_612del и c.550delA в компаунд-гетерозиготном состоянии визуализируются 4 фрамента длинами 50, 51, 164 и 179 н.п.

Для проведения молекулярно-генетического исследования ДНК выделяется из лимфоцитов периферической крови человека с использованием набора реактивов выделения DNA Prep 100 (DIAtom™) по протоколу производителя. Для приготовления растворов, необходимых для проведения ПЦР, использовались импортные реагенты высокой степени очистки. Последовательности олигонуклеотидных праймеров были синтезированы ЗАО «Евроген», г. Москва. Амплификацию всех исследуемых фрагментов ДНК проводили методом ПЦР на программируемом термоциклере МС2 фирмы «ДНК-технология» (Россия) в объеме 25 μl реакционной смеси следующего состава: 20-100 нг геномной ДНК; по 0.25 μМ каждого оригинального олигопраймера (SEQ ID NO: 1-3); по 200 μМ каждого нуклеозидтрифосфата; 1,0 единица активности ДНК-полимеразы Biotaq («БиоМастер»); буфер для ПЦР (67 mM Tris-HCl; 16.6 mM (NH4)2SO4; 0.01% Twin-20; рН 8.8); 6,0 mM MgCl2; 20-30 μl минерального масла.

Параметры ПЦР были следующие: денатурация двухцепочечной ДНК при t=94°C в течение 5 минут, далее 30 циклов полимеразной цепной реакции t=94°C - 30 секунд, t=65°C - 30 секунд, t=72°C - 30 секунд, окончательная элонгация при t=72°C в течение 5 минут.

Визуализацию результатов ПЦР производили в 10% геле с соотношением акриламида (АА) и бисакриламида (БА) 19:1. Для заливки 10% ПААГ готовили раствор следующего состава: 16,7 мл 30%-ного раствора АА и БА; 5 мл 10xTBE; 28,3 мл дистиллированной воды. Непосредственно перед заливкой геля в раствор добавляли 400 мкл 10%-ного персульфата амония и 48 мкл ТЕМЕД. В качестве электрофорезного буфера использовали 1xTBE. Проводили префорез в течение 20 мин. Пробы для нанесения на гель готовились следующим образом: 10 мкл смеси после ПЦР-реакции смешивали с 2 мкл буфера для нанесения. Состав буфера для нанесения проб: 25% бромфенолового синего; 25% ксилолцианола; 30% глицерина; 20% дистиллированной воды. Проводили электрофорез при 15-18 В/см в течение 3 часов. В качестве маркера молекулярного веса использовали ДНК фага λ, рестрицированную PstI.

После разделения фрагментов гель окрашивали в растворе бромистого этидия (0,1 мкг/мл в 1xTBE) в течение 20 минут, промывали водой. Результаты исследования регистрировались на гель-документирующей системе GelDoc® 2000.

Таким образом, представленный материал показывает, что предлагаемый способ позволяет эффективно детектировать две наиболее частые мутации c.598_612del и c.550delA гена CAPN3, обе или одна из которых встречается хотя бы на одной из хромосом в 81% случаев среди всех больных ПКМД2А. Применение данного изобретения позволяет оптимизировать молекулярно-генетическую диагностику поясно-конечностных мышечных дистрофий. Низкая себестоимость и простота исследования позволяют применять данный способ детекции практически в любой ПЦР-лаборатории с минимальным набором оборудования и реактивов.

ПЕРЕЧЕНЬ НУКЛЕОТИДОВ

Набор олигонуклеотидов для детекции мутаций c.598_612del и c.550delA гена CAPN3, обе или одна из которых встречается хотя бы на одной из хромосом в 81% случаев среди всех российских больных ПКМД2А, где последовательности олигонуклеотидов имеют следующий нуклеотидный состав:

SEQ ID NO 1 5'-GGTGAAAACCAGTTGATTGTTGTAC-3'

SEQ ID NO 2 5'-GAACTCATTGCGGTGGTTGGAC-3'

SEQ ID NO 3 5'-CGTGGTTATAGATGACTGCCTGC-3'.



 

Похожие патенты:

Группа изобретений относится к биотехнологии, в частности к устройству и способу для автоматического анализа биологических образцов, обеспечивающих выполнение всех необходимых операций для анализа биологических образцов в режиме реального времени.

Изобретение относится к наборам олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации генетического материала методом мультиплексной ПЦР.

Изобретение относится к биохимии. Описана популяция панкреатических эндокринных клеток, которые соэкспрессируют NKX6.1 и инсулин, и где менее 10% клеток в популяции экспрессируют глюкагон, где популяцию панкреатических эндокринных клеток получают дифференцировкой плюрипотентных стволовых клеток человека, полученных из устойчивых линий эмбриональных стволовых клеток человека, где указанная дифференцировка включает первую стадию культивирования плюрипотентных стволовых клеток в среде, содержащей агонист рецептора TGF-β, выбранный из группы, состоящей из активина А, активина В, TGFβ-I, TGFβ-II, GDF-8 и GDF-11, в концентрации от около 2 нг/мл до 100 нг/мл, и дополнительную стадию культивирования клеток панкреатической эндодермы в среде, содержащей от 20 нМ до 500 нМ (2S,5S)-(Е,Е)-8-(5-(4-(трифторметил)фенил)-2,4-пентадиеноиламино)бензолактам.

Настоящее изобретение относится к биохимии, в частности к способу модификации гена LacZ из Escherichia coli. Для осуществления способа фрагмент ДНК, содержащий кодирующую область гена LacZ, нарабатывают с помощью полимеразной цепной реакции с использованием олигонуклеотидного праймера, позволяющего ввести дополнительный кодон GGA, кодирующий глицин, непосредственно после инициаторного кодона ATG.

Изобретение относится к области биохимии, а именно к способу определения последовательности молекулы нуклеиновой молекулы-мишени. Получают олигонуклеотидный зонд захвата, присоединенный к кодированному микроносителю.

Изобретение относится к области медицины. Предложен способ определения вероятности рецидивирования рака молочной железы у субъекта - млекопитающего, включающий измерение уровня экспрессии РНК-транскриптов KI67, CCND1, PTEN, NDRG1, TERT в биологическом образце, содержащем опухолевые клетки и определение показателя рецидивирования для указанного субъекта с учетом измеренных уровней экспрессии генов как точки на графике с двумя координатами X и Y.

Изобретение относится к области биохимии, в частности к трансгенной растительной клетке сои, семени и растению сои, которые предназначены для получения растения, имеющего устойчивость к гербициду, выбранному из группы, состоящей из 2,4-D, глифосата, глюфосината и их комбинаций.

Изобретение относится к медицине и касается способа прогнозирования возникновения рецидива вульвы I и II стадии. Предложенный способ заключается в определении в ткани опухоли ДНК вируса папилломы человека методом полимеразной цепной реакции.

Изобретение относится к области молекулярной биологии и биотехнологии. Изобретение представляет собой набор 5'-фосфорилированных олигонуклеотидных праймеров для амплификации методом полимеразной цепной реакции (ПЦР) полной кодирующей последовательности гена мембранного протеина системы секреции III типа (TTSS) HrcV возбудителя мелиоидоза.

Изобретение относится к области молекулярной биологии и биотехнологии. Изобретение представляет собой набор 5'-фосфорилированных олигонуклеотидных праймеров для амплификации методом полимеразной цепной реакции гена ompA/motB, кодирующего поверхностный протеин OmpA/MotB возбудителя мелиоидоза.

Изобретение касается способа обнаружения микроделеций в области хромосомы с ДНК-маркирующим участком. Способ включает выбор области хромосомы с ДНК-маркирующим участком; получение зонда захвата, соответствующего последовательности ДНК в указанной области; гибридизацию зонда захвата со смешанной библиотекой для связывания с последовательностью из множества образцов ДНК из области с ДНК-маркирующим участком; секвенирование захваченной последовательности ДНК из области с ДНК-маркирующим участком для получения данных секвенирования и анализ результатов секвенирования с использованием метода математической статистики с получением результата, показывающего наличие или отсутствие микроделеции в области хромосомы с ДНК-маркирующим участком в каждом из множества образцов ДНК. Изобретение позволяет эффективно и точно детектировать известные и неизвестные микроделеции в области хромосомы с ДНК-маркирующим участком при обработке большого количества образцов ДНК. 13 з.п. ф-лы, 29 ил., 8 табл.

Настоящее изобретение относится к тестам микроРНК плазмы для обнаружения колоректального рака на ранних стадиях. Описан способ, включающие этапы: измерения общего профиля экспрессии или уровня содержания одной или нескольких микроРНК, полученных из одного или нескольких образцов плазмы, крови или сыворотки субъекта; и сравнение общего профиля экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от субъекта, предположительно страдающего от колоректальной неоплазии, с общим профилем экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от нормального субъекта, где нормальным субъектом является здоровый человек, не страдающий от колоректальной неоплазии, где повышенная экспрессия miR15b свидетельствует о наличии колоректальной неоплазии. Также описано применение набора для диагностики колоректальной неоплазии, где набор включает реагенты, детектирующие биомаркеры, для определения уровня дифференциальной экспрессии miR15b в образце плазмы, крови или сыворотки, где сверхэкспрессия указанной микроРНК свидетельствует о колоректальной неоплазии. Изобретение расширяет арсенал средств для диагностики колоректального рака. 2 н. и 7 з.п. ф-лы, 4 ил., 6 табл.

Изобретение относится к биохимии. Описан синтетический олигонуклеотид длиной от 19 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций. При этом указанный олигонуклеотид специфически гибридизуется с природным антисмысловым полинуклеотидом гена IFRD1 и имеет последовательность, по меньшей мере на 90% идентичную последовательности, обратно комплементарной участку в рамках нуклеотидов 1-740 последовательности SEQ ID NO: 2, или 1-418 последовательности SEQ ID NO: 3, или 1-540 последовательности SEQ ID NO: 4, или 1-546 последовательности SEQ ID NO: 5, или 1-429 последовательности SEQ ID NO: 6, или 1-429 последовательности SEQ ID NO: 7, или имеет последовательность, по меньшей мере на 90% идентичную участку последовательности SEQ ID NO: 1. Изобретение также относится к применению указанного антисмыслового олигонуклеотида для лечения заболеваний и расстройств, ассоциированных с экспрессией IFRD1. Изобретение расширяет арсенал средств для лечения заболеваний и расстройств, ассоциированных с экспрессией IFRD1. 6 н. и 26 з.п. ф-лы, 1 ил., 1 табл., 2 пр.

Изобретения относятся к области определения последовательности нуклеиновой кислоты. Предложена группа изобретений, включающая устройство и способ для оптического контроля секвенирования нуклеиновой кислоты, машиночитаемый носитель с компьютерной программой и программный элемент, используемые в вышеуказанном способе, а также применение 5-метил-(2-(2-нитрофенил)пропил)карбонат-dUTP, 5-метил-(2-оксо-1,2-дифенилэтил)карбонат-dUTP в качестве блокатора в секвенировании ДНК в вышеуказанном способе. Устройство включает подложку в виде проволочной сетки для связывания молекулы на поверхности; оптическую схему, выполненную с возможностью направления возбуждающего излучения на подложку, приема, детектирования излучения и направления расщепляющего излучения на подложку; раствор с нуклеотидами и ферментом, где нуклеотиды содержат блокатор. Способ включает обеспечение подложки с молекулой, облучение подложки возбуждающим излучением, ограничение возбуждающего излучения с помощью подложки, прием и детектирование флуоресценции возбужденной флуоресцентной метки нуклеотида, выполнение облучения подложки расщепляющим излучением, ограничение расщепляющего излучения и обеспечение раствора с многочисленными нуклеотидами и ферментом. Изобретения обеспечивают усовершенствование способа определения последовательности нуклеиновой кислоты. 5 н. и 9 з.п. ф-лы, 11 ил.

Изобретение относится к области медицины, в частности к молекулярной онкологии, и предназначено для прогнозирования выживаемости больных раком тела матки на основании уровня экспрессии гена ESR1. Осуществляют выделение тотальной РНК из тканевых проб матки с помощью метода гуанидин-тиоционат-фенол-хлороформной экстракции, получение кДНК с помощью обратной транскрипции на матрице РНК и последующую амплификацию в режиме ПЦР-РВ. Проводят расчет относительной экспрессии генетического локуса ESR1 с последующим вычислением соотношения экспрессии этого гена в опухолевой ткани относительно нормальной ткани матки по формуле K=REcancer/REnormal. При значении K в пределах 0,31≤KESR1≤0,81 прогнозируют благоприятный исход заболевания. При значении K в пределах 5,84≤KESR1≤9,32 прогнозируют неблагоприятный исход заболевания. Изобретение обеспечивает эффективное прогнозирование выживаемости больных раком тела матки. 2 табл., 2 пр.

Изобретение относится к области медицины, в частности к акушерству и гинекологии, и предназначено для прогнозирования высокого риска репродуктивных потерь в первом триместре беременности. Из периферической венозной крови женщин выделяют ДНК с последующей амплификацией полиморфных вариантов A66G гена MTRR, -31С-Т (rs1143627) IL-1β, -174G-C (rs1800795) IL-6 и С677Т (rs1801133) MTHFR. При выявлении одного из четырех генотипов: -31СТ IL-1β / -174GG IL-6 / 677СТ MTHFR / 66GG MTRR; -31СТ IL-1β / -174СС IL-6 / 677СС MTHFR / 66AG MTRR; -31CC IL-1β / -174CC IL-6 / 677CC MTHFR/ 66AG MTRR; -31CC IL-1β / -174GC IL-6 / 677CT MTHFR/ 66AG MTRR прогнозируют высокий риск репродуктивных потерь в первом триместре беременности. Изобретение позволяет формировать среди женщин группы риска репродуктивных потерь в первом триместре беременности и своевременно реализовывать в этих группах необходимые лечебно-профилактические мероприятия. 1 ил., 1 табл., 7 пр.

Изобретение относится к области медицины, в частности к иммунологии и педиатрии, и предназначено для диагностики тимомегалии у детей. Проводят ПЦР в режиме реального времени с использованием соответствующих праймеров и флюоресцентно-меченого олигонуклеотида с последующим расчетом числа копий Т-рецепторных эксцизионных колец (ТРЭК) по стандартной кривой, построенной по разведениям плазмиды, представленной SEQ ID NO: 1 с известной концентрацией ДНК ТРЭК. Тимомегалию диагностируют при снижении уровня ТРЭК ниже 25,36 копий на 1 тыс. лимфоцитов у детей в возрасте до 2 лет, ниже 14,71 копий на 1 тыс. лимфоцитов у детей 3-6 лет и ниже 4,82 копий на 1 тыс. лимфоцитов у детей 7-10 лет. Изобретение обеспечивает эффективное определение тимомегалии у детей по уровню ТРЭК, что позволит своевременно назначить иммунокорригирующую терапию. 1 ил., 1 табл., 3 пр.

Изобретение относится к области медицины, в частности к стоматологии, и предназначено для получения точных количественных данных о видовом составе микроорганизмов пародонтальных карманов. В качестве исследуемого материала используют содержимое пародонтального кармана. Для осуществления предлагаемого способа проводят забор содержимого пародонтальных карманов стерильным бумажным эндодонтическим штифтом размером №25, который вводят в наиболее глубокие участки пародонтального кармана экспозицией не менее 10 сек и затем помещают в пробирку с транспортной средой. Проводят выделение тотальной ДНК из биоматерила, ПЦР в режиме реального времени, при этом используют видоспецифичные праймеры к фрагментам ДНК Porphyromonas gingivalis, Streptococcus oralis, Streptococcus sanguis, Streptococcus sobrinus, Treponema denticola. После этого концентрацию микроорганизмов в исследуемом образце рассчитывают по формуле В=1,7×(Nst×Ε×(Cst-Ct))/V, где: В - концентрация микроорганизмов, копий ДНК/мл; Nst - стандартная начальная концентрация ДНК; Ε - эффективность РТ-ПЦР - число, показывающее, во сколько раз за один цикл изменится количество фрагментов ДНК; Cst - значение порогового цикла стандартного образца; Ct - значение порогового цикла опытного образца; V - объем исследуемой пробы, мл; 1,7 - коэффициент перерасчета. Использование изобретения повышает точность способа за счет определения концентрации пародонтопатогенных бактерий в абсолютных значениях - количество копий ДНК/мл. 3 табл., 2 пр.

Изобретение относится к медицинской микробиологии. Описан способ идентификации подвидов возбудителя туляремии Francisella tularensis subsp. tularensis, Francisella tularensis subsp. mediasiatica и Francisella tularensis subsp. holarctica, включающий стадии выделения ДНК микроорганизма из исследуемого материала и проведение с полученной ДНК двух реакций амплификации. При этом используется набор сконструированных специфических праймеров к вариабельным участкам области RD6 туляремийного микроба, где набор состоит из трех праймеров: RD6-com ATACTAGCTTCAATCTCTGTGG СТТТ RD6-hol ATGCACTGGTTGGAATACAAATC RD6-tul CACATAGCAAATTAGTTGGATATGGA и второй из двух праймеров: RD6-del1 AACAATACCAACACTATTGAGTAAAA RD6-del2 AGCCATGCAATTATTAAAGC. Подвид возбудителя туляремии определяют по размеру специфического амплификата, в случае первой реакции амплификации если он составляет 212 п.о., а во второй 85 п.о., то регистрируют Francisella tularensis subsp. holarctica, если соответственно 425-91 п.о., то Francisella tularensis subsp. tularensis и 419-85 п.о. определяют как Francisella tularensis subsp. mediasiatica. Изобретение расширяет арсенал средств для выявления трёх основных подвидов туляремийного микроба. 2 з.п. ф-лы, 2 ил., 1 табл., 3 пр.

Изобретение относится к области генной инженерии, конкретно к наборам синтетических олигонуклеотидов, и может быть использовано для определения уровней экспрессии основных изоформ гена PDLIM4. Предложен набор синтетических олигонуклеотидов для определения статуса PDLIM4 методом ПЦР в реальном времени. Уровень экспрессии PDLIM4 определяют в ходе ПЦР-РВ за счет определения скорости накопления флуоресцентного продукта реакции. ПЦР проводят с использованием набора олигонуклеотидов, состоящего из концевых праймеров для проведения амплификации целевого участка кДНК PDLIM4 - области стыка экзонов 2-3 (для определения количества суммарных изоформ PDLIM4) и экзонов 6-7 (для определения полноразмерной изоформы PDLIM4). Набор олигонуклеотидов содержит разрушаемый в ходе реакции флуоресцентно-меченый зонд. Изобретение позволяет быстро, чувствительно и специфично определять уровни экспрессии полноразмерной изоформы гена PDLIM4, а также тотальной совокупности изоформ PDLIM4, в том числе в клиническом резекционном либо биопсийном материале, полученном от пациентов с опухолями молочной железы, для более точного установления фенотипических характеристик заболевания. 1 табл., 1 ил.

Изобретение относится к области биохимии. Предложен набор олигонуклеотидов для детекции мутаций c.598_612del и c.550delA гена CAPN3. Обе или одна из данных мутаций встречается хотя бы на одной из хромосом в 81 случаев среди всех российских больных поясно-конечностной мышечной дистрофией 2А типа. Изобретение позволяет провести эффективную диагностику двух наиболее частых мутаций гена CAPN3. 1 ил.

Наверх