Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака



Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака
Определение микрорнк в плазме для обнаружения ранних стадий колоректального рака

 


Владельцы патента RU 2611189:

ОСПИТАЛЬ КЛИНИК ДЕ БАРСЕЛОНА (ES)
СЕНТРО ДЕ ИНВЕСТИГАСЬЁН БИОМЕДИКА ЭН РЕД ДЕ ЭНФЕРМЕДАДЕС ЭПАТИКАС И ДИХЕСТИВАС (ES)

Настоящее изобретение относится к тестам микроРНК плазмы для обнаружения колоректального рака на ранних стадиях. Описан способ, включающие этапы: измерения общего профиля экспрессии или уровня содержания одной или нескольких микроРНК, полученных из одного или нескольких образцов плазмы, крови или сыворотки субъекта; и сравнение общего профиля экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от субъекта, предположительно страдающего от колоректальной неоплазии, с общим профилем экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от нормального субъекта, где нормальным субъектом является здоровый человек, не страдающий от колоректальной неоплазии, где повышенная экспрессия miR15b свидетельствует о наличии колоректальной неоплазии. Также описано применение набора для диагностики колоректальной неоплазии, где набор включает реагенты, детектирующие биомаркеры, для определения уровня дифференциальной экспрессии miR15b в образце плазмы, крови или сыворотки, где сверхэкспрессия указанной микроРНК свидетельствует о колоректальной неоплазии. Изобретение расширяет арсенал средств для диагностики колоректального рака. 2 н. и 7 з.п. ф-лы, 4 ил., 6 табл.

 

Перекрестные ссылки на родственные заявки

Настоящая заявка заявляет приоритет по предварительной заявке США с серийным номером 61/550.148, поданной 21 октября 2011 г., полное содержание которой включено здесь в качестве ссылки.

Область техники, к которой относится изобретение

Настоящее изобретение относится в целом к области обнаружения колоректального рака и, более конкретно, к анализам микроРНК (miRNA) плазмы для обнаружения колоректального рака на ранних стадиях.

Сведения о финансировании исследований из федерального бюджета

Нет.

Включение по ссылке материалов, поданных на компакт-диске

Нет.

Предпосылки создания изобретения

Без ограничения объема изобретения предпосылки его создания описаны в связи с разновидностями колоректального рака.

Заявка на патент США №20100317533 (Lou и соавт. 2010 г.) определяет группу биомаркеров метастазов опухоли, включающих любые два из следующих маркеров: карбоангидраза-9 (CAIX), фактор роста эндотелия сосудов С (VEGF-C), эфрин А5 (EFNA5), эф-рецептор В2 (ЕРНВ2), трансформирующий фактор роста бета 3 (TGF-β3), изофермент-3 пируват-дегидрогеназы киназы (PDK3), карбоангидраза-12 (CAXII), кератин 14 (KRT14), фактор, индуцируемый гипоксией 1 альфа субъединицей (HIF-1α) или тенасцин С (TNC). CAIX, VEGF-C, EFNA5, ЕРНВ2, TGF-β3 или PDK3 могут служить показателями умеренного метастатического потенциала, в то время как CAXII, KRT14, HIF-1a или TNC могут служить показателями высокого метастатического потенциала. Предложен также способ определения риска метастазирования опухоли с использованием указанных выше биомаркеров. Биомаркеры могут быть использованы для диагностики, прогноза, выбора лечения или для проверки предлагаемой терапии. Биомаркеры могут быть использованы для оценки злокачественных опухолей или карцином, имеющих гипоксичные участки, таких как рак молочной железы.

Заявка на патент США №20100120898 (Croce и соавт., 2010 г.) раскрывает способы и рецептуры для диагностики, прогноза и лечения гепатоцеллюлярной карциномы (ГЦК). Также предлагаются способы идентификации анти-ГЦК агентов. Заявка Сгосе предлагает способ диагностирования наличия или риска развития гепатоцеллюлярной карциномы (ГЦК), включающий измерение уровня, по меньшей мере, одного генного продукта микроРНК в образце, полученном от тестируемого субъекта, в котором изменение уровня генного продукта микроРНК в тестируемом образце по отношению к уровню соответствующего генного продукта микроРНК в контрольном образце указывает на то, что субъект имеет либо подвержен риску развития ГЦК.

Патент США N 7939255, выданный Chung направлен на методы диагностики рака прямой кишки. Кратко, патент раскрывает метод диагностики и набор для оценки прогноза колоректального рака (КРК) с геном-супрессором опухоли, которые должны использоваться для диагностики колоректального рака (КРК), причем способ содержит: идентификацию периодически изменяемых участков (RAR) хромосомы; и обнаружения геномных изменений в RAR. Заявлено, что изобретение позволяет выполнять раннюю диагностику, а также оценку прогноза для различных видов рака и опухолей, включая колоректальный рак (КРК).

Публикация №WO2011076147, озаглавленная "Биомаркер на основе Микро-РНК плазмы и методы для раннего выявления колоректального рака", поданная Li, описывает диагностический набор молекулярных маркеров в крови для диагностики колоректального рака и/или мониторинга терапевтического эффекта лечения колоректального рака. Заявлено, что этот набор содержит множество молекул нуклеиновых кислот, и каждая молекула нуклеиновой кислоты кодирует биомаркер микроРНК, где одна или несколько из множества молекул нуклеиновых кислот по-разному экспрессированы в плазме пациента и здорового контрольного пациента, и одна или несколько молекул нуклеиновых кислот с различной экспрессией, вместе представляют собой экспрессию биомаркера нуклеиновой кислоты, который указывает на наличие колоректального рака. Изобретение заявляет также соответствующие методы, использующие такие биомаркеры экспрессии нуклеиновой кислоты для идентификации колоректального рака, а также для профилактики или лечения такого состояния. Наконец, изобретение предлагает фармацевтический препарат для профилактики и/или лечения колоректального рака.

Публикация № WO 2011076142 под названием "Препараты и методы для профилирования экспрессии микроРНК в плазме прямой кишки", также поданная Li, посвящена препаратам и методам профилирования экспрессии микроРНК (miRNA) в плазме при колоректальном раке. В частности, указанное изобретение относится к диагностическому набору молекулярных маркеров в крови для диагностики рака прямой кишки, мониторинга терапии рака и/или лечения колоректального рака, который включает в себя множество молекул нуклеиновых кислот, где каждая молекула нуклеиновой кислоты кодируется последовательностью микроРНК, где одна или несколько из множества молекул нуклеиновых кислот дифференциально экспрессируются в плазме крови больных колоректальным раком и в плазме здоровых контрольных лиц, а одна или более дифференциально экспрессированных молекул нуклеиновой кислоты вместе представляют собой сигнатуру экспрессии нуклеиновой кислоты, которая указывает на наличие колоректального рака. В изобретении заявлены также соответствующие методы, использующие такие биомаркеры экспрессии нуклеиновой кислоты для идентификации колоректального рака, а также для профилактики или лечения такого состояния. Наконец, изобретение предлагает фармацевтический препарат для профилактики и/или лечения колоректального рака.

Публикация № WO 2011088226, озаглавленная "Обнаружение желудочно-кишечных заболеваний", поданная Christine, заявляет о методах и системах для характеристики фенотипа путем обнаружения микроРНК, везикул или биомаркеров, которые свидетельствуют о болезни или развития заболевания. Заболевание может относиться к нарушениям желудочно-кишечного тракта, таким как колоректальный рак. МикроРНК, везикулы, или биомаркеры могут быть обнаружены в биологической жидкости.

В публикации № WO 2010004562, которая называется "Способы и препараты для обнаружения колоректального рака", поданной Baruch, заявлен способ проведения минимально-инвазивного раннего выявления колоректального рака и/или клеток-предшественников колоректального рака, с помощью молекул микроРНК, связанных с колоректальным раком, а также различных молекул нуклеиновых кислот, относящиеся к ним или к их производным.

Наконец, публикация № WO 2011012136 под названием "Метод классификации образца клеток человека как злокачественного", поданная Fog, и др., заявляет способ отличия между злокачественными и незлокачественными образцами. Указанный способ включает определение уровня содержания по меньшей мере одной микроРНК (miR), выбранной из miR-группы I, состоящей из: miR-21, miR-34a и miR-141, определение уровня содержания по меньшей мере одной микроРНК (miR), выбранной из miR-группы II, состоящей из: miR-126, miR-143 и miR-145 в тестовом образце клеток, сравнении уровня экспрессии указанной выбранной микроРНК в тестовом образце клеток с уровнем экспрессии той же выбранной микроРНК в ранее записанной тестовой серии.

Сущность изобретения

В одном варианте осуществления настоящее изобретение включает в себя способ диагностики или обнаружения колоректальной неоплазии у человека, включающий этапы: получения одного или нескольких биологических образцов от субъекта, подозреваемого в наличии колоректальных новообразований; измерения общего профиля экспрессии или уровня содержания одной или нескольких микроРНК, полученных из одного или нескольких биологических образцов субъекта; а также сравнения общей картины экспрессии одной или нескольких микроРНК из биологического образца от субъекта, подозреваемого в наличии колоректальной неоплазии с общей картиной экспрессии одной или нескольких микроРНК из биологического образца от нормального субъекта, в котором нормальным субъектом является здоровый человек, не страдающий от колоректальной неоплазии, при этом повышенная экспрессия комбинации miR19a и miR19b или miR19a и miR19b и miR15b является признаком колоректального рака. В одном аспекте способ дополнительно включает анализ экспрессии по крайней мере одной из miR18a, miR29a или miR335 по сравнению с экспрессией у нормального субъекта, как показатель колоректальной неоплазии. В другом аспекте способ дополнительно включает анализ экспрессии по крайней мере одной из miR29a, miR92a или miR141. В другом аспекте один или несколько биологических образцов выбираются из группы, состоящей из одной или нескольких биологических жидкостей, образца плазмы, образца сыворотки, образца крови, образца ткани или образца фекалий. В другом аспекте способ способен обнаруживать ранний КРК на ранних стадиях (I-II) так же точно, как и на запущенных стадиях КРК (II-III), правосторонних опухолей и левосторонних поражений. В другом аспекте настоящего изобретения способ включает доверительный интервал 90, 91, 92, 93, 94 или 95% и более. В другом аспекте способ дополнительно включает определение уровни экспрессии микроРНК, которые имеют пониженную экспрессию при колоректальной неоплазии, выбранных из:

В другом аспекте способ дополнительно включает определение уровня экспрессии микроРНК, которые имеют повышенную экспрессию при колоректальной неоплазии, выбранных из:

В другом аспекте уровень экспрессии одной или нескольких микроРНК измеряется профилированием экспрессии с помощью микроматриц, ПЦР, ПЦР с обратной транскриптазой, ПЦР с обратной транскриптазой в реальном времени, количественной ПЦР в реальном времени, ПЦР с анализом по конечной точке, мультиплексной ПЦР с анализом по конечной точке, ПЦР-амплификацией при пониженной температуре денатурации (COLD-PCR), ICE-COLD ПЦР, масс-спектрометрии, гибридизации in situ (ISH), мультиплексной гибридизация, или секвенирования нуклеиновых кислот. В другом аспекте способ используется для лечения пациентов, подверженных риску или страдающих от колоректальной неоплазии, для выбора противоопухолевого средства терапии пациентов, подверженных риску или страдающих от колоректальной неоплазии, отнесения пациента к определенной подгруппе колоректальной неоплазии или для клинического испытания при терапии колоректальной неоплазии, определения сопротивляемости или реакции колоректальной неоплазии на лечебный режим, разработки набора для диагностики колоректальных новообразований или каких-либо их комбинаций. В другом аспекте общий характер экспрессии или уровень 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 55 или 60 микроРНК, выбранных из таблиц 2, 3, 4 и 5, в котором микроРНК повышают специфичность определения, диагностики или выявления колоректальной неоплазии. В другом аспекте способ дополнительно содержит этап использования общего профиля экспрессии или уровня содержания микроРНК для прогнозирования, организации лечения, или мониторинга ответа на лечение от колоректальной неоплазии.

Еще один вариант осуществления настоящего изобретения включает в себя биомаркер прогрессирования колоректальный неоплазии и/или метастаза, в котором биомаркер, включающий одну или несколько микроРНК и изменение общей экспрессии одной или нескольких микроРНК при колоректальной неоплазии клеток, полученных от больного, указывает на прогрессирование колоректальной неоплазии по сравнению с общей экспрессией одной или нескольких микроРНК в нормальных клетках без колоректальной неоплазии или клетках с колоректальной неоплазией клеток, взятых ранее у того же самого пациента, отличающийся тем, что повышенная экспрессия комбинации miR19a и miR19b или miR19a и miR19b и miR15b, свидетельствует о наличии колоректального рака. В одном аспекте способ дополнительно включает анализ одной или нескольких микроРНК из числа следующих: miR29a, miR92a, miR141, miR18a, miR19a, miR19b, miR15b, miR29a или miR335. В другом аспекте биомаркер дополнительно содержит микроРНК с пониженной экспрессией при колоректальной неоплазии, выбранные из:

В другом аспекте биомаркер дополнительно содержит микроРНК с повышенной экспрессией при колоректальной неоплазии, выбранные из:

В другом аспекте биомаркер дополнительно содержит микроРНК экспрессией при колоректальной неоплазии, выбранные из:

В другом аспекте биомаркер дополнительно содержит микроРНК с повышенной кспрессией при колоректальной неоплазии, выбранные из:

Специалисту в данной области понятно, что чаще всего биосигнатура (анализ) будет содержать микроРНК как с повышенной, так и с пониженной экспрессией. Таким образом, настоящее изобретение также включает в одном аспекте комбинацию микроРНК с повышенной и пониженной экспрессией из соответствующих микроРНК. В другом аспекте один или несколько биологических образцов выбираются из группы, состоящей из одной или нескольких биологических жидкостей, образца плазмы, образца сыворотки, образца крови, образца тканей или образца фекалий. В другом аспекте способ способен обнаруживать ранний КРК на ранних стадиях (I-II) так же точно, как и на запущенных стадиях КРК (II-III), правосторонних опухолей и левосторонних поражений. В другом аспекте общий характер экспрессии или уровень 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 55 или 60 микроРНК, выбранных из таблиц 2, 3, 4 и 5, в котором микроРНК повышают специфичность определения, диагностики или выявления колоректальной неоплазии.

Еще один вариант осуществления настоящего изобретения включает в себя набор для диагностики колоректальной неоплазии, включающий: биомаркерные детекторные реагенты для определения уровня дифференциальной экспрессии микроРНК miR19a и miR19b или miR19a и miR19b и miR15b, в котором избыточная экспрессия комбинации miR19a и miR19b или miR19a и miR19b и miR15b свидетельствует о колоректальном новообразовании, причем доверительный интервал определения колоректального рака составляет не менее 90%. В одном аспекте изобретения набор дополнительно включает реагенты для обнаружения и анализа по крайней мере одной из микроРНК: miR18a, miR29a или miR335. В одном аспекте изобретения набор дополнительно включает реагенты для обнаружения и анализа по крайней мере одной из микроРНК: miR29a, miR92a или miR141. В другом аспекте изобретения набор дополнительно включает инструкции для использования при диагностике риска колоректальной неоплазии, в которой инструкции включаются поэтапно, чтобы сравнить уровень экспрессии микроРНК, при измерении экспрессии в образце, полученном от субъекта, подозреваемого на наличие колоректальной неоплазии, с уровнем экспрессии в образце, полученном от нормального субъекта, где нормальным субъектом является здоровое лицо, не страдающее от колоректальной неоплазии. В другом аспекте изобретения набор дополнительно включает средства, сосуды и реагенты, необходимые для получения образцов от субъекта, выбранных из группы, состоящей из одной или нескольких биологических жидкостей, образца плазмы, образца сыворотки, образца крови, образца тканей или образца фекалий. В другом аспекте набор дополнительно содержит микроРНК с пониженной экспрессией при колоректальной неоплазии, выбранные из:

В другом аспекте набор дополнительно содержит микроРНК с повышенной экспрессией при колоректальной неоплазии, выбранные из:

В другом аспекте набор дополнительно включает реагенты для обнаружения и анализа общего характера экспрессии или уровня экспрессии для 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 55 или 60 микроРНК, выбранных из Таблиц 2, 3, 4 и 5 для диагностики или выявления колоректальной неоплазии.

Еще один вариант осуществления настоящего изобретения включает в себя способ выбора терапии рака для пациента с диагнозом колоректальной неоплазии, причем способ включает: получение образца от субъекта, имеющего колоректальную неоплазию; и определение уровня экспрессии miR18a, miR19a, miR19b, miR15b, miR29a и miR335 no сравнению с уровнем экспрессии биологического образца от нормального субъекта, причем нормальным субъектом является здоровое лицо, которое не страдает от колоректальной неоплазии; при этом избыточная экспрессия микроРНК свидетельствует о наличии колоректального рака; и выбор метода терапии рака, основанный на выявлении колоректальной неоплазии у пациента.

Другой вариант осуществления настоящего изобретения включает в себя способ выполнения клинического испытания для оценки лекарства, предполагаемого полезным в лечении заболевания, причем этот способ включает: (а) измерения уровня содержания микроРНК в образцах, полученных от группы пациентов, в которых микроРНК взяты из одной или нескольких проб, выбранных из микроРНК miR19a и miR19b или miR19a и miR19b и miR15b (b) прием препарата-кандидата первой подгруппой пациентов и плацебо второй подгруппой пациентов; прием сравниваемого препарата второй подгруппой пациентов; или комбинации препарата-кандидата и другого активного препарата второй подгруппой пациентов; (с) повторение этапа (а) после приема препарата-кандидата или плацебо, сравниваемого препарата или комбинированного препарата; и (d) определения, уменьшает ли препарат-кандидат количество опухолевых клеток толстой кишки, которые проявляют изменение экспрессии микроРНК, статистически значимым по сравнению с какими-либо изменениями во второй подгруппе пациентов, при этом статистически значимое снижение указывает, что препарат-кандидат полезен в лечении указанного состояния болезни.

В другом варианте осуществления настоящее изобретение включает в себя способ диагностики или обнаружения колоректальной неоплазии у человека, включающий этапы: идентификации человека, страдающего от или подозреваемого в наличии колоректального новообразования; получение одного или нескольких биологических образцов от субъекта, где биологические образцы, выбранные из одного или нескольких биологических жидкостей, образца плазмы, пробы сыворотки, образца крови, образца ткани или образца фекалий; измерения общего профиля экспрессии или уровня содержания miR18a, miR19a, miR19b, miR15b, miR29a и miR335; и сравнение общего профиля экспрессии одного или нескольких микроРНК из биологического образца от субъекта, подозреваемого в наличии колоректальной неоплазии с общим профилем экспрессии одного или нескольких микроРНК из биологического образца от нормального субъекта, где нормальным субъектом является здоровое лицо, не страдающее от колоректального новообразования, отличающийся повышенной экспрессией микроРНК: miR18a, miR19a, miR19b, miR15b, miR29a и miR335, является показателем колоректального рака.

В другом варианте осуществления настоящее изобретение включает в себя способ диагностики или обнаружения колоректальной неоплазии у человека, включающий этапы: идентификации человека, страдающего от или подозревается в наличии колоректального новообразования; получение одного или нескольких биологических образцов от субъекта, где биологические образцы выбираются из одной или нескольких биологических жидкостей, образца плазмы, образца сыворотки, образца крови, образца ткани или образца фекалий; измерение общего профиля экспрессии или уровня содержания одной или нескольких микроРНК, выбранных из:

где ППК - это площадь под кривой (ROC) параметров, CI - 95% доверительный интервал, S - чувствительность, a Sp - специфичность; и сравнение общего профиля экспрессии одной или нескольких микроРНК, полученных из биологического образца от субъекта, подозреваемого в наличии колоректальной неоплазии с общим профилем экспрессии одной или нескольких микроРНК из биологического образца от нормального субъекта, причем нормальным субъектом является здоровое лицо, которое не страдает от колоректальной неоплазии; где изменение общего профиля экспрессии одной или нескольких микроРНК в биологическом образце от субъекта является показателем наличия у него колоректальной неоплазии. В одном аспекте изобретения микроРНК имеют пониженную экспрессию при колоректального новообразовании и выбраны из:

В другом аспекте изобретения микроРНК имеют повышенную экспрессию при колоректальном новообразовании и выбраны из:

В другом аспекте уровень экспрессии одной или нескольких микроРНК измеряется профилированием экспрессии с помощью микроматриц, ПЦР, ПЦР с обратной транскриптазой, ПЦР с обратной транскриптазой в реальном времени, количественной ПЦР в реальном времени, ПЦР с анализом по конечной точке, мультиплексной ПЦР с анализом по конечной точке, ПЦР-амплификацией при пониженной температуре денатурации (COLD-PCR), ICE-COLD ПЦР, масс-спектрометрии, гибридизации in situ (ISH), мультиплексной гибридизация, или секвенирования нуклеиновых кислот. В другом аспекте способ используется для лечения пациентов, подверженных риску или страдающих от колоректальной неоплазии, для выбора противоопухолевого средства терапии пациентов, подверженных риску или страдающих от колоректальной неоплазии, отнесения пациента к определенной подгруппе колоректальной неоплазии или для клинического испытания при терапии колоректальной неоплазии, определения сопротивляемости или реакции колоректальной неоплазии на лечебный режим, разработки набора для диагностики колоректальных новообразований или каких-либо их комбинаций. В другом аспекте изобретения определяется общий характер экспрессии или уровень 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 55 или 60 микроРНК для диагностики или обнаружения колоректальной неоплазии.

Краткое описание иллюстраций

Для более полного понимания особенностей и преимуществ настоящего изобретения теперь приводится подробное описание изобретения вместе с прилагаемыми иллюстрациями, на которых:

на фиг. 1А и 1Б представлено различие экспрессии микроРНК между микровыборками пациентов с КРК и контрольными выборками из группы 1 (фиг. 1А) и между пациентами с распространенной аденомой (РА) и контрольными пациентами (Фиг. 1Б). На цветовой диаграмме представлены 50 случайно выбранных микроРНК с наибольшей кратностью изменения (КИ). Красные пиксели соответствуют повышенному содержанию микроРНК в представленных образцах плазмы, а зеленые пиксели соответствуют пониженным уровням содержания микроРНК;

фиг. 2 - это диаграмма межгруппового анализа (МГА), на которой представлено группировка образцов по профилям экспрессии микроРНК. Здоровые контрольные лица (С); пациенты с колоректальным раком (КРК); пациенты с распространенными аденомами (РА);

на фиг. 3 представлены блочные диаграммы экспрессии микроРНК в плазме группы 2 с КРК, определенные ПЦР анализом в реальном времени (qRT-PCR). Уровни экспрессии микроРНК, приведены к уровню miR 16 и представлены в виде значений - dCt. Линии внутри блоков обозначают медианы. Блоки отмечают интервал между 25-м и 75-м процентилями;

на фиг. 4А и 4Б представлены результаты анализа Функциональных характеристик приемника (ROC) для сигнатуры двухплазменной микроРНК: miR19a+miR19b (фиг. 4А) и сигнатуры трехплазменной микроРНК: miR19a+miR19b+miR15b (фиг. 4Б) в соответствии с результатами, полученными из профилирования с помощью микроматриц в группе 1 КРК и данными qRT-PCR в группе 2 КРК.

Подробное описание изобретения

В то время как реализация и использование различных вариантов осуществления настоящего изобретения будут подробно описаны ниже, следует понимать, что настоящее изобретение предоставляет множество применимых изобретательских концепций, которые могут быть воплощены в различных конкретных контекстах. Конкретные варианты, обсуждаемые здесь, являются просто иллюстрацией конкретных способов реализовать и использовать изобретение и не ограничивают весь объем изобретения.

Для облегчения понимания настоящего изобретения ниже определен ряд терминов. Термины, определенные здесь, имеют значение, которое обычно подразумевается человеком с обычной квалификацией в областях, относящихся к настоящему изобретению. Признаки определенной или неопределенной формы относятся не только к одному объекту, а к общему классу объектов, для иллюстрации которых применим конкретный пример. Терминология используется для описания конкретных вариантов осуществления изобретения, но варианты их использования, кроме указанных в формуле изобретения, не ограничивают объем изобретения.

Сокращения: распространенные аденомы - РА; площадь под кривой ROC - ППК; межгрупповой анализ - МГА; колоректальный рак - КРК; кратность изменения - КИ; линейные модели для данных микроматриц - LIMMA; miR - микроРНК; кривая функциональных характеристик приемника - ROC-кривая.

Используемые здесь термины "колоректальный рак" и "колоректальная неоплазия" включают общепринятое медицинского определение рака ободочной и прямой кишки в качестве медицинского состояния, характеризующегося раковыми клетками желудочно-кишечного тракта ниже тонкой кишки (то есть толстого кишечника, толстой кишки), в том числе слепой кишки, восходящей кишки, поперечно-ободочной кишки, нисходящей ободочной кишки, сигмовидной кишки и прямой кишки) и включают в себя предраковое состояние (также называемое здесь как распространенные аденомы), рак на ранней стадии и рак на поздней стадии. Кроме того, используемый здесь термин "колоректальный рак" также дополнительно включает в себя заболевания, которые характеризуются раковыми клетками двенадцатиперстной кишки и тонкой кишки (тощей и подвздошной).

Используемый здесь термин "образец ткани" (термин "ткань" используется взаимозаменяемо с термином "образец ткани") относится к любому материалу, состоящему из одной или более клеток, индивидуально или в комплексе с любым межклеточным веществом или в сочетании с любым химическим веществом. Это определение включает любой биологический или органический материал и любой клеточный субфрагмент, их продукт или побочный продукт. Определение "образец ткани" включает, в том числе, сперму, яйца, эмбрионы и компоненты крови. Кроме того, в определение "ткани" для целей настоящего изобретения включены некоторые бесклеточные структуры, такие как кожные слои, которые имеют клеточное происхождения, но больше не характеризуются как клеточные. Термин "стул", используемый здесь, является клиническим термином, который относится к фекалиям, выделяемым человеком.

Используемый здесь, термин "ген" относится к функциональным белком, полипептидам или единицам кодирования белков. Специалистам в данной области понятно, что этот термин включает в себя функциональные геномные последовательности, последовательности кДНК или фрагменты и их комбинации, а также генные продукты, в том числе те, которые могут быть изменены руками человека. Очищенные гены, нуклеиновые кислоты, белки и т.п.используются для обозначения этих компонентов при их идентификации и отделении от, по крайней мере, одной фоновой нуклеиновой кислоты или белка, с которыми они обычно ассоциированы. Термин "аллель" или "аллельная форма" относится к альтернативному варианту гена, кодирующего тот же функциональный белок, но содержащего другую нуклеотидную последовательность относительно другой версии одного и того же гена.

Используемый здесь термин "микроРНК" ("miRNA" или "miR") относится к РНК (или РНК-аналогу); представляет собой продукт эндогенного, декодирующего гена, предшественники которого РНК-транскрипторы могут образовывать небольшие стволовые петли, из которого отщепляются развитые "микроРНК", например, Dicer-рибонуклеаза. "микроРНК" кодируются в генах, отличных от мРНК, экспрессию которых они контролируют.

Используемый здесь термин "нуклеиновая кислота" или "молекула нуклеиновой кислоты" относится к полинуклеотидам, например, дезоксирибонуклеиновой кислоте (ДНК), либо рибонуклеиновой кислоте (РНК), олигонуклеотидам, фрагментам, полученным в полимеразной цепной реакции (ПНР) и фрагментам, полученным с помощью любого лигирования, расщепления, воздействия эндонуклеазы и воздействия экзонуклеазы. Молекулы нуклеиновых кислот, могут быть составлены из мономеров, которые существуют в природе в виде нуклеотидов (например, ДНК и РНК), или аналогов существующих в природе нуклеотидов (например, энантиомерных форм существующих в природе нуклеотидов) или комбинации того и другого. Модифицированные нуклеотиды могут иметь изменения в сахарных составляющих и/или в составляющих пиримидиновых или пуриновых оснований. Сахарные модификации включают, например, замену одной или более гидроксильной группы галогенами, алкильными группами, аминами и азидо группами, или же сахара могут быть функционализированы в простые эфиры или сложные эфиры. Кроме того, весь сахарный остаток может быть заменен стерически- и электронно-подобными структурами, такими как аза-сахарами и карбоциклическими аналогами Сахаров. Примерами модификаций оснований являются алкилированные пурины и пиримидины, ацилированные пурины или пиримидины или другие основания с хорошо известными заменами гетероциклическими группами. Мономеры нуклеиновой кислоты могут быть связаны фосфодиэфирными связями или аналогами таких связей. Аналогами фосфодиэфирных связей являются фосфоротиоат, фосфородитиоат, фосфороселеноат, фосфородиселеноат, фосфоранилотиоат, фосфоранилидат, фосфорамидат и т.п. Термин "молекула нуклеиновой кислоты" также включает так называемые "связанные с пептидом нуклеиновые кислоты", которые содержат природные или модифицированные основания нуклеиновых кислот, присоединенные к полиамидному каркасу. Нуклеиновые кислоты могут быть либо одноцепочечными, либо двухцепочечными.

Термин "биомаркер", используемый здесь в различных вариантах осуществления, относится к конкретному биохимическому признаку в организме, который имеет определенную молекулярную функцию, делающую его полезным для диагностики и измерения развития болезни или влияния лечения. Например, общие метаболиты или биомаркеры, найденные в дыхании человека, и соответствующие диагностическому состоянию человека, обеспечивающему такой метаболит включают, в том числе, ацетальдегид (источник: этанол, X-треонин; диагноз: интоксикация), ацетон (источник: ацетоацетат; диагноз: пищевой диабет), аммоний (исходное вещество: дезаминирование аминокислот; диагноз: уремия и заболевание печени), CO (моноксид углерода) (источник: CH2C12, повышенный % содержания COHn; диагноз: загрязнение воздуха внутри помещений), хлороформ (источник: галогенированные соединения), дихлорбензол (источник: галогенированные соединения), диэтиленамин (источник: холин; диагноз: чрезмерное развитие кишечной микрофлоры), H (водород) (источник: кишечник; диагноз: непереносимость лактозы), изопрен (источник: жирная кислота; диагноз: метаболический стресс), метанэтиол (источник: метионин; диагноз: чрезмерное развитие кишечной микрофлоры), метилэтилкетон (источник: жирная кислота; диагноз: загрязнение/недостаток воздуха в помещении), O-толуидин (источник: раковая опухоль; диагноз: бронхогенная карцинома), пентановые сульфиды и сульфиды (источник: перекисное окисление липидов; диагноз: инфаркт миокарда), H2S (источник: метаболизм; диагноз: периодонтальное заболевание/овуляция), MeS (источник: метаболизм; диагноз: цирроз) и Me2S (источник: инфекция; диагноз: язвенный гингивит).

Термин "статистически значимые" различия между группами исследуемых, относится к условию, когда с использованием соответствующего статистического анализа (например, хи-квадрат, т-тест) вероятность совпадения групп меньше 5%, например p<0,05. Другими словами, вероятность получения таких же результатов на совершенно случайной основе составляет менее 5 из 100 попыток.

Термин "набор" или "тестовый набор" означает комбинации реагентов и вспомогательных веществ, необходимых для анализа. Хотя тестовый набор состоит в большинстве случаев из нескольких компонент, также имеются однокомпонентные тестовые реагенты, которые также должны рассматриваться в качестве тестовых наборов.

Термин "полимеразная цепная реакция" (ПЦР), который используется здесь, относится к способу K.B. Mullis, патенты США NN 4683195, 468.202 и 4965188, включенные здесь в качестве ссылки, в которых описан способ увеличения концентрации сегмента целевой последовательности в смеси геномной ДНК без клонирования или очистки. Данный процесс амплификации целевой последовательности состоит во введении большого избытка двух олигонуклеотидных праймеров к смеси ДНК, содержащей нужную целевую последовательность, а затем проведении точной последовательности циклической термообработки в присутствии ДНК-полимеразы. Эти два праймера комплементарны к своим соответствующим нитям двухцепочечной целевой последовательности. Чтобы осуществить амплификацию, смесь денатурируют и затем праймеры ренатурируют с комплементарными последовательностями целевой молекулы. После ренатурации праймеры дополняют полимеразой для образования новой пары комплементарных нитей. Этапы денатурации, ренатурации праймеров и дополнения полимеразой могут быть повторены многократно (т.е., если денатурации, ренатурация и дополнение составляют один "цикл", то может быть проведено много "циклов"), чтобы получить высокую концентрацию амплифицированного сегмента желаемой целевой последовательности. Длина амплифицированного сегмента желаемой целевой последовательности определяется относительным положением праймеров по отношению друг к другу, и поэтому эта длина является управляемым параметром. В силу повторяющегося характера процесса, этот метод называют "полимеразной цепной реакцией" (далее ПЦР).

В другом аспекте уровень экспрессии одной или нескольких микроРНК может измеряться профилированием экспрессии с помощью микроматриц, ПЦР, ПЦР с обратной транскриптазой, ПЦР с обратной транскриптазой в реальном времени, количественной ПЦР в реальном времени, ПЦР с анализом по конечной точке, мультиплексной ПЦР с анализом по конечной точке, ПЦР-амплификацией при пониженной температуре денатурации (COLD-PCR), ICE-COLD ПЦР, масс-спектрометрии, гибридизации in situ (ISH), мультиплексной гибридизация, или секвенирования нуклеиновых кислот. Тем не менее, могут быть использованы другие методы для определения экспрессии микроРНК, такие как поверхностный плазмонный резонанс, эффекты резонансной флуоресценции (перенос, гашение и их варианты), или следующие поколения любого из перечисленных выше методов и их комбинаций, все из которых находятся в пределах объема настоящего изобретения. Общий уровень экспрессии одной или нескольких микроРНК может быть использован для повышения чувствительности и надежности определения наличия колоректальной неоплазии. Например, что характерно, увеличение чувствительности сопровождается увеличением количества измеряемых микроРНК, например, чем большее количество микроРНК измеряется (например, 2 по сравнению с 8 или 15 по сравнению с 30), тем выше сопутствующее повышение надежности определения, как это хорошо известно специалистам в данной области. Специалисту в данной области понятно, что чаще всего биосигнатура (анализ) будет содержать микроРНК как с повышенной, так и с пониженной экспрессией. Таким образом, настоящее изобретение также включает в одном аспекте комбинацию микроРНК с повышенной и пониженной экспрессией из соответствующих микроРНК.

Настоящее изобретение может быть использовано для диагностики и лечения пациентов, включая или способствуя проведению прогноза, организацией процесса лечения, мониторинга реакции на лечение, использованию в клинических испытаниях, исследованиях и их комбинации. Специалисту в данной области понятно, что обнаружение микроРНК, определенных здесь, может использоваться для любой из этих целей.

МикроРНК (miRNAs) - это эволюционно консервированные, эндогенные, небольшие некодирующие молекулы РНК из 20-22 нуклеотидов, которые функционируют как регуляторы экспрессии генов. Последние исследования показывают, что микроРНК регулируют различные важные клеточные процессы, такие как развитие, дифференциация, пролиферация и апоптоз. Предполагается, что они играют важную роль в инициации и прогрессировании рака у человека, выступая в качестве онкогенов или опухолевых супрессоров [1].

Изменения профилей экспрессии микроРНК в различных тканях были обнаружены при различных патологиях человека, включая рак. На сегодняшний день каждый тип опухоли, проанализированный с помощью профилирования микроРНК тканей, проявляет существенно различные профили микроРНК по сравнению с нормальными клетками из той же ткани [2-4]. Кроме того, некоторые недавние отчеты показали, что микроРНК присутствуют в сыворотке или плазме крови человека и других животных [5-7]. Циркулирующие уровни микроРНК достаточно устойчивы, воспроизводимы и сходны для особей одного и того же вида [5]. Таким образом, профилирование экспрессии циркулирующих микроРНК имеет большие перспективы в качестве нового неинвазивного способа диагностики рака и других заболеваний.

Колоректальная карцинома (КРК) является второй наиболее распространенной формой рака в западных странах, и представляет собой второй по значимости причиной связанной с раком смертности [8]. К счастью, есть свидетельства того, что скрининг лиц со средним риском заболевания может привести к снижению смертности и заболеваемости за счет ранней диагностики рака и удаления предвестников раковых поражений [9]. Фактически цель программ скрининга заключается в выявлении на ранней стадии КРК и распространенных аденом (РА), которые являются предраковыми патологическими изменениями, связанные с высоким риском развития инвазивных патологических изменений.

В настоящее время нет оптимальной и общепризнанной стратегии скрининга КРК [10, 11], анализы кала имеют ограниченную чувствительность, а колоноскопия является инвазивным подходом [12]. Таким образом, срочно необходимы новые подходы, которые могут дополнять и совершенствовать текущие стратегии. В этой связи, предыдущие исследования показали, что содержание некоторых микроРНК увеличивается в плазме у пациентов с КРК, что свидетельствует об их потенциальной роли в качестве неинвазивных биомаркеров [13-16]. Тем не менее, все эти исследования были ограничены анализом небольшого числа микроРНК. Соответственно, обязательно нужно дополнительно изучать характеристики профилирования микроРНК плазмы с помощью методов с высокой пропускной способностью и оценивать их возможности для обнаружении скрытых признаков КРК и предвестников патологических раковых изменений. В настоящем исследовании мы провели профилирования микроРНК в плазме с помощью микроматриц в группах пациентов с КРК или РА и здоровых людей, выявившее группу микроРНК, способных выявить пациентов с колоректальной неоплазией с высокой различительной способностью. Проверка в независимой группе людей с использованием различных технологий позволяет нам выделить 6 микроРНК в плазме, как очень перспективных биомаркеров для неинвазивной диагностики КРК. К сожалению, дискриминационная способность этих микроРНК для обнаружения предвестников раковых поражений ограничена.

Циркулирующие микроРНК имеют большие перспективы использования в качестве новых биомаркеров для диагностики рака и других заболеваний. Срочно необходимы новые неинвазивные подходы, которые могут дополнять и совершенствовать текущие стратегии скрининга колоректального рака (КРК). Геномное профилирование экспрессии микроРНК в плазме было выполнено с помощью микроматриц в группе пациентов (n=61), включая пациентов с КРК или с предвестниками злокачественных поражений, такими как распространенные колоректальные аденомы (РА) и группы здоровых субъектов. Для определения экспрессии выбранных микроРНК использовался ПЦР анализ в реальном времени у независимой группы пациентов из другой клиники (n=135). У пациентов с КПР или РА проявились значительно отличающиеся профили экспрессии микроРНК плазмы по сравнению с контрольной группой. Группа из 13 микроРНК была выбрана для подтверждения в независимом группе пациентов, и для 6 из них было доказано, что микроРНК экспрессируется существенно выше в группе с КРК с высокой точностью разделения. Было подтверждено, что экспрессия одной из этих 6 микроРНК также может быть существенно повышена у пациентов с РА, с умеренной точностью.

В общей сложности 273 пациентов из двух больниц (Госпитальная клиника г.Барселона, Каталония, Испания и больница Donostia, г. Гипускоа, Испания) последовательно участвовали в этом исследовании. Из них 77 были исключены, так как они соответствовали какому-либо из следующих критериев: Клинический диагноз САП или синдром Линча, наличие более 10 колоректальных аденом, диагноз рака других органов на момент выбора, воспалительное заболевание кишечника, прохождение химиотерапии или лучевой терапии на момент взятия анализа крови, неполное обследование кишечника, неадекватная подготовка кишечника к диагностической колоноскопии или наличие гемолиза в образцах плазмы. В итоге, в группу было включено 196 пациентов: 123 больных с впервые выявленным спорадическим колоректальным новообразованием (63 с КРК и 40 с РА) и 73 здоровых людей без индивидуальной истории какого-либо рака и с недавно проведенной колоноскопией, подтверждающей отсутствие колоректальных новообразований. Пациенты с РА выбирались из числа тех, у кого аденомы имели размер не менее 10 мм или гистологически имели дисплазию высокой степени или ≥20% ворсинчатой части. Эти пациенты подразделялись на две разные и несвязанные группы: группа 1, 61 субъект из клинической больницы в Барселоне, задействованная в проведении профилирования экспрессии микроРНК в плазме; и группа из 2.135 пациентов из госпитальной больницы Donostia, которые были набраны для последующей проверки результатов, полученных в группе 1. Характеристики участников приведены в таблице 1. Образцы крови у всех пациентов были взяты до эндоскопии или операции.

Исследование было одобрено институциональным комитетом по этике Госпитальной клиники г.Барселона (дата утверждения: 03/26/2009), а от всех участников было получено письменное информированное согласие в соответствии с Хельсинской декларацией.

Выделение РНК из образцов плазмы. У каждого из участников бралось по 20 мл цельной крови в пробирки с ЭДТА. Образцы крови находились при температуре 4°C до отделения плазмы, а плазму замораживали в течение 6 часов после взятия крови. Образцы центрифугировали при 1600g в течение 10 мин при 4°C для осаждения клеток крови, затем плазму и переливали в новые пробирки с последующим дальнейшим центрифугированием при 16000g в течение 10 минут при 4°C, чтобы полностью удалить клеточные компоненты. После этого плазма разделялась на равные части и хранилась при температуре -80°C до использования. Вся РНК с фрагментами малых РНК отделалась от 550 мкл плазмы с помощью реагента Trizol LS (Invitrogen, г. Карлсбад, шт. Калифорния) и miRNeasy Mini Kit (Qiagen, г. Хилден, Германия) в соответствии с протоколом производителей со следующими изменениями. Реагент Trizol LS был добавлен в образцы плазмы в объемном соотношении 2:1. После разделения фаз с добавлением хлороформа и центрифугированием водную фазу отделяли в новую пробирку и дополнительно добавляли один объем Trizol LS. После второго разделение фаз к водной фазе добавляли 1,5 объем 100% этанола и смесь загружали в колонку miRNeasy в соответствии с инструкциями производителя. Проводилась обработка ДНКазой (Qiagen) для удаления примесей ДНК. Окончательный объем элюции составлял 30 мкл. Концентрация РНК подвергалась количественному анализу с помощью NanoDrop 1000 (NanoDrop, г. Вилмингтон, шт. Делавер) во всех образцах и в диапазоне от 3 до 35 нг/мкл. Процесс извлечения повторяли для каждого образца до получения достаточного количества РНК для следующих этапов.

Геномное профилирование экспрессии микроРНК в плазме было выполнено с помощью микроматриц. Профилирование экспрессии микроРНК было выполнено во всех образцах от группы 1, с использованием анализа профилирования экспрессии микроРНК, основанном на платформе SAM-Bead (Illumina, Inc, г. Сан-Диего, шт.Калифорния). Эта микроматрица содержит 1.146 датчиков, включающих регистрацию 743 проверенных микроРНК, что составляет около 97% всех микроРНК человека, аннотированных в базе данных miRBase Sanger v. 12.0. Анализ микроРНК с помощью микроматрицы выполнялся с помощью 200 нг из общего количества РНК в образце. Все этапы проводили в соответствии с протоколом производителя, как описано ранее [13, 14]. Данные получали с помощью программного обеспечения для анализа данных BeadStudio и преобразовывали к логарифмическому масштабу по основанию 2. Данные микроматрицы для всех образцов были квантиль-нормированы с помощью пакета ПО Lumi bioconductor [15].

Определение экспрессии микроРНК ПЦР-анализом в реальном времени (qRT-PCR). Экспрессия микроРНК определялась ПЦРанализом в реальном времени (qRT-PCR) с предварительной мультиплексной амплификацией. В сокращенном изложении, 21 нг РНК плазмы ретротранскрибировались с соединением Megaplex RT Primers (Applied Biosystems Inc., г. Фостер-сити, шт. Калифорния) и предварительно усиливались с помощью Megaplex PreAmp Primers и TaqMan PreAmp MasterMix (Applied Biosystems Inc) в течение 14 циклов. Экспрессия каждой микроРНК оценивалась ПЦР-анализом с помощью проб TaqMan miRNA (Applied Biosystems Inc.) в ПЦР-системе реального времени Viia7 (Applied Biosystems Inc.). Несколько предполагаемых малоядерных РНК были проанализированы для определения наиболее подходящий из них в наших образцах (RNU6B, miR16, miR423-5p, RNU48, miR544, miR103, miR525, miR451). MiR16 продемонстрировала наибольшую стабильность и содержание и, поэтому, уровни экспрессии микроРНК нормировались к miR 16 в качестве внутренней меры в соответствии с другими публикациями [16, 17]. Значения Ct рассчитывались по автоматическому порогу. Ни один из эталонных контрольных образцов не давал амплификации. Каждый этап ПЦР-анализа проводился троекратно. Для каждого образца рассчитывались относительные уровни экспрессии микроРНК в виде значений ACt [ACt = Ct целевой микроРНК - Ct внутреннего контрольного образца микроРНК].

Статистический анализ. Для выявления различий экспрессии микроРНК в группах использовались линейные модели данных микроматриц (LIMMA). В методе LIMMA используются линейные модели и эмпирические попарно модерируемые t-статистики и F-статистики Байеса [18]. Наиболее значительные микроРНК с помощью F-статистики использовались для проведения анализа соответствия, реализованного функцией межгруппового анализа (МГА), содержащейся в пакете программного обеспечения made4 [19]. Этот метод способен визуализировать данные высокой размерности (например, данные многократных измерений экспрессии) на двумерной диаграмме, на которой области, ограниченные эллипсами представляют 95% от оценочного бинормального распределения оценок образцов по первой и второй осям [20]. Строились диаграммы Венна (Venn) с учетом только совпадений микроРНК с абсолютной кратностью изменений более 1,5 и умеренным значением p<0,05 (программы VennCounts и VennDiagram из пакета LIMMA). Количественные переменные были проанализированы с использованием критерия Стьюдента. Значимым принималось двустороннее значение p<0,05. Оценка предсказуемости отдельных микроРНК и различных комбинаций микроРНК, скорректированных по возрасту и полу, были рассчитаны с использованием логистической регрессии (биномиального распределения GLM). Графики ROC-анализа и производные точки разделения, а также общие параметры дискриминационный точности, были рассчитаны с использованием программного пакета DiagnosisMed R. Чувствительность и специфичность были рассчитаны по оптимальной границе разделения, связанной с минимальным расстоянием между характеристической кривой ROC от левого верхнего угла.

Геномное профилирование микроРНК с образцах плазмы от пациентов с колоректальным раком. Экспрессия микроРНК в плазме отличает пациентов с колоректальным раком от здоровых лиц. Для оценки разности расчетов профилирования экспрессии микроРНК между пациентами с КРК и здоровыми людьми, проводились эксперименты с микроматрицами микроРНК с РНК, полученной из образцов плазмы 21 пациента с КПР и 20 здоровых людей. Для дальнейшего исследования, если у пациентов с колоректальным раком и предвестниками поражений обнаруживались измененные профили экспрессии микроРНК, эксперименты с микроматрицами микроРНК проводились также с РНК плазмы 20 пациентов с распространенными колоректальными аденомами (РА).

Первоначальный сравнительный статистический анализ с использованием LIMMA дал в общей сложности 93 микроРНК значительно дерегулированных (p<0,05) у пациентов с КРК по сравнению со здоровыми лицами, и 125 микроРНК, для больных с РА по сравнению с контрольной группой. Все данные микроматриц представлены в GEO (номер доступа: GSE 25609). На фиг. 1А и 1Б представлены диаграммы зон активности для 50 микроРНК с самой значительной кратностью изменений между пациентами с КРК и контрольной группой (фиг. 1А), а также между больными с РА и контрольной группой (фиг.1Б). Различия кратности изменений и p-значений, а также соответствующие параметры прогнозирования для этих микроРНК у больных с КРК или РА, приведены в таблицах 2-3 и 4-5, соответственно. Затем строилась диаграмма межгруппового анализа (МГА) для визуального представления сходства между пациентами с КРК или РА и пациентами контрольной группы в соответствии с экспрессией микроРНК в плазме. Как показано на фиг.2, пациенты с КРК или РА и здоровые люди проявились как три четко разделенные группы. Также были проанализирована специфичность экспрессии микроРНК для каждого вида опухолевого поражения, то есть КРК и РА, по сравнению с контрольными образцами с использованием анализа Venn (фиг. 2). Было обнаружено, что подмножества из 21 и 28 микроРНК отличались исключительной и существенно повышенным содержанием у пациентов с КРК и РА соответственно, при этом об группы пациентов с опухолями имели 24 общих микроРНК с существенно повышенным содержанием. Таким образом, каждый вид колоректального новообразования характеризуется особым профилем экспрессии микроРНК, но оба они также характеризуются существенным количеством микроРНК с несущественной экспрессией, что позволяет идентифицировать оба вида патологических изменений с помощью одного теста, основанного на общей сигнатуре микроРНК в плазме.

Подтверждение экспрессии микроРНК ПЦР-анализом в реальном времени (qRT-PCR). Результаты экспрессии микроРНК в плазме на основе измерений в микроматрицах технически воспроизводимы. Изначально ПЦР анализ в режиме реального времени проводился для подтверждения результатов в микроматрицах для 28 образцов случайно выбранных из группы 1 (19 больных с колоректальными новообразованиями и 9 здоровых лиц). Для этих исследований в общем было выбрано 14 образцов микроРНК. Двенадцать микроРНК-кандидатов (miR17-5p, miR92a, miR19b, miR18a, miR29a, miR302a, miR23a, miR27a, miR24, miR335, miR424 и miR15b) были выбраны потому, что они присутствует в первых 50 раздерегулированных микроРНК при КРК и/или РА и имеют логарифм интенсивности в микроматрице по основанию 2≥8. Две дополнительных микроРНК (miR19a и miR20a), хотя они не удовлетворяли предыдущим критериям, были также выбраны потому, что часть miR17-92 кластера - это один из наиболее хорошо охарактеризованных онкогенных кластеров микроРНК. В целом, результаты анализа ПЦР в реальном времени и анализа микроматриц коррелировали (данные не представлены) за исключением miR424, которые не показывают никакого увеличения по ПЦР, и, следовательно, она была исключена из дальнейшего анализа.

Было доказано, что шесть микроРНК в плазме имеют повышенную экспрессию у больных с КРК в независимой группе. Во-вторых, методом ПЦР-анализа в режиме реального времени были проанализированы 13 микроРНК-кандидатов, которые показали достаточное повышение экспрессии на предыдущем этапе (miR92a, miR17-5P, miR18a, miR19a, miR19b, miR20a, miR15b, miR29a, miR302a, miR23a, miR27a, miR24 и miR335) в плазме независимой группы из 42 пациентов с КРК и 53 здоровых людей, чтобы подтвердить наши результаты.

Интересно, что miR18a, miR19a, miR19b, miR15b, miR29a и miR335 подтвердили, значительно повышенную регуляцию у пациентов с КРК (фиг. 3). Кроме того, в этой группе пациентов проявила повышенную экспрессию также miR-24, однако без достижения статистической значимости (p=0,08). Примечательно, что утвержденные микроРНК в этой второй группе также продемонстрировали высокую точность в разделении пациентов с КРК от здоровых пациентов контрольной группы с площадью под ROC-кривой (ПРК) в диапазоне от 0,8 (95% CI: 0,71-0,89) до 0,7 (95% CI: 0,59-0,80). Далее, мы пытались проверить может ли любая комбинация этих микроРНК улучшить точность разделения при обнаружении КРК по отношению к каждой из микроРНК по отдельности. Среди комбинаций лучшую способность разделения проявляют сигнатуры miR19a+miR19b, а также miR19a+miR19b+miR15b (Таблица 6; Фиг. 4). Наконец, мы исследовали предсказательную способность этих сигнатур для пациентов с ранними стадиями (TNM I-II) и поздними стадиями (TNM III-IV) КРК. Как показано в Таблице 2, обе сигнатуры проявляют высокую разделительную способность, как на ранних, так и на поздних стадиях КРК. Точно также мы проверили, позволят ли эти сигнатуры обнаружить правосторонние опухоли настолько же точно, насколько левосторонние, и это было подтверждено (таблица 2).

Параметры кривой ROC (площадь под кривой (ПРК) и 95% доверительный интервал (ДИ) показаны для всех случаев КРК, а также для разных стадий опухоли (I/II и III/IV) и в ее местоположениях (справа и слева по отношению к селезеночному изгибу).

Было подтверждено, что содержание одной из микроРНК в плазме повышено у пациентов с распространенными колоректальными аденомами. Для того чтобы оценить, повторяется ли обнаруженная повышенная экспрессия любой из микроРНК в плазме обеих групп пациентов с КРК, также и у пациентов с предвестниками раковых поражений, они были проанализированы методом ПЦР в реальном времени в образцах плазмы независимой группы из 40 пациентов с РА и 53 здоровых лиц. Во второй группе пациентов с РА было подтверждено существенное повышение экспрессии miR18a по сравнению с лицами из контрольной группы, так же как это было и в первой группе (фиг. 1Б). Однако, хотя эта микроРНК проявила хорошую разделительную способность в первой группе пациентов с РА (ППК: 0,84, 95% ДИ: 0,72-0,96, S: 80%, Sp: 80%), этот параметр оказался ниже во второй группе пациентов (ППК: 0,64, 95% ДИ: 0,52-0,75, S: 72%, Sp: 57%).

В этом исследовании авторы выполнили геномное профилирование микроРНК по микроматрицам образцов плазмы от пациентов с КРК или РА, а также здоровых людей. Эти результаты показывают, что экспрессия микроРНК в плазме может различаться у пациентов с колоректальной неоплазией и контрольной группой, что указывает на их потенциальную ценность для неинвазивного выявления этих поражений. Насколько нам известно, это первое сообщение, содержащее анализ геномной экспрессии микроРНК в плазме у пациентов с КРК и РА по технологии с высокой пропускной способностью, а затем по оценке результатов для внешней независимой группы. На основе этого анализа с высокой пропускной способностью мы идентифицировали большое количество предполагаемых биомаркеров микроРНК в плазме, которые могут использоваться для выявления пациентов, страдающих от КРК или РА. Кроме того, мы подтвердили высокую разделительную способность между пациентами с КРК и здоровыми лицами шести плазменных микроРНК в другой группе и используя другую технологию. Стоит отметить, что пять из этих микроРНК (т.е. miR19a, miR19b, miR18a, miR15b и miR335) представляют собой новые биомаркеры, о которых ранее не сообщалось.

Недавнее открытие стабильных микроРНК в плазме и других жидкостях открыло возможность использования этих молекул в качестве биомаркеров заболеваний, и в нескольких исследованиях эту стратегия изучалась в различных условиях. При раке человека этот подход действительно перспективен, потому что анализ связанных с опухолями циркулирующих микроРНК, вероятно, может оказаться в состоянии обнаруживать неоплазии неинвазивным способом. Тем не менее, в то время как большинство исследований профилирования экспрессии микроРНК при раке были произведены с помощью образцов тканей, только ограниченное число из них были направлены на исследование потенциальной ценности циркулирующих микроРНК для диагноза и прогноза [21-23]. Примечательно, что использование микроРНК в качестве биомаркеров, является лучшей стратегией, чем использование РНК или белковых маркеров, благодаря высокой стабильности этих молекул, даже в присутствии РНКазы [23].

Пока только в нескольких исследованиях проанализирована экспрессия некоторых плазменных микроРНК-кандидатов при КРК. Первоначально Ng и соавт. путем анализа qRT-PCR обнаружили, что содержание двух плазменных микроРНК (а именно, mirl7-3p и miR92a) было значительно повышено у пациентов с КРК по сравнению с контрольной группой. Однако их первичный анализ был ограничен 95 микроРНК в 10 образцах плазмы (пяти пациентов с КРК и пять здоровых людей). Что более важно, это исследование только оценивало потенциальную полезность плазменных микроРНК в диагностике КРК, но не в выявлении предраковых поражений [24]. Вскоре после этого, Huang и др. сообщили о потенциальной полезности 2 микроРНК в плазме - miR29a и miR92a - для выявления пациентов как с КРК, так и с РА. Однако этот анализ qRT-PCR был ограничен 12 микроРНК, выбранных на основе предыдущих сообщений. Pu и др. путем qRT-PCR проанализировали экспрессию трех микроРНК в образцах плазмы от пациентов с КРК и сообщили о значительно повышенной экспрессии miR221, однако пациенты с РА не были включены в это исследование [25]. Наконец, Cheng и соавт. сообщили о значительной повышающей регуляции уровней miR141 в плазме у больных метастатическим КРК после анализа экспрессии трех микроРНК [26].

Исследование заключалось в выполнении полного профилирования циркулирующих микроРНК с помощью технологии с высокой пропускной способностью у пациентов с КРК и РА для того, чтобы определить плазменные микроРНК потенциально полезные в качестве биомаркеров для диагностики пациентов с этими поражениями. Среди 743 проанализированных микроРНК мы обнаружили 95 циркулирующих микроРНК, значительно дерегулированных у всех пациентов с КРК и у 125 пациентов с РА, причем некоторые из них показали хорошую различительную способность. Важно отметить, что среди микроРНК со значительно повышенной регуляцией при анализе микроматриц авторы настоящего изобретения не только подтвердили связь с КРК плазменных микроРНК, таких как miR29a, miR92a и miR141, указанную в предыдущих исследованиях, но и сообщили о новых микроРНК-кандидатах потенциально связанных с канцерогенезом КРК. Более того, среди этих микроРНК с повышенной экспрессией мы обнаружили всех членов кластера miR17-92 (miR17, miR92a, miR19a, miR19b, miR18a и miR20a) и двух членов кластера miR106b-25 (miR-25 и miR93), менее широко известного кластера - аналога miR17-92 у млекопитающих. Эти данные подчеркивают роль кластера miR17-92 как основного игрока в колоректальном канцерогенезе. Кластер miR17-92, который также обозначается как oncomiRl, является одним из наиболее хорошо охарактеризованных онкогенных кластеров микроРНК [27, 28]. В этой связи было высказано предположение, что увеличение хромосомной нестабильности, ответственной за прогрессирование от аденомы к аденокарциноме, приводит не только к повышенной регуляции онкогенов, но и вызывает повышенную экспрессию критических микроРНК, в том числе кластера miR17-92 [29].

Авторы настоящего изобретения показали, что некоторые из микроРНК с повышенной регуляцией в первой группе пациентов с КРК (т.е. miR18a, miR19a, miR19b, miR15b, miR29a и miR335) проявляли также повышенную экспрессию в независимой группе. Примечательно, что эти проверенные микроРНК показали высокую точность выявления КРК, а некоторые комбинации этих микроРНК повышают разделительную способность по сравнению с любой из микроРНК в отдельности. Кроме того, они способны обнаружить ранние стадии КРК (I-II) настолько же точно, насколько и поздние стадии КРК (III-IV), а также правосторонние опухоли настолько же точно, насколько и левосторонние поражения. Эти результаты указывают на потенциальную возможность использования этих плазменных микроРНК в качестве новых неинвазивных биомаркеров для диагноза КРК.

Что касается поражений, предшествующих колоректальному раку, мы обнаружили, что только одна из шести микроРНК, имеющих повышенную экспрессию при КРК (miR-18а), дает также существенно повышенную экспрессию в двух независимых группах пациентов с РА. Хотя микроРНК miR-18a показала неплохую разделительную способность в первой группе пациентов, эта способность была умеренной во второй группе. Соответственно, наши результаты, полученные у больных с РА, не являются окончательными и будут необходимы дальнейшие исследования, чтобы установить, способна ли какая-либо из этих микроРНК точно обнаружить предраковые поражения самостоятельно или в комбинации с другими микроРНК. Действительно, в группе пациентов с РА проанализированной Huang и соавт., две плазменные микроРНК (miR-29a и miR-92a) показали довольно хорошую точность в отделении пациентов с РА от контрольной группы [16]. Эти две плазменные микроРНК имеют также значительно повышенную экспрессию в нашей первой группе больных с РА, но не во второй группе. Возможным объяснением такого расхождения между группами пациентов может быть менее выраженное наличие признаков РА во второй группе пациентов (таблица 1). В целом, эти результаты показывают, что оценка полезности плазменных микроРНК для диагностики больных с РА представляет собой интересное направление исследований, которое заслуживает дальнейшего изучения. В настоящее время выявление РА остается главной задачей в стратегии неинвазивного скринига КРК. Действительно, нужно отметить, что иммунохимический анализ кала, который в настоящее время принят как основная стратегия неинвазивного скрининга КРК в популяции среднего риска, показывает хорошие результаты для диагностики КРК, однако не выявляет почти 50% случаев РА, как это было недавно продемонстрировано в одном из исследований нашей группы [12].

Интересно, что обо всех проверенных в этом исследовании микроРНК ранее сообщалось, что они повышенно экспрессируются в образцах ткани от больных КРК [30-34]. Соответственно, можно предположить, что КРК представляет собой источник этих плазменных микроРНК. Таким образом, наши результаты не только указывают на miR29a, miR15b, miR19a, miR-19b, miR-18a и miR-335 в качестве мощных биомаркеров для диагностики КРК, но и подчеркивают их причастность к колоректальному канцерогенезу. Кроме того, учитывая потенциальную онкогенного роль этих микроРНК, наши результаты открывают возможность будущей разработки новых целевых методов лечения, направленных на ингибирование этих молекул.

В дополнение к перечисленным микроРНК и семейств микроРНК для повышения вероятности обнаружения колоректального рака могут быть добавлены другие микроРНК. Например, способ может дополнительно включать определение уровня экспрессии микроРНК, которые имеют пониженную экспрессию при колоректальной неоплазии, выбранных из:

Этот способ может дополнительно включать определение уровня экспрессии микроРНК, которые имеют пониженную экспрессию при колоректальной неоплазии, выбранных из:

Еще одна биосигнатура или анализ будет включать в себя комбинацию микроРНК как с повышенной, так и с пониженной экспрессией, например, тех микроРНК, которые перечислены выше или описаны здесь. Таким образом, настоящее изобретение также включает в качестве способа реализации комбинацию микроРНК как с повышенной, так и с пониженной экспрессией, из соответствующих микроРНК, из перечисленных микроРНК и семейств (или сопутствующих) микроРНК.

Таким образом, у пациентов с КРК и РА проявляются значительно иные профили плазменных микроРНК по сравнению со здоровыми людьми. Эти связанные с опухолями циркулирующие микроРНК являются новыми биомаркерами и представляют собой потенциальную возможность для неинвазивной ранней диагностики. В данном исследовании мы выявили шесть многообещающих плазменных микроРНК - кандидатов для обнаружения КРК. Тем не менее, этот подход должен быть дополнительно подтвержден в больших группах пациентов, особенно пациентов с РА, с тем чтобы оценить их эффективность и потенциальную применимость в условиях скрининга.

Следует понимать, что любой вариант, который обсуждается в данном описании изобретения может быть реализован в отношении любого способа, комплекта, реагента или препарата изобретения и наоборот. Кроме того, комбинации, описанные в изобретении, могут быть использованы для достижения способов реализации по настоящему изобретению.

Следует понимать, что конкретные варианты, описанные здесь, приведены в качестве иллюстрации, а не в качестве ограничений изобретения. Основные признаки этого изобретения могут быть использованы в различных вариантах осуществления, не выходя за пределы объема настоящего изобретения. Специалистам в данной области понятны, или они способны установить путем рутинных экспериментов, многочисленные эквиваленты конкретных процедур, описанных в данном документе. Такие эквиваленты считаются входящими в объем настоящего изобретения и охватываются формулой изобретения.

Все публикации и патентные заявки, упомянутые в описании, указывают на уровень профессионализма специалистов в данной области техники, к которой относится данное изобретение. Все публикации и патентные заявки включены в настоящее описание путем ссылки в той же степени, как если бы каждая отдельная публикация или патентная заявка были конкретно и индивидуально указаны как включенные посредством ссылки.

Использование слов "какой-либо" или "любой" в сочетании с термином "содержащий" в формуле изобретения и/или спецификации могут означать "один", но это также согласуется со значением "один или несколько", "по крайней мере один" и один или более чем один". Использование термина "или" в формуле изобретения применяется в значении "и/или", если явно не указано, что он относятся только к альтернативе или альтернативам, которые являются взаимоисключающими, хотя разглашение сути изобретения поддерживает определение, относящееся только к альтернативам и термину "и/или". В данной заявке термин «примерно» используется для обозначения того, что значение включает неизбежную погрешность устройства, метода, используемых с целью определения значения, или изменений объектов исследования.

Используемые в настоящем описании слова "включающий" (и любые формы этого слова, например, "содержать" и "содержит"), "имеющий" (и любые формы этого слова, например, "иметь" и "имеет"), "включающий" (и любые формы этого слова, например, "включает" и "включать") или "содержащий" (и любые формы этого слова, например, "содержит" и "содержать") являются инклюзивными и свободными формами не исключающими дополнительных неуказанных элементов, или этапов способа реализации. Используемое здесь, слово "состоящий из" не ограничивает сферу требования к указанным материалам или этапам, которые не оказывают существенного влияния на основные и новые характеристики заявленного изобретения. Используемое здесь словосочетание "состоящий из" исключает любой элемент, этап, или ингредиент, не указанный в пункте формулы изобретения за исключением, например, дополнений, обычно связанных с элементом или ограничением.

Термин "или их комбинации", использованный здесь, обозначает все перестановки и комбинации перечисленных элементов, предшествующих термину. Например, термин "А, В, С или их комбинации" предназначен для обозначения по меньшей мере одного следующих: А, В, С, АВ, АС, ВС, или ABC, и если порядок важен в конкретном контексте, также В А, С А, СВ, СВА, ВС А, АСВ, ВАС или CAB. Продолжая этот пример, сюда прямо включаются комбинации, которые содержат повторы одного или более элемента или термина, например ВВ, AAA, АВ, ВВС, АААВСССС, СВВААА, САВАВВ, и так далее. Специалисту в данной области понятно, что, как правило, не существует ограничений на количество элементов или терминов в любой комбинации, если иное не очевидно из контекста.

Использованные здесь выражения приближения, такие как, без ограничения, "о", "значительный" или "по существу" относится к условию, что таким образом выраженный термин понимается не обязательно как абсолютный или совершенный, а считаться достаточно близким к тому, что подразумевается специалистом в этой области техники, для гарантировать присутствие данного условия. Степень, до которой может варьироваться описание, будет зависеть от того, насколько большое изменение может происходить и до каких пор обычный специалист в данной области воспринимает необходимые характеристики и видоизмененные характеристики этого условия. В общем, но в связи с предшествующим обсуждением, числовое значение в данном документе, которое модифицируют выражением аппроксимации, таким как "примерно", может отличаться от указанного значения, по меньшей мере, на ±1, 2, 3, 4, 5, 6, 7, 10, 12 или 15%.

Все композиции и/или способы, описанные и заявленные здесь, могут быть выполнены и осуществлены без дополнительных экспериментов в свете настоящего описания. Хотя композиции и способы по данному изобретению были описаны в виде предпочтительных вариантов осуществления, специалистам в данной области понятно, что к композициям и/или методам могут быть применены изменения на отдельных этапах или в последовательности этапом метода, описанного здесь, без нарушения концепции, сущности и объема изобретения. Все такие и подобные замены и модификации, очевидные для специалистов в данной области техники, остаются в пределах сущности, объема и концепции изобретения, как определено в прилагаемой формуле изобретения.

СПИСОК ЛИТЕРАТУРЫ

1. Esquela-Kerscher, A. and Slack, F.J. (2006) Oncomirs - microRNAs with a role in cancer. Nat Rev Cancer, 6, 259-69.

2. Calin, G.A. and Croce, CM. (2006) MicroRNA signatures in human cancers. Nat Rev Cancer, 6, 857-66.

3. Lu, J., Getz, G., Miska, E.A., Alvarez-Saavedra, E., Lamb, J., Peck, D., Sweet-Cordero, A., Ebert, B.L., Mak, R.H., Ferrando, A.A., Downing, J.R., Jacks, Т., Horvitz, H.R. and Golub, T.R. (2005) MicroRNA expression profiles classify human cancers. Nature, 435, 834-8.

4. Schetter, A.J., Leung, S.Y., Sohn, J.J., Zanetti, K.A., Bowman, E.D., Yanaihara, N., Yuen, S.T., Chan, T.L., Kwong, D.L., Au, G.K., Liu, C.G., Calin, G.A., Croce, CM. and Harris, C.C. (2008) MicroRNA expression profiles associated with prognosis and therapeutic outcome in colon adenocarcinoma. JAMA, 299, 425-36.

5. Mitchell, P.S., Parkin, R.K., Kroh, E.M., Fritz, B.R., Wyman, S.K., Pogosova-Agadjanyan, E.L., Peterson, A., Noteboom, J., O'Briant, K.C., Allen, A., Lin, D.W., Urban, N., Drescher, C.W., Knudsen, B.S., Stirewalt, D.L., Gentleman, R., Vessella, R.L., Nelson, P.S., Martin, D.B. and Tewari, M. (2008) Circulating microRNAs as stable blood-based markers for cancer detection. Proc Natl Acad Sci USA, 105, 10513-8.

6. Gilad, S., Meiri, E., Yogev, Y., Benjamin, S., Lebanony, D., Yerushalmi, N., Benjamin, H., Kushnir, M., Cholakh, H., Melamed, N., Bentwich, Z., Hod, M., Goren, Y. and Chajut, A. (2008) Serum microRNAs are promising novel biomarkers. PLoS One, 3, e3148.

7. Chim, S.S., Shing, T.K., Hung, E.C., Leung, T.Y., Lau, T.K., Chiu, R.W. and Lo, Y.M. (2008) Detection and characterization of placental microRNAs in maternal plasma. Clin Chem, 54, 482-90.

8. Jemal, A., Siegel, R., Ward, E., Hao, Y., Xu, J. and Thun, M.J. (2009) Cancer statistics, 2009. CA Cancer J Clin, 59, 225-49.

9. Gellad, Z.F. and Provenzale, D. Colorectal cancer: national and international perspective on the burden of disease and public health impact. Gastroenterology, 138, 2177-90.

10. Hoff, G. and Dominitz, J.A. Contrasting US and European approaches to colorectal cancer screening: which is best? Gut, 59, 407-14.

11. Whitlock, E.P., Lin, J.S., Liles, E., Beil, T.L. and Fu, R. (2008) Screening for colorectal cancer: a targeted, updated systematic review for the U.S. Preventive Services Task Force. Ann Intern Med, 149, 638-58.

12. Quintero, E., Castells, A., Bujanda, L., Cubiella, J., Salas, D., Lanas, A., Andreu, M., Carballo, F., Morillas, J.D., Hernandez, C, Jover, R., Montalvo, I., Arenas, J., Laredo, E., Hernandez, V., Iglesias, F., Cid, E., Zubizarreta, R., Sala, Т., Ponce, M., Andres, M., Teruel, G., Peris, A., Roncales, M.P., Polo-Tomas, M., Bessa, X., Ferrer-Armengou, O., Grau, J., Serradesanferm, A., Ono, A., Cruzado, J., Perez-Riquelme, F., Alonso-Abreu, I., de la Vega-Prieto, M., Reyes-Melian, J.M., Cacho, G., Diaz-Tasende, J., Herreros-de-Tejada, A., Poves, C, Santander, C. and Gonzalez-Navarro, A. Colonoscopy versus fecal immunochemical testing in colorectal-cancer screening. N Engl J Med, 366, 697-706.

13. Cunningham, J.M., Oberg, A.L., Borralho, P.M., Kren, B.T., French, A.J., Wang, L., Bot, B.M., Morlan, B.W., Silverstein, K.A., Staggs, R., Zeng, Y., Lamblin, A.F., Hilker, C.A., Fan, J.В., Steer, C.J. and Thibodeau, S.N. (2009) Evaluation of a new high-dimensional miRNA profiling platform. BMC Med Genomics, 2, 57.

14. Chen, J., Lozach, J., Garcia, E.W., Barnes, В., Luo, S., Mikoulitch, I., Zhou, L., Schroth, G. and Fan, J.B. (2008) Highly sensitive and specific microRNA expression profiling using BeadArray technology. Nucleic Acids Res, 36, e87.

15. Du, P., Kibbe, W.A. and Lin, S.M. (2008) lumi: a pipeline for processing Illumina microarray. Bioinformatics, 24, 1547-8.

16. Huang, Z., Huang, D., Ni, S., Peng, Z., Sheng, W. and Du, X. Plasma microRNAs are promising novel biomarkers for early detection of colorectal cancer. Int J Cancer, 127, 118-26.

17. Chang, K.H., Mestdagh, P., Vandesompele, J., Kerin, M.J. and Miller, N. MicroRNA expression profiling to identify and validate reference genes for relative quantification in colorectal cancer. BMC Cancer, 10, 173.

18. Smyth, G.K. (2004) Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol, 3, Article3.

19. Culhane, A.C., Thioulouse, J., Perriere, G. and Higgins, D.G. (2005) MADE4: an R package for multivariate analysis of gene expression data. Bioinformatics, 21, 2789-90.

20. Sabates-Bellver, J., Van der Flier, L.G., de Palo, M., Cattaneo, E., Maake, C, Rehrauer, H., Laczko, E., Kurowski, M.A., Bujnicki, J.M., Menigatti, M., Luz, J., Ranalli, T.V., Gomes, V., Pastorelli, A., Faggiani, R., Anti, M., Jiricny, J., Clevers, H. and Marra, G. (2007) Transcriptome profile of human colorectal adenomas. Mol Cancer Res, 5, 1263-75.

21. Lawrie, C.H., Gal, S., Dunlop, H.M., Pushkaran, В., Liggins, A.P., Pulford, K., Banham, A.H., Pezzella, F., Boultwood, J., Wainscoat, J.S., Hatton, C.S. and Harris, A.L. (2008) Detection of elevated levels of tumour-associated microRNAs in serum of patients with diffuse large B-cell lymphoma. Br J Haematol, 141, 672-5.

22. Wong, T.S., Liu, X.B., Wong, B.Y., Ng, R.W., Yuen, A.P. and Wei, W.I. (2008) Mature miR-184 as Potential Oncogenic microRNA of Squamous Cell Carcinoma of Tongue.

Clin Cancer Res, 14, 2588-92.

23. Chen, X., Ba, Y., Ma, L., Cai, X., Yin, Y., Wang, K., Guo, J., Zhang, Y., Chen, J., Guo, X., Li, Q., Li, X., Wang, W., Wang, J., Jiang, X., Xiang, Y., Xu, C, Zheng, P., Zhang, J., Li, R., Zhang, H., Shang, X., Gong, Т., Ning, G., Zen, K. and Zhang, C.Y. (2008) Characterization of microRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res, 18, 997-1006.

24. Ng, E.K., Chong, W.W., Jin, FL, Lam, E.K., Shin, V.Y., Yu, J., Poon, T.C., Ng, S.S. and Sung, J.J. (2009) Differential expression of microRNAs in plasma of patients with colorectal cancer: a potential marker for colorectal cancer screening. Gut, 58, 1375-81.

25. Pu, X.X., Huang, G.L., Guo, H.Q., Guo, C.C., Li, H., Ye, S., Ling, S., Jiang, L., Tian, Y. and Lin, T.Y. Circulating miR-221 directly amplified from plasma is a potential diagnostic and prognostic marker of colorectal cancer and is correlated with p53 expression. J Gastroenterol Hepatol, 25, 1674-80.

26. Cheng, H., Zhang, L., Cogdell, D.E., Zheng, H., Schetter, A.J., Nykter, M., Harris, C.C., Chen, K., Hamilton, S.R. and Zhang, W. Circulating plasma MiR-141 is a novel biomarker for metastatic colon cancer and predicts poor prognosis. PLoS One, 6, e17745.

27. Mendell, J.T. (2008) miRiad roles for the miR-17-92 cluster in development and disease. Cell, 133, 217-22.

28. Olive, V., Jiang, I. and He, L. mir-17-92, a cluster of miRNAs in the midst of the cancer network. Int J Biochem Cell Biol, 42, 1348-54.

29. Diosdado, В., van de Wiel, M.A., Terhaar Sive Droste, J.S., Mongera, S., Postma, C, Meijerink, W.J., Carvalho, B. and Meijer, G.A. (2009) MiR-17-92 cluster is associated with 13q gain and c-myc expression during colorectal adenoma to adenocarcinoma progression. Br J Cancer, 101, 707-14.

30. Volinia, S., Calin, G.A., Liu, C.G., Ambs, S., Cimmino, A., Petrocca, F., Visone, R., Iorio, M., Roldo, C, Ferracin, M., Prueitt, R.L., Yanaihara, N., Lanza, G., Scarpa, A., Vecchione, A., Negrini, M., Harris, C.C. and Croce, CM. (2006) A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci USA, 103, 2257-61.

31. Monzo, M., Navarro, A., Bandres, E., Artells, R., Moreno, I., Gel, В., Ibeas, R., Moreno, J., Martinez, F., Diaz, Т., Martinez, A., Balague, O. and Garcia-Foncillas, J. (2008) Overlapping expression of microRNAs in human embryonic colon and colorectal cancer. Cell Res, 18, 823-33.

32. Lanza, G., Ferracin, M., Gafa, R., Veronese, A., Spizzo, R., Pichiorri, F., Liu, C.G., Calin, G.A., Croce, CM. and Negrini, M. (2007) mRNA/microRNA gene expression profile in microsatellite unstable colorectal cancer. Mol Cancer, 6, 54.

33. Motoyama, K., Inoue, H., Takatsuno, Y., Tanaka, F., Mimori, K., Uetake, H., Sugihara, K. and Mori, M. (2009) Over- and under-expressed microRNAs in human colorectal cancer. Int J Oncol, 34. 1069-75.

34. Earle, J.S., Luthra, R., Romans, A., Abraham, R., Ensor, J., Yao, H. and Hamilton, S.R. Association of microRNA expression with microsatellite instability status in colorectal adenocarcinoma. J Mol Diagn, 12, 433-40.

1. Способ обнаружения колоректальной неоплазии у человека, включающий этапы:

измерения общего профиля экспрессии или уровня содержания одной или нескольких микроРНК, полученных из одного или нескольких образцов плазмы, крови или сыворотки субъекта; и

сравнение общего профиля экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от субъекта, предположительно страдающего от колоректальной неоплазии, с общим профилем экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от нормального субъекта, где нормальным субъектом является здоровый человек, не страдающий от колоректальной неоплазии,

где повышенная экспрессия miR15b свидетельствует о наличии колоректальной неоплазии.

2. Способ по п. 1, включающий этапы:

измерения общего профиля экспрессии или уровня микроРНК, полученных из одного или нескольких образцов плазмы, крови или сыворотки субъекта, где, по меньшей мере, эти миРНК являются miR19a и miR19b и miR15b; и

сравнения общего профиля экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от субъекта, предположительно страдающего от колоректальной неоплазии, с общим профилем экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от нормального субъекта, в котором нормальным субъектом является здоровый человек, не страдающий от колоректальной неоплазии,

где повышенная экспрессия miR19a и miR19b и miR15b свидетельствует о наличии колоректальной неоплазии.

3. Способ по п. 1 или 2, который дополнительно включает анализ экспрессии, по меньшей мере, одной из miR29a или miR335 по сравнению с экспрессией у нормального субъекта, причем повышенная экспрессия miR29a или miR335 расценивается как дополнительный показатель колоректальной неоплазии.

4. Способ по любому из предшествующих пунктов, в котором образец является образцом плазмы.

5. Способ по любому из предшествующих пунктов, в котором уровень экспрессии одной или нескольких микроРНК измеряется профилированием экспрессии с помощью микроматриц, ПЦР, ПЦР с обратной транскриптазой, ПЦР с обратной транскриптазой в реальном времени, количественной ПЦР в реальном времени, ПЦР с анализом по конечной точке, мультиплексной ПЦР с анализом по конечной точке, ПЦР-амплификацией при пониженной температуре денатурации (COLD-PCR), ICE-COLD ПЦР, масс-спектрометрии, гибридизации in situ (ISH), мультиплексной гибридизация, или секвенирования нуклеиновых кислот.

6. Применение набора для диагностики колоректальной неоплазии, где набор включает реагенты, детектирующие биомаркеры, для определения уровня дифференциальной экспрессии miR15b в образце плазмы, крови или сыворотки, где сверхэкспрессия указанной микроРНК свидетельствует о колоректальной неоплазии.

7. Применение набора по п. 6, в котором набор дополнительно включает реагенты, детектирующие биомаркеры, для определения уровня дифференциальной экспрессии miR19a и miR19b, где сверхэкспрессия miR19a и miR19b и miR15b свидетельствует о колоректальной неоплазии.

8. Применение по любому из пп. 6 или 7, в котором набор дополнительно включает реагенты для детекции и анализа, по меньшей мере, одного из числа miR29a, или miR335.

9. Применение набора по любому из пп. 6-8, дополнительно включающее:

a. инструкции для применения в диагностике риска прогрессирующих колоректальных аденом и/или колоректальной неоплазии, где инструкции включают пошаговые руководства для сравнения уровня экспрессии микроРНК при измерении экспрессии образца, полученного из субъекта, предположительно имеющего колоректальные аденомы или колоректальные неоплазии, с уровнем экспрессии образца, полученного из нормального субъекта, где нормальным субъектом является здоровый человек, не страдающий от прогрессирующих колоректальных аденом или колоректальной неоплазии; и

b. инструменты, сосуды и реагенты для получения образцов из субъекта, выбранных из группы, состоящей из одного или нескольких из числа биологических жидкостей, образца плазмы, образца сыворотки, образца крови, образца ткани, образца кала.



 

Похожие патенты:

Изобретение касается способа обнаружения микроделеций в области хромосомы с ДНК-маркирующим участком. Способ включает выбор области хромосомы с ДНК-маркирующим участком; получение зонда захвата, соответствующего последовательности ДНК в указанной области; гибридизацию зонда захвата со смешанной библиотекой для связывания с последовательностью из множества образцов ДНК из области с ДНК-маркирующим участком; секвенирование захваченной последовательности ДНК из области с ДНК-маркирующим участком для получения данных секвенирования и анализ результатов секвенирования с использованием метода математической статистики с получением результата, показывающего наличие или отсутствие микроделеции в области хромосомы с ДНК-маркирующим участком в каждом из множества образцов ДНК.

Изобретение относится к области биохимии. Предложен набор олигонуклеотидов для детекции мутаций c.598_612del и c.550delA гена CAPN3.

Группа изобретений относится к биотехнологии, в частности к устройству и способу для автоматического анализа биологических образцов, обеспечивающих выполнение всех необходимых операций для анализа биологических образцов в режиме реального времени.

Изобретение относится к наборам олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации генетического материала методом мультиплексной ПЦР.

Изобретение относится к биохимии. Описана популяция панкреатических эндокринных клеток, которые соэкспрессируют NKX6.1 и инсулин, и где менее 10% клеток в популяции экспрессируют глюкагон, где популяцию панкреатических эндокринных клеток получают дифференцировкой плюрипотентных стволовых клеток человека, полученных из устойчивых линий эмбриональных стволовых клеток человека, где указанная дифференцировка включает первую стадию культивирования плюрипотентных стволовых клеток в среде, содержащей агонист рецептора TGF-β, выбранный из группы, состоящей из активина А, активина В, TGFβ-I, TGFβ-II, GDF-8 и GDF-11, в концентрации от около 2 нг/мл до 100 нг/мл, и дополнительную стадию культивирования клеток панкреатической эндодермы в среде, содержащей от 20 нМ до 500 нМ (2S,5S)-(Е,Е)-8-(5-(4-(трифторметил)фенил)-2,4-пентадиеноиламино)бензолактам.

Настоящее изобретение относится к биохимии, в частности к способу модификации гена LacZ из Escherichia coli. Для осуществления способа фрагмент ДНК, содержащий кодирующую область гена LacZ, нарабатывают с помощью полимеразной цепной реакции с использованием олигонуклеотидного праймера, позволяющего ввести дополнительный кодон GGA, кодирующий глицин, непосредственно после инициаторного кодона ATG.

Изобретение относится к области биохимии, а именно к способу определения последовательности молекулы нуклеиновой молекулы-мишени. Получают олигонуклеотидный зонд захвата, присоединенный к кодированному микроносителю.

Изобретение относится к области медицины. Предложен способ определения вероятности рецидивирования рака молочной железы у субъекта - млекопитающего, включающий измерение уровня экспрессии РНК-транскриптов KI67, CCND1, PTEN, NDRG1, TERT в биологическом образце, содержащем опухолевые клетки и определение показателя рецидивирования для указанного субъекта с учетом измеренных уровней экспрессии генов как точки на графике с двумя координатами X и Y.

Изобретение относится к области биохимии, в частности к трансгенной растительной клетке сои, семени и растению сои, которые предназначены для получения растения, имеющего устойчивость к гербициду, выбранному из группы, состоящей из 2,4-D, глифосата, глюфосината и их комбинаций.

Изобретение относится к медицине и касается способа прогнозирования возникновения рецидива вульвы I и II стадии. Предложенный способ заключается в определении в ткани опухоли ДНК вируса папилломы человека методом полимеразной цепной реакции.

Изобретение относится к биохимии. Описан синтетический олигонуклеотид длиной от 19 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций. При этом указанный олигонуклеотид специфически гибридизуется с природным антисмысловым полинуклеотидом гена IFRD1 и имеет последовательность, по меньшей мере на 90% идентичную последовательности, обратно комплементарной участку в рамках нуклеотидов 1-740 последовательности SEQ ID NO: 2, или 1-418 последовательности SEQ ID NO: 3, или 1-540 последовательности SEQ ID NO: 4, или 1-546 последовательности SEQ ID NO: 5, или 1-429 последовательности SEQ ID NO: 6, или 1-429 последовательности SEQ ID NO: 7, или имеет последовательность, по меньшей мере на 90% идентичную участку последовательности SEQ ID NO: 1. Изобретение также относится к применению указанного антисмыслового олигонуклеотида для лечения заболеваний и расстройств, ассоциированных с экспрессией IFRD1. Изобретение расширяет арсенал средств для лечения заболеваний и расстройств, ассоциированных с экспрессией IFRD1. 6 н. и 26 з.п. ф-лы, 1 ил., 1 табл., 2 пр.

Изобретения относятся к области определения последовательности нуклеиновой кислоты. Предложена группа изобретений, включающая устройство и способ для оптического контроля секвенирования нуклеиновой кислоты, машиночитаемый носитель с компьютерной программой и программный элемент, используемые в вышеуказанном способе, а также применение 5-метил-(2-(2-нитрофенил)пропил)карбонат-dUTP, 5-метил-(2-оксо-1,2-дифенилэтил)карбонат-dUTP в качестве блокатора в секвенировании ДНК в вышеуказанном способе. Устройство включает подложку в виде проволочной сетки для связывания молекулы на поверхности; оптическую схему, выполненную с возможностью направления возбуждающего излучения на подложку, приема, детектирования излучения и направления расщепляющего излучения на подложку; раствор с нуклеотидами и ферментом, где нуклеотиды содержат блокатор. Способ включает обеспечение подложки с молекулой, облучение подложки возбуждающим излучением, ограничение возбуждающего излучения с помощью подложки, прием и детектирование флуоресценции возбужденной флуоресцентной метки нуклеотида, выполнение облучения подложки расщепляющим излучением, ограничение расщепляющего излучения и обеспечение раствора с многочисленными нуклеотидами и ферментом. Изобретения обеспечивают усовершенствование способа определения последовательности нуклеиновой кислоты. 5 н. и 9 з.п. ф-лы, 11 ил.

Изобретение относится к области медицины, в частности к молекулярной онкологии, и предназначено для прогнозирования выживаемости больных раком тела матки на основании уровня экспрессии гена ESR1. Осуществляют выделение тотальной РНК из тканевых проб матки с помощью метода гуанидин-тиоционат-фенол-хлороформной экстракции, получение кДНК с помощью обратной транскрипции на матрице РНК и последующую амплификацию в режиме ПЦР-РВ. Проводят расчет относительной экспрессии генетического локуса ESR1 с последующим вычислением соотношения экспрессии этого гена в опухолевой ткани относительно нормальной ткани матки по формуле K=REcancer/REnormal. При значении K в пределах 0,31≤KESR1≤0,81 прогнозируют благоприятный исход заболевания. При значении K в пределах 5,84≤KESR1≤9,32 прогнозируют неблагоприятный исход заболевания. Изобретение обеспечивает эффективное прогнозирование выживаемости больных раком тела матки. 2 табл., 2 пр.

Изобретение относится к области медицины, в частности к акушерству и гинекологии, и предназначено для прогнозирования высокого риска репродуктивных потерь в первом триместре беременности. Из периферической венозной крови женщин выделяют ДНК с последующей амплификацией полиморфных вариантов A66G гена MTRR, -31С-Т (rs1143627) IL-1β, -174G-C (rs1800795) IL-6 и С677Т (rs1801133) MTHFR. При выявлении одного из четырех генотипов: -31СТ IL-1β / -174GG IL-6 / 677СТ MTHFR / 66GG MTRR; -31СТ IL-1β / -174СС IL-6 / 677СС MTHFR / 66AG MTRR; -31CC IL-1β / -174CC IL-6 / 677CC MTHFR/ 66AG MTRR; -31CC IL-1β / -174GC IL-6 / 677CT MTHFR/ 66AG MTRR прогнозируют высокий риск репродуктивных потерь в первом триместре беременности. Изобретение позволяет формировать среди женщин группы риска репродуктивных потерь в первом триместре беременности и своевременно реализовывать в этих группах необходимые лечебно-профилактические мероприятия. 1 ил., 1 табл., 7 пр.

Изобретение относится к области медицины, в частности к иммунологии и педиатрии, и предназначено для диагностики тимомегалии у детей. Проводят ПЦР в режиме реального времени с использованием соответствующих праймеров и флюоресцентно-меченого олигонуклеотида с последующим расчетом числа копий Т-рецепторных эксцизионных колец (ТРЭК) по стандартной кривой, построенной по разведениям плазмиды, представленной SEQ ID NO: 1 с известной концентрацией ДНК ТРЭК. Тимомегалию диагностируют при снижении уровня ТРЭК ниже 25,36 копий на 1 тыс. лимфоцитов у детей в возрасте до 2 лет, ниже 14,71 копий на 1 тыс. лимфоцитов у детей 3-6 лет и ниже 4,82 копий на 1 тыс. лимфоцитов у детей 7-10 лет. Изобретение обеспечивает эффективное определение тимомегалии у детей по уровню ТРЭК, что позволит своевременно назначить иммунокорригирующую терапию. 1 ил., 1 табл., 3 пр.

Изобретение относится к области медицины, в частности к стоматологии, и предназначено для получения точных количественных данных о видовом составе микроорганизмов пародонтальных карманов. В качестве исследуемого материала используют содержимое пародонтального кармана. Для осуществления предлагаемого способа проводят забор содержимого пародонтальных карманов стерильным бумажным эндодонтическим штифтом размером №25, который вводят в наиболее глубокие участки пародонтального кармана экспозицией не менее 10 сек и затем помещают в пробирку с транспортной средой. Проводят выделение тотальной ДНК из биоматерила, ПЦР в режиме реального времени, при этом используют видоспецифичные праймеры к фрагментам ДНК Porphyromonas gingivalis, Streptococcus oralis, Streptococcus sanguis, Streptococcus sobrinus, Treponema denticola. После этого концентрацию микроорганизмов в исследуемом образце рассчитывают по формуле В=1,7×(Nst×Ε×(Cst-Ct))/V, где: В - концентрация микроорганизмов, копий ДНК/мл; Nst - стандартная начальная концентрация ДНК; Ε - эффективность РТ-ПЦР - число, показывающее, во сколько раз за один цикл изменится количество фрагментов ДНК; Cst - значение порогового цикла стандартного образца; Ct - значение порогового цикла опытного образца; V - объем исследуемой пробы, мл; 1,7 - коэффициент перерасчета. Использование изобретения повышает точность способа за счет определения концентрации пародонтопатогенных бактерий в абсолютных значениях - количество копий ДНК/мл. 3 табл., 2 пр.

Изобретение относится к медицинской микробиологии. Описан способ идентификации подвидов возбудителя туляремии Francisella tularensis subsp. tularensis, Francisella tularensis subsp. mediasiatica и Francisella tularensis subsp. holarctica, включающий стадии выделения ДНК микроорганизма из исследуемого материала и проведение с полученной ДНК двух реакций амплификации. При этом используется набор сконструированных специфических праймеров к вариабельным участкам области RD6 туляремийного микроба, где набор состоит из трех праймеров: RD6-com ATACTAGCTTCAATCTCTGTGG СТТТ RD6-hol ATGCACTGGTTGGAATACAAATC RD6-tul CACATAGCAAATTAGTTGGATATGGA и второй из двух праймеров: RD6-del1 AACAATACCAACACTATTGAGTAAAA RD6-del2 AGCCATGCAATTATTAAAGC. Подвид возбудителя туляремии определяют по размеру специфического амплификата, в случае первой реакции амплификации если он составляет 212 п.о., а во второй 85 п.о., то регистрируют Francisella tularensis subsp. holarctica, если соответственно 425-91 п.о., то Francisella tularensis subsp. tularensis и 419-85 п.о. определяют как Francisella tularensis subsp. mediasiatica. Изобретение расширяет арсенал средств для выявления трёх основных подвидов туляремийного микроба. 2 з.п. ф-лы, 2 ил., 1 табл., 3 пр.

Изобретение относится к области генной инженерии, конкретно к наборам синтетических олигонуклеотидов, и может быть использовано для определения уровней экспрессии основных изоформ гена PDLIM4. Предложен набор синтетических олигонуклеотидов для определения статуса PDLIM4 методом ПЦР в реальном времени. Уровень экспрессии PDLIM4 определяют в ходе ПЦР-РВ за счет определения скорости накопления флуоресцентного продукта реакции. ПЦР проводят с использованием набора олигонуклеотидов, состоящего из концевых праймеров для проведения амплификации целевого участка кДНК PDLIM4 - области стыка экзонов 2-3 (для определения количества суммарных изоформ PDLIM4) и экзонов 6-7 (для определения полноразмерной изоформы PDLIM4). Набор олигонуклеотидов содержит разрушаемый в ходе реакции флуоресцентно-меченый зонд. Изобретение позволяет быстро, чувствительно и специфично определять уровни экспрессии полноразмерной изоформы гена PDLIM4, а также тотальной совокупности изоформ PDLIM4, в том числе в клиническом резекционном либо биопсийном материале, полученном от пациентов с опухолями молочной железы, для более точного установления фенотипических характеристик заболевания. 1 табл., 1 ил.
Изобретение относится к области клинической лабораторной диагностики. Предложен способ оценки готовности раневой поверхности к пластическому закрытию с использованием метода полимеразной цепной реакции (ПЦР). Способ включает количественное определение копий ДНК бактерий St. Aureus (MRSA), St. Epidermidis (MRCoNS), Ps. Aeruginosa, Kl. Pneumoniae, E. Coli, как наиболее значимых видов бактериального возбудителя инфекции, при этом в одном миллилитре раневого отделяемого определяют содержание бактериального возбудителя. При значении содержания каждого бактериального возбудителя менее 500 копий/мл делают вывод о готовности раны к пластическому закрытию. Предложенный способ позволяет надежно оценить готовность раны к пластическому закрытию и может быть использован в клинической практике для оценки эффективности комплексной терапии и готовности раны к пластическому закрытию. 2 пр.

Изобретение относится к области ветеринарии и молекулярной биотехнологии и предназначено для диагностики анаплазмоза рогатого скота методом полимеразной цепной реакции (ПЦР). Осуществляют выявление фрагмента гена MSP4, кодирующего ДНК анаплазм, с использованием 10 различных пар прямых и обратных олигонуклеотидных праймеров. Проводят электрофоретическое определение размера амплифицируемого фрагмента нуклеотидной последовательности. По наличию на электрофореграмме фрагментов соответствующей длины диагностируют в крови животного кровепаразитов Anaplasma marginale или Anaplasma ovis. Изобретение обеспечивает эффективный способ обнаружения фрагментов генома Anaplasma marginale и Anaplasma ovis методом ПЦР с использованием специфических олигонуклеотидных праймеров. 3 табл.
Наверх