Способ диагностики тимомегалии у детей



Способ диагностики тимомегалии у детей
Способ диагностики тимомегалии у детей

 

G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2611393:

Федеральное государственное бюджетное учреждение "Государственный научный центр "Институт иммунологии" Федерального медико-биологического агентства России (RU)

Изобретение относится к области медицины, в частности к иммунологии и педиатрии, и предназначено для диагностики тимомегалии у детей. Проводят ПЦР в режиме реального времени с использованием соответствующих праймеров и флюоресцентно-меченого олигонуклеотида с последующим расчетом числа копий Т-рецепторных эксцизионных колец (ТРЭК) по стандартной кривой, построенной по разведениям плазмиды, представленной SEQ ID NO: 1 с известной концентрацией ДНК ТРЭК. Тимомегалию диагностируют при снижении уровня ТРЭК ниже 25,36 копий на 1 тыс. лимфоцитов у детей в возрасте до 2 лет, ниже 14,71 копий на 1 тыс. лимфоцитов у детей 3-6 лет и ниже 4,82 копий на 1 тыс. лимфоцитов у детей 7-10 лет. Изобретение обеспечивает эффективное определение тимомегалии у детей по уровню ТРЭК, что позволит своевременно назначить иммунокорригирующую терапию. 1 ил., 1 табл., 3 пр.

 

Изобретение относится к области медицины, а именно к иммунологии и педиатрии, и может быть использовано при диагностике тимомегалии, определении природы и механизмов развития данного состояния. Также предлагаемое изобретение может быть использовано при отборе детей с увеличением тимуса, нуждающихся в иммунологической коррекции, и для адекватного подхода к применению существующих методов лечения патологии вил очковой железы (тимуса).

У детей, особенно первых лет жизни, нередко наблюдается увеличение размеров тимуса. Это состояние обозначается как тимомегалия и трактуется как синдром, связанный с аномалиями развития, дисфункциями эндокринной и нервной систем и другими патологическими состояниями. Данным термином объединяют различные по своей природе состояния, характеризующиеся увеличением тимуса. Некоторые исследователи постулируют связь тимомегалии с иммунодефицитом. Противоположная теория основана на том, что увеличение размеров тимуса у детей рассматривают как возможный вариант нормы.

Однако частая встречаемость тимомегалии у детей с отягощенным анамнезом, перинатальным поражением центральной нервной системы (ЦНС), а также обнаруженные клинико-иммунологические и гормонально-метаболические особенности этих детей как в период клинического благополучия, так и во время острых инфекционных заболеваний и оперативных вмешательств, позволяют выделить данных детей в отдельную группу с повышенным риском возникновения дисбаланса иммунной и нейроэндокринной систем, которая требует оптимизации профилактических мероприятий и дифференцированного врачебного наблюдения.

В настоящее время для диагностики тимомегалии используют ультразвуковое сканирование (Сиротина О.Б. Автореферат диссертации, 2012) и рентгенографию (Матковская Т.В. Рентгенография, методы исследований, 1983). Однако эти методы позволяют определить размеры тимуса, не касаясь оценки функции этого органа: обеспечения развития (созревания, селекции, дифференцировки) Т-лимфоцитов. Кроме того, изменение размеров тимуса этими способами удается определить не всегда. К тому же рентгенография связана с лучевой нагрузкой, а для проведения УЗИ необходимы специально подготовленные исполнители, что сужает возможности распространения этих методов для широкого круга обследуемых.

Известен способ диагностики тимомегалии у детей (авт. свид. СССР № 1642395), при котором проводят иммунологическое обследование детей с определением абсолютного числа Т-лимфоцитов и В-лимфоцитов; при дисбалансе относительного и абсолютного содержания Т- и В-лимфоцитов, заключающемся в снижении относительного числа Т-лимфоцитов до 15-30% при нормальных значениях их абсолютного числа и повышенном абсолютном числе лимфоцитов, диагностируют наличие тимомегалии у детей.

Установлено также, что при тимомегалии, кроме снижения численности Т-лимфоцитов, наблюдаются и другие признаки гипофункции Т-клеточного звена иммунной системы: изменение их субпопуляционного состава, ослабление функциональной активности (Ваганов П.Д. Клинико-иммунологическая характеристика детей с синдромом увеличенной вилочковой железы и их коррекция / П.Д. Ваганов, М.И. Мартынова, В.Я. Арион // Российский вестник перинатологии и педиатрии. - 2001. - Т. 46. - № 3. - С. 59-60; Никонова Μ.Φ. Особенности популяции Т-лимфоцитов у больных с тимомегалией / М.Ф. Никонова, И.М. Данько, П.Д. Ваганов, А.А. Ярилин // Иммунология. - 2008. - Т. 29. - ? 4. - С. 201-206; Тюрин Н.А. Т- и В-компоненты иммунной системы при острых бронхолегочных заболеваниях у детей с тимомегалией и без нее / Н.А. Тюрин, В.Я. Арион, Л.В. Пушко, Л.Г. Кузьменко, Л.В. Байдун, И.А. Журавлева // Педиатрия. - 1991. - № 6. - С. 39-42).

Однако определение уровня Т-лимфоцитов для определения достоверной картины о состоянии тимуса у детей раннего возраста недостаточно. Логически была установлена связь увеличения размеров тимуса с изменением его функционирования. В связи с этим была рассмотрена возможность нарушений тимопоэза при тимомегалии, особенно у детей раннего возраста, когда процессы развития Т-лимфоцитов проявляют максимальную зависимость от тимуса.

Таким образом, было предложено проводить исследование уровня Т-рецепторных эксцизионных колец (ТРЭК) - маркеров, отражающих выход Т-лимфоцитов из тимуса в периферический отдел иммунной системы.

ТРЭК представляют собой кольцевидные структуры, вырезаемые из геномной ДНК в процессе перестройки зародышевых генов Т-клеточного рецептора. При этом происходит сближение пространственно разделенных генетических сегментов, находящийся между ними генетический материал вырезается и замыкается в эписомальное кольцо - ТРЭК. При делении Т-клеток эти кольцевые молекулы не делятся и остаются только в одной дочерней клетке. С каждым последующим делением число ТРЭК на общее число Т-клеток уменьшается в геометрической прогрессии. Вне тимуса в наибольшем количестве ТРЭК обнаруживаются в Т-лимфоцитах - недавних эмигрантах из тимуса, т.е. клетках, которые после выхода из тимуса не успели поделиться.

Поэтому задачей изобретения была разработка достоверного и безопасного способа диагностики тимомегалии у детей по уровню Т-рецепторных эксцизионных колец с целью назначения своевременной иммунокорригирующей терапии.

Для диагностики тимомегалии у детей определяли количество копий Т-рецепторных эксцизионных колец (ТРЭК) в лимфоцитах периферической крови путем проведения полимеразной цепной реакции в режиме реального времени с использованием соответствующих праймеров и флюоресцентно-меченого олигонуклеотида с последующим расчетом числа копий Т-рецепторных эксцизионных колец по стандартной кривой, построенной по разведениям плазмиды, представленной SEQ ID NO: 1 с известной концентрацией ДНК ТРЭК, и при снижении уровня ТРЭК ниже 25,36 копий на 1 тыс.лимфоцитов у детей в возрасте до 2 лет, ниже 14,71 копий на 1 тыс.лимфоцитов - у детей дошкольного возраста 3-6 лет и ниже 4,82 копий на 1 тыс.лимфоцитов - у детей 7-10 лет определяли тимомегалию.

Техническим результатом изобретения является определение референсных значений для ТРЭК у детей с тимомегалией в зависимости от возраста, что позволяет выявить группу детей с тимомегалией на основе оценки количества ТРЭК с помощью ПЦР в режиме реального времени, используя плазмиду из ДНК человеческого тимуса, представленную SEQ ID NO: 1.

Краткое описание чертежей

Рисунок 1. Пример содержания ТРЭК у 2-летнего ребенка с тимомегалией (1) в сравнении с ребенком того же возраста с нормальными размерами тимуса (2) с учетом серии разведений плазмиды с известной концентрацией ДНК TREC - 107, 106, 105, 104, 103, 102, 101 копий/мкл (образцы представлены в дублях).

Подробное описание изобретения

Пример 1. Выделение ДНК из мононуклеаров крови у детей с тимомегалией

У детей с предполагаемой тимомегалией проводят забор крови в стерильные пробирки для крови с объемом вакуума 2 мл, содержащие антикоагулянт (K3EDTA в концентрации 2 мг/мл). Количество лейкоцитов и лимфоцитов в цельной крови, окрашенных в растворе Тюрка (3% раствор уксусной кислоты, подкрашенный генцианом фиолетовым), подсчитывают в счетной камере Горяева.

После этого производят разделение клеточных элементов периферической крови с выделением мононуклеаров крови. Разделение клеточных элементов крови осуществляется путем центрифугирования в одноступенчатом градиенте плотности фиколла-верографина (плотность 1,077 г/мл).

Затем проводят выделение ДНК из мононуклеаров крови. Выделение ДНК проводится из 1×106 лимфоцитов периферической крови с использованием набора «Проба НК». Объем полученной ДНК составляет 50 мкл. Концентрацию ДНК определяют спектрофотометрически.

Пример 2. Получение плазмиды из ДНК человеческого тимуса для проведения расчета числа копий ТРЭК

Для определения абсолютного количества ТРЭК в лимфоцитах крови используют плазмиду. Плазмида получена путем клонирования ДНК ТРЭК тимоцитов человека (из тимуса детей в возрасте до 1 года, удаляемого во время операций на сердце в соответствии с существующей хирургической практикой) в вектор pJetl.2/Blunt («Fermentas»).

Для изготовления плазмиды была проведена ПЦР-амплификация фрагмента ДНК ТРЭК (35 циклов) с помощью праймеров, содержащих сайты рестрикции. Очищенный ПЦР-продукт лигировали с вектором pJetl.2/Blunt («Fermentas»), затем трансформировали компетентные клетки E.coli. Трансформированные бактерии высевали на чашки Петри с LB-агаром, содержащим 100 мкг/мл ампициллина. Через сутки появившиеся колонии бактерий подвергали дальнейшему анализу. Четыре колонии подращивали в течение 16 ч в 3 мл жидкой среды LB с ампициллином (мини-культуры). Плазмиды выделяли из мини-культур с помощью набора QIAPrep («Qiagen»). Концентрации выделенных плазмид определяли путем спектрофотометрии при длине волны 260 нм. Полученные плазмиды подвергли рестрикционному анализу. После успешного рестрикционного анализа часть выделенных плазмид была отправлена на секвенирование с используемыми для ее синтеза праймерами для более детального установления и подтверждения последовательности ее ДНК. По полученным результатам секвенирования был сделан вывод о специфичности и корректности проведенной вставки. Плазмида представлена последовательностью SEQ ID NO: 1. SEQ ID NO: 2 представляет собой специфическую вставку для определения уровня ТРЭК.

Пример 3. Определение количества копий Т-рецепторных эксцизионных колец в лимфоцитах периферической крови детей с тимомегалией

Следующим этапом проводят исследование содержания Т-рецепторных эксцизионных колец. Исследование заключается в определении количества копий Т-рецепторных эксцизионных колец в лимфоцитах периферической крови детей методом полимеразной цепной реакции в режиме реального времени (ПЦР-РВ) в соответствии с общепринятыми методиками: с использованием соответствующих специфических праймеров и флюоресцентно-меченого олигонуклеотида (зонда). Для расчета числа копий ТРЭК применяется калибровочная кривая, полученная с использованием плазмиды с известной концентрацией ДНК ТРЭК. Число копий ТРЭК пересчитывается на 1 тыс.лимфоцитов. В случае снижения уровня ТРЭК диагностируют тимомегалию. Снижение содержания ТРЭК свидетельствует о несостоятельности у детей иммунной системы и позволяет своевременно назначить иммунокорригирующую терапию.

Было обследовано 130 детей в возрасте от 1 месяца до 10 лет, из них 60 детей с увеличением тимуса и 70 детей без тимомегалии. Размер тимуса определяли рентгенологически. Мерой выраженности тимомегалии был кардио-тимико-торакальный индекс (КТТИ). В исследование были отобраны дети с тимомегалией II степени (0,37<КТТИ<0,42). Поскольку из данных литературы известно, что уровень ТРЭК зависит от возраста, обследованные дети были разделены на три возрастные подгруппы: до 3 лет (0-2 года), 3-6 лет и 7-10 лет. Сравнение содержания ТРЭК у мальчиков и девочек в одинаковых возрастных группах не выявило тендерных различий по уровню ТРЭК (Р>0,05).

Результаты исследования представлены в таблице 1, из которой следует, что при тимомегалии выявляется статистически значимое снижение числа копий ТРЭК в лимфоцитах. Наибольшие различия в уровне ТРЭК наблюдаются у детей раннего возраста: в возрасте до 2 лет содержание ТРЭК при тимомегалии почти в 3 раза ниже показателей детей с нормальными размерами тимуса (рисунок 1). В дальнейшем (после 2 лет) разница в степени снижения содержания ТРЭК у детей с тимомегалией в сравнении с лицами без увеличения тимуса менее выражена и составляет 2,3 раза в возрасте 3-6 лет, 2 раза - в 7-10 лет, уменьшается и число детей с тимомегалией. При сопоставлении числа копий ТРЭК у детей раннего возраста с тимомегалией с показателями возрастной нормы оказалось, что уровень ТРЭК у этих детей соответствуют нормальным показателям, свойственным примерно 8-летним детям, у которых функциональная активность тимуса снижена по сравнению с детьми более раннего возраста.

Таким образом, снижение уровня ТРЭК ниже 25,36 копий на 1 тыс. лимфоцитов у детей в возрасте до 2 лет, ниже 14,71 копий на 1 тыс. лимфоцитов - у детей дошкольного возраста (3-6 лет) и ниже 4,82 копий на 1 тыс. лимфоцитов - у детей 7-10 лет позволяет диагностировать тимомегалию.

Эти изменения вызывают функциональный дефицит Т-клеточного звена иммунной системы и могут способствовать проявлению ее несостоятельности. Поэтому детей с тимомегалией можно рассматривать как детей из группы риска, предрасположенных к возникновению более частых заболеваний.

При проведении экспериментов впервые получены свидетельства ослабления эмиграции Т-клеток из тимуса в периферический отдел иммунной системы у детей с тимомегалией в зависимости от возраста. Определение референсных значений для ТРЭК у детей с тимомегалией в зависимости от возраста позволяет выявить группу детей с тимомегалией на основе оценки количества ТРЭК с помощью ПЦР в режиме реального времени, используя плазмиду из ДНК человеческого тимуса, представленную SEQ ID NO: 1.

Установление несостоятельности иммунной системы у детей позволяет своевременно назначать иммунокорригирующую терапию. При этом исследование проводится in vitro, исключая воздействие на ребенка ионизирующего излучения.

Перечень последовательностей

<110> ФГБУ "ГНЦ Институт иммунологии" ФМБА России

<120> Способ диагностики тимомегалии у детей

<160> NUMBER OF SEQ ID NOS: 1

<210> SEQ ID NO 1

<211> 3382

<212> DNA

<213> Human

<400> SEQUENCE 1 (PLASMID)

GCCCCTGCAGCCGAATTATATTATTTTTGCCAAATAATTTTTAACAAAAGCTCTGAAGTCTTCTTCATTTAAATTCTTAGATGATACTTCATCTGGAAAATTGTCCCAATTAGTAGCATCACGCTGTGAGTAAGTTCTAAACCATTTTTTTATTGTTGTATTATCTCTAATCTTACTACTCGATGAGTTTTCGGTATTATCTCTATTTTTAACTTGGAGCAGGTTCCATTCATTGTTTTTTTCATCATAGTGAATAAAATCAACTGCTTTAACACTTGTGCCTGAACACCATATCCATCCGGCGTAATACGACTCACTATAGGGAGAGCGGCCGCCAGATCTTCCGGATGGCTCGAGTTTTTCAGCAAGATAAAGAGGGCAGCCCTCTCCAAGGCAAAATGGGGCTCCTGTGGGGAACAGAGGGGTGCCTCTGTCAACAAAGGTGATGCCACATCCCTTTCAACCATGCTGACACCTCTGGTTTTTGTAAAGGTGCCCACTCCTGTGCACGGTGATGCATAGGCACCTGCACCCCGTGCCTAAACCCTGCAGCTGGCACGGGCCCTGTCTGCTCTTCATTCACCGTTCTCACGAGTTGCAATAAGTTCAGCCCTCCATGTCACACTGTGTTTTCCATCCTGGGGAGTGTTTCACAGCTATCCCAAGCCCCACGCTGACGAATCACGGCCGAAAACACACTCTGATGCCAGCACAGACCACGGAGCAAATGTCAGACAAGATCAGCCTCGGAAAAGTGAGTCCTGAATTGCGATGGAAGTATCTTTCTAGAAGATCTCCTACAATATTCTCAGCTGCCATGGAAAATCGATGTTCTTCTTTTATTCTCTCAAGATTTTCAGGCTGTATATTAAAACTTATATTAAGAACTATGCTAACCACCTCATCAGGAACCGTTGTAGGTGGCGTGGGTTTTCTTGGCAATCGACTCTCATGAAAACTACGAGCTAAATATTCAATATGTTCCTCTTGACCAACTTTATTCTGCATTTTTTTTGAACGAGGTTTAGAGCAAGCTTCAGGAAACTGAGACAGGAATTTTATTAAAAATTTAAATTTTGAAGAAAGTTCAGGGTTAATAGCATCCATTTTTTGCTTTGCAAGTTCCTCAGCATTCTTAACAAAAGACGTCTCTTTTGACATGTTTAAAGTTTAAACCTCCTGTGTGAAATTATTATCCGCTCATAATTCCACACATTATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCAATTGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCC

<210> SEQ ID NO 2

<211> 408

<212> DNA

<213> Human

<400> SEQUENCE 2 (AMPLICON)

AAAGAGGGCAGCCCTCTCCAAGGCAAAATGGGGCTCCTGTGGGGAACAGAGGGGTGCCTCTGTCAACAAAGGTGATGCCACATCCCTTTCAACCATGCTGACACCTCTGGTTTTTGTAAAGGTGCCCACTCCTGTGCACGGTGATGCATAGGCACCTGCACCCCGTGCCTAAACCCTGCAGCTGGCACGGGCCCTGTCTGCTCTTCATTCACCGTTCTCACGAGTTGCAATAAGTTCAGCCCTCCATGTCACACTGTGTTTTCCATCCTGGGGAGTGTTTCACAGCTATCCCAAGCCCCACGCTGACGAATCACGGCCGAAAACACACTCTGATGCCAGCACAGACCACGGAGCAAATGTCAGACAAGATCAGCCTCGGAAAAGTGAGTCCTGAATTGCGATGGAAGT

Способ диагностики тимомегалии у детей, заключающийся в определении количества копий Т-рецепторных эксцизионных колец (ТРЭК) в лимфоцитах периферической крови путем проведения полимеразной цепной реакции в режиме реального времени с использованием соответствующих праймеров и флюоресцентно-меченого олигонуклеотида с последующим расчетом числа копий Т-рецепторных эксцизионных колец по стандартной кривой, построенной по разведениям плазмиды, представленной SEQ ID NO: 1 с известной концентрацией ДНК ТРЭК, и при снижении уровня ТРЭК ниже 25,36 копий на 1 тыс. лимфоцитов у детей в возрасте до 2 лет, ниже 14,71 копий на 1 тыс. лимфоцитов - у детей дошкольного возраста 3-6 лет и ниже 4,82 копий на 1 тыс. лимфоцитов - у детей 7-10 лет диагностируют тимомегалию.



 

Похожие патенты:

Изобретение относится к медицине и может быть использовано для оценки эффективности эндотелиопротекторной терапии у экспериментальных животных после реконструктивных операций на брюшном отделе аорты.

Изобретение относится к медицине, а именно к способу оценки угрозы формирования у беременной гемической анемии при индуцирующем действии цитомегаловирусной инфекции в период обострения на структуру мембран эритроцитов.

Изобретение относится к области медицины, в частности к акушерству и гинекологии, и предназначено для прогнозирования высокого риска репродуктивных потерь в первом триместре беременности.

Изобретение относится к области медицины, в частности к молекулярной онкологии, и предназначено для прогнозирования выживаемости больных раком тела матки на основании уровня экспрессии гена ESR1.
Изобретение относится к медицине, в частности к дерматовенерологии и патологической анатомии, и касается способа диагностики псориатической эритродермии. Способ заключается в иммуногистохимическом исследовании.

Изобретение относится к области медицины, а именно к онкостоматологии и лабораторной диагностике, и касается прогнозирования риска развития новообразований слизистой оболочки полости рта у лиц старше 40 лет.

Изобретение относится к экспериментальной медицине в области оториноларингологии и может быть использовано для оценки протективного действия фармакологического препарата при острой сенсоневральной тугоухости (ОСНТ) в эксперименте.

Изобретение относится к области медицины, а именно к судебной медицине, и может быть использовано для определения давности смерти человека на поздних сроках посмертного периода по величине оптической плотности синовиальной жидкости коленного сустава трупа.

Изобретение относится к медицине, а именно к терапии, и может быть использовано для дифференциальной диагностики острого бронхита и острой пневмонии. Сущность способа: у пациента с клинической картиной острой респираторной инфекции, сопровождающейся бронхо-легочным синдромом, определяют в слюне содержание уксусной, валериановой и изокапроновой кислот.
Изобретение относится к медицине, а именно к онкоурологии. Определяют среднекубическую величину новообразования магнитно-резонансной томографией.

Изобретение относится к области медицины, в частности к акушерству и гинекологии, и предназначено для прогнозирования высокого риска репродуктивных потерь в первом триместре беременности.

Изобретение относится к области медицины, в частности к молекулярной онкологии, и предназначено для прогнозирования выживаемости больных раком тела матки на основании уровня экспрессии гена ESR1.

Изобретения относятся к области определения последовательности нуклеиновой кислоты. Предложена группа изобретений, включающая устройство и способ для оптического контроля секвенирования нуклеиновой кислоты, машиночитаемый носитель с компьютерной программой и программный элемент, используемые в вышеуказанном способе, а также применение 5-метил-(2-(2-нитрофенил)пропил)карбонат-dUTP, 5-метил-(2-оксо-1,2-дифенилэтил)карбонат-dUTP в качестве блокатора в секвенировании ДНК в вышеуказанном способе.

Изобретение относится к биохимии. Описан синтетический олигонуклеотид длиной от 19 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Настоящее изобретение относится к тестам микроРНК плазмы для обнаружения колоректального рака на ранних стадиях. Описан способ, включающие этапы: измерения общего профиля экспрессии или уровня содержания одной или нескольких микроРНК, полученных из одного или нескольких образцов плазмы, крови или сыворотки субъекта; и сравнение общего профиля экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от субъекта, предположительно страдающего от колоректальной неоплазии, с общим профилем экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от нормального субъекта, где нормальным субъектом является здоровый человек, не страдающий от колоректальной неоплазии, где повышенная экспрессия miR15b свидетельствует о наличии колоректальной неоплазии.

Изобретение касается способа обнаружения микроделеций в области хромосомы с ДНК-маркирующим участком. Способ включает выбор области хромосомы с ДНК-маркирующим участком; получение зонда захвата, соответствующего последовательности ДНК в указанной области; гибридизацию зонда захвата со смешанной библиотекой для связывания с последовательностью из множества образцов ДНК из области с ДНК-маркирующим участком; секвенирование захваченной последовательности ДНК из области с ДНК-маркирующим участком для получения данных секвенирования и анализ результатов секвенирования с использованием метода математической статистики с получением результата, показывающего наличие или отсутствие микроделеции в области хромосомы с ДНК-маркирующим участком в каждом из множества образцов ДНК.

Изобретение относится к области биохимии. Предложен набор олигонуклеотидов для детекции мутаций c.598_612del и c.550delA гена CAPN3.

Группа изобретений относится к биотехнологии, в частности к устройству и способу для автоматического анализа биологических образцов, обеспечивающих выполнение всех необходимых операций для анализа биологических образцов в режиме реального времени.

Изобретение относится к наборам олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации генетического материала методом мультиплексной ПЦР.

Изобретение относится к биохимии. Описана популяция панкреатических эндокринных клеток, которые соэкспрессируют NKX6.1 и инсулин, и где менее 10% клеток в популяции экспрессируют глюкагон, где популяцию панкреатических эндокринных клеток получают дифференцировкой плюрипотентных стволовых клеток человека, полученных из устойчивых линий эмбриональных стволовых клеток человека, где указанная дифференцировка включает первую стадию культивирования плюрипотентных стволовых клеток в среде, содержащей агонист рецептора TGF-β, выбранный из группы, состоящей из активина А, активина В, TGFβ-I, TGFβ-II, GDF-8 и GDF-11, в концентрации от около 2 нг/мл до 100 нг/мл, и дополнительную стадию культивирования клеток панкреатической эндодермы в среде, содержащей от 20 нМ до 500 нМ (2S,5S)-(Е,Е)-8-(5-(4-(трифторметил)фенил)-2,4-пентадиеноиламино)бензолактам.

Изобретение относится к области медицины, в частности к стоматологии, и предназначено для получения точных количественных данных о видовом составе микроорганизмов пародонтальных карманов. В качестве исследуемого материала используют содержимое пародонтального кармана. Для осуществления предлагаемого способа проводят забор содержимого пародонтальных карманов стерильным бумажным эндодонтическим штифтом размером №25, который вводят в наиболее глубокие участки пародонтального кармана экспозицией не менее 10 сек и затем помещают в пробирку с транспортной средой. Проводят выделение тотальной ДНК из биоматерила, ПЦР в режиме реального времени, при этом используют видоспецифичные праймеры к фрагментам ДНК Porphyromonas gingivalis, Streptococcus oralis, Streptococcus sanguis, Streptococcus sobrinus, Treponema denticola. После этого концентрацию микроорганизмов в исследуемом образце рассчитывают по формуле В=1,7×(Nst×Ε×(Cst-Ct))/V, где: В - концентрация микроорганизмов, копий ДНК/мл; Nst - стандартная начальная концентрация ДНК; Ε - эффективность РТ-ПЦР - число, показывающее, во сколько раз за один цикл изменится количество фрагментов ДНК; Cst - значение порогового цикла стандартного образца; Ct - значение порогового цикла опытного образца; V - объем исследуемой пробы, мл; 1,7 - коэффициент перерасчета. Использование изобретения повышает точность способа за счет определения концентрации пародонтопатогенных бактерий в абсолютных значениях - количество копий ДНК/мл. 3 табл., 2 пр.
Наверх