Набор синтетических олигонуклеотидов для определения уровней экспрессии гена pdlim4



Набор синтетических олигонуклеотидов для определения уровней экспрессии гена pdlim4
Набор синтетических олигонуклеотидов для определения уровней экспрессии гена pdlim4

 

C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2612139:

Федеральное государственное бюджетное учреждение науки Институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова Российской академии наук (ИБХ РАН) (RU)

Изобретение относится к области генной инженерии, конкретно к наборам синтетических олигонуклеотидов, и может быть использовано для определения уровней экспрессии основных изоформ гена PDLIM4. Предложен набор синтетических олигонуклеотидов для определения статуса PDLIM4 методом ПЦР в реальном времени. Уровень экспрессии PDLIM4 определяют в ходе ПЦР-РВ за счет определения скорости накопления флуоресцентного продукта реакции. ПЦР проводят с использованием набора олигонуклеотидов, состоящего из концевых праймеров для проведения амплификации целевого участка кДНК PDLIM4 - области стыка экзонов 2-3 (для определения количества суммарных изоформ PDLIM4) и экзонов 6-7 (для определения полноразмерной изоформы PDLIM4). Набор олигонуклеотидов содержит разрушаемый в ходе реакции флуоресцентно-меченый зонд. Изобретение позволяет быстро, чувствительно и специфично определять уровни экспрессии полноразмерной изоформы гена PDLIM4, а также тотальной совокупности изоформ PDLIM4, в том числе в клиническом резекционном либо биопсийном материале, полученном от пациентов с опухолями молочной железы, для более точного установления фенотипических характеристик заболевания. 1 табл., 1 ил.

 

Изобретение «Набор синтетических олигонуклеотидов для определения уровней экспрессии гена PDLIM4» относится к области молекулярной биологии и может быть использовано для быстрого определения уровней экспрессии основных изоформ гена PDLIM4.

В настоящее время многие аспекты этиологии и патогенеза рака молочной железы (РМЖ) остаются неясными. Сложность изучения этого заболевания обуславливается тем, что понятие РМЖ объединяет группу гистологически и биохимически гетерогенных опухолей, отличающихся по инвазивности, клиническому течению и чувствительности к проводимой химиотерапии. Подобная гетерогенность и разнообразие определяют потребность в более детальной классификации типов РМЖ в зависимости от характера злокачественного перерождения и проводимой терапии. В связи с этим, большой интерес представляет поиск молекулярных маркеров, ассоциированных со злокачественным перерождением клеток. Изучение генов, вовлеченных в процессы онкотрансформации, а также механизмов регуляции активности этих генов приближает нас к составлению полной картины молекулярных механизмов к РМЖ, что на практике способствует ранней диагностике, субтипированию РМЖ и, в дальнейшем, выбору оптимальной стратегии терапии.

Одним из генов, принимающих участие в малигнизации клеток, может быть ген RIL. Белок RIL (reversion-induced LIM-domain containing), впоследствии названный PDLIM4, впервые описали в 1995 году как потенциальный супрессор опухолевого роста. У человека ген PDLIM4 локализован на хромосоме 5 в области 5q31.1, часто делегируемой при ряде злокачественных заболеваний. Ген PDLIM4/RIL может подвергаться не только делециям, но и эпигенетической супрессии, часто обнаруживаемой при изучении транскриптома трансформированных клеток, в частности, клеток РМЖ.

Роль PDLIM4 в канцерогенезе РМЖ малоизучена, однако многочисленные данные о корреляции изменений экспрессии этого гена с процессами малигнизации несомненно заслуживают внимания и нуждаются в дальнейшем изучении. На начальном этапе представляется возможным проанализировать данные о взаимосвязи изменений экспрессии PDLIM4 с клиническими параметрами РМЖ, такими как статус рецепторов гормонов, тип опухоли, индекс плоидности, количество клеток в S-фазе и других.

Рецепторы эстрогена (ER) и прогестерона (PR) - важнейшие биомаркеры, на экспрессии которых основана современная классификация подтипов РМЖ.

Используя комбинацию ER и PR в сочетании с рецептором эпидермального фактора роста человека 2 (HER2), а также ряд иных молекулярно-генетических признаков, можно выделить пять подтипов РМЖ, отличающихся профилями экспрессии генов: НЕR2-положительный, базальноподобный, клаудин-дефицитный и люминальные молекулярные подтипы А и В.

Корреляцию между уровнем метилирования гена PDLIM4 и статусом PR и ER анализировали в ряде работ, посвященных молекулярным механизмам прогрессии РМЖ. В большинстве этих работ прослеживалась подобная корреляция: повышенный уровень метилирования PDLIM4 был сопряжен с утратой рецепторов и, наоборот, в рецептор-положительных опухолях уровень метилирования PDLIM4 был в среднем более низким. Эти данные позволяют предположить, что метилирование гена PDLIM4 более характерно для трижды негативных (базальноподобного и клаудин-дефицитного) и HER2-положительных подтипов РМЖ, нежели для люминальных подтипов А и В. Более точно оценить корреляцию между подтипом опухоли и уровнем экспрессии PDLIM4 сложно, так как не выявлено взаимосвязи между уровнем метилирования PDLIM4 и экспрессией третьего основного классификационного биомаркера - HER2.

Приведенные данные позволяют предположить, что опухоли с низким уровнем метилирования PDLIM4 окажутся чувствительными к гормонотерапии, проведение которой будет более целесообразным, чем химиотерапии. В то же время известны случаи устойчивости к эндокринной терапии больных с опухолями ER+/PR+, поэтому гормонально-рецепторный статус не всегда позволяет определить чувствительность к гормонотерапии при РМЖ.

Еще одна важная характеристика опухоли - количество (%) ее клеток, находящихся в S-фазе клеточного цикла (SPF, S-phasefraction). Значение SPF коррелирует со скоростью роста опухоли: чем больше таких клеток, тем быстрее они делятся и тем интенсивнее растет и развивается опухоль. Высокое значение SPF коррелирует с такими параметрами, как большой размер опухоли, вероятное поражение лимфоузлов, невысокая степень дифференцировки клеток и отсутствие рецепторов стероидов.

Величина SPF считается прогностическим фактором общей и безрецидивной выживаемости, уступающим по значимости только статусу лимфатических узлов. Высокое значение SPF оценивается как важный фактор плохого прогноза, указывающий на существенное снижение выживаемости больных. Прогностически благоприятной считают величину SPF менее 8%.

Показано, что величина SPF коррелирует с уровнем метилирования PDLIM4. Пониженный уровень метилирования PDLIM4 обнаружен в опухолях с невысоким значением SPF. Эти данные согласуются с результатами оценки связи экспрессии PDLIM4 со степенью дифференцировки клеток РМЖ - в слабо дифференцированных опухолях повышен уровень метилирования PDLIM4. Таким образом, можно предположить, что низкий уровень метилирования PDLIM4 будет соответствовать медленно растущим опухолям молочной железы и коррелировать с более благоприятным прогнозом.

Существование корреляции между уровнем метилирования PDLIM4 и степенью дифференцировки клеток представляет большой интерес для использования PDLIM4 в качестве диагностического маркера, облегчающего определение подтипа РМЖ в соответствии с моделью опухолевых стволовых клеток (ОСК). Модель ОСК подразумевает, что любое злокачественное новообразование (неоплазия) развивается из одной клетки. В результате ряда событий генетический аппарат нормальной клетки может настолько трансформироваться, что происходит ее перерождение в инициирующую раковую клетку. В основе самовоспроизведения ОСК лежит асимметричный тип деления, который заключается в том, что родительская стволовая клетка может давать начало клеткам двух типов: стволовой, аналогичной материнской, и частично дифференцированной мультипотентной клетке-предшественнику. В результате пролиферации из этих клеток формируется злокачественная опухоль, имеющая иерархическую структуру и содержащая ОСК, временно пролиферирующие клетки-предшественники и терминально дифференцированные раковые клетки. Основную массу опухоли составляют дифференцированные клетки, обладающие ограниченным пролиферативным потенциалом, однако существует компартмент, образованный ОСК, который поддерживает опухоль и обеспечивает ее устойчивость к терапии. Согласно недавним исследованиям, ОСК, входящие в состав РМЖ, можно разделить на две подгруппы: эпителиоподобные и мезенхимальноподобные. В эпителиоподобных ОСК экспрессируется альдегиддегидрогеназа (ALDH), они обладают высокой пролиферативной активностью, а мезенхимальноподобные (CD24-/CD44+) ОСК обеспечивают способность к инвазии и формированию метастазов.

Суммируя сказанное, необходимо отметить, что существование корреляции между уровнем экспрессии PDLIM4 и важнейшими клиническими параметрами РМЖ свидетельствует о непосредственном участии этого гена в процессах онкотрансформации. В большинстве случаев подавление экспрессии PDLIM4 коррелирует с прогностически неблагоприятными параметрами, такими как изменение кариотипа клеток, высокое значение SPF, крупные размеры опухолей или отсутствие рецепторов гормонов. Эти данные позволяют отнести PDLIM4 к потенциальным онкосупрессорам.

Приведенные нами свидетельства взаимосвязи эпигенетических модификаций PDLIM4 с процессами злокачественного перерождения клеток и параметрами высокоинвазивных типов РМЖ позволяют рассматривать PDLIM4 в качестве непосредственного участника процессов канцерогенеза. Один из этих механизмов может заключаться в инактивации c-Src, однако вероятно существование и иных белков, регуляторами которых может быть PDLIM4. Дальнейшее изучение механизмов участия PDLIM4 в процессе канцерогенеза, а также изучение корреляции его экспрессии с развитием отдельных субтипов РМЖ представляется перспективным для поиска новых возможностей диагностики и лечения рака.

Существует несколько различных способов определения экспрессионного статуса того или иного гена - может проводиться определение количеств присутствующей в опухолевых клетках мРНК целевого гена, либо может быть проведено бисульфитное секвенирование соответствующего участка геномной ДНК с целью определения статуса метилирования области и, как следствие, сделаны выводы об эпигенетическом статусе и уровне экспрессии целевого белка. Может быть проведена детекция продукта гена - целевого белка либо иммуноферментными методами, либо масс-спектрометрически. Из перечисленных способов лишь некоторые представляются практически применимыми в клинических условиях - это определение количества присутствующей в опухолевых клетках мРНК путем постановки совмещенной реакции обратной транскрипции - полимеразной цепной реакции (ОТ-ПЦР), и определение уровней продукта экспрессии гена - белка иммуноферментными методами. Второй подход более трудоемок и чаще используется для определения секретирующихся из клеток белков, нежели для внутриклеточных. Метод ОТ-ПЦР может быть совмещен как с детекцией результата ПЦР по конечной точке - классической ПЦР-реакции, так и с детекцией в реальном времени - ОТ-ПЦР-РВ. Второй способ детекции позволяет не только получить качетственные данные о наличии или отсутствии экспрессии целевого гена, но и количественно оценить уровень экспрессии.

В настоящее время из литературы известны последовательности праймеров для проведения ОТ-ПЦР на PDLIM4 с детекцией по конечной точке: RIL4ex sense 5-CTCGCTTTCCAGTCCCTCACAAT-3 и RIL5ex antisense 5-TCTAGCATGCCCTGCAAGTAGC-3 [8]. Эти праймеры могут использоваться для определения статуса PDLIM4, однако не позволяют получить информацию об уровнях экспрессии и экспрессирующихся изоформах гена.

В качестве ближайшего аналога может быть указана заявка WO 2009036922 А2. Заявка касается методов и наборов для обнаружения наличия раковых клеток или наличия геномного DNA от раковых клеток, включающих определение статуса метилирования, или уровней экспрессии или их комбинации группы генов, включающей PDLIM4. Набор праймеров включает:

PDLIM4_4_M_S (SEQ ID NO. 34): GGCGTTTAGGTTAATTTTTCGT PDLIM4_4_M_AS (SEQ ID NO. 35): CGATCCCATATCTAAAACCGA PDLIM4_4_MB (SEQ ID NO. 36): 5'-FAM-CGACATGCCTCGCGATCCGCCCGAAACGCATGTCG-3'-DABCYL

FAM и DABCYL являются флуоресцентными маркерами.

Эти праймеры могут использоваться для определения статуса PDLIM4, уровня экспрессии, однако не позволяют получить информацию об экспрессирующихся изоформах гена.

Техническая задача, на достижение которой направлено изобретение, является разработка набора праймеров для быстрого проведения анализа статуса и определения уровней экспрессии PDLIM4 методом ОТ-ПЦР-РВ. Определение уровней экспрессии PDLIM4 достигается за счет использования флуресцентно-меченого зонда, позволяющиего проводить контроль динамики накопления флуоресцентного продукта реакции и расчитывать на основании этих данных уровни экспрессии соответствующих изоформ PDLIM4.

Предложен набор синтетических олигонуклеотидов для экспрессионного анализа PDLIM4. Статус PDLIM4 определяют методом ПЦР в реальном времени. Уровень экспрессии PDLIM4 определяют в ходе ПЦР-РВ за счет определения скорости накопления флуоресцентного продукта реакции. ПЦР проводят с использованием одного из предложенных наборов олигонуклеотидов, состоящих из концевых праймеров для проведения амплификации целевого участка кДНК PDLIM4 - области стыка либо экзонов 2-3 (для определения количества суммарных изоформ PDLIM4), либо экзонов 6-7 (для определения полноразмерной изоформы PDLIM4). Набор содержит разрушаемый в ходе реакции флуоресцентно-меченый зонд.

Зонд для ПЦР в реальном времени является олигонуклеотидом, к которому присоединены молекула флуорофора (карбоксифлуоресцеин (FAM)) и молекула гасителя флуоресценции (Black Hole Quenchers (BHQ)).

Например, Black Hole Quencher-1 deoxythymidine (BHQ1-dT), см. на фиг. 1.

Технический результат: Предложенное изобретение позволяет быстро, чувствительно и специфично определять уровни экспрессии полноразмерной изоформы гена PDLIM4, а также тотальной совокупности изоформ PDLIM4, в том числе в клиническом резекционном либо биопсийном материале, полученном от пациентов с опухолями молочной железы, для более точного установления фенотипических характеристик заболевания.

Набор синтетических олигонуклеотидов для определения уровней экспрессии гена PDLIM4 методом ПЦР в реальном времени, включающий праймеры и зонды следующей нуклеотидной последовательности:

PDLIM4-2-3-dir ACCATCTCACGGGTCCAT (SEQ ID NO: 1),

PDLIM4-2-3-rev GGATCTCAGGATCGATGTGG (SEQ ID NO: 2),

PDLIM4-2-3-probe FAM-ACCGCATCAAGGGCTGCCAC-BHQ (SEQ ID NO: 3),

PDLIM4-6-7-dir CTCCGAGGTGTACAGGATG (SEQ ID NO: 4),

PDLIM4-6-7-rev ATGGTGCCCACGATGC ((SEQ ID NO: 5),

PDLIM4-6-7-probe FAM-GCCGCGGAGCCCAAGCAGTC-BHQ (SEQ ID NO: 6).

Заявляемый набор праймеров применяют следующим образом.

1. Получение биологического материала от пациента. В качестве образцов для проведения анализа могут быть использованы биоптаты опухолей либо резекционный материал, полученный от пациентов.

2. Выделение и очистка препаратов РНК из исходных образцов. Способы выделения РНК из биологического материала хорошо известны специалистам и, как правило, включают стадии лизиса клеток, фенол-хлороформной экстракции РНК и ее очистки. Быстрое и качественное выделение РНК можно проводить с использованием коммерчески доступных наборов реагентов.

3. Постановка реакции обратной транскрипции и получения кДНК с использованием универсальной затравки олиго-дТ-18.

4. Амплификация полученных препаратов кДНК с применением предлагаемого набора праймеров, специфичных к стыкам экзонов 2-3 и 6-7 гена PDLIM4 и соответствующих флуоресцентно-меченых зондов.

5. Анализ результатов ПЦР-РВ и определение уровней экспрессии PDLIM4 за счет измерения динамики накопления флуоресцентного продукта реакции.

Реакцию амплификации проводят с использованием специализированного оборудования - амплификатора ПЦР-РВ согласно следующему температурному режиму:

Детекция флуоресценции проводится на стадии 2 каждого цикла.

Набор синтетических олигонуклеотидов для экспрессионного анализа гена PDLIM4 методом ПЦР в реальном времени, включающий праймеры и зонды следующей нуклеотидной последовательности:

PDLIM4-2-3-dir ACCATCTCACGGGTCCAT (SEQ ID NO: 1),

PDLIM4-2-3-rev GGATCTCAGGATCGATGTGG (SEQ ID NO: 2),

PDLIM4-2-3-probe FAM-ACCGCATCAAGGGCTGCCAC-BHQ (SEQ ID NO: 3),

PDLIM4-6-7-dir CTCCGAGGTGTACAGGATG (SEQ ID NO: 4),

PDLIM4-6-7-rev ATGGTGCCCACGATGC ((SEQ ID NO: 5),

PDLIM4-6-7-probe FAM-GCCGCGGAGCCCAAGCAGTC-BHQ (SEQ ID NO: 6).



 

Похожие патенты:

Изобретение относится к медицинской микробиологии. Описан способ идентификации подвидов возбудителя туляремии Francisella tularensis subsp.

Изобретение относится к области медицины, в частности к стоматологии, и предназначено для получения точных количественных данных о видовом составе микроорганизмов пародонтальных карманов.

Изобретение относится к области медицины, в частности к иммунологии и педиатрии, и предназначено для диагностики тимомегалии у детей. Проводят ПЦР в режиме реального времени с использованием соответствующих праймеров и флюоресцентно-меченого олигонуклеотида с последующим расчетом числа копий Т-рецепторных эксцизионных колец (ТРЭК) по стандартной кривой, построенной по разведениям плазмиды, представленной SEQ ID NO: 1 с известной концентрацией ДНК ТРЭК.

Изобретение относится к области медицины, в частности к акушерству и гинекологии, и предназначено для прогнозирования высокого риска репродуктивных потерь в первом триместре беременности.

Изобретение относится к области медицины, в частности к молекулярной онкологии, и предназначено для прогнозирования выживаемости больных раком тела матки на основании уровня экспрессии гена ESR1.

Изобретения относятся к области определения последовательности нуклеиновой кислоты. Предложена группа изобретений, включающая устройство и способ для оптического контроля секвенирования нуклеиновой кислоты, машиночитаемый носитель с компьютерной программой и программный элемент, используемые в вышеуказанном способе, а также применение 5-метил-(2-(2-нитрофенил)пропил)карбонат-dUTP, 5-метил-(2-оксо-1,2-дифенилэтил)карбонат-dUTP в качестве блокатора в секвенировании ДНК в вышеуказанном способе.

Изобретение относится к биохимии. Описан синтетический олигонуклеотид длиной от 19 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Настоящее изобретение относится к тестам микроРНК плазмы для обнаружения колоректального рака на ранних стадиях. Описан способ, включающие этапы: измерения общего профиля экспрессии или уровня содержания одной или нескольких микроРНК, полученных из одного или нескольких образцов плазмы, крови или сыворотки субъекта; и сравнение общего профиля экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от субъекта, предположительно страдающего от колоректальной неоплазии, с общим профилем экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от нормального субъекта, где нормальным субъектом является здоровый человек, не страдающий от колоректальной неоплазии, где повышенная экспрессия miR15b свидетельствует о наличии колоректальной неоплазии.

Изобретение касается способа обнаружения микроделеций в области хромосомы с ДНК-маркирующим участком. Способ включает выбор области хромосомы с ДНК-маркирующим участком; получение зонда захвата, соответствующего последовательности ДНК в указанной области; гибридизацию зонда захвата со смешанной библиотекой для связывания с последовательностью из множества образцов ДНК из области с ДНК-маркирующим участком; секвенирование захваченной последовательности ДНК из области с ДНК-маркирующим участком для получения данных секвенирования и анализ результатов секвенирования с использованием метода математической статистики с получением результата, показывающего наличие или отсутствие микроделеции в области хромосомы с ДНК-маркирующим участком в каждом из множества образцов ДНК.

Изобретение относится к области биохимии. Предложен набор олигонуклеотидов для детекции мутаций c.598_612del и c.550delA гена CAPN3.

Изобретение относится к биохимии. Описан синтетический олигонуклеотид длиной от 19 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Изобретение относится к биохимии. Описаны олигонуклеотиды, повышающие экспрессию гена РНКазы H1 путем нацеленного контакта с природными антисмысловыми полинуклеотидами РНКазы H1.

Изобретение относится к биохимии. Описаны антисмысловые олигонуклеотиды, модулирующие экспрессию связывающего половые гормоны глобулина (ГСПГ), в частности, путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами связывающего половые гормоны глобулина (ГСПГ).

Изобретение относится к биохимии. Описан олигонуклеотид длиной приблизительно от 15 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Настоящее изобретение относится к антисмысловым олигонуклеотидам, модулирующим экспрессию и/или функцию интерферон-регуляторного фактора 8 (IRF8), в частности, путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами интерферон-регуляторного фактора 8 (IRF8).

Изобретение относится к биохимии. Описаны олигонуклеотиды длиной от 15 до 30 нуклеотидов, содержащие по меньшей мере одну модификацию, причем указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного фрагмента сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Изобретение относится к биохимии. Описаны олигонуклеотиды, повышающие экспрессию гена фактора роста фибробластов 21 (FGF21), путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами фактора роста фибробластов 21 (FGF21).

Настоящее изобретение относится к области генетики, молекулярной биологии и медицины. Способ представлен определением соматических мутаций в тирозон-киназном домене гена BCR/ABL, ответственных за устойчивость к терапии иматинибом при хроническом миелолейкозе.

Изобретение относится к биохимии. Описаны олигонуклеотиды, модулирующие экспрессию фактора роста гепатоцитов (ФРГ), в частности, посредством нацеленного взаимодействия с природными антисмысловыми полинуклеотидами фактора роста гепатоцитов (ФРГ).

Изобретение относится к области молекулярной биологии. Предложены рекомбинантная генетическая конструкция, клонированная в лентивирусный или ретровирусный вектор по сайтам рестрикции XpaI и XhoI и направленная на подавление экспрессии онкогена C-KIT в клетках нейробластом, и применение указанной конструкции для регуляции активности гена C-KIT и его белкового продукта.
Изобретение относится к области клинической лабораторной диагностики. Предложен способ оценки готовности раневой поверхности к пластическому закрытию с использованием метода полимеразной цепной реакции (ПЦР). Способ включает количественное определение копий ДНК бактерий St. Aureus (MRSA), St. Epidermidis (MRCoNS), Ps. Aeruginosa, Kl. Pneumoniae, E. Coli, как наиболее значимых видов бактериального возбудителя инфекции, при этом в одном миллилитре раневого отделяемого определяют содержание бактериального возбудителя. При значении содержания каждого бактериального возбудителя менее 500 копий/мл делают вывод о готовности раны к пластическому закрытию. Предложенный способ позволяет надежно оценить готовность раны к пластическому закрытию и может быть использован в клинической практике для оценки эффективности комплексной терапии и готовности раны к пластическому закрытию. 2 пр.
Наверх