Способ диагностики анаплазмоза рогатого скота методом полимеразной цепной реакции

Изобретение относится к области ветеринарии и молекулярной биотехнологии и предназначено для диагностики анаплазмоза рогатого скота методом полимеразной цепной реакции (ПЦР). Осуществляют выявление фрагмента гена MSP4, кодирующего ДНК анаплазм, с использованием 10 различных пар прямых и обратных олигонуклеотидных праймеров. Проводят электрофоретическое определение размера амплифицируемого фрагмента нуклеотидной последовательности. По наличию на электрофореграмме фрагментов соответствующей длины диагностируют в крови животного кровепаразитов Anaplasma marginale или Anaplasma ovis. Изобретение обеспечивает эффективный способ обнаружения фрагментов генома Anaplasma marginale и Anaplasma ovis методом ПЦР с использованием специфических олигонуклеотидных праймеров. 3 табл.


Предлагаемое изобретение относится к области биотехнологии, молекулярно-генетической диагностики кровепаразитарных болезней животных, научных исследований в ветеринарии и молекулярной биотехнологии.

Анаплазмоз рогатого скота - трансмиссивная лихорадочная болезнь, протекающая с явлениями анемии и истощения, вызываемая внутриэритроцитарными паразитами из рода Anaplasma (Rickettsia). У крупного рогатого скота возбудитель - Anaplasma marginale Theiler, 1910, у овец и коз - A. ovis Lestoquard, 1924. В Российской Федерации и странах СНГ смертность от анаплазмоза среди больного скота составляет 25% и более (Степанова Н.И., Дьяконов Л.П., 1973; Георгиу X., 1997). За рубежом смертность среди крупного рогатого скота достигает 50-80% (Seifert Н., 1960), а иногда и 96-100% (Lubrihi А., 1969).

В комплексе мероприятий по оздоровлению хозяйств от анаплазмоза ведущее место принадлежит диагностике. В настоящее время при постановке диагноза учитывают эпизоотологические данные, симптоматику и результаты микроскопии мазков крови. Рекомендованы серологические методы диагностики - РНГА, РДСК и ИФА (Георгиу Х., 1997). Отсутствие коммерчески доступных диагностикумов на отечественном рынке вызвало необходимость создания тест-системы для диагностики анаплазмоза рогатого скота методом полимеразной цепной реакции.

В настоящее время совершенствование методов диагностики анаплазмоза крайне необходимо, поскольку традиционные методы световой микроскопии не всегда позволяют достоверно диагностировать возбудителя.

Принцип полимеразной цепной реакции (ПЦР) заключается в многократном увеличении (амплификации) определенного участка ДНК выявляемого объекта путем его копирования с помощью фермента ДНК-полимеразы и специфических праймеров. Специфические праймеры (прямой и обратный) ограничивают определенный фрагмент нуклеотидной последовательности таким образом, что элонгация новой цепи ДНК при амплификации в ПЦР происходит только между ними. Основными параметрами эффективного прохождения реакции амплификации, обеспечивающими специфичность и чувствительность, являются правильный выбор области генома идентифицируемого агента, структура и температурный режим отжига олигонуклеотидных праймеров.

Известен способ выявления фрагмента генома Anaplasma marginale методом «гнездовой» ПЦР (nested-PCR) с использованием одной пары праймеров к гену MSP5 (Major Surface Protein 5) [1]. Также описан способ выявления Anaplasma marginale методом ПЦР с использованием одной пары праймеров к гену MSP1a (major surface antigen protein 1a) [2]. Прототип.

В задачу исследований входило - разработка эффективного способа обнаружения фрагментов генома Anaplasma marginale и Anaplasma ovis методом ПЦР с использованием специфических олигонуклеотидных праймеров.

Авторами изобретения было выявлено, что для выявления Anaplasma marginale и Anaplasma ovis целесообразно использовать праймеры к специфичному для обоих возбудителей участку гена MSP4 (Major Surface Protein 4) как наиболее консервативной области генома. При конструировании праймеров и оценке их специфичности использовали нуклеотидные последовательности и программу BLAST, доступные в Интернете на сайте NCBI.

Предложенный способ заключается в следующем: с помощью компьютерной программы DNASTAR (Lasergene Co., USA) на основании программы, предоставленной в базах данных Интернет ресурсов GenBank (CLUA), по генотипам возбудителей выбирают рефернс - последовательность. Праймеры проверяют на отсутствие гомологии с последовательностями других микроорганизмов и генома человека программой BLAST с помощью веб-ресурса Национального центра биотехнологической информации (http://www.ncbi.nlm.nih.gov/). На основании проведенного компьютерного анализа были подобраны 10 пар праймеров, которые являются главным компонентом ПЦР и обеспечивают ее специфичность и чувствительность.

Праймеры имеют следующую характеристику: комлементарность выбранной области гена, отсутствие самокомлементарных участков внутри каждого праймера и между прямым и обратным, фланкируют область фрагментов гена MSP4. Синтез разработанных олигонуклеотидных праймеров заказывается в коммерческом сервисном центре.

Амплификация специфических фрагментов ДНК анаплазм с помощью разработанных праймеров для диагностики анаплазмоза рогатого скота

В процессе проведения практических экспериментов подбирают оптимальные условия прохождения полимеразной цепной реакции с разработанными праймерами. ДНК прогревают при 95° в течение 3 минут и используют для постановки ПЦР. Состав реакционной смеси указан в таблице 3. В качестве положительного контроля и ПЦР используют референтный тюменский штамм Anaplasma ovis. Предварительно штамм был исследован серологическими методами (РДСК, РНГА, ИФА). В качестве отрицательного контроля используют дистиллированную воду.

Полимеразную цепную реакцию проводят в объеме реакционной смеси 25 мкл на 1 пробу ДНК. Температурно-временной режим проведения реакции для амплификатора «Терцик» («ДНК-технология», Россия) представлен в таблице 2.

После проведения реакции амплификации продукты ПЦР анализируют методом электрофоретического разделения в 2% агарозном геле с добавлением бромистого этидия.

В процессе ПЦР были получены продукты амплификации ДНК фрагмента специфичного участка гена MSP4, кодирующего ДНК анаплазм. При обнаружении амплифицируемых фрагментов нуклеотидной последовательности соответствующей длины на электрофореграмме в исследуемом образце диагностируют наличие в крови животного кровепаразитов Anaplasma marginale или Anaplasma ovis.

При учете результатов ПЦР в первую очередь оценивали контрольные образцы. В электрофоретической дорожке с положительным контрольным образцом (К+) присутствовала светящаяся полоса на уровне, соответствующем фрагменту длиной 860 или 240 пн. В отрицательных пробах полоса отсутствовала.

Опытные пробы оценивали по наличию в соответствующей дорожке специфической полосы, которая в положительных образцах располагалась на том же уровне, что и полоса в положительной контрольной пробе.

Специфичность праймеров проверяли на образцах крови от животных, содержащих анаплазмы. Специфическая полоса была выявлена только в случае наличия в пробе Anaplasma marginale или Anaplasma ovis.

Предложенный вариант апробирован с положительным результатом и регулярной воспроизводимостью в 2013-2015 годах на 150 пробах, полученных из крови крупного рогатого скота и овец, поступивших из различных регионов.

Предлагаемое изобретение найдет применение в диагностических исследованиях в научно-исследовательских институтах, ветеринарных лабораториях, животноводческих хозяйствах.

Источники информации

1. Torioni De Echaide S, Knowles DP, McGuire TC et al. Detection of Cattle Naturally Infected with Anaplasma marginale ina Region of Endemicity by Nested PCR and a Competitive Enzyme-Linked Immunosorbent Assay Using Recombinant Major Surface Protein 5 // J. Clin. Mlicrobiol, Vol. 36, № 3. 1998, p. 777-782.

2. Ybanez AP, Ybanez RHD et al. High Genetic Diversity of Anaplasma marginale Detected from Philippine Cattle // J. Vet. Med. Sci. 2014. 76(7): 1009-1014.

Сущность изобретения поясняется таблицами, в которых отображается следующая информация:

Способ диагностики анаплазмоза рогатого скота методом полимеразной цепной реакции, при котором используют 10 различных пар прямых и обратных олигонуклеотидных праймеров (ACGAAGTGGCTTCTGAAGG и AGCTAATCCCAACCTTGCC, AGGAGGAGCCAGAGTGGA и CCAGAGATTCCGCACCACT, CATTCCCGCACACAACAGT и TGCTCCAAGGTTAAGCCGT, ATTACCCGCGACGCTACAT и AGCACGTCATAGCAGCCATT, TGGCTTCTGAAGGGGAGTA и TCCGCCAAAGTACAAACCT, AATGGCTGCTATGACGTGCT и TACACTGTTGTGTGCGGGAA, TTACCCGCGACGCTAACATT и TTGTGTGCGGGAATGTCCTT, GTTTGCTACTTTGGCGGACG и TTACACTGTTGTGTGCGGGA, TTACCTCGTTCGACATGCGT и CGTCCGCCAAAGTAGCAAAC, GAAGTGGCTTCTGAAGGGGG и ACGCATGTCGAACGAGGTAA) для выявления фрагмента специфичного участка гена MSP4, кодирующего ДНК анаплазм, с последующим электрофоретическим определением размера амплифицируемого фрагмента нуклеотидной последовательности, где по наличию на электрофореграмме фрагментов соответствующей длины в исследуемом образце диагностируют наличие в крови животного кровепаразитов Anaplasma marginale или Anaplasma ovis.


Похожие патенты:

Изобретение относится к медицине, в частности к лабораторным методам исследования, и может быть использовано для диагностики сахарного диабета. Способ включает биохимическое исследование крови у пациентов, где в плазме / сыворотке крови определяют уровень метилглиоксаль-модифицированных липопротеидов низкой плотности путем иммунометрического сэндвич-метода иммуноферментного анализа.

Группа изобретений относится к области медицины, а именно к диагностике. Способ идентификации и количественного определения специфической молекулы-мишени в образце, включающий: тестирование и выбор первого лиганда или множества первых лигандов и второго лиганда или множества вторых лигандов, соединенных с детектируемой меткой, в отношении связывания с молекулой-мишенью; или выбор первого лиганда или множества первых лигандов и второго лиганда или множества вторых лигандов, соединенных с детектируемой меткой, в отношении связывания с молекулой-мишенью; скрининг образца, содержащего специфическую молекулу-мишень, в высокопроизводительном скрининговом анализе, включающий добавление первого и второго лиганда, каждый из которых имеет первую и вторую детектируемую метку, связывание каждого из первого и второго лигандов с отдельными и специфическими сайтами на специфической молекуле-мишени, где скрининговый анализ не требует стадии промывания; обнаружение излучения света, когда первый и второй лиганды специфически связываются со специфической молекулой-мишенью; измерение интенсивности излучаемого света и по интенсивности света проводят идентификацию и количественное определение специфической молекулы-мишени в образце.

Изобретение относится к области медицины, в частности к иммунологии и педиатрии, и предназначено для диагностики тимомегалии у детей. Проводят ПЦР в режиме реального времени с использованием соответствующих праймеров и флюоресцентно-меченого олигонуклеотида с последующим расчетом числа копий Т-рецепторных эксцизионных колец (ТРЭК) по стандартной кривой, построенной по разведениям плазмиды, представленной SEQ ID NO: 1 с известной концентрацией ДНК ТРЭК.

Изобретение относится к медицине и может быть использовано для оценки эффективности эндотелиопротекторной терапии у экспериментальных животных после реконструктивных операций на брюшном отделе аорты.

Изобретение относится к медицине, а именно к способу оценки угрозы формирования у беременной гемической анемии при индуцирующем действии цитомегаловирусной инфекции в период обострения на структуру мембран эритроцитов.

Изобретение относится к области медицины, в частности к акушерству и гинекологии, и предназначено для прогнозирования высокого риска репродуктивных потерь в первом триместре беременности.

Изобретение относится к области медицины, в частности к молекулярной онкологии, и предназначено для прогнозирования выживаемости больных раком тела матки на основании уровня экспрессии гена ESR1.
Изобретение относится к медицине, в частности к дерматовенерологии и патологической анатомии, и касается способа диагностики псориатической эритродермии. Способ заключается в иммуногистохимическом исследовании.

Изобретение относится к области медицины, а именно к онкостоматологии и лабораторной диагностике, и касается прогнозирования риска развития новообразований слизистой оболочки полости рта у лиц старше 40 лет.

Изобретение относится к экспериментальной медицине в области оториноларингологии и может быть использовано для оценки протективного действия фармакологического препарата при острой сенсоневральной тугоухости (ОСНТ) в эксперименте.
Изобретение относится к области клинической лабораторной диагностики. Предложен способ оценки готовности раневой поверхности к пластическому закрытию с использованием метода полимеразной цепной реакции (ПЦР).

Изобретение относится к области генной инженерии, конкретно к наборам синтетических олигонуклеотидов, и может быть использовано для определения уровней экспрессии основных изоформ гена PDLIM4.

Изобретение относится к медицинской микробиологии. Описан способ идентификации подвидов возбудителя туляремии Francisella tularensis subsp.

Изобретение относится к области медицины, в частности к стоматологии, и предназначено для получения точных количественных данных о видовом составе микроорганизмов пародонтальных карманов.

Изобретение относится к области медицины, в частности к иммунологии и педиатрии, и предназначено для диагностики тимомегалии у детей. Проводят ПЦР в режиме реального времени с использованием соответствующих праймеров и флюоресцентно-меченого олигонуклеотида с последующим расчетом числа копий Т-рецепторных эксцизионных колец (ТРЭК) по стандартной кривой, построенной по разведениям плазмиды, представленной SEQ ID NO: 1 с известной концентрацией ДНК ТРЭК.

Изобретение относится к области медицины, в частности к акушерству и гинекологии, и предназначено для прогнозирования высокого риска репродуктивных потерь в первом триместре беременности.

Изобретение относится к области медицины, в частности к молекулярной онкологии, и предназначено для прогнозирования выживаемости больных раком тела матки на основании уровня экспрессии гена ESR1.

Изобретения относятся к области определения последовательности нуклеиновой кислоты. Предложена группа изобретений, включающая устройство и способ для оптического контроля секвенирования нуклеиновой кислоты, машиночитаемый носитель с компьютерной программой и программный элемент, используемые в вышеуказанном способе, а также применение 5-метил-(2-(2-нитрофенил)пропил)карбонат-dUTP, 5-метил-(2-оксо-1,2-дифенилэтил)карбонат-dUTP в качестве блокатора в секвенировании ДНК в вышеуказанном способе.

Изобретение относится к биохимии. Описан синтетический олигонуклеотид длиной от 19 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Настоящее изобретение относится к тестам микроРНК плазмы для обнаружения колоректального рака на ранних стадиях. Описан способ, включающие этапы: измерения общего профиля экспрессии или уровня содержания одной или нескольких микроРНК, полученных из одного или нескольких образцов плазмы, крови или сыворотки субъекта; и сравнение общего профиля экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от субъекта, предположительно страдающего от колоректальной неоплазии, с общим профилем экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от нормального субъекта, где нормальным субъектом является здоровый человек, не страдающий от колоректальной неоплазии, где повышенная экспрессия miR15b свидетельствует о наличии колоректальной неоплазии.

Изобретение относится к молекулярной биологии и медицине. Способ представлен выявлением и идентификацией наиболее перспективных полиморфизмов генов, определяющих повышенный риск развития ишемического инсульта (РР ИИ). Изобретение позволяет создать принципиально новый способ оценки генетического риска развития инсульта, основанного не на нескольких, а на 48 SNP, а также классификацию SNP в соответствии с их патофизиологическим значением и создать алгоритм оценки и интерпретации индивидуального риска развития инсульта. 5 з.п. ф-лы, 4 ил., 4 табл., 1 пр.

Изобретение относится к области ветеринарии и молекулярной биотехнологии и предназначено для диагностики анаплазмоза рогатого скота методом полимеразной цепной реакции. Осуществляют выявление фрагмента гена MSP4, кодирующего ДНК анаплазм, с использованием 10 различных пар прямых и обратных олигонуклеотидных праймеров. Проводят электрофоретическое определение размера амплифицируемого фрагмента нуклеотидной последовательности. По наличию на электрофореграмме фрагментов соответствующей длины диагностируют в крови животного кровепаразитов Anaplasma marginale или Anaplasma ovis. Изобретение обеспечивает эффективный способ обнаружения фрагментов генома Anaplasma marginale и Anaplasma ovis методом ПЦР с использованием специфических олигонуклеотидных праймеров. 3 табл.
