Устройство для назальной доставки лекарственных средств



Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств
Устройство для назальной доставки лекарственных средств

 


Владельцы патента RU 2612506:

ИМПЕЛ НЬЮРОФАРМА ИНК. (US)

Группа изобретений относится к медицине и медицинской технике и может быть использована для доставки композиции в обонятельную область назальной полости. Предложено устройство, содержащее контейнер, диффузор, камеру для композиции и сопло. При этом контейнер вмещает пропеллент. Диффузор сообщается и с контейнером, и с камерой для композиции. Сопло сообщается с камерой для композиции. Предложен способ с использованием этого устройства для доставки композиции в обонятельную область назальной полости. Изобретения обеспечивают эффективное введение композиции в обонятельную область и соответственно её доставку через гематоэнцефалический барьер за счёт усовершенствования механизма доставки большей части распылённого лекарственного препарата в верхнюю часть назальной полости для увеличения экспозиции в обонятельном эпителии. 2 н. и 31 з.п. ф-лы, 25 ил., 4 табл., 5 пр.

 

ПЕРЕКРЕСТНЫЕ ССЫЛКИ НА РОДСТВЕННЫЕ ЗАЯВКИ

Данная заявка претендует на приоритет документа США № 61/449008, поданного 3 марта 2011 г., документа США № 61/451935, поданного 11 марта 2011 г., документа США № 61/484025, поданного 9 мая 2011 г., и документа США № 61/498974, поданного 20 июня 2011 г., которые настоящим целиком включены сюда в качестве ссылок.

ЗАЯВЛЕНИЕ О ПРАВИТЕЛЬСТВЕННОМ ИНТЕРЕСЕ

Настоящее изобретение было выполнено при поддержке правительства США согласно гранту армии США по программе SBIR (новаторские разработки малых предприятий) W81XWH-10-C-0238. Правительство может обладать определенными правами на данную заявку.

ИЗВЕСТНЫЙ УРОВЕНЬ ТЕХНИКИ

Центральная нервная система (ЦНС) включает мозг, ствол головного мозга и спинной мозг. ЦНС изолирована от внешнего мира несколькими оболочками, которые амортизируют и защищают мозг, ствол головного мозга и спинной мозг. Например, оболочки, образующие гематоэнцефалический барьер (ГЭБ), защищают мозг от определенных компонентов крови. Гематоликворный барьер (ГЛБ) защищает другие части ЦНС от многих химических композиций и микроорганизмов.

Традиционные способы доставки композиций в ЦНС типично являются инвазивными. Например, имплантированный в череп насос, такой как интрацеребровентрикулярный насос, может доставлять в мозг различные композиции. Однако имплантация такого насоса требует хирургии мозга, которая может повлечь различные серьезные осложнения. Определенные композиции, например эпидуральные болеутоляющие средства, могут быть введены прямыми инъекциями через защитную оболочку в ЦНС. Однако такая инъекция для большинства композиций является непрактичной.

Интраназальное введение традиционно было сфокусировано на распределении растворов лекарственных средств в виде аэрозолей для местной доставки к назальному эпителию. Вследствие легкой доступности сосудистого ложа назальной полости, назальное введение лекарственных препаратов было сфокусировано на доставке лекарственных препаратов локально в назальную полость или непосредственно в кровоток.

Значительная часть современных исследований мозга сосредоточена на усилении доставки лекарственных средств в мозг с помощью различных композиций. Традиционные подходы к улучшению поглощения композиций мозгом за счет рецептуры композиции включают (1) мукоадгезивные композиции; 2) усилители пенетрации; 3) липосомы; 4) вазоконстрикторы; и 5) наночастицы. Примеры различных композиций с улучшенными композициями включают различные цитокины, например факторы некроза опухоли, интерлейкины и интерфероны, описанные в патенте США 6991785, и фактор роста и дифференцировки-5 (GDF-5) и родственные белки, описанные в публикации США № 20100074959.

Направленная доставка лекарственных средств в центральную нервную систему (ЦНС) является сложной задачей. Большое количество лекарственных средств, включая биотехнологические продукты, является кандидатами для лечения заболеваний ЦНС, но направленная доставка лекарственных средств в мозг проблематична. Лечение опухолей мозга ограничено тем, что менее 1% большинства терапевтических агентов при системном введении способны проходить через ГЭБ. Транспорт малых молекул через ГЭБ является исключением, а не правилом, и 98% всех малых молекул не проходят через ГЭБ (Pardride, NeuroRx. 2005 January; 2(1): 1-2. 2005); приблизительно 100% лекарственных средств с большими молекулами или генами не проходят через ГЭБ (Pardride, NeuroRx. 2005 January; 2(1): 1-2. 2005). ГЭБ позволяет малым (менее примерно 500 Да) липофильным молекулам из кровотока проникать в ЦНС (Pardridge, Arch Neurol. 2002; 59:35-40). Многие более крупные терапевтические агенты не достигают мозга для лечения расстройств ЦНС, таких как, без ограничений, болезнь Паркинсона, болезнь Альцгеймера, депрессия, инсульт и эпилепсия (Pardridge, NeuroRx. 2005 January; 2(1): 3-14). Расстройства, включая аутизм, лизосомальную болезнь накопления, синдром ломкой X-хромосомы, атаксию и слепоту, являются серьезными расстройствами, для которых практически не существует эффективных способов лечения. Во многих из этих случаев ген, лежащий в основе заболевания, известен, но доставка через ГЭБ является лимитирующей проблемой при генной терапии или заместительной терапии ферментами, и никаких терапевтических средств разработано не было. Доставка лекарственных средств терапевтических композиций, например белков, сталкивается с несколькими серьезными проблемами вследствие их нестабильности, высокого ферментативного метаболизма, низкого желудочно-кишечного всасывания, быстрого почечного элиминирования и потенциальной иммуногенности.

Существует потребность в устройствах, которые могут доставлять композиции в верхнюю часть назальной полости для прямой доставки из носа-в-мозг. Некоторые существующие устройства для назальной доставки лекарственных средств в недостаточной степени выталкивают лекарственное средство из устройства. Недостаточное выталкивание лекарственного средства вследствие ненадлежащего приведения в действие пользователем является далеким от оптимального. Кроме того, факел выброса, создаваемый такими существующими устройствами, слишком широк. В дополнение к этому, некоторые лекарственные продукты плохо смешиваются и/или остаются суспендированными в пропеллентах в устройствах типа MDI (ингаляторы с мерными дозами). Некоторые из существующих устройств для назальных лекарственных средств используют тангенциальный разгон для выталкивания лекарственных препаратов на обонятельный эпителий. Традиционные тангенциальные устройства приводят к тому, что на обонятельном эпителии откладывается небольшая часть композиции. Тангенциальный компонент в аэрозольном факеле имеет склонность приводить к более широкому факелу, причем часть аэрозольных частиц попадает на боковые стенки назальной полости в нижней ее части.

Требуются усовершенствованные механизмы для введения желательных агентов в мозг, ствол головного мозга и/или спинной мозг.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Описано устройство для доставки композиции в обонятельную область назальной полости, включающее контейнер, пригодный для содержания в нем пропеллента, диффузор, сообщающийся с контейнером, камеру композиции, сообщающуюся с диффузором, и сопло, сообщающееся с камерой композиции, где устройство способно доставлять композицию в обонятельную область назальной полости.

В одном аспекте, устройство включает контейнер, находящийся под давлением.

В другом аспекте, пропеллент включает ГФА (гидрофторалкан (HFA)), азот или ХФУ (хлорфторуглерод).

В другом аспекте, устройство включает камеру композиции, содержащую лекарственное средство или агент визуализации.

В еще одном аспекте, лекарственное средство представляет собой оксим.

В еще одном аспекте, диффузор представляет собой фритту (frit).

В еще одном аспекте, агентом визуализации является FDG (фтордезоксиглюкоза, ФДГ) или FLT (3-дезокси-3-[18F]фтортимидин).

В еще одном аспекте, устройство содержит пропеллент, где пропеллент представляет собой жидкость под давлением.

В еще одном аспекте, жидкость под давлением представляет собой ГФА (гидрофторалкан).

В другом аспекте, находящийся под давлением жидкий ГФА высвобождается из контейнера и входит в контакт с диффузором, причем диффузор превращает находящийся под давлением жидкий ГФА в газообразный ГФА.

В другом аспекте, диффузор превращает меньшую часть находящегося под давлением жидкого ГФА в газообразный ГФА.

В дополнительном аспекте, диффузор превращает большую часть находящегося под давлением жидкого ГФА в газообразный ГФА.

В еще одном аспекте, устройство доставляет по меньшей мере 62,6% композиции в обонятельную область.

В еще одном аспекте, устройство доставляет более 64,2% композиции в обонятельную область.

В другом аспекте, устройство доставляет по меньшей мере 64,3% композиции в обонятельную область.

В еще одном аспекте, устройство включает контейнер, где контейнер представляет собой шприц, сиретту или баллон.

В еще одном аспекте, композиция не является агентом визуализации.

В дополнительном аспекте, композиция не является ФДГ.

В одном аспекте, лекарственное средство имеет форму жидкой суспензии, жидкой дисперсии, порошка или водного раствора.

В еще одном аспекте, устройство дополнительно включает направляющий элемент.

В еще одном аспекте, направляющий элемент помогает наведению сопла устройства на обонятельную область пользователя.

В еще одном аспекте, устройства дополнительно включают отверстие для введения, сообщающееся с камерой композиции.

В еще одном аспекте, устройство дополнительно включает индикатор, предназначенный для информирования пользователя о глубине или степени введения капсулы в назальную полость пользователя.

В одном аспекте, диффузор является пористым.

В другом аспекте, диффузор является неоднородно пористым.

В другом аспекте, диффузор является однородно пористым.

В другом аспекте, диффузор является удлиненным.

В еще одном аспекте, диффузор представляет собой дискообразный элемент, включающий элементы конической формы, имеющие дистальные отверстия.

В еще одном аспекте, контейнер представляет собой ингалятор с мерными дозами.

В другом варианте исполнения описано устройство для доставки композиции, включающее контейнер, пригодный для размещения пропеллента, диффузор, сообщающийся с контейнером, камеру композиции, сообщающуюся с диффузором, и сопло, сообщающееся с камерой композиции, где устройство способно доставлять композицию в ухо, на кожу, в щечный карман или в глаза.

В другом варианте исполнения описан способ доставки лекарственного средства в обонятельную область назальной полости, включающий обеспечение контейнера, пригодного для размещения пропеллента, диффузора, сообщающегося с контейнером, камеры композиции, сообщающейся с диффузором, и сопла, сообщающегося с камерой композиции, где при приведении в действие устройство способно доставлять композицию в обонятельную область назальной полости.

В одном аспекте, способ включает доставку лекарственного средства для лечения инфекционной болезни, онкологии или иммунологической болезни.

В одном аспекте, способ включает приведение в действие устройства для подачи пропеллента из контейнера, причем диффузор рассеивает жидкий пропеллент из контейнера в газообразный пропеллент, газообразный пропеллент контактирует с композицией в камере композиции, и композиция и газообразный пропеллент выходят через сопло устройства.

В другом аспекте способа, диффузор превращает меньшую часть находящегося под давлением жидкого ГФА в газообразный ГФА.

В другом аспекте способа, диффузор превращает большую часть находящегося под давлением жидкого ГФА в газообразный ГФА.

В еще одном аспекте способа, по меньшей мере 64,2% композиции доставляется в обонятельную область.

В еще одном аспекте способа, более 64,2% композиции доставляется в обонятельную область.

В другом аспекте способа, композиция представляет собой лекарственное средство или диагностический агент.

В другом аспекте способа, композиция представляет собой лекарственное средство.

В еще одном аспекте способа, диагностический агент является агентом визуализации.

В еще одном аспекте способа, лекарственное средство представляет собой оксим.

В еще одном аспекте способа, агентом визуализации является фтордезоксиглюкоза или фтортимидин.

В еще одном аспекте способа, композиция не является фтордезоксиглюкозой.

В еще одном аспекте способа, композиция не является агентом визуализации.

В еще одном аспекте способа, лекарственное средство имеет форму жидкой суспензии, жидкой дисперсии, порошка, липосом или водного раствора и их комбинаций.

В еще одном аспекте способа, устройство включает один или несколько направляющих элементов.

В еще одном аспекте способа, направляющий элемент помогает наведению сопла устройства на обонятельную область пользователя.

В другом аспекте способа, устройство включает отверстие для введения, сообщающееся с камерой композиции.

В аспекте способа, устройство включает индикатор, предназначенный для информирования пользователя о глубине введения устройства в назальную полость пользователя.

В другом аспекте способа, диффузор является пористым.

В другом аспекте способа, диффузор является неоднородно пористым.

В другом аспекте способа, диффузор является однородно пористым.

В аспекте способа, диффузор является удлиненным.

В другом аспекте способа, диффузор представляет собой дискообразный элемент, включающий элементы конической формы, имеющие дистальные отверстия.

В аспекте способа, контейнер представляет собой ингалятор с мерными дозами.

В другом варианте исполнения описана интраназальная композиция оксима для использования при лечении воздействия органофосфата.

В еще одном варианте исполнения описан способ доставки оксима через гематоэнцефалический барьер нуждающемуся в этом субъекту, включающий введение субъекту терапевтически эффективной дозы оксима, где доза доставляется в верхнюю обонятельную область назальной полости.

В одном аспекте способа, терапевтически эффективное количество оксима, которое вводится пользователю, находится в диапазоне значений от примерно 0,001 мг/кг до примерно 100 мг/кг.

В другом аспекте способа, терапевтически эффективное количество оксима, которое вводится пользователю, находится в диапазоне значений от примерно 0,01 мг/кг до примерно 10 мг/кг.

В еще одном аспекте способа, терапевтически эффективное количество оксима, которое вводится пользователю, находится в диапазоне значений от примерно 0,1 мг/кг до примерно 1 мг/кг.

В еще одном аспекте, описанный способ доставки оксима предназначен для лечения воздействия органофосфата.

В другом варианте исполнения описан способ доставки оксима интраназально пользователю, включающий обеспечение назальной лекарственной формы оксима, выталкивание назальной лекарственной формы с помощью пропеллента и доставку назальной лекарственной формы в назальную полость пользователя, так чтобы оксим доставлялся в назальную полость и затем в центральную нервную систему и/или мозг пользователя.

В одном аспекте, доставляемый оксим включает 2-PAM, MMB4, HI6, TMB4 или Hlo7 и их комбинации.

В другом аспекте, назальная лекарственной формы оксима представляет собой порошок, водный раствор, суспензию или липидсодержащий продукт и их комбинации.

В другом аспекте, пользователь был подвергнут воздействию органофосфатного средства, включая зарин, табун, зоман, Ви-Экс (Russian VX) или диизопропилфторфосфат и их комбинации.

В другом аспекте, большая часть оксима в назальной лекарственной форме откладывается в назальной полости.

В другом аспекте, интраназально доставляется назальная лекарственная форма агониста мускаринового рецептора или антагониста мускаринового рецептора.

В еще одном аспекте, интраназально доставляется назальная лекарственная форма атропина или скополамина или их комбинации.

В еще одном аспекте, интраназально доставляется назальная лекарственная форма антагониста бензодиазепина.

В еще одном аспекте, антагонист бензодиазепина включает диазепам, мидалозам или лоразепам или их комбинации.

В еще одном аспекте, назальная лекарственная форма представляет собой антагонист бензодиазепина, агонист мускаринового рецептора или антагонист мускаринового рецептора или их комбинации.

В еще одном аспекте, интраназальная лекарственная форма включает диазепам, мидалозам, лоразепам, атропин или скополамин или их комбинации.

В еще одном аспекте, назальная лекарственная форма доставляется в назальную полость пользователя, подвергшегося воздействию органофосфата.

В другом аспекте, назальная лекарственная форма доставляется в назальную полость пользователя до воздействия органофосфата.

В еще одном аспекте, назальная лекарственная форма доставляется в назальную полость пользователя после воздействия органофосфата.

В еще одном аспекте, воздействие оксима увеличивает экспозицию оксима в ЦНС. В дополнительных аспектах, по меньшей мере 53% оксима транспортируется непосредственно (directly transported, DTP) в мозг.

Изобретение будет лучше понятно из приведенного далее детального описания различных вариантов исполнения, рассматриваемого в сочетании с сопровождающими чертежами. Приведенное ниже описание является наглядным, иллюстративным и описательным и не должно рассматриваться как ограничивающее объем, определяемый любыми пунктами прилагаемой формулы изобретения.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

Фиг.1 представляет собой схематический чертеж одного варианта исполнения изобретения.

Фиг.2 изображает вариант исполнения изобретения.

Фиг.3 изображает вариант исполнения изобретения.

Фиг.4 изображает другой вариант исполнения изобретения.

Фиг.5 изображает другой вариант исполнения изобретения.

Фиг.6 изображает другой вариант исполнения изобретения.

Фиг.7 изображает другой вариант исполнения изобретения.

Фиг.8 изображает другой вариант исполнения изобретения с присоединенным назальным направляющим элементом.

Фиг.9 изображает вариант исполнения диффузора и камеры композиции, причем диффузор является цилиндрическим и однородно пористым.

Фиг.10 изображает вариант исполнения диффузора и камеры композиции, причем диффузор является цилиндрическим и однородно пористым, с непористым открытым кончиком конусной формы, выступающим в готовую лекарственную форму.

Фиг.11 изображает вариант исполнения диффузора и камеры композиции, причем диффузор является цилиндрическим, с открытым кончиком конусной формы, выступающим в готовую лекарственную форму, и является однородно пористым.

Фиг.12 изображает вариант исполнения диффузора и камеры композиции, причем диффузор является цилиндрическим со множеством конических выступов, с открытым кончиком, позволяющим газообразному пропелленту заходить в камеру композиции.

Фиг.13 изображает вариант исполнения диффузора и камеры композиции, причем диффузор является цилиндрическим со множеством конических выступов, позволяющих газообразному пропелленту заходить в камеру лекарственного средства. Он также включает трубку, позволяющую пропелленту заходить в камеру композиции до лекарственного средства для улучшения распыления.

Фиг.14 изображает вариант исполнения диффузора и камеры композиции, причем диффузор является цилиндрическим и однородно пористым. Он также включает трубку, позволяющую пропелленту заходить в камеру композиции до лекарственного средства для улучшения распыления.

Фиг.15 изображает вариант исполнения изобретения, в котором пропеллент создается путем сжатия воздуха вручную.

Фиг.16A изображает вариант исполнения устройства, имеющий камеру композиции в корпусе устройства, позволяющую потоку пропеллента проходить через камеру композиции и обтекать ее. Фиг.16B изображает поперечное сечение устройства по Фиг.16A.

Фиг.17 изображает схематический чертеж устройства, используемого для введения лекарственного препарата 2-PAM крысам в Примере 1.

Фиг.18 демонстрирует результаты испытаний осаждения 2-PAM (затемненный участок) с помощью POD-устройства в назальной полости крысы на обонятельной области (светлая окружность). Незначительное количество лекарственного препарата откладывалось в дыхательной области назальной полости и ничего не было обнаружено в трахее или пищеводе.

Фиг.19 представляет собой график, демонстрирующий POD-введение дозы 2,5 мг 2-PAM, которое приводило к значительно более низким значениям в плазме в любой момент времени в течение первых 60 минут и общим более низким значениям AUC (площадь под кривой) плазмы. *=p<0,05.

Фиг.20 представляет собой график, демонстрирующий POD-введение дозы 2,5 мг 2-PAM, которое приводило к значительно более высоким значениям в мозге в моменты времени 5 и 120 минут и общим более высоким значениям AUC мозга. *=p<0,05.

Фиг.21 изображает модель назальной полости человека, использовавшуюся для испытаний осаждения модельного лекарственного средства флуоресцеина, описанных в Примере 3.

Фиг.22 представляет собой обработанное изображение осаждения в назальной полости человека, как описано в Примере 3. Пять отдельных частей - преддверие, носовые раковины, обонятельная область, основание и пищевод - были проанализированы на осаждение после распыления с помощью устройства. Фиг.22 показывает, что большая часть распыленного материала находится в обонятельной области.

Фиг.23 представляет собой схему экспериментальной установки для испытаний на ударное воздействие, описанных в Примере 4.

Фиг.24 представляет собой схему экспериментальной установки для оценки каких-либо изменений температуры на поверхности, на которую направлено устройство, описанное в Примере 5. Для измерения температуры поверхности мишени был использован лазерный термометр. Устройство распыляло один лишь газообразный ГФА или газообразный ГФА, смешанный с дозой жидкости, и регистрировались любые колебания температуры.

ДЕТАЛЬНОЕ ОПИСАНИЕ ВАРИАНТОВ ИСПОЛНЕНИЯ

Если не указано иное, все технические и научные термины, используемые в данном описании, имеют значения, общеизвестные рядовому специалисту в данной области техники, применимые к описанным способам и композициям. В используемом тут значении следующие термины и фразы имеют приписанные им значения, если не будет указано иное:

В используемом в данном описании значении, термин в единственном числе (в английском тексте - с неопределенными артиклями "a" или "an") может означать один или несколько.

"Диагностический агент" относится к и охватывает атом, молекулу или композицию, пригодные для использования в диагностике болезни. Диагностические агенты включают, без ограничений, радиоизотопы, красители, контрастные агенты, флуоресцентные композиции или молекулы и усиливающие агенты (например, парамагнитные ионы). Нерадиоактивным диагностическим агентом является контрастный агент, пригодный для магниторезонансной визуализации, компьютерной томографии или ультразвуковой диагностики. Диагностический агент может быть использован для проведения позитронно-эмиссионной томографии (ПЭТ), МРВ (магниторезонансной визуализации), рентгена, КТ (компьютерной томографии), ультразвуковой диагностики, оперативной, внутрисосудистой, лапароскопической или эндоскопической процедуры.

“Диффузор” относится к и охватывает устройство для диспергирования или отклонения композиции в различных направлениях.

“Фритта” должна относиться к и охватывать пористый элемент или фильтр.

“Агент визуализации” относится к и охватывает атом, молекулу или композицию, пригодные для использования в детектировании физических изменений или создании изображений внутренних тканей организма. В некоторых аспектах, агент визуализации может быть диагностическим агентом.

“Пропеллент” должен относиться к и охватывать композиции, выполняющие роль носителей для создания движущей силы или толчка.

Термин "терапевтически эффективное количество" относится к и охватывает количество лекарственного средства, эффективное для лечения болезни или расстройства у млекопитающего. В одном аспекте, терапевтически эффективное количество относится к целевой концентрации в ЦНС с подтвержденной эффективностью, например, в замедлении развития болезни. Эффективность может быть измерена обычными способами, в зависимости от состояния, лечение которого проводится.

Термины "лечение" и "лечить" и т.п. относятся к и охватывают терапевтические или сдерживающие мероприятия, направленные на болезнь или расстройство и приводящие к любому клинически желательному или целительному эффекту, включая, без ограничений, смягчение или облегчение одного или нескольких симптомов, регрессию, замедление или приостановку прогрессирования болезни или расстройства. Подтверждением лечения может быть ослабление тяжести симптома, уменьшение числа симптомов или частоты рецидивов.

“Пользователь” или “субъект” должны относиться к и охватывать человека или другое животное. Например, животное может быть приматом или не приматом и может включать кролика, быка, лошадь, свинью, крысу, мышь, собаку или кошку.

Устройство может быть использовано в лечении, профилактике, паллиативном уходе за людьми и в ветеринарных целях. Устройство может быть использовано в исследованиях и в промышленности. Например, устройство может быть использовано для нанесения композиции в сельскохозяйственных целях.

При использовании в данном документе торговых наименований, заявители подразумевают независимое включение композиции продукта с данной торговой маркой, непатентованного лекарственного препарата и активного фармацевтического ингредиента (ингредиентов) продукта с данной торговой маркой.

Для ясности описания и не для ограничений детальное описание изобретения разделено на следующие далее подразделы.

Интраназальное введение композиций обеспечивает некоторые преимущества по сравнению с традиционными хирургическими, внутривенными или пероральными путями введения через гематоэнцефалический барьер (ГЭБ). Интраназальное введение в обонятельную область позволяет избежать разрушения в желудочно-кишечном тракте и метаболизма при первом прохождении через печень, такого как разрушение лекарственных средств ферментами печени, что позволяет экономически эффективно, быстро и прогнозируемо становиться биодоступным большему количеству лекарственного препарата, чем при оральном введении. Интраназальное введение обеспечивает простоту, удобство и безопасность. Интраназальное введение лекарственного препарата обычно является безболезненным (учитывая, что боль может быть субъективным показателем, отличающимся для разных пациентов) и не требует стерильной методики, внутривенных катетеров или других инвазивных приспособлений и обычно может быть немедленно и легко доступным для всех пациентов. Интраназальное введение может обеспечить быстрое достижение терапевтических концентраций лекарственного препарата в мозге и спинном мозге.

Назально вводимые композиции контактируют с верхней обонятельной областью, и молекулярный транспорт происходит напрямую через данную ткань в компартменты центральной нервной системы (Henry, R.J. et al., Pediatr Dent, 1998. 20(5): p. 321-6; Sakane, T. et al., J Pharm Pharmacol, 1991. 43(6): p. 449-51; Banks, W.A. et al., J Pharmacol Exp Ther, 2004. 309(2): p. 469-75; Westin et al., Pharm Res, 2006. 23(3): p. 565-72). Обонятельная слизистая оболочка расположена в верхней части назальной полости, непосредственно под решетчатой пластинкой решетчатой кости черепа. Она содержит обонятельные клетки, которые проходят через решетчатую пластинку решетчатой кости и выступают в полость черепа. При вхождении композиций в контакт с этой специализированной слизистой, они быстро транспортируются непосредственно в мозг в обход ГЭБ и быстро транспортируются прямо в центральную нервную систему, часто быстрее, чем при внутривенном введении композиции.

Обонятельная слизистая оболочка включает обонятельный эпителий. Обонятельный эпителий расположен в верхней части носа между верхней носовой раковиной и крышей назальной полости, непосредственно под решетчатой пластинкой решетчатой кости. У людей она покрывает от примерно 10 до примерно 20 см2 или примерно 8% от общей площади поверхности носа и состоит из четырех основных типов клеток: эпителиальные клетки, нейроны с обонятельными рецепторами, поддерживающие клетки и базальные клетки (Mathison S. et al., (1998) Journal of Drug Targeting 5: 415-441). Хотя обонятельным эпителием занято 3% назальной полости (Morrison and Costanzo, 1990), этот путь является прямым, поскольку обонятельные нейроны не имеют синапса между воспринимающим элементом и афферентным путем (Ding and Даhl, 2003). Обонятельный эпителий имеет глубину, вдвое большую, чем глубина дыхательного эпителия, причем тела обонятельных нервных клеток типично расположены в средней и глубинной областях эпителия, в то время как ядра поддерживающих клеток организованы в виде монослоя, расположенного ближе к мукозальной поверхности. Существует тесный контакт между поддерживающими клетками и между поддерживающими клетками и обонятельными нервными клетками (Morrison E.E. et al. (1992) Journal of Comparative Neurology 297(1): 1-13).

Когда композиция назального лекарственного препарата доставляется вглубь и достаточно высоко в назальную полость, она будет достигать обонятельной слизистой оболочки и будет происходить транспортировка лекарственного препарата в мозг и/или ЦСЖ (цереброспинальную жидкость) через нейроны с обонятельными рецепторами. Перенос композиций из носа в мозг называется носомозговым путем. Носомозговой путь используется, когда лекарственные препараты центрального действия, такие как, без ограничений, седативные средства, противоконвульсивные средства и опиаты вводятся назально. Устройство по настоящему изобретению обеспечивает возможность доставки носомозговым путем, что позволяет почти немедленно доставлять назальные лекарственные препараты в центральную нервную систему и мозг в обход гематоэнцефалического барьера.

Проблема, которая решается в настоящем изобретении, связанная с доставкой лекарственных средств из носа-в-мозг, также вызвана сложной архитектурой носа, которая природно рассчитана на то, чтобы направлять лекарственные средства в нижние носовые воздухоносные пути в направлении легких, что усложняет достижение лекарственными препаратами обонятельной области. Большая часть лекарственного средства, дозируемого из традиционных назальных устройств, таких как распылители или насосы, подвергаются воздействию природного движения воздуха в назальной полости в направлении к пищеводу. Большая часть распыляемого факела, дозируемого традиционными устройствами, встречается с направленным природно вниз воздушным потоком в назальной полости. Остальная часть препарата из традиционных устройств попадает на дыхательный эпителий и удаляется по механизму клиренса реснитчатым эпителием или всасывается в кровоток. Хотя инстилляция с помощью назального катетера и капли в нос в меньшей степени зависят от такого природного направленного вниз движения воздуха, они требуют, чтобы субъекты находились в положении лежа на спине, часто ассоциированы с дискомфортом для пользователя и не являются оптимальными для частого клинического введения.

Кроме того, в верхней части назальной полости существует резервуар остаточного воздуха, который не удаляется при нормальном дыхании, таким образом, оставаясь в обонятельной области и выступая в качестве барьера для отложения. Этот остаточный воздух необходимо вытеснить для стабильной доставки распыленного лекарственного препарата на обонятельный эпителий в верхней части назальной полости. Устройство, описанное в данном документе, доставляет большую часть распыленного лекарственного препарата в верхнюю часть назальной полости для увеличения экспозиции лекарственного средства в обонятельном эпителии, местонахождении пути из носа-в-мозг, путем устранения направленного вниз природного движения воздуха и вытеснения остаточного воздуха верхней части назальной полости.

Устройство по настоящему изобретению предпочтительно и стабильно обеспечивает отложение большей части дозы в более дистальные части назальной полости, такие как обонятельная область. Готовая лекарственная форма (также называемая в данном документе композицией лекарственного средства или назальной лекарственной формой) на скорости выталкивается из устройства в назальную полость.

Фиг.1 изображает один вариант исполнения устройства, в котором контейнер 10 содержит пропеллент. Пропеллент может находиться под давлением. Пропеллент представляет собой текучую среду, например жидкость или газ. В одном аспекте, пропеллент является жидкостью. В другом аспекте, пропеллент является газом. Пропелленты включают фармацевтически пригодные пропелленты. Некоторые примеры фармацевтически пригодных пропеллентов включают гидрофторалкан (ГФА) включая, без ограничений, ГФА, ГФА 227, ГФА 134a, ГФА-FP, ГФА-BP и подобные ГФА. В одном аспекте, пропеллент представляет собой жидкий ГФА. В другом аспекте, пропеллент является газообразным ГФА. Дополнительные примеры пригодных пропеллентов включают азот или хлорфторуглероды (ХФУ). Дополнительно, пропелленты могут быть сжатым воздухом (например, атмосферным воздухом). Контейнер 10 может быть обычным устройством ингалятора с мерными дозами (MDI), включающим находящийся под давлением контейнер, дозирующий клапан (включая шток) для дозирования пропеллента при приведении в действие. В определенных аспектах, пропеллент не дозируется при приведении в действие. В одном аспекте, контейнер 10 не содержит лекарственного средства. В другом аспекте, контейнер включает пропеллент и лекарственное средство.

Контейнер 10 сообщается с диффузором. Например, если диффузор сообщается с контейнером 10, “сообщение” должно относиться к и охватывать конгруэнтность или сообщение по жидкости. Пропеллент из контейнера 10 рассеивается через диффузор. В одном аспекте, большая часть пропеллента рассеивается через диффузор. В другом аспекте, меньшая часть пропеллента рассеивается через диффузор. Большая часть относится к и охватывает по меньшей мере 50 процентов. Меньшая часть относится к и охватывает менее 50 процентов. В другом аспекте, по меньшей мере примерно 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или примерно 100%, включая конечные точки, пропеллента рассеивается через диффузор. Диффузор сообщается с камерой композиции 14. Камера композиции 14 способна удерживать композицию, такую как, без ограничений, лекарственное средство и/или диагностический агент. В одном аспекте, диагностический агент является агентом визуализации. В примере, агент визуализации представляет собой фтордезоксиглюкозу (ФДГ) или фтортимидин (FLT). В другом аспекте, композиция представляет собой лекарственное средство. В другом аспекте, композиция не является агентом визуализации. В одном аспекте, композиция является жидкостью. В другом аспекте, композиция является порошком. В еще одном аспекте, композиция представляет собой интраназальную композицию лекарственного средства в жидком или порошкообразном состоянии. Интраназальная композиция может содержать пригодные интраназальные носители и эксципиенты, известные специалистам.

Пропеллент в контейнере 10 выступает в роли носителя для передачи движущей силы или толчка для выталкивания композиции из камеры композиции 14. Камера композиции 14 сообщается с соплом 16. Движущая сила или толчок пропеллента способны вытолкнуть композицию из камеры композиции 14 и сопла 16, когда он сообщается с камерой композиции 14.

В одном аспекте, когда MDI-устройство приводится в действие, высвобождается дискретное количество находящегося под давлением текучего ГФА. MDI может содержать количество ГФА-пропеллента, достаточное для от примерно 30 до примерно 300 срабатываний, включая конечные точки. Количество текучего пропеллента, высвобождаемое при приведении в действие, может составлять от примерно 20 до примерно 200 мкл жидкого пропеллента, включая конечные точки.

Фиг.2 изображает один из вариантов исполнения устройства. В корпусе привода 20 размещен контейнер 10, в одном аспекте контейнер 10 представляет собой ингалятор с мерными дозами, который включает контейнер пропеллента 18, имеющий шейку 19 и блок дозирующего клапана 21. Шток клапана 23 сообщается с соединительным каналом 22. Пропеллент, выходящий из штока клапана 23, представляет собой текучую среду. Текучая среда может быть жидкостью, газом или их комбинацией. Диффузор 28 сообщается с пропеллентом, выходящим из контейнера 10, и камерой композиции 14.

Пропеллент, выходящий из контейнера 10, входит в контакт с диффузором 28. Диффузор 28 способен преобразовывать жидкий пропеллент, выходящий из контейнера 10, в газообразный пропеллент. В одном аспекте, диффузор 28 способен превращать весь или большую часть жидкого пропеллента в газообразный пропеллент. В другом аспекте, диффузор способен превращать меньшую часть жидкого пропеллента в газообразный пропеллент. Большая часть относится к и охватывает по меньшей мере 50 процентов.

Меньшая часть относится к и охватывает менее 50 процентов. В другом аспекте, по меньшей мере примерно 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или примерно 100%, включая конечные точки, жидкого пропеллента превращается в газообразный пропеллент. После контакта с диффузором 28, рассеянный пропеллент входит в контакт с композицией в камере композиции 14. Рассеянный пропеллент и композиция входят в контакт друг с другом, когда пропеллент приводит в движение композицию в камере композиции 14. Сопло 16 сообщается по жидкости с камерой композиции 14. Композиция выталкивается рассеянным пропеллентом, сообщающимся с соплом 16. Пропеллент приводит в движение композицию, выталкивая его через дальний конец сопла 16. Из сопла 16 выходит композиция, пропеллент или их комбинация.

В некоторых аспектах, диффузор 28 выполняет функцию превращения пропеллента из жидкости в газ. В других аспектах, диффузор 28 выполняет функцию предотвращения вхождения композиции, находящуюся в камере композиции 14, в контакт с контейнером 10. В другом аспекте, диффузор выполняет роль одностороннего запорного клапана. В других аспектах, диффузор 28 выполняет функцию превращения пропеллента из жидкости в газ и предотвращения вхождения композиции, находящейся в камере композиции 14, в контакт с контейнером 10. В еще одном аспекте, диффузор выполняет функцию повышения температуры пропеллента.

Пример диффузора 28 включает фритту, множество фритт или элемент диффузора или их комбинации. В одном аспекте, диффузор представляет собой фритту. В другом аспекте, диффузор представляет собой множество фритт. В другом аспекте, диффузор представляет собой элемент диффузора.

В одном аспекте, фритта (фритты) имеют любые пригодные размеры и формы и изготовлены с использованием любого пригодного пористого материала любой пригодной плотности. В одном аспекте, фритта изготовлена из гидрофобного материала. В одном аспекте, фритта изготовлена из инертного материала во избежание химических реакций с любыми композициями. Инертный материал может быть металлом или неметаллом. В одном аспекте, фритта состоит из металла. В другом аспекте, фритта состоит из неметалла. В одном аспекте, инертный материал представляет собой спеченный никель. В качестве примера, может быть использована фритта, изготовленная с использованием пористой нержавеющей стали, имеющей размеры пор в интервале значений от примерно 1 микрона до примерно 100 микрон. В другом аспекте размеры пор находятся в интервале значений от примерно 1 до примерно 10, от примерно 10 до примерно 20, от примерно 20 до примерно 30, от примерно 30 до примерно 40, от примерно 40 до примерно 50, от примерно 50 до примерно 60, от примерно 60 до примерно 70, от примерно 70 до примерно 80, от примерно 80 до примерно 90, от примерно 90 до примерно 100 микрон, включая конечные точки. В другом аспекте, фритта может быть изготовлена с использованием алюминиевой пены. Число и размеры пор и общие размеры (например, диаметр и толщина) фритты подбираются так, чтобы обеспечить максимальную площадь поверхности для испарения, в то же время ограничивая перепады давления, сопровождающие прохождение испаренного пропеллента через фритту. В определенных аспектах, фритта может быть изготовлена из тефлона, стекла, металлической сетки, сита, пористого металла, полиэфирэфиркетона или другого пластического материала. В одном аспекте, прохождение жидкого пропеллента через фритту с повышенной площадью поверхности приводит к переходу жидкости в газ и повышению температуры образующегося газа. В другом аспекте, прохождение газообразного пропеллента через фритту с увеличенной площадью поверхности повышает температуру газа.

Как изображено на Фиг.2, в одном аспекте, диффузор 28 расположен на соединительном канале 22. В другом аспекте, диффузор 28 расположен внутри камеры лекарственного средства 24, причем интраназальная лекарственная форма расположена в камере лекарственного средства 24. Сопло 26 сообщается с камерой лекарственного средства 24. Диффузор 28, камера лекарственного средства 24 и сопло 26 размещены в капсуле лекарственного средства 30 рядом с корпусом привода 20.

Корпус капсулы лекарственного средства 30 может состоять из любого пригодного для размещения компонентов материала. В одном аспекте, корпус капсулы лекарственного средства 30 может быть сконструирован из пластика. В одном аспекте, корпус капсулы лекарственного средства 30 может суживаться на дальнем конце, что позволит подводить сопло 26 ближе к носовой перегородке. Сужение позволяет улучшить позиционирование устройства под пригодным горизонтальным углом по отношению к верхней назальной полости.

На Фиг.3 изображен другой вариант исполнения устройства. В корпусе привода 32 (или футляре) размещены контейнер пропеллента 34, имеющий шейку 33, и блок дозирующего клапана 35. Шток клапана 37 расположен внутри соединительного канала 36. Пропеллент, выходящий из штока клапана 37, находится в форме жидкости или представляет собой смесь жидкой и газообразной форм. Диффузор 44 расположен на канале 36 и предназначен для преобразования большей части или всего жидкого пропеллента в газообразный пропеллент. Диффузор 44 расположен внутри камеры лекарственного средства 42, причем интраназальная лекарственная форма расположена в камере лекарственного средства 42. Сопло 40 сообщается с камерой лекарственного средства 42. Диффузор 44, камера лекарственного средства 42 и сопло 40 расположены внутри капсулы лекарственного средства 46 рядом с корпусом привода 32.

Отверстие для введения 38 предусмотрено для введения композиции в камеру лекарственного средства 42. Отверстие для введения 38 может быть сконструировано из силикона или пластика. В одном аспекте, игла шприца может быть введена через отверстие для введения 38 для инъекции композиции в камеру лекарственного средства 42. В одном аспекте, композиция представляет собой лекарственное средство. В другом аспекте, композиция представляет собой диагностический агент. В еще одном аспекте, композиция не является агентом визуализации. Лекарственное средство может быть жидкостью или порошком.

На Фиг.4 представлен другой вариант исполнения устройства. В корпусном элементе 48 размещены контейнер пропеллента под давлением 50, соединительный канал 52, блок выпускного клапана 51, диффузор 54, камера лекарственного средства 56 и сопло 58. Контейнер пропеллента под давлением 50 содержит жидкий пропеллент и имеет блок выпускного клапана 51. Соединительный канал 52 сочетается с блоком выпускного клапана 51 контейнера 50 и диффузором 54. Диффузор 54 сообщается с камерой лекарственного средства 56. В одном аспекте, камера лекарственного средства содержит интраназальную лекарственную форму, включающую лекарственное средство. Сопло 58 сообщается с камерой лекарственного средства 56.

На Фиг.5 изображен другой вариант исполнения устройства. В корпусе привода 60 размещены контейнер пропеллента 62, имеющий шейку 61, блок дозирующего клапана 63 и шток клапана 65. Шток клапана 65 расположен внутри соединительного канала 72. Пропеллент, выходящий из штока клапана 65, находится в форме жидкости, в газообразной форме или в виде смеси жидкой и газообразной форм. Диффузор 70 расположен на канале 72 и предназначен для преобразования жидкого пропеллента в газообразный пропеллент. Диффузор 70 сообщается с камерой лекарственного средства 68. В одном аспекте, камера лекарственного средства 68 содержит интраназальную лекарственную форму. Сопло 66 сообщается с камерой лекарственного средства 68. Диффузор 70, камера лекарственного средства 68 и сопло 66 расположены внутри капсулы лекарственного средства 69 рядом с корпусом привода 60. Корпус привода 60 имеет форму, позволяющую разместить направляющий элемент. Направляющий элемент включает один из, множество или все из направляющего элемента для введения в нос 64, направляющего элемента для регулирования положения относительно носовой перегородки 74, направляющего элемента относительно верхней губы 76 и визуального индикатора 71.

В одном аспекте, направляющий элемент для введения в нос 64 предусмотрен на корпусе привода 60. Направляющий элемент для введения в нос 64 предназначен для размещения в носу пользователя. В другом аспекте, направляющий элемент для введения в нос 64 предназначен для направления сопла 66 на обонятельную область пользователя.

В другом аспекте, на корпусе привода 60 предусмотрен направляющий элемент для направления относительно перегородки 74. В одном аспекте, направляющий элемент для регулирования положения относительно перегородки 74 предназначен для обеспечения контакта с носовой перегородкой пользователя.

В еще одном аспекте, на корпусе привода 60 предусмотрен направляющий элемент относительно верхней губы 76. Направляющий элемент относительно верхней губы 76 предназначен для обеспечения контакта с верхней губой пользователя. В одном аспекте, визуальный индикатор 71 предназначен для информирования пользователя о глубине или степени введения капсулы 70 в назальную полость пользователя. В одном аспекте, визуальный индикатор 71 вставляют на определенную величину или глубину в назальную полость пользователя.

На Фиг.6 изображен другой вариант исполнения устройства. В корпусном элементе 80 размещены контейнер пропеллента под давлением 94, блок выпускного клапана 91 и соединительный канал 92. Контейнер пропеллента под давлением 94 содержит жидкий пропеллент и имеет блок выпускного клапана 91. Соединительный канал 92 сообщается с блоком выпускного клапана 91 и диффузором 84. Диффузор 84 сообщается с камерой лекарственного средства 82. В одном аспекте, камера лекарственного средства 82 содержит дозу интраназального средства. Сопло 78 сообщается с камерой лекарственного средства 82.

В одном аспекте, предусмотрена функция регулирования направления. Функция регулирования направления включает направляющую штангу 86. Направляющая штанга 86 прилегает к ручке направляющей штанги 88. Ручка направляющей штанги 88 выполнена заедино с ручкой вращения 90. Ручка вращения 90 может быть закреплена или присоединена с возможностью вращения к корпусному элементу 80 таким образом, чтобы обеспечить удобство применения для пользователей-правшей или левшей. Направляющая штанга 86 регулирует направление сопла 78 в назальной полости пользователя путем ее введения в противоположную ноздрю пользователя и ограничения угла введения. В одном аспекте, ручка направляющей штанги 88 и ручка вращения 90 выполнены из пластика. В еще одном аспекте, ручка направляющей штанги и ручка вращения сконструированы из структурного пенопласта.

На Фиг.7 представлен другой вариант исполнения устройства. Корпусный элемент 98 предусмотрен для того, чтобы способствовать размещению и защищать различные изображенные структурные элементы. Контейнер пропеллента под давлением 108 содержит пропеллент и имеет блок выпускного клапана 107. Соединительный канал 104 расположен между блоком выпускного клапана 107 и диффузором 102. Диффузор 102 расположен внутри камеры лекарственного средства 100, причем интраназальная лекарственная форма, содержащая лекарственное средство, расположена внутри камеры 100. Сопло 96 расположено на камере 100.

На Фиг.8 изображен назальный направляющий элемент 112, который может быть добавлен к камере лекарственного средства 118. Направляющий элемент не будет препятствовать соплу 116 или отверстиям сопла 114 и предназначен для ограничения положения/глубины введения устройства в назальную полость желательным углом введения.

Фиг.9 изображает один из вариантов исполнения диффузора 122 и его взаимодействие с камерой лекарственного средства 130. Пропеллент входит в контакт с диффузором 122. Диффузор 122 превращает жидкий пропеллент в газообразный пропеллент. В одном аспекте, он превращает большую часть жидкого пропеллента в газообразный пропеллент. В другом аспекте, он превращает меньшую часть жидкого пропеллента в газообразный пропеллент. В еще одном аспекте, он превращает весь жидкий пропеллент в газообразный пропеллент. В одном аспекте, диффузор 122 имеет цилиндрическую форму. В еще одном аспекте, диффузор 122 сочетается по форме с камерой композиции 130.

Диффузор 122 является пористым. Поры могут быть однородными по размеру и форме. В другом аспекте, поры диффузора 122 являются неоднородными по размеру и форме. В еще одном аспекте, диффузор 122 является однородно пористым. В еще одном аспекте, диффузор 122 является неоднородно пористым. Как изображено на Фиг.9, диффузор 122 имеет цилиндрическую форму и является однородно пористым, причем газ может проходить через поры, но поры являются непроницаемыми для готовой лекарственной формы 124. Газообразный пропеллент затем контактирует с готовой лекарственной формой 124, выталкивая готовую лекарственную форму 124 через сопло 128 и из устройства.

Фиг.10 изображает другой вариант исполнения диффузора 134 и его взаимодействие с камерой лекарственного средства 138. Пропеллент входит в контакт с диффузором 134, выталкивая готовую лекарственную форму 142 через сопло 146. Часть газообразного пропеллента, выходящего из диффузора 134, выталкивается через ответвление диффузора 140, что помогает распылению готовой лекарственной формы 142. Как изображено на Фиг.10, диффузор 134 является неоднородно пористым из-за ответвления диффузора 140.

Фиг.11 изображает другой вариант исполнения диффузора 150 и его взаимодействие с камерой лекарственного средства 154. Пропеллент входит в контакт с диффузором 150. Диффузор 150 имеет вытянутую форму или удлиненную форму. В одном аспекте, диффузор 150 имеет вытянутую цилиндрическую форму. Функция вытянутой цилиндрической формы заключается в увеличении площади диффузора 150 в камере лекарственного средства 154 и контакте с любой готовой лекарственной формой 156, содержащейся в ней. Часть газообразного пропеллента контактирует с готовой лекарственной формой 156, выталкивая готовую лекарственную форму 156 в сопло 160. Другая часть газообразного пропеллента проходит через вытянутую или удлиненную форму, способствуя распылению готовой лекарственной формы 156. Как изображено на Фиг.11, диффузор 150 имеет цилиндрическую форму и является однородно пористым, причем газ может проходить через поры, но поры являются непроницаемыми для готовой лекарственной формы 156.

Фиг.12 изображает другой вариант исполнения диффузора 164 и его взаимодействие с камерой лекарственного средства 166. Пропеллент контактирует с диффузором 164. Диффузор 164 имеет множество конических выступов, каждый с отверстием на дальнем конце, причем кончики обеспечивают преимущественно поток газообразного пропеллента в готовую лекарственную форму 168. Пропеллент контактирует с готовой лекарственной формой 168, выталкивая ее через сопло 172.

Фиг.13 изображает другой вариант исполнения диффузора и его взаимодействие с камерой лекарственного средства 178. Пропеллент контактирует с элементом диффузора 176. Элемент диффузора 176 имеет множество конических выступов, каждый с отверстием на дальнем конце, причем кончики позволяют обеспечить преимущественно поток газообразного пропеллента в готовую лекарственную форму 180. Диффузионная трубка 182 позволяет смеси пропеллента проходить в обход готовой лекарственной формы 180 в пустое пространство 184. Газообразный пропеллент, выходящий из элемента диффузора 176, контактирует с готовой лекарственной формой 180, выталкивая ее в пустое пространство 184 и через сопло 186.

Диффузионная трубка 182 обеспечивает возможность дыхания одновременно с использованием устройства. При применении устройства пользователем диффузионная трубка 182 обеспечивает возможность дыхания пользователя без ингаляции готовой лекарственной формы 180, содержащейся в камере лекарственного средства 178. Кроме того, диффузионная трубка 182 позволяет пропелленту распылять готовую лекарственную форму 180, когда он входит в контакт с готовой лекарственной формой 180 в камере лекарственного средства 178. Готовая лекарственная форма 180 выходит из устройства распыленной. В другом аспекте, без использования диффузионной трубки 182 готовая лекарственная форма 180 выходит из сопла в виде жидкости или частично аэрозоля или их комбинации. В одном аспекте, фритта или множество фритт (не показано) сообщается с диффузионной трубкой 182 и/или диффузионным элементом 176, действуя как контрольный клапан.

Фиг.14 изображает другой вариант исполнения диффузора 190 и его взаимодействие с камерой лекарственного средства 194. Пропеллент контактирует с диффузором 190, который является однородно пористым, причем газ может проходить через поры, но поры являются непроницаемыми для готовой лекарственной формы. Диффузионная трубка 196 позволяет смеси пропеллента поступать в обход готовой лекарственной формы 192 в пустое пространство 197. Газообразный пропеллент, выходящий из диффузора 190, контактирует с готовой лекарственной формой препарата 192, выталкивая ее в пустое пространство 197 и через сопло 198.

Диффузионная трубка 196 обеспечивает возможность дыхания одновременно с использованием устройства. При применении устройства пользователем диффузионная трубка 196 обеспечивает возможность дыхания пользователя без ингаляции готовой лекарственной формы 192, содержащейся в камере лекарственного средства 194. Кроме того, диффузионная трубка 196 позволяет пропелленту распылять готовую лекарственную форму 192, когда он входит в контакт с готовой лекарственной формой 192 в камере лекарственного средства 194. Готовая лекарственная форма 192 выходит из устройства распыленной. В другом аспекте, в случае отсутствия диффузионной трубки 196, готовая лекарственная форма 192 выходит из сопла 198 в виде жидкости или частично аэрозоля или их комбинации. В одном аспекте, фритта или множество фритт (не показано) сообщается с диффузионной трубкой 196, действуя как контрольный клапан.

Фиг.15 изображает другой вариант исполнения устройства. Ручной привод создания давления позволяет пользователю применять устройство введения без необходимости в предварительно наполненном под давлением контейнере или контейнере ГФА. Это устройство имеет поршень 200, который вдавливается в камеру сжатия воздуха 202, что приводит к получению определенного количества сжатого воздуха, находящегося в камере сжатия воздуха 202. Давление захваченного воздуха таким образом повышают от давления окружающей среды до величины, в несколько раз превышающей давление атмосферного воздуха. В одном аспекте, ручной привод создания давления представляет собой шприц или сиретту. Устройство содержит стопорный штифт 204, который вставляют для удерживания поршня в положении высокого давления. В дополнение к этому, устройство содержит пусковой клапан 206. В одном аспекте, пусковой клапан 206 является аналогичным запорному клапану. Имеется диффузор 208, сообщающийся с пусковым клапаном 206 и камерой размещения композиции 210. Композицию помещают в камеру размещения композиции 210, которая сообщается с соплом 212. Когда устройство приводится в состояние высокого давления, пусковой клапан 206 устанавливается в заряженное положение, в котором воздух высокого давления заблокирован в камере сжатия воздуха 202. Когда пусковой клапан 206 перемещается пользователем в открытое положение, сжатый воздух в камере сжатия воздуха 202 проходит через диффузор и в камеру размещения композиции, где он смешивается с композицией. Смесь сжатого воздуха и композиции затем выходит из устройства через сопло 212 с положительной скоростью.

Фиг.16A изображает другой вариант исполнения устройства, пригодный для доставки композиции в назальную полость животного или человека. Контейнер пропеллента под давлением 214 сообщается с диффузором 216. Диффузор 216 сообщается с внутренней частью корпусного элемента 218 и с камерой композиции 220. Внутренняя часть корпусного элемента 218 сообщается с соплом 222. Фиг.16B представляет собой поперечное сечение Фиг.16A по пунктирной линии. Фиг.16B показывает, что камера композиции 220 соединена с корпусным элементом 218 с помощью фланцев 224. Пропеллент рассеивается диффузором 216, и фланцы 224 позволяют рассеянному пропелленту проходить как через камеру композиции 220, так и вокруг камеры композиции 220. Когда контейнер пропеллента под давлением 214 приводится в действие с высвобождением некоторого количества пропеллента, пропеллент проходит через диффузор 216. Диффузор рассеивает пропеллент во внутреннюю часть корпусного элемента 218 и в камеру композиции 220, где пропеллент смешивается с композицией. Пропеллент также проходит с наружной стороны камеры композиции 220 и затем смешивается с композицией, выходящей из камеры композиции 220. Смесь фармацевтической композиции и пропеллента затем выходит из сопла 222. При использовании устройства пользователем взаимосвязь камеры композиции 220 с корпусом 218 обеспечивает возможность дыхания пользователя без ингаляции готовой лекарственной формы, содержащейся в камере композиции 220.

Устройство может быть предназначено для педиатрического применения или для использования взрослыми. Квалифицированный специалист в данной области техники может предусмотреть модификации устройства, обеспечивающие его педиатрическое применение или использование взрослыми.

В другом варианте исполнения устройство доставляет композицию через слизистую оболочку или эпителий языка, рта, кожу или конъюнктиву. В другом варианте исполнения способ включает введение композиции на или в язык, на или в кожу, на или в конъюнктиву субъекта.

В еще одном варианте исполнения устройство доставляет композицию в области носовой раковины назальной полости. В одном аспекте, устройство доставляет композицию преимущественно в области носовой раковины назальной полости.

В дополнительных вариантах исполнения устройство может быть использовано для лечения, профилактики или паллиативного ухода. Устройство может быть использовано в исследовательских или промышленных целях. Устройство может быть использовано для рассеивания композиции, которое приводится в движение пропеллентом, сообщающимся с диффузором. Например, устройство может быть использовано в сельском хозяйстве для дозирования композиции сельскохозяйственного назначения.

Предусмотрена интраназальная композиция оксима. Дополнительно, описан способ интраназального введения оксима в обонятельную область.

Оксимы могут быть доставлены в центральную нервную систему (ЦНС) для профилактики, лечения и паллиативного ухода при воздействии органофосфатной (ОФ) композиции, такой как нервно-паралитические боевые отравляющие вещества (например зарин, табун, зоман, Ви-Экс (Russian VX) и т.д.) или пестициды (например диизопропилфторфосфат). Оксимы традиционно вводились, например, внутривенно. Интраназальное введение оксима в обонятельную область позволяет обеспечить транспорт через ГЭБ.

Нервно-паралитические агенты, содержащие фосфорорганические композиции, представляют собой значительную опасность для солдат, которые могут подвергнуться их воздействию в боевых условиях на земле, на море, в воздухе и в космосе. Гражданское население также подвержено рискам для здоровья, ассоциированным с нервно-паралитическими агентами при использовании коммерчески доступных пестицидов, так же как и первые пострадавшие от террористических атак. Современная схема лечения воздействия нервно-паралитического агента включает использование холинергического реактиватора (пралидоксим, 2-PAM), антагониста мускаринового рецептора (атропин) и противосудорожного средства (диазепам). Хотя 2-PAM и атропин доступны в различных инъекционных форматах (например, внутривенной (IV) инфузии или внутримышечного (IM) автоинжектора), инъекция на поле боя связана со значительными практическими сложностями, такими как необходимость снятия индивидуальной бронезащиты и наличия надлежащей подготовки по использованию автоинжекторов. Кроме того, для недавно разработанных оксимов, таких как MMB4 и HI6, трудно составить рецептуры композиций для современных автоинжекторов. Существует высокая потребность в разработке практичных, более эффективных систем с быстрым началом действия, пригодных для нанесения агентов против нервно-паралитических газов, таких как оксимы, способных проникать в центральную нервную систему (ЦНС) субъектов в боевых условиях и чрезвычайных ситуациях.

Способ доставки оксима через гематоэнцефалический барьер нуждающемуся в этом субъекту включает введение субъекту терапевтически эффективной дозы оксима, причем доза доставляется в верхнюю обонятельную область назальной полости.

В одном аспекте способа, терапевтически эффективное количество оксима, которое вводится пользователю, находится в диапазоне значений от примерно 0,001 мг/кг до примерно 100 мг/кг.

В другом аспекте способа, терапевтически эффективное количество оксима, которое вводится пользователю, находится в диапазоне значений от примерно 0,01 мг/кг до примерно 10 мг/кг.

В еще одном аспекте способа, терапевтически эффективное количество оксима, которое вводится пользователю, находится в диапазоне значений от примерно 0,1 мг/кг до примерно 1 мг/кг. В одном аспекте, мг/кг обозначает количество мг композиции на килограмм веса тела. В другом аспекте, доза представляет собой постоянную дозу, независимую от веса.

Реализация способа доставки оксима интраназально в обонятельную область включает обеспечение устройства, описанного в данном документе, для введения в назальную полость пользователя. Устройство вставляют в назальную полость пользователя. По меньшей мере одна терапевтически эффективная доза оксима доставляется с помощью устройства. По меньшей мере одна терапевтически эффективная доза оксима доставляется в обонятельную область. Доставка оксима в обонятельную область обеспечивает доставку оксима через ГЭБ.

Оксимы, такие как, без ограничений, 2-PAM (2-пиридинальдоксима метилхлорид), MMB4, HI6, TMB4, Hlo7, в настоящее время используются для лечения воздействия ОФ, но они плохо проникают через гематоэнцефалический барьер. Таким образом, оксимы, в их современной форме введения, малопригодны для лечения или предотвращения поражений ЦНС, причиняемых этими композициями.

Путем использования устройства, описанного в данном документе для реализации способа, композиция, такая как оксим, может быть введена самостоятельно или введена боевым товарищем, или гражданским лицом, имеющим медицинскую подготовку, или пользователем без предварительной медицинской подготовки. Устройство обеспечивает доставку композиции, не требуя специального режима дыхания пользователя, и может быть введена пользователю, находящемуся без сознания.

Процент прямого транспорта (ППТ%) в мозг рассчитывают при использовании оксима для определения количества лекарственного средства в мозге, которое поступило в ЦНС непосредственно из назальной полости. В одном варианте исполнения величина ППТ составляет 62,6±9,6%. В одном аспекте, величина ППТ составляет более 64,2%. В другом аспекте, величина ППТ составляет по меньшей мере 64,3%. В другом аспекте, величина ППТ составляет по меньшей мере 53%. В другом аспекте, величина ППТ составляет более 53%. В другом аспекте, величина ППТ составляет более 55%. В другом аспекте, величина ППТ составляет по меньшей мере примерно 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100%, включая конечные точки. В другом аспекте, величина ППТ составляет по меньшей мере примерно 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100%, включая конечные точки.

Устройство наносит композицию на обонятельную область. В одном варианте исполнения процент отложения композиции составляет по меньшей мере 64,2%. В одном аспекте, процент отложения композиции составляет более 64,2%. В другом аспекте, процент отложения композиции составляет по меньшей мере 64,3%. В другом аспекте, процент отложения композиции составляет более 50%. В другом аспекте, процент отложения композиции составляет более 55%. В другом аспекте процент отложения композиции составляет по меньшей мере примерно 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100%, включая конечные точки. В другом аспекте, процент отложения композиции составляет по меньшей мере примерно 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100%, включая конечные точки.

Композиции, которые могут быть доставлены описанным устройством, включают, без ограничений, материалы, предназначенные для паллиативного ухода, профилактики или лечения инфекционных болезней, воспалительных болезней и онкологии. Композиции, которые могут быть доставлены устройством, включают, без ограничений, материалы, предназначенные для паллиативного ухода, профилактики или лечения болезни Паркинсона, болезни Альцгеймера, депрессии, инсульта, эпилепсии, аутизма, лизосомальных болезней накопления, синдрома ломкой X-хромосомы, атаксии, инсулинонедостаточности и слепоты. Композиции, которые могут быть доставлены, включают, без ограничений, дефероксамин (DFO), антагонист глюкагонподобного пептида-1, цефалексин, мидазолам, морфин, инсулиноподобный фактор роста-1, фактор роста нервов, инсулин, оксимы, агенты визуализации, включая, без ограничений, FDL и FLT, GDP-5 и цитокины, включая, без ограничений, интерлейкины (т.е. IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9 и IL-10), интерфероны и фактор некроза опухоли (т.е. TNF-α и TNF-β).

Изобретение далее описано в следующих примерах, не предназначенных для ограничения объема изобретения.

ПРИМЕРЫ

Пример 1

Оксимное лекарственное средство, 2-PAM, вводили в обонятельную область носа крыс с помощью устройства (например, устройства для доставки под давлением в обонятельную область (POD)). Концентрации 2-PAM в мозге и плазме измеряли в определенные моменты времени после введения лекарственного препарата. Устройство обеспечивало доставку 2-PAM, приводящую к повышенной экспозиции мозга и пониженной экспозиции плазмы по сравнению с внутривенной инъекцией.

Использование животных. Крыс использовали для экспериментов по отложению, переносимости и распределению. Взрослых самцов крыс Sprague-Dawley (200-300 г; Harlan, Indianapolis, IN) содержали в условиях 12-часового цикла свет/темнота при свободном доступе к пище и воде. За животными ухаживали в соответствии с ведомственными нормативами и все эксперименты проводили по протоколу, утвержденному ведомственным комитетом Тихоокеанского северо-западного института диабета по уходу за животными и их использованием (Pacific Northwest Diabetes Institute Institutional Animal Care and Use Committee), протокол № 12610.

Статистический анализ. В большинстве случаев при сравнении двух величин использовался t-критерий. При сравнении более чем двух групп, таком как сравнение порошкообразной композиции 2-PAM POD с водной композицией 2-PAM POD и внутривенным (IV) 2-PAM, использовали двухфакторный дисперсионный анализ с апостериорным критерием Бонферрони. При сравнении значений AUC для плазмы и мозга, полученных для разных животных в каждый момент времени, использовали способ, описанный Westin et al., 2006. Во всех случаях статистическую значимость определяли как p<0,05.

Водные композиции 2-PAM готовили путем растворения 2-PAM в деионизированной воде. 2-PAM растворяли в 500 мкл воды с концентрациями 10 мг/мл, 100 мг/мл, 250 мг/мл и 500 мг/мл и оставляли в закрытой микроцентрифужной пробирке при температуре окружающей среды (25°С). Такие композиции на водной основе осматривали визуально через 1 час, 24 часа и 48 часов с целью обнаружения помутнения или осадка.

Композиции сухого порошка 2-PAM готовили путем помещения лекарственного средства 2-PAM в свободной форме в микроцентрифужную пробирку и измельчения лекарственного средства с помощью моторизованного пестика (Kontes, Vineland, NJ). Порошок 2-PAM затем рассматривали под микроскопом для того, чтобы убедиться в гомогенности композиции порошка. 2-PAM растирали пестиком до тех пор, пока не оставалось агломератов 2-PAM размером более 100 мкм в диаметре. Такие более крупные агломераты могли бы забить сопло POD с диаметром 810 мкм, используемое в экспериментах на крысах.

Конструкция POD-устройства для назального введения аэрозоля крысам изображена на Фиг.17. Ингалятор с мерными дозами (MDI), способный дозировать 25 мкл гидрофторалкана 227, присоединен к пластиковому приводу. Привод сообщается по газу с политетрафторэтиленовой фриттой, имеющей размер пор 50 мкм. Фритта сообщается с содержащим дозу цилиндром, который помещают в корпус POD для создания распыленного потока. При приведении в действие ГФА пропеллент превращается в газ при прохождении через материал фритты и затем смешивается с дозой и доза вместе со смесью пропеллента выходит из сопла, изготовленного из трубки 23 калибра (23 gauge) из нержавеющей стали, с покрытием из фторированного этиленпропилена, нанесенным с наружной стороны металлического кончика, для защиты назального эпителия от повреждения соплом при использовании. Конструкция POD-устройства для крыс была успешной и обеспечивала стабильную доставку порошкообразных композиций 2-PAM без измеримого остатка лекарственного средства в устройстве.

Основной порядок использования любого из POD-устройств на крысах был следующим. Животное анестезировали 5% изофлураном в течение 2 минут для обеспечения возможности беспрепятственного введения. Крысу вынимали из изофлурановой камеры и размещали в положении лежа на спине. Дозу загружали в устройство и сопло осторожно вводили на 8,0 мм в назальную полость крысы и направляли в сторону решетчатой пластинки решетчатой кости. Затем сжимали баллончик MDI для выпускания дозы в назальную полость крысы. Кроме того, камеру с дозой сухого порошка взвешивали на весах с чувствительностью 0,1 мг (Mettler Toledo, Columbus, OH) перед загрузкой дозы, после помещения дозы в камеру загрузки дозы и после срабатывания, чтобы убедиться, что в устройство была загружена точная доза и что полная доза была выпущена в назальную полость крысы.

Композиции 2-PAM были приготовлены с 0,1% красителя кумасси синего для проведения испытаний на отложение в назальной полости крыс. Животным вводили дозы с помощью POD-устройства для сухого порошка, как описано выше, с использованием разовой дозы 2,5 мг 2-PAM с кумасси синим. Вскоре после завершения введения (<5 минут) животным вводили чрезмерную дозу 250 мг/кг пентобарбитала. Назальную полость затем рассекали по перегородке, перегородку удаляли и ткани анализировали на локализацию красителя. Дополнительно, трахею и пищевод препарировали из задней стенки ротовой полости до легких для определения того, происходило ли отложение 2-PAM при использовании POD-распылителя за пределами назальной полости. Такие исследования отложения проводили на N=4 крысах. Типичные результаты испытаний отложения приведены на Фиг.18. На Фиг.18 обонятельная область назальной полости крысы в верхней панели обведена белым кругом. Видно, что темный краситель осаждается преимущественно в данной обонятельной области.

Был разработан чувствительный РХ/МС-способ для определения распределения введенного с помощью POD 2-PAM в плазме и мозге крыс. Фиксированный объем (20 мкл) 2-хлор-1-метилпиридиния йодида-d 6 (Cerilliant, Palo Alto, CA) добавляли в каждый образец ткани и плазмы в качестве внутреннего стандарта. Образцы ткани гомогенизировали в 3 мл воды. Прибавляли к образцам 60 мкл ацетонитрила, чтобы вызвать преципитацию белка. Образцы центрифугировали в течение 10 минут при 1000g. Для количественных определений использовали прибор Agilent HPPX/МС series 1100 series B с автоматическим пробоотборником (Agilent, Technologies, Inc., Santa Clara, CA). Объем инъекции составлял 5 мкл. Образцы морфия пропускали через Phenomenex Synergi 4u Polar RP 80A (Agilent, Technologies, Inc., Santa Clara, CA) со скоростью потока 0,3 мл/мин.

Калибровочную кривую получали в день анализа в соответствии с тем же способом, что и описанный для образцов. Каждая калибровочная кривая была линейной с коэффициентом линейной регрессии R2>0,99. Кроме того, в день анализа обрабатывали два образца для контроля качества с известным количеством лекарственного средства для обеспечения повседневной стабильности аналитического метода.

Этот способ РХ/МС оказался успешным и позволил получить воспроизводимые количественные результаты для образцов как тканей, так и мозга. Детектируемые пики 2-PAM в большинстве случаев были значительно выше фонового уровня. Чувствительность данного метода определения составляла 0,05 мкг/мл в плазме и 1,0 нг в ткани мозга. Этот метод может быть использован в будущих исследованиях на приматах или в клинических исследованиях.

В экспериментах по распределению в тканях животных анестезировали 5% изофлураном в течение двух минут. Затем животных извлекали из ящика для вводного наркоза изофлураном и помещали в положение лежа на спине. Животным затем вводили дозу препарата с помощью POD-устройства (2,5 мг в разовой дозе 10 мкл) или путем внутривенной инъекции (2,5 мг в 500 мкл). Животных, которых умертвляли через 5 минут после введения дозы, оставляли под анестезией 2% изофлурана до момента умертвления. Животным, которых умертвляли в остальные моменты времени, позволяли проснуться после анестезии изофлураном и помещали их назад в жилище. За 3 минуты до времени умертвления животных снова обрабатывали 5% изофлураном и затем быстро вводили чрезмерную дозу Beuthanasia -D (Schering-Plough Animal Health Corp., North Chicago, IL). При использовании внутривенно (IV) 2-PAM и водной POD-композиции 2-PAM животных умертвляли в моменты времени 5, 15, 30, 60 и 120 минут (N=6). Животных, которым вводили дозу сухого порошка 2-PAM в виде POD-композиции, умертвляли в моменты времени 5 и 15 минут (N=6).

Немедленно после смерти животных обезглавливали. Собирали кровь из туловища и помещали в микроцентрифужную пробирку с 10 мкл 40 мМ ЭДТА. Плазму выделяли из крови центрифугированием при 6000g в течение 10 минут. Затем плазму замораживали до анализа концентрации 2-PAM описанным выше способом РХ/МС. Кости основания черепа и теменные кости быстро удаляли из головы. Мозг вынимали в течение 2 минут после умертвления. Мозг помещали в микроцентрифужную пробирку и замораживали до проведения анализа концентрации 2-PAM методом РХ/МС.

Рассчитывали процент прямого транспорта (ППТ%) в мозг для определения количества лекарственного средства в мозге, поступившего непосредственно из назальной полости в ЦНС. Величину ППТ% использовали для оценки количества лекарственного средства в мозге, которое не может быть объяснено системным распределением. Вышеуказанную величину ППТ рассчитывали следующим образом.

Введение водной композиции 2-PAM с помощью POD приводило к пониженной системной экспозиции и повышенной экспозиции ЦНС по сравнению с эквивалентной внутривенной (IV) дозой. Внутривенная (IV) доза давала типичную кривую содержания в плазме с наивысшей точкой в момент времени 5 минут (Фиг.19). Введенный с помощью POD 2-PAM давал более низкие концентрации в плазме, чем при внутривенном введении, что было неожиданным, с учетом ограниченной абсорбции 2-PAM через назальный дыхательный эпителий в кровоток. Общая AUC плазмы была значительно ниже после POD-введения по сравнению с внутривенным (IV) введением.

В отличие от значений в плазме, концентрации 2-PAM в мозге после POD-введения были значительно более высокими, чем после внутривенного введения, как через 5, так и через 120 минут (Фиг.20). Кроме того, общая AUC концентрации в мозге была значительно больше после POD-введения по сравнению с внутривенным. С точки зрения применения 2-PAM для лечения воздействия нервно-паралитическим газом представляет интерес тот факт, что через 5 минут после введения 2-PAM с помощью POD концентрация в мозге была в 3,5 раза выше по сравнению с внутривенным введением.

Соотношения мозг-к-плазме были значительно более высокими после POD-введения 2-PAM по сравнению с внутривенным в любой момент времени, за исключением 30 минут (Таблица 1). Такие повышенные соотношения указывают на тот факт, что часть лекарственного средства была доставлена непосредственно в мозг из назальной полости, эффективно в обход гематоэнцефалического барьера. Расчет процента прямого транспорта (%ППТ) показал, что он равен 80,9%. Такой %ППТ можно объяснить в первую очередь высокими значениями для мозга, определенными через 5 минут после введения 2-PAM с помощью POD. Таблица 2 показывает соотношения концентраций в мозге к концентрациям в плазме. Для всех моментов времени, за исключением 30 минут, POD-введение давало значительно более высокие соотношения концентраций в мозге и в плазме при 15,25-кратно повышенном соотношении в мозге и в плазме через 5 минут.

Таблица 1
Время (мин) POD IV
5 132,7* 8,7
15 58,5* 13,1
30 41,1 16,8
60 61,4* 11,7
120 126,7* 6,7

Композиция порошка 2-PAM, введенная с помощью POD-устройства, давала еще большие концентрации 2-PAM в мозге (Таблица 2). Исследования введения порошка 2-PAM с помощью POD были более ограниченными, чем водных композиций, но через 5 и 15 минут после введения композиции порошка давали схожие значения уровней в крови по сравнению с введением водного 2-PAM с помощью POD, но значительно более высокие концентрации в мозге.

Таблица 2
Концентрация 2-PAM в плазме (нг/г ткани) стандартное отклонение
Время (мин) POD IV порошок POD POD IV порошок POD
5 0,44 1,42* 0,46 5 0,1 0,4 0,27
15 0,33 0,73* 0,38 15 0,1 0,2 0,11
Концентрация 2-PAM в мозге (нг/г ткани) стандартное отклонение
Время (мин) POD IV порошок POD POD IV порошок POD
5 41,6 11,9 106,19* 5 19,0 2,0 11,75
15 10,4 9,0 293,32 15 6,4 1,0 220,27

В Таблице 2 приведены распределения композиции порошка 2-PAM, введенного с помощью POD. Композиция порошка при введении с помощью POD давала значения в плазме через 5 и 15 минут, которые существенно не отличались от жидких композиций при введении с помощью POD. Однако концентрации 2-PAM после введения с помощью POD композиции порошка значительно превышали значения как для водного 2-PAM с помощью POD, так и для внутривенного 2-PAM. *=p<0,05.

В результате проведения экспериментов по определению фармакокинетических параметров и распределения были получены данные, подтверждающие потенциал введения 2-PAM с помощью POD в качестве лечения при воздействии нервно-паралитического газа. POD-введение как водной композиции, так и композиции порошка приводило к высокой экспозиции мозга в течение первых 5 минут после введения.

Пример 2

Устройство, использованное в Примере 2, представлено на Фиг.3. Устройство в данном примере называется устройством для доставки в обонятельную область под давлением (POD). Для определения количества композиции, доставляемой из устройства в обонятельную область назальной полости, был разработан способ определения процентной части дозы, осаждающейся в ключевых областях модели назальной полости человека. Этот способ основан на количественных определениях путем проведения анализа изображений и способен детектировать и проводить количественные определения отложения в 5 определенных областях, описывающих полную модель носа, включая верхнюю обонятельную область.

Материалы: Модель назальной полости человека была сконструирована из прозрачного термоформуемого пластичного листового материала (Фиг.21). Эта форма является тонкостенной и прозрачной для источника синего света, обеспечивающего возбуждение индикаторного красителя флуоресцеина, используемого в экспериментальных дозах. Эта модель назальной полости человека была основана на компьютерной модели, созданной на основании сканов МРВ от множества особ (Liu, J Appl Physiol, 2009 Mar; 106(3): 784-95). Таким образом, модель представляет собой “усредненную” назальную полость человека.

Был спроектирован и сконструирован столик для позиционирования назальных моделей и нацеливания POD-устройства при выборе направления и приведении в действие. Этот столик был достаточно легко приспосабливаемым при работе, позволяя обеспечить широкий выбор углов нацеливания как по горизонтали, так и по вертикали. Путем нацеливания устройства под различными углами по отношению к назальной полости можно было испытать устройство введения на надежность.

Тонкостенную прозрачную модель носа готовили путем нанесения с внутренней стороны покрытия из очень тонкого слоя имитации слизистой, в качестве которой использовался приобретенный в магазине раствор для дезинфекции рук. Подготовленную модель затем фотографировали в изготовленном на заказ трансиллюминаторе/фотобоксе в качестве холостого опыта для данной конкретной экспериментальной точки. Модель затем устанавливали на столик вместе с POD-устройством, заряженным дозой 0,1 мг/мл флуоресцеин/вода. Немедленно после приведения в действие POD модель снимали со столика и держали горизонтально для предотвращения миграции дозы. Модель с введенной дозой как можно скорее помещали в трансиллюминатор/фотобокс и фотографировали. Модель затем промывали в потоке водопроводной воды и сушили встряхиванием или потоком воздуха для подготовки к следующим испытаниям. Два фотографических изображения затем анализировали цифровыми методами, как описано ниже, для выявления отложения в модели.

Обработку данных полученных изображений холостого опыта и эксперимента проводили с использованием прикладной программы ImageJ. Для повторного сравнения изображений в ImageJ и точного вычитания фона цифровые фотографии выполняли при тщательном размещении модели в определенном положении в трансиллюминаторе/фотобоксе. Программа ImageJ выполняла три ключевые функции: 1) проводилась цветовая обработка изображения с помощью делителя RGB-каналов. Эта функция удаляла красный и синий сигналы из изображения, оставляя преимущественно сигнал, генерируемый флуоресцентным сигналом флуоресцеина в дозе.

ROI-менеджер (функция выделения требуемой области) ImageJ позволил нам определить пять областей, представляющих интерес: обонятельную, носовую раковину, пищевод, основание и преддверие, которые количественно анализировали для каждого введения с помощью устройства. Области разделены линиями, представленными на Фиг.20, и эти области имеют удельную поверхность, в пикселях, которая может быть количественно измерена по интенсивности сигнала флуоресцеина. Фиг.22 также изображает типичную картину распыления факела после POD-введения. Флуоресцеин, вводимый в модель с помощью POD-устройства, можно увидеть как интенсивное освещение на темном фоне. На Фиг.20 можно заметить, что большая часть введенной дозы находится в обонятельной области модели носа человека. Каждый пиксель на этих фотографиях может иметь значение от 0 до 255. Функция Measure (Измерение) программы ImageJ рассчитывает среднее значение для пикселей в каждой определенной области, представляющей интерес. Общий сигнал, зарегистрированный в конкретной представляющей интерес области, таким образом, является произведением среднего значения пикселей на число измеренных пикселей. Дополнительный интерес представляет собой зарегистрированное Max (максимальное) значение. Поскольку фотография не может зарегистрировать более 256 уровней сигнала, мы пришли к выводу, что анализ является недействительным, если в этой колонке будут получены значения, равные 255, поскольку мы не можем быть уверены, что действительный сигнал не имел бы величину значительно выше 255, если бы он мог быть измерен. В результате этого может возникнуть эффект регистрации неполного сигнала в данной области, представляющей интерес (ROI), потому что сигнал будет по существу срезан. Поэтому настройки выдержки фотокамеры имеют критическое значение для обеспечения того, чтобы зарегистрированные сигналы не выходили за пределы диапазона чувствительности способа, но при этом позволяли достичь максимальной чувствительности способа.

Кроме того, наши расчеты предусматривали вычитание значений, полученных для холостого опыта. Это связано с присутствием рассеянного светового излучения и потому всегда существующим потенциалом фоновой флуоресценции с участием модели и имитации слизистой. Поскольку эти элементы не являются безупречными при использовании, мы каждый раз делали фотографию фона и проводили вычитание для каждой точки данных. Этот способ обеспечивает преимущество, заключающееся в возможности частичного отложения на более чем одной области модели носа. Он также обеспечивает четко выраженное качественное фотографическое/визуальное подтверждение количественных результатов.

Результаты исследований отложения приведены в Таблице 3. Было использовано два разных POD-устройства, обозначенных как Tip#1 и Tip#2 (наконечники № 1 и 2). Каждый наконечник использовали для введения в модель носа N=3 раза под горизонтальным углом 0 градусов по отношению к перегородке или 5 градусов по горизонтали к перегородке. Все введения с помощью POD выполнялись под вертикальным углом 55 градусов по отношению к основанию назальной полости.

Таблица 3
Наконечник №1,
0 градусов
Наконечник №1,
5 градусов вперед
Зона Ср. распределение Ст. отклонение Ср. распределение Ст. отклонение
Обонятельная 59,9 14,7 70,0 12,9
носовая раковина 38,3 13,2 35,1 5,3
пищевод -1,4 4,7 -3,1 12,1
основание 3,6 4,1 0,7 2,5
преддверие -0,4 4,6 -2,7 2,8
Наконечник №2,
0 градусов
Наконечник №2,
5 градусов вперед
Зона Ср. распределение Ст. отклонение Ср. распределение Ст. отклонение
Обонятельная 58,2 3,9 61,1 7,3
носовая раковина 49,1 12,1 38,5 3,6
пищевод -4,6 5,2 -0,1 4,6
основание -0,8 1,5 0,8 0,1
преддверие -1,9 3,4 -0,4 2,3

Пример 3

Испытания силы соударения были использованы для сравнения нескольких конфигураций сопла/камеры дозы с приводными механизмами ингаляторов с мерными дозами (MDI) при использовании нескольких коммерческих назальных распыляемых продуктов. Сила соударения является идеальным способом определения характеристик факела, важных для стабильности доставки дозы, локализации дозы и комфортности введения дозы и безопасности. Схема экспериментальной установки, использованной в данном примере, представлена на Фиг.23.

Измерения силы соударения проводились с помощью прибора Mettler Toledo XS 64 с настройками вывода данных 10 замеров в секунду, сопряженного с компьютером Apple MacBook Pro с процессором 2,2 GHz Intel Core 2 Duo, 4 GB 667 MHz DDR2 SDRAM через переходной кабель ft. (футов) RS232 (Mettler Toledo) - USB (Gigaware) с поддерживающим программным драйвером. Сбор данных производили с помощью прикладной программы Windmill Logger версии 4.07, release 7 (Windmill Software Ltd.) в среде виртуальной машины Windows Vista с использованием Parallels Desktop 5 for Mac на MacBook Pro. Данные, собранные с помощью Windmill Logger, импортировались непосредственно в Microsoft Excel для графической обработки и анализа.

Для выполнения измерений был сконструирован столик для измерения силы соударения. Этот столик включал средства для точного контроля уровня и расстояния наряду с выполненными на заказ держателями для индивидуальных исследуемых устройств. Приведение в действие осуществляли вручную. POD или коммерческие устройства нацеливали точно на центр 16,9-граммового алюминиевого поддона размером 74×80 мм. Поддон очищали от дозы/остатков после проведения измерений для каждой точки данных. Расстояние от отверстия сопла до поддона было равно 4 см, что в соответствии с выводами Guo et al. 2009 (Guo, J Pharm Sci., 2009, Aug;98(8):2799-806) находится в границах окна расстояний от 3 до 6 см, в котором генерируются наибольшие силы соударения, и также в соответствии с нашими целевыми значениями расстояния в моделях носа человека. Значения, полученные в ходе проведения испытаний при срабатывании MDI в результате приведения в действие клапана, были в общем нечувствительными к различиям между отдельными нажатиями, при использовании устройства в соответствии с указаниями. Единственным наблюдаемым эффектом были более низкие значения при очень медленном нажатии.

В данном Примере были проведены испытания трех коммерческих назальных распыляемых продуктов: средство от насморка Rite Aid Pump Mist Nasal Relief, оксиметазолин-HCl 0,05%; NeilMed NasoGel For Dry Noses, увлажняющий гель для сухой слизистой оболочки носа в аэрозольной упаковке; и Rite Aid No Drip Nasal Spray, насос, оксиметазолин, 0,05%.

Устройство, использованное в этих исследованиях, изображено на Фиг.3 и называется в данном Примере устройством для доставки в обонятельную область под давлением (POD). Испытания сопла POD по сравнению с коммерческими распылительными насосами были описаны выше. В данном Примере мы испытывали POD-устройство в таких же условиях, что и коммерческие распылительные устройства, использующие MDI-контейнеры, содержащие 5% этанол, флуоресцеин, смешанный с ГФА 134a или с ГФА 227. MDI-клапаны были отрегулированы на доставку постоянного объема 50 мкл.

Измерения сил соударения для трех коммерческих назальных распылителей насосного типа показали, что создаваемые пиковые усилия обычно имеют значения менее 0,8 грамма. Было отмечено, что такие продукты создают или очень широкие факелы распыления, или медленно движущиеся потоки гелеобразного материала. Усилия, создаваемые этими подвергнутыми испытаниям продуктами, были значительно ниже сил, указываемых Guo et al., 2009, равных от 3,0 до 4,9 грамм. POD-устройство создавало силы соударения с измеренными пиковыми значениями около 4 грамм и средними значениями чуть ниже 3 грамм силы при использовании более высоколетучего ГФА 134a. Эти значения силы опускались ниже 2 грамм при использовании вместо него ГФА 227. В любом случае, силы соударения для POD-устройства также вполне укладывались в диапазон значений сил соударения, измеренных для коммерческого MDI-устройства Guo et al., 2009, которое продемонстрировало максимальное значение, равное 6,5 грамм.

Было обнаружено, что измеренные силы соударения зависят от типа используемого ГФА и объема ГФА, дозируемого MDI-контейнером. На величину сил соударения также влияли конфигурация камеры дозы и сопла. Ни в одном эксперименте мы не получили сил, превышавших измеренные для коммерческого продукта, указанного в статье Guo et al.

Пример 4

В данном примере были проведены испытания устройства, названного устройством доставки в обонятельную область под давлением (POD), с целью определения того, будет ли устройство выбрасывать спрей с пониженной температурой. Эти испытания предусматривали измерения изменений температуры поверхности, создаваемые ГФА POD, в целевой области. Схема экспериментальной установки, использованной в данном примере, изображена на Фиг.24.

Гидрофторалкан (ГФА), используемый в качестве пропеллента в POD-устройстве, высвобождается из мерного контейнера в виде жидкости. После высвобождения ГФА очень быстро испаряется и расширяется, создавая импульс давления, который приводит в движение дозу в сопле POD. Характерной особенностью POD с использованием ГФА является то, что газообразный ГФА выбрасывается в направлении мишени вместе с и после доставки дозы. Расширение ГФА вызывает заметное понижение температуры газообразного пропеллента в процессе выброса. Чтобы установить, передается ли и в какой степени этот перепад температур тканям-мишеням, мы разработали и провели эксперименты по детектированию и измерению температуры поверхности мишеней во время и непосредственно после их столкновения с зарядом устройства, выбрасывающего только ГФА или смесь ГФА и жидкой композиции (поскольку оно может быть использовано для введения жидкой готовой лекарственной формы).

Материалы: инфракрасный термометр Kintrex, модель IRT0421, способный измерять температуру поверхности без фактического контакта с исследуемой поверхностью. Температуры измерялись в градусах Фаренгейта. Привод, оснащенный контейнером ГФА 134а, рассчитанным на подачу 50 мкл пропеллента, бумажные салфетки Kimwipe, чашка петри, 1% агароза/вода, 3 наконечника, включая сопло с высоким сопротивлением, с низким сопротивлением и открытой конфигурации/без фритты.

Фиг.24 изображает экспериментальную установку для измерения изменений температуры при срабатывании POD-устройства в разных условиях. Термометр был расположен в 4 см от мишени. На таком расстоянии термометр “видит” и считывает показатели с круглого пятна диаметром 0,33 см (круг мишени на Фиг.24).

Были проведены испытания наконечников трех конфигураций. 1. Наконечник с установленным соплом высокого сопротивления. Сопло с высоким сопротивлением препятствует истечению газообразного ГФА в достаточной степени для того, чтобы сопло было лимитирующим элементом системы POD. Оно высвобождает газ в течение длительного периода времени. 2. Наконечник с установленным соплом низкого сопротивления. В этом наконечнике фритта, размещенная со стороны привода, является фактическим лимитирующим элементом устройства. Он высвобождает газ быстрее, чем сопло с высоким сопротивлением. 3. Наконечник, не имеющий ни сопла, ни фритты. Этот наконечник не создает по существу никаких ограничений для потока газообразного или жидкого ГФА через устройство. Используя эти три конфигурации, мы надеялись понять, каким образом ограничения газового потока влияют на температуру мишени при выбрасывании дозы, а также четко определить роль тефлоновой фритты в рассеивании и ускорении перехода ГФА из жидкого состояния в газообразное.

Мы также провели испытания эффекта близости мишени к соплу на изменения температуры мишени. "Выстреливание" производили с расстояния 4 см и 2 см.

Кроме того, испытывали устройство на трех разных мишенях. 1) Мы использовали мишень с очень низкой массой. Эта мишень была сконструирована из бумажной салфетки Kimwipe. Мы ожидали, что мишень с низкой массой будет иметь очень низкую термическую инерцию и потому будет демонстрировать гораздо более сильные изменения температуры при испытаниях. 2) Мы создали имитацию эпителия (имитация эпителия №1) путем наложения бумажной салфетки Kimwipe на 1% агароза/вода. Эта мишень была спроектирована для того, чтобы термометр определял показатели для поверхности с окраской и текстурой, схожими с поверхностью мишени с низкой массой. 3) Другая имитация эпителия (имитация эпителия №2) была изготовлена из 1% агароза/вода с бумажной салфеткой Kimwipe, расположенной чуть ниже поверхности (на глубине менее 0,5 мм) агарозы. Эта мишень была спроектирована на тот случай, если термометр реагирует на бумажный слой, расположенный под по существу прозрачной агарозой, чтобы определить, являются ли температурные эффекты преимущественно поверхностными.

Кроме того, некоторые температурные измерения проводились на имитациях эпителия при добавлении в установку дозы 50 мкл воды. В Таблице 4 приведены изменения температуры, определенные при использовании одного лишь гидрофторалканового пропеллента. Изменение температуры в градусах Фаренгейта обозначено символом Δ. Мы считали, и наши результаты подтвердили, что это позволит создать условия для наиболее резких изменений температуры. Для бумажной мишени низкой массы, с низкой термической инерцией, наибольшее изменение температуры наблюдалось в том случае, когда в наконечнике не были установлены фритта или сопло. Результаты для таких условий были плотно сгруппированы возле -25°F. Действительно, при такой конструкции можно наблюдать, что из кончика наконечника выбрасывается дисперсный материал или аэрозоль, что позволяет предположить, что определенная часть ГФА остается в жидком состоянии во время прохождения внутри корпуса привода и наконечника. Любой жидкий ГФА, достигший мишени, будет затем охлаждаться в результате испарения на мишени и позволяет объяснить наблюдаемое резкое снижение температуры.

Таблица 4
Сопло с низким сопротивлением Без фритты/сопла
4 см от мишени 2 см от мишени
-Δмакс. -Δмакс. -Δмакс.
Низкая масса 2,5 3,7 4,4 5,6 25,2 27,2
Имитация эпителия 1 0,5 1,1 1,1 1,9 3,9 4,4
Имитация эпителия 2 1,0 1,5 0,9 1,8 4,2 5,3
Сопло с высоким сопротивлением Без фритты/сопла
4 см от мишени 2 см от мишени
-Δмакс. -Δмакс. -Δмакс.
Низкая масса 1,9 3,2 2,9 5,2 25,2 27,2
Имитация эпителия 1 1,2 3,5 1,2 1,6 3,9 4,4
Имитация эпителия 2 1,7 2,6 2,5 3,2 4,2 5,3

В отличие от указанных, все другие экспериментальные условия приводили к гораздо меньшим перепадам температуры мишени. Умеренное охлаждение на 3-4°F наблюдалось при использовании не содержащего препятствий наконечника на имитациях эпителия. Очевидно, что теплоемкость мишени является критическим фактором этого анализа.

Установка тефлоновой фритты и сопла в наконечнике приводила к еще меньшим перепадам температуры. На мишени из салфетки низкой массы, сопло с низким сопротивлением давало наибольшее снижение температуры, с максимальным значением, равным 5,6°F, с расстояния 2 см. Сопло с высоким сопротивлением приводило к немного меньшим величинам снижения температуры. Типичные значения составляли 3°F или меньше.

Наблюдается незначительная тенденция в зависимости от расстояния наконечника до мишени. Как и можно было ожидать, обработка с более близкого расстояния может приводить к более низким температурам мишени.

При добавлении дозовой нагрузки 50 мкл воды для наконечника, включающего тефлоновую фритту и сопло с низким сопротивлением, наблюдались очень малые температурные эффекты. Результаты изменялись в пределах от падения температуры на 0,5°F до повышения на 0,2°F. Было определено, что при наблюдаемых малых изменениях и трудностях работы с жидкими дозами на экспериментальной установке мы не сможем получить надежные результаты для жидких доз. Однако мы считаем, что результаты, полученные для жидких доз, согласуются с прогнозируемыми.

Гидрофторалкановый пропеллент, используемый в POD-устройстве, будет оказывать минимальное влияние на температуру ткани, с которой он контактирует. Данные демонстрируют функцию тефлоновой фритты в POD и понижение температуры обрабатываемого участка только при доставке ГФА. Кроме того, типичная нагрузка, равная 50 мкл, сама по себе должна уменьшать любые температурные эффекты.

Пример 5

Для оценки нацеливания на обонятельную область человека готовой лекарственной формы осуществлялась доставка 2 композиций 2-PAM из устройства в модель назальной полости человека и анализировалось их отложение в обонятельной области.

Изготовленная из силиконового каучука модель назальной полости человека была приобретена у Koken Inc. (Tokyo, Japan). Следовое количество (0,1%) кумасси синего (Sigma Aldrich, St. Louis, MO) подмешивалось в сухой порошок 2-PAM. Сухой порошок 2-PAM и кумасси синего измельчали до гомогенного порошка с помощью ступки и пестика. Прибавляли 0,1% родамина B в водную композицию (250 мг/мл) для визуализации модели назальной полости. Композицию сухого порошка вдували в модель назальной полости (N=10) с помощью устройства и делали фотографии для получения качественных показателей отложения в обонятельной области. Фотографии анализировали для определения того, была ли большая часть порошка 2-PAM нанесена в обонятельной области.

То же самое делали с водной композицией и отложение в обонятельной области также количественно определяли по весу этой композиции (N=10). Обонятельную область модели назальной полости вырезали из модели таким образом, чтобы она была съемной. Обонятельную область взвешивали перед распылением с помощью POD и после распыления и процент дозы, нанесенной в обонятельной области, рассчитывали по весу.

Композиция сухого порошка 2-PAM при введении в назальную полость человека, позволяла эффективно доставлять лекарственное средство в обонятельную область. Качественная оценка 10 попыток введения в модель однозначно показала, что большая часть лекарственного средства (примерно 50% или больше) попадала в обонятельную область. В дополнение к нанесению лекарственного средства в обонятельную область, POD-устройство с сухим порошком наносило значительную часть дозы 2-PAM на поверхность участка решетчатой пластинки модели, отделяющей обонятельную область назальной полости от мозга.

Водная композиция 2-PAM продемонстрировала характер отложения в модели назальной полости человека, аналогичный сухой композиции порошка. В дополнение к носящим качественный характер фотографиям назальной полости человека, было определено, что 62,6±9,6% дозы откладывается в обонятельной области назальной полости.

Объем настоящего изобретения не ограничен конкретными вариантами исполнения, описанными в данном документе. На самом деле, различные модификации изобретения, в дополнение к описанным в данном документе, будут очевидными квалифицированным специалистам в этой области техники из приведенного выше описания и сопровождающих фигур. Предполагается, что такие модификации входят в объем приложенной формулы изобретения.

1. Устройство для доставки композиции в обонятельную область назальной полости, содержащее:

контейнер, способный вмещать пропеллент,

диффузор, сообщающийся с контейнером,

камеру для композиции, сообщающуюся с диффузором, при этом камера для композиции способна вмещать композицию, и

сопло, сообщающееся с камерой для композиции,

причем устройство способно доставлять композицию в обонятельную область назальной полости.

2. Устройство по п. 1, в котором контейнер находится под давлением.

3. Устройство по п. 1, в котором пропеллент является, по меньшей мере, одним из гидрофторалкана, азота или хлорфторуглерода.

4. Устройство по п. 1, в котором композиция, способная к вмещению в камере для композиции, является лекарством или диагностическим средством.

5. Устройство по п. 4, в котором лекарство является оксимом.

6. Устройство по п. 1, в котором диффузор является фриттой.

7. Устройство по п. 4, в котором диагностическое средство является радиофармацевтическим препаратом.

8. Устройство по п. 1, в котором пропеллент является жидкостью под давлением.

9. Устройство по п. 8, в котором жидкость под давлением является гидрофторалканом.

10. Устройство по п. 9, в котором при приведении устройства в действие жидкий гидрофторалкан, находящийся под давлением, высвобождается из контейнера и вступает во взаимодействие с диффузором, при этом жидкий гидрофторалкан, находящийся под давлением, превращается в газообразный гидрофторалкан.

11. Устройство по п. 10, в котором меньшая часть жидкого гидрофторалкана, находящегося под давлением, превращается в газообразный гидрофторалкан.

12. Устройство по п. 10, в котором большая часть жидкого гидрофторалкана, находящегося под давлением, превращается в газообразный гидрофторалкан.

13. Устройство по п. 1, в котором, по меньшей мере, 64,2% композиции доставляется в обонятельную область.

14. Устройство по п. 1, в котором более чем 64,2% композиции доставляется в обонятельную область.

15. Устройство по п. 1, в котором, по меньшей мере, 64,3% композиции доставляется в обонятельную область.

16. Устройство по п. 1, в котором контейнер является шприцом, сиреттой или баллоном.

17. Устройство по п. 1, в котором композиция не является радиофармацевтическим препаратом.

18. Устройство по п. 1, в котором композиция не является ФДГ (фтордезоксиглюкозой).

19. Устройство по п. 4, в котором лекарство является жидкой суспензией, жидкой дисперсией, порошком, липосомами, водным раствором или их сочетанием.

20. Устройство по п. 1, дополнительно содержащее один или более направляющий элемент.

21. Устройство по п. 20, в котором направляющий элемент помогает при позиционировании сопла относительно обонятельной области пользователя.

22. Устройство по п. 1, дополнительно содержащее отверстие для введения, сообщающееся с камерой для композиции.

23. Устройство по п. 20, в котором направляющий элемент является индикатором, чувствительным к глубине введения устройства в назальную полость пользователя.

24. Устройство по п. 1, в котором диффузор является пористым.

25. Устройство по п. 24, в котором диффузор является неоднородно пористым.

26. Устройство по п. 24, в котором диффузор является однородно пористым.

27. Устройство по п. 7, в котором радиофармацевтический препарат является фтордезоксиглюкозой или фтортимидином.

28. Устройство по п. 1, в котором диффузор продолжается в композицию в камере для композиции.

29. Устройство по п. 1, в котором диффузор является дисковидным элементом, содержащим элементы конической формы, имеющие дистальные отверстия.

30. Устройство по п. 1, в котором контейнер является ингалятором с мерными дозами.

31. Способ интраназальной доставки композиции в обонятельную область назальной полости, при этом способ содержит следующие этапы:

обеспечивают устройство, содержащее контейнер, способный вмещать пропеллент,

диффузор, сообщающийся с контейнером,

камеру для композиции, сообщающуюся с диффузором, причем камера для композиции способна вмещать композицию, и

сопло, сообщающееся с камерой для композиции, причем устройство при приведении в действие способно доставлять композицию в обонятельную область назальной полости.

32. Способ по п. 31 для лечения инфекционного заболевания, онкологического или иммунологического заболевания.

33. Способ по п. 31, в котором композиция является оксимом.



 

Похожие патенты:

Изобретение относится к медицине, в частности к фармакологии, может быть использовано для коррекции процессов пероксидации в условиях теплового стресса в эксперименте.

Изобретение относится к области биохимии, в частности к иммуногенной композиции, содержащей антиген и иммуностимулирующий олигонуклеотид, состоящий из нуклеотидной последовательности 5'TCGTCGTTTTTCGGTGCTTTT3', дополнительно содержащей фармацевтически приемлемый носитель.

Настоящее изобретение относится к области биотехнологии и иммунологии. Предложены выделенные полинуклеотиды, кодирующие вариабельные области легкой и тяжелой цепи антитела против человеческого EGFR; анти-EGFR антитело и фрагмент антитела; а также вектор, клетка-хозяин и способ получения анти-EGFR антитела или его фрагмента.

Изобретение относится к медицине, а именно к физиотерапии и физиологии спорта, и может быть использовано для повышения работоспособности человека. Осуществляют влияние на компенсаторно-приспособительные реакции его органов и систем.

Изобретение относится к соединениям, представленным формулами (1), (2) или (3), или их фармацевтически приемлемой соли. Изобретение также относится к фармацевтической композиции, включающей в качестве активного ингредиента соединение, представленное формулами (1), (2) или (3), обладающей ингибирующей активностью в отношении O-GlcNAcase, или его фармацевтически приемлемую соль и фармацевтически приемлемый носитель.

Изобретение относится к медицине, а именно к онкологии. Применяют «Желпластан» для интраоперационной профилактики лимфореи у больных раком шейки матки с тазовой лимфаденэктомией.
Изобретение относится к медицине, а именно к реаниматологии. Выполняют забор гепаринизированной плазмы.
Группа изобретений относится к медицине, а именно к восстановительной и профилактической медицине, физиотерапии, косметологии, и может быть использована для оздоровления и омоложения организма.

Группа изобретений относится к способам лечения недержания кала посредством введения нуждающемуся в этом индивидууму композиций, содержащих оксиметазолин в качестве активного ингредиента.

Изобретение относится к фармацевтической промышленности и представляет собой композицию для поддержания и/или восстановления организма во время и/или после тяжелых физических нагрузок, содержащую L-таурин, L-лейцин, L-изолейцин, L-валин, экстракт листьев зеленого чая, йохимбин гидрохлорид, элеутерококка колючего корневищ и корней экстракт, левзеи сафлоровидной корневищ с корнями экстракт, родиолы розовой корневищ с корнями экстракт, экстракт кожуры горького апельсина, рибофлавина натрия фосфат, холина альфосцерат, пантотенат кальция, пиридоксина гидрохлорид, фолиевую кислоту, цианокобаламин, биотин, никотинамид, L-карнитин, бета-аланин, калия оротат, метилурацил, инозин, кофеин, экстракт листьев, соцветий и корневищ иван-чая, креатина моногидрат, L-тирозин, аскорбиновую кислоту, магний в форме бис-глицината, медь в форме бис-глицината, цинк в форме бис-глицината, L-глутамин, тиамина гидрохлорид, холекальциферол 5000 МЕ, кальция малат, натрия дигидрофосфат, альфа-токоферола ацетат, L-селенметионин, экстракт оливкового листа, экстракт листьев мяты перечной, экстракт листьев мелиссы лекарственной, экстракт корней и корневищ валерианы лекарственной, ретинола пальмитат и воду, причем компоненты в композиции находятся в определенном соотношении в миллиграммах.

Изобретение относится к медицине и направлено на повышение эффективности сепарации аэрозолей, в том числе и нанометрового размера. Фильтр выполнен в виде тампона, корпус которого представляет собой форму усеченного корпуса с круговыми насечками для удержания в носовой полости пользователя.
Настоящее изобретение относится к медицине, а именно к терапии. Выполняют введение лекарственного средства в евстахиеву трубу интраназально или орально для последующего всасывания в цереброспинальную венозную систему.

Группа изобретений относится к медицине, в частности к устройству для доставки сухих порошковых препаративных форм, которое может представлять собой одноразовое устройство, а также к способу применения для предотвращения или борьбы с тошнотой и рвотой и другими заболеваниями и расстройствами и способу производства устройства для доставки указанных форм.

Изобретение относится к медицине, в частности к оториноларингологии и физиотерапии, и касается лечения обострения хронических воспалительных заболеваний пазух носа.

Группа изобретений относится к медицинской технике. Комплект распылителя содержит: корпус кожуха; элемент формирования канала прохождения потока, покрывающий отверстие в корпусе кожуха; трубку подачи наружного воздуха, расположенную вертикально относительно основной поверхности элемента формирования канала прохождения потока, и во внутренней круговой поверхности которой сформирована длинная канавка; трубку подачи сжатого воздуха, обеспечиваемую ниже трубки подачи наружного воздуха внутри корпуса кожуха, проходящую вовнутрь трубки подачи наружного воздуха; и элемент формирования области распыления.

Группа изобретений относится к медицине, а именно к оториноларингологии, и может быть использована при лечении параназальных риносинуситов. Для этого пациент принимает дренажное положение для каждой подлежащей лечению пазухи носа и создает отрицательное давление в полости носа.

Группа изобретений относится к медицине. Небулайзерный набор содержит корпус контейнера, имеющий поверхность стенки с линейным участком.

Изобретение относится к медицинской технике, а именно к выпускным узлам для выпуска лекарственного средства из емкости. Выпускной узел имеет первое выпускное отверстие, насос, входной канал для соединения емкости с насосом и выходной канал для соединения насоса с первым выпускным отверстием.

Изобретение относится к медицинской технике. Система для сообщения потока текучей среды в дыхательные пути субъекта и измерения параметров потока текучей среды содержит назальную канюлю и установленные на ней датчики для генерирования выходных сигналов, передающих информацию о параметрах потока текучей среды между ноздрями субъекта и назальной канюлей.

Изобретение относится к области распределения жидкости, в частности, в форме капель в фармацевтической, например глазной жидкости. Устройство для распределения жидкости содержит резервуар (12) для жидкости, деформируемый для распределения жидкости путем надавливания на него, наконечник (10) для распределения жидкости, установленный на резервуаре (12), канал для прохода жидкости (24, 50), канал для прохода воздуха (26) снаружи внутрь резервуара (12), при этом канал для прохода воздуха (26) перекрыт органом (28), выполненным из воздухопроницаемого полимерного материала, причем этот материал не является пористым, а орган (28) называют воздухопроницаемым органом (28).

Ингалятор // 2527351
Группа изобретений относится к компоненту ингалятора и ингалятору для периодического, синхронного с ингаляцией или вдохом образования паровоздушной смеси или/и конденсационного аэрозоля, включающему в себя корпус; размещенную в корпусе камеру; воздухозаборное отверстие для подведения воздуха из окружающей среды в камеру; электрический нагревательный элемент для испарения порции жидкого материала, причем образующийся пар в камере смешивается с воздухом, поступающим через воздухозаборное отверстие, и образуется паровоздушная смесь или/и конденсационный аэрозоль; и фитиль с капиллярной структурой, который с нагревательным элементом составляет композит, и нагревательный элемент после испарения вновь автоматически снабжается жидким материалом.
Наверх