Способ детектирования и характеризации токсиногенного штамма clostridium difficile



Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile
Способ детектирования и характеризации токсиногенного штамма clostridium difficile

 


Владельцы патента RU 2612789:

КОНИНКЛЕЙКЕ ФИЛИПС ЭЛЕКТРОНИКС Н.В. (NL)

Изобретение относится к биотехнологии. Описан способ детектирования и характеризации токсиногенного штамма Clostridium difficile в пробе, в котором выполняют следующие стадии: a. предоставляют пробу; b. в мультиплексном ПЦР-анализе:

i) эту пробу анализируют в отношении присутствия или отсутствия гена tcdB цитотоксина; ii) эту пробу анализируют в отношении присутствия или отсутствия следующих делеций в гене tcdC: a) делеций 18 п.н. в SEQ ID NO: 1 от нуклеотида 330 до нуклеотида 347; b) делеций 39 п.н. в SEQ ID NO: 1 как представлено в SEQ ID NO: 14; c) делеций единственного нуклеотида в положении 117 SEQ ID NO: 1. При этом мультиплексная ПЦР-амплификация является количественной ПЦР реального времени, где пробу дополнительно анализируют в отношении присутствия или отсутствия делеций 1,8 т.п.н. гена tcdA энтеротоксина, где пробу дополнительно анализируют в отношении присутствия или отсутствия cdtA и/или cdtB бинарного токсина, и, где a. если присутствует последовательность гена tcdB, отсутствует делеция tcdA, не присутствует ни делеция единственного нуклеотида в положении 117 SEQ ID NO: 1, ни делеция 18 п.н., ни делеция 39 п.н., то эта проба оценивается как токсиногенный штамм Clostridium difficile, b. если присутствует последовательность гена tcdB, отсутствует делеция tcdA, присутствует делеция единственного нуклеотида в положении 117 SEQ ID NO: 1, присутствует делеция 18 п.н. и присутствует ген бинарного токсина cdtA/B, то эта проба оценивается как штамм риботипа 027 Clostridium difficile, c. если присутствует последовательность гена tcdB, присутствует делеция tcdA, не присутствует ни делеция единственного нуклеотида в положении 117 SEQ ID NO: 1, ни делеция 18 п.н., ни делеция 39 п.н. в SEQ ID NO: 1 как представлено в SEQ ID NO: 14, и отсутствует ген cdtA/B бинарного токсина, то эта проба оценивается как штамм риботипа 017 Clostridium difficile, и d. если присутствует последовательность гена tcdB, отсутствует делеция tcdA, присутствует делеция 39 п.н. в SEQ ID NO: 1 как представлено в SEQ ID NO: 14, присутствует ген cdtA/B бинарного токсина, то эта проба оценивается как штамм риботипа 078 Clostridium difficile. Изобретение расширяет арсенал способов диагностики. 3 н. и 9 з.п. ф-лы, 2 ил., 1 табл.

 

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

Данное изобретение относится к области биологии и химии. В частности, это изобретение относится к области молекулярной биологии. Более конкретно, это изобретение относится к области детектирования нуклеиновых кислот и ПЦР реального времени. Особенно предпочтительно это изобретение относится к детектированию и характеризации токсиногенного штамма Clostridium difficile.

УРОВЕНЬ ТЕХНИКИ

Clostridium difficile является видом грамположительных бактерий рода Clostridium. Clostridium являются анаэробными, спорообразующими палочками (бациллами). C. difficile является наиболее серьезной причиной антибиотик-ассоциированной диареи (AAD) и может приводить к псевдомембранному колиту, тяжелой инфекции ободочной кишки, часто происходящему из уничтожения нормальной флоры кишечника антибиотиками. Бактерии C. difficile, которые природно находятся в организме, становятся избыточными: этот избыточный рост является вредным, так как эта бактерия высвобождает токсины, которые могут вызывать метеоризм, запор и диарею с болью в животе, которые могут становиться тяжелыми. Потенциальные симптомы часто имитируют некоторые подобные гриппу симптомы. Прекращение лечения антибиотиками, вызывающими болезнь, часто является полезным.

Инфекции C. difficile могут находиться в диапазоне степени тяжести от бессимптомной до тяжелой, особенно среди лиц пожилого возраста. Люди наиболее часто инфицируются в больницах, домах престарелых или инвалидов или учреждениях, хотя увеличивается инфицирование C. difficile в условиях общественных больниц, поликлиник. Степень приобретения C. difficile может быть оценена как 13% в пациентах, находящихся в больницах до 2 недель, и 50% в пациентах, находящихся в больницах более 4 недель. Частота и тяжесть вызываемого C. difficile колита остается высокой и, по-видимому, ассоциирована с увеличенными коэффициентами смертности. Раннее вмешательство и интенсивное лечение являются ключевыми факторами для выздоровления.

В 2005 г. сообщалось о появлении нового высокотоксичного штамма C. difficile, устойчивого к фторхинолоновым антибиотикам, таким как Ципро (ципрофлоксацин) и Левахин (левофлоксацин), являющегося, как считается, причиной, вызывающей географически распространенные появления эпидемии в Северной Америке (Dial S, Delaney J, Barkun A, Suissa S (2005). "Use of gastric acid-suppressive agents and the risk of community-acquired Clostridium difficile-associated disease". JAMA 294 (23): 2989-95, doi:10.100l/jama.294.23.2989).

4 июня 2003 г. сообщалось о двух вспышках от высоковирулентного штамма этой бактерии в Монреале, Квебеке и Калгари, Альберте, в Канаде. Источники информации сообщали об уровнях смертности как о низких, как 36, так и о высоких, как 89, с приблизительно 1400 случаями в 2003 г. и в первые несколько месяцев в конце 2004 г. По данным на март 2005 г. эпидемия распространилась в области Торонто, Онтарио, где были госпитализированы 10 человек.

Подобная вспышка имела место в больнице Stoke Mandeville Hospital в Соединенном Королевстве Великобритании и Северной Ирландии между 2003 и 2005 гг.

Было высказано предположение, что как канадские, так и английские эпидемии были связаны, по-видимому, с более вирулентным штаммом NAP1/BI/027 этой бактерии. Этот штамм, также известный как Квебекский штамм, участвовал также в эпидемиях в двух голландских больницах (Гардервийк и Амерсфоорт, в обеих в 2005 г.). Теория для объяснения этой увеличенной вирулентности штамма 027 заключается в том, что этот штамм является гиперпродуцентом как токсина А, так и токсина В и что некоторые антибиотики могут действительно стимулировать эти бактерии к их гиперпродуцированию.

При анализе группы пациентов с этими спорами, многие из них, у которых отсутствовала симптоматика, будут передавать этот организм индивидуумам, которые имеют ослабленный иммунитет и, следовательно, будут восприимчивы к увеличению интенсивности диареи и плохому исходу. Примечательно, что вышеописанные группы ставят перед эпидемиологами задачу попытки выяснения, каким образом эта болезнь распространяется, посредством объединения информационной технологии с клиническим обследованием.

1 октября 2006 г. сообщалось, что по меньшей мере 49 человек умерли в больницах в Лейчестере в Англии на протяжении восьми месяцев, согласно исследованию Государственного совета по здравоохранению.

27 октября 2006 г. 9 смертей были приписаны этой бактерии в Квебеке в Канаде.

27 февраля 2007 г. новая эпидемия была идентифицирована в Trillium Health Centre в Mississauga, Ontario, где 14 человек были диагностированы как имеющие эту бактерию. Эти бактерии были бактериями того же самого штамма, что и бактерии штамма в Квебеке. Официальные представители не смогли определить, является ли C. difficile ответственным за смерти четырех пациентов на протяжении двух предыдущих месяцев.

В октябре 2007 г. Национальный центр по здравоохранению Мейдстоуна и Танбриджа в Уэльсе был подвергнут серьезной критике Комиссии по здравоохранению в отношении его действий в большой эпидемии C. difficile в больницах в Кенте с апреля 2004 г. до сентября 2006 г. В ее отчете эта Комиссия оценивает, что приблизительно 90 пациентов "определенно или вероятно" умерли в результате этой инфекции (Сообщение для печати Комиссии здравоохранения: “Сторожевой пес” здравоохранения находит существенные недостатки в борьбе с инфекцией Национального центра в Мейдстоуне и Танбридже Уэльса, 11 октября 2007 г. и Daily Telegraph: Министр здравоохранения участвует в расследовании большого скандала, 11 октября 2007 г).

Таким образом, существует потребность в способе детектирования и характеризации токсиногенного штамма Clostridium difficile в пробе.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Авторы этого изобретения нашли новаторский способ детектирования и характеризации токсиногенного штамма Clostridium difficile в пробе. Преимуществом является то, что многочисленные диагностические вопросы могут быть решены в одном единственном способе. Этот способ теперь позволяет определять пробу как содержащую гипервирулентный штамм Clostridium difficile. Кроме того, он позволяет оценивать пробу как штамм, не являющийся штаммом NAP1/BI/02 7. Эта проба может быть также оценена как штамм NAP1/BI/027. Она может быть оценена также как штамм риботипа 078 или оценена как штамм 017. Таким образом, в единственном анализе могут быть выполнены все эти определения.

Это изобретение относится к способу детектирования и характеризации токсиногенного штамма Clostridium difficile в пробе, в котором выполняют следующие стадии: (а) предоставляют пробу, (b) в мультиплексном ПЦР-анализе (с) эту пробу анализируют в отношении присутствия или отсутствия гена tcdB цитотоксина, (d) эту пробу анализируют в отношении присутствия или отсутствия одной или нескольких из следующих делеций в гене tcdC: (а) делеций 18 п.н. в SEQ ID NO: 1 от нуклеотида 330 до нуклеотида 347, (b) делеций 36 п.н. в SEQ ID NO: 1 от нуклеотида 301 до нуклеотида 336, (с) делеций 39 п.н. в SEQ ID NO: 1 от нуклеотида 340 до нуклеотида 378, (d) делеций 54 п.н. в SEQ ID NO: 1 от нуклеотида 313 до нуклеотида 366 и (е) делеций единственного нуклеотида в положении 117 SEQ ID NO: 1.

Это изобретение относится также к набору для выполнения способов этого изобретения, содержащему праймеры или зонды для амплификации и/или детектирования (i) гена tcdB цитотоксина, (ii) делеций 1,8 т.п.н. в гене tcdA, (iii) делеций 18 п.н. в SEQ ID NO: 1 от нуклеотида 330 до нуклеотида 347 гена tcdC, (iv) делеций 39 п.н. в SEQ ID NO: 1 от нуклеотида 340 до нуклеотида 378 гена tcdC, (v) делеций единственного нуклеотида в положении 117 SEQ ID NO: 1 и праймеры и/или зонды для (vi) детектирования гена cdtA/B бинарного токсина.

"Полимеразная цепная реакция" или "ПЦР" обозначает реакцию для амплификации in vitro специфических ДНК-последовательностей одновременным удлинением комплементарных цепей ДНК. Другими словами, ПЦР является реакцией для получения множественных копий или репликонов нуклеиновой кислоты-мишени, фланкированной сайтами связывания праймеров, причем такая реакция предусматривает одно или несколько повторений следующих стадий: (i) денатурации нуклеиновой кислоты-мишени, (ii) отжига праймеров с сайтами связывания праймеров и (iii) удлинения этих праймеров полимеразой нуклеиновых кислот в присутствии нуклеозидтрифосфатов. Обычно эта реакция является цикличной, использующей различные температуры, оптимизированные для каждой стадии, в приборе термоциклере. Конкретные температуры, продолжительности в каждой стадии и скорости изменения между стадиями зависят от многих факторов, хорошо известных квалифицированным в данной области специалистам, например, приведенных в качестве примеров в ссылках: McPherson et al, editors, PCR: A Practical Approach and PCR2: A Practical Approach (IRL Press, Oxford, 1991 и 1995, соответственно). Например, в обычной ПЦР, использующей ДНК-полимеразу Taq, двухцепочечная нуклеиновая кислота-мишень может быть денатурирована при температуре >90°C, праймеры могут отжигаться при температуре в диапазоне 50-75°C и праймеры могут удлиняться при температуре в диапазоне 72-78°C.

Термин "ПЦР" включает в себя производные формы этой реакции, в том числе, но не ограничивающиеся ими, ПЦР реального времени, ПЦР с вмонтированными праймерами, количественные ПЦР, мультиплексные ПЦР и т.п.

Объемы реакции находятся в диапазоне от нескольких сотен нанолитров, например, 200 нл, до нескольких сотен микролитров. Здесь предпочтительные объемы равны 10-50 микролитрам, более предпочтительно приблизительно 25 микролитрам на одну реакционную камеру.

"ПЦР реального времени" обозначает ПЦР, для которой количество продукта реакции, т.е. ампликона, подвергают мониторингу при протекании этой реакции. Имеются многие формы ПЦР реального времени, которые различаются в основном в химических способах детектирования, используемых для мониторинга продукта реакции, например, Gelfand et al, патент США 5210015 ("taqman"); Wittwer et al, патенты США 6174670 и 6569627 (интеркалирующие красители); Tyagi et al, патент США 5925517 (молекулярные метки). Химические способы детектирования для ПЦР реального времени рассматриваются в Mackay et al, Nucleic Acids Research, 30: 1292-1305 (2002). В ПЦР реального времени может быть также использована реакция с двумя температурными стадиями, в которой температура полимеризации равна температуре отжига, даже для типичных гибридизационных зондов, таких как праймеры Scorpion или зонды Pleiades.

"Мультиплексная ПЦР" обозначает ПЦР, в которой множественные последовательности-мишени (или единственная последовательность-мишень и одна или несколько ссылочных последовательностей), одновременно, находятся в одной и той же реакционной смеси, например, Bernard et al, Anal. Biochem., 273: 221-228 (1999) (двухцветная ПЦР реального времени). Обычно используют различные наборы праймеров для каждой амплифицируемой последовательности. Обычно количество последовательностей-мишеней в мультиплексной ПЦР находится в диапазоне от 2 до 10, или от 2 до 8, или более обычно от 3 до 6. Для данного изобретения предпочтительным количеством является количество 2-6.

"Количественная ПЦР" обозначает ПЦР, предназначенную для измерения содержания одной или нескольких конкретных последовательностей-мишеней в пробе или образце. Количественная ПЦР включает в себя определение как абсолютного, так и относительного количества таких последовательностей-мишеней. Количественные измерения выполняют с использованием одной или нескольких ссылочных последовательностей, которые могут анализироваться отдельно или вместе с последовательностью-мишенью. Ссылочная последовательность может быть эндогенной или экзогенной относительно пробы или образца, и, в последнем случае, может содержать одну или несколько конкурирующих матриц. Типичные эндогенные ссылочные последовательности включают в себя сегменты транскриптов следующих генов: пактина, GAPDH, микроглобулина, рибосомной РНК и т.п. Способы количественной ПЦР хорошо известны специалистам с обычной квалификацией в данной области, как иллюстрируется в следующих ссылках: ‘Freeman et al, Biotechniques, 26: 112-126 15 (1999); Becker-Andre et al, Nucleic Acids Research, 17: 9437-9447 (1989); Zimmerman et al, Biotechniques, 21: 268-279 (1996); Diviacco et al, Gene, 122: 3013-3020 (1992); BeckerAndre et al, Nucleic Acids Research, 17: 9437-9446 (1989) и т.п.

"Праймер" обозначает олигонуклеотид либо природный, либо синтетический, который способен при образовании дуплекса с полинуклеотидной матрицей действовать в качестве сайта инициации синтеза нуклеиновой кислоты и удлиняться от его 3’-конца вдоль этой матрицы таким образом, что образуется удлиненный дуплекс. Удлинение праймера обычно проводят с использованием полимеразы нуклеиновой кислоты, такой как ДНК- или РНК-полимераза. Последовательность нуклеотидов, добавляемых в процессе удлинения, определяется последовательностью полинуклеотида-матрицы. Обычно праймеры удлиняются ДНК-полимеразой. Праймеры обычно имеют длину в диапазоне от 14 до 40 нуклеотидов или в диапазоне от 18 до 36 нуклеотидов. Праймеры используются в разнообразных реакциях амплификации нуклеиновых кислот, например, реакциях линейной амплификации, использующих единственный праймер, или полимеразных цепных реакциях, использующих два или несколько праймеров. Руководство для выбора длин и последовательностей праймеров для конкретных применений хорошо известно специалистам с обычной квалификацией в данной области, как доказывается следующими ссылками: Dieffenbach, editor, PCR Primer: A Laboratory Manual, 2nd Edition (Cold Spring Harbor Press, New York, 2003).

"Проба” обозначает количество материала из биологического источника, источника окружающей среды, медицинского источника или источника пациента, в котором необходимо детектирование или измерение нуклеиновых кислот-мишеней. С одной стороны, предполагается, что этот термин включает в себя образец или культуру (например, микробиологические культуры). С другой стороны, предполагается, что этот термин включает в себя как биологические, так и происходящие из окружающей среды пробы. Проба может включать в себя образец синтетического происхождения. Биологической пробой может быть проба животного, в том числе человека, в виде жидкости, твердого вещества (например, стула) или ткани, а также проба жидких или твердых пищевых или кормовых продуктов и ингредиентов, таких как молочные продукты, овощи, мясо и мясные побочные продукты и отходы. Биологические пробы могут включать в себя материалы, взятые из пациента, включающие в себя, но не ограничивающиеся ими, культуры, кровь, слюну, цереброспинальную жидкость, плевральную жидкость, сперму, пункционные аспираты и т.п. Биологические пробы могут быть получены из всех из различных семейств домашних животных, а также неприрученных или диких животных, включающих в себя, но не ограничивающихся ими, таких животных, как копытные, медведь, рыба, грызуны и т.д. Пробы окружающей среды включают в себя материал окружающей среды, такой как материал поверхности, почва, вода и промышленные пробы, а также пробы, полученные из инструментов переработки кормовых и молочных продуктов, устройства, оборудования, кухонной посуды, одноразовых и неодноразовых материалов. Эти примеры не должны рассматриваться как ограничивающие типы проб, применимые к данному изобретению. Термины "проба" и "образец" используются взаимозаменяемо.

Предпочтительные продукты амплификации представлены в следующей таблице:

C. difficile
SEQ ID NO Название мишени Длина мишени (п.н.) Последовательность мишени
2 tcdB (ампликон 1) 120
3 tcdB (ампликон 2) 140
4 tcdC_nt117 140

5 делеции tcdC 18 п.н., 36 п.н. и 54 п.н. 200; один и тот же район мишени для всех
6 бинарный токсин 200
7 делеция (делеции) tcdA 540


8 ампликон tcdC 18 п.н. 145
9 ампликон tcdC 36 п.н. 138

10 ампликон tcdC 39 п.н. 95
11 ампликон tcdC 54 п.н. 110
1 полноразмерная последовательность tcdC дикого типа (район штамма 630 REGION ACCESSION AM180355: 804310..805008) 699


12 полноразмерная последовательность tcdC риботипа 027 (включающая в себя нуклеотид 117 и делецию 18 п.н.)
(ACCESSION DQ861412)
680


13 полноразмерная последовательность tcdC варианта с делецией 36 п.н.
(ACCESSION DQ861424)
663

14 полноразмерная последовательность tcdC варианта с делецией 39 п.н.
(ACCESSION EF470292)
660

15 полноразмерная последовательность tcdC варианта с делецией 54 п.н. (отсутствует в публичной базе данных) 645

2 SEQ ID NO: 2 является предпочтительным ампликоном tcdB.
3 SEQ ID NO: 3 является дополнительным предпочтительным репликоном tcdB.
4 SEQ ID NO: 4 описывает делецию нуклеотида 117 tcdC
5 SEQ ID NO: 5 описывает делеции tcdC 18 п.н., 36 п.н., 39 п.н. и 54 п.н.
6 SEQ ID NO: 6 описывает бинарный токсин.
7 SEQ ID NO: 7 описывает делецию (делеции) tcdA.
8 SEQ ID NO: 8 является предпочтительным ампликоном tcdA 18 п.н.
9 SEQ ID NO: 9 является предпочтительным ампликоном tcdC 36 п.н.
10 SEQ ID NO: 10 является предпочтительным ампликоном tcdC 39 п.н.
11 SEQ ID NO: 10 является предпочтительным ампликоном tcdC 54 п.н.
1 SEQ ID NO: 1 является полноразмерной последовательностью tcdC дикого типа (штамм 630 REGION ACCESSION AM180355: 804310..805008)
12 SEQ ID NO: 12 является полноразмерной последовательностью tcdC риботипа 027 (она включает в себя делецию нуклеотида 117 и делецию 18 п.н.) ACCESSION DQ861412
13 SEQ ID NO: 13 является полноразмерной последовательностью варианта tcdC с делецией 36 п.н. (ACCESSION DQ861424)
14 SEQ ID NO: 14 является полноразмерной последовательностью варианта tcdC с делецией 39 п.н. (ACCESSION EF470292)
15 SEQ ID NO: 15 является полноразмерной последовательностью варианта tcdC с делецией 54 п.н.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

Фиг.1 показывает предпочтительные мишени в соответствии с данным изобретением.

Фиг. 2 показывает возможную установку картриджа в соответствии с данным изобретением.

ПОДРОБНОЕ ОПИСАНИЕ ВАРИАНТОВ ОСУЩЕСТВЛЕНИЯ

Это изобретение относится к способу детектирования и характеризации токсиногенного штамма Clostridium difficile в пробе, в котором выполняют следующие стадии: (а) предоставляют пробу, (b) в мультиплексном ПЦР-анализе (с) эту пробу анализируют в отношении присутствия или отсутствия гена tcdB цитотоксина, (d) эту пробу анализируют в отношении присутствия или отсутствия одной или нескольких из следующих делеций в этом гене tcdC: (а) делеций 18 п.н. в SEQ ID NO: 1 от нуклеотида 330 до нуклеотида 347, (b) делеций 36 п.н. в SEQ ID NO: 1 от нуклеотида 301 до нуклеотида 336, (с) делеций 39 п.н. в SEQ ID NO: 1 от нуклеотида 340 до нуклеотида 378, (d) делеций 54 п.н. в SEQ ID NO: 1 от нуклеотида 313 до нуклеотида 366 и (е) делеций единственного нуклеотида в положении 117 SEQ ID NO: 1.

Необязательно, эту пробу дополнительно анализируют в отношении присутствия или отсутствия делеций 1,8 т.п.н. гена tcdA энтеротоксина.

Предпочтительно, эту пробу дополнительно анализируют в отношении присутствия или отсутствия cdtA и/или cdtB бинарного токсина.

В одном варианте способа по этому изобретению эту пробу анализируют на (i) присутствие или отсутствие всех из следующих делеций: (а) делеций 18 п.н. в SEQ ID NO: 1 от нуклеотида 330 до нуклеотида 347, (b) делеций 39 п.н. в SEQ ID NO: 1 от нуклеотида 340 до нуклеотида 378 и (с) делеций единственного нуклеотида в положении 117 SEQ ID NO: 1, (ii) эту пробу анализируют в отношении присутствия или отсутствия гена tcdB цитотоксина, (iii) эту пробу анализируют в отношении присутствия или отсутствия делеций 1,8 т.п.н. tcdA и (iv) эту пробу анализируют в отношении присутствия или отсутствия гена cdtA/B бинарного токсина.

Предпочтительно в способе по этому изобретению, (а) если присутствует последовательность гена tcdB, отсутствует делеция tcdA, не присутствует ни делеция единственного нуклеотида в положении 117 SEQ ID NO: 1, ни делеция 18 п.н., ни делеция 39 п.н., то эту пробу оценивают как токсиногенный Clostridium difficile, (b) если присутствует последовательность гена tcdB, отсутствует делеция tcdA, присутствует делеция единственного нуклеотида в положении 117, присутствует делеция 18 п.н., присутствует ген cdtA/B бинарного токсина, то эту пробу оценивают как штамм риботипа 027 Clostridium difficile, (с) если присутствует последовательность гена tcdB, присутствует делеция tcdA, не присутствует ни делеция единственного нуклеотида в положении 117 SEQ ID NO: 1, ни делеция 18 п.н., ни делеция 39 п.н. в SEQ ID NO: 1 от нуклеотида 340 до нуклеотида 378, отсутствует ген cdtA/B бинарного токсина, то эту пробу оценивают как штамм риботипа 017 Clostridium difficile, и (d) если присутствует последовательность гена tcdB, отсутствует делеция tcdA, присутствует делеция 39 п.н. в SEQ ID NO: 1 от нуклеотида 340 до нуклеотида 378, присутствует ген cdtA/B бинарного токсина, то эту пробу оценивают как штамм риботипа 078Clostridium difficile.

Необязательно и дополнительно могут быть анализированы следующие мишени. Они являются мишенями, ассоциированными с гипервирулентностью, такие как, но не ограничивающиеся ими, tcdCΔ36bp, tcdCΔ54bp. Штаммы, несущие делеции 36 п.н., 39 п.н. или 54 п.н., все, имеют дополнительные специфические мутации выше по ходу транскрипции в гене tcdC, которые приводят к укороченному и нефункциональному белку TcdC, который предпочтительно является частью этого анализа.

Специфические вариации в 3’-части гена tcdB сообщались в отношении штаммов non-NAP1/BI/027, которые предпочтительно находятся в этом анализе.

Предпочтительно продукты амплификации мультиплексного ПЦР-анализа имеют размер между 60 и 200 п.н.

В одном варианте осуществления реакцию мультиплексной амплификации выполняют в замкнутой системе в присутствии флуоресцентных индикаторов в реакционной смеси (реакционных смесях), причем эти флуоресцентные индикаторы способны генерировать оптический сигнал, связанный с присутствием и/или количеством каждого ампликона в этой реакции амплификации, и позволяют осуществлять мониторинг этого оптического сигнала флуоресцентных индикаторов в реакции амплификации.

В способе по этому изобретению эта замкнутая система дает оптические выходные данные для пользователя, указывающие оценивание, описанное в общих чертах выше.

Мультиплексная ПЦР-амплификация является количественной ПЦР-реакцией реального времени. Эта ПЦР реального времени (также обозначаемая здесь как количественная ПЦР и/или количественная ПЦР реального времени (кПЦР)) является способом одновременной амплификации и количественного определения нуклеиновых кислот с использованием полимеразной цепной реакции (ПЦР). Количественная ПЦР реального времени с обратной транскрипцией (ОТ-кПЦР) является количественным ПЦР-способом реального времени, предусматривающим дополнительно обратную транскрипцию РНК в ДНК, например, мРНК в кДНК. В кПЦР-способах амплифицированную нуклеиновую кислоту определяют количественно по мере ее накапливания. Обычно используют флуоресцентные красители, которые интеркалируются двухцепочечной ДНК (например, этидийбромид или SYBR® Green I), или модифицированные зонды нуклеиновых кислот ("репортерные зонды"), которые флуоресцируют при гибридизации с комплементарной нуклеиновой кислотой (например, накапливающейся ДНК), для количественного определения в способах на основе кПЦР. В частности, в качестве репортерных зондов могут быть использованы флуорогенные праймеры, гибридизационные зонды (например, зонды LightCycler (Roche)), гидролизные зонды (например, зонды TaqMan (Roche)) или шпилечные зонды, такие как молекулярные метки, праймеры Scorpion (DxS), праймеры Sunrise (Oncor), праймеры LUX (Invitrogen), праймеры Amplifluor (Intergen) или т.п. Согласно данному изобретению, флуорогенные праймеры или зонды могут быть, например, праймерами или зондами, к которым могут быть присоединены, например ковалентно присоединены, флуоресцентные красители. Такими флуоресцентными красителями могут быть, например, FAM (5- или 6-карбоксифлуоросцеин), VIC, NED, Флуоросцеин, FITC, IRD-700/800, CY3, CY5, CY3.5, CY5.5, HEX, TET, TAMRA, JOE, ROX, BODIPY TMR, Oregon Green, Rhodamine Green, Rhodamine Red, Texas Red, Yakima Yellow, Alexa Fluor, PET Biosearch Blue™, Marina Blue®, Bothell Blue®, CAL Fluor® Gold, CAL Fluor® Red 610, Quasar™ 670, LightCycler Red640®, Quasar™ 705, LightCycler Red705® и т.п. Конкретные репортерные зонды могут дополнительно содержать гасители флуоресценции.

Для вариантов данного изобретения в количественной мультиплексной ПЦР реального времени могут быть использованы селективные праймеры.

Термин "праймер" обозначает здесь олигонуклеотид, содержащий последовательность, которая комплементарна транскрибируемой нуклеиновой кислоте ("матрице"). Во время репликации полимеразы присоединяют нуклеотиды, комплементарные соответствующим нуклеотидам этой матрицы, к 3’-концу праймера.

В конкретных вариантах осуществления этого изобретения полимеразой, используемой для количественной ПЦР реального времени, является полимераза из термофильного организма, или термостабильная полимераза, или полимераза, выбранная из группы, состоящей из ДНК-полимеразы Thermus thermophilus (Tth), ДНК-полимеразы Thermus acquaticus (Taq), ДНК-полимеразы Thermotoga maritima (Tma), ДНК-полимеразы Thermococcus litoralis (Tli), ДНК-полимеразы Pyrococcus furiosus (Pfu), ДНК-полимеразы Pyrococcus woesei (Pwo), ДНК-полимеразы Pyrococcus kodakaraensis (KOD), ДНК-полимеразы Thermus filiformis (Tfi), ДНК-полимеразы Sulfolobus solfataricus (Dpo4), ДНК-полимеразы Thermus pacificus (Tpac), ДНК-полимеразы Thermus eggertssonii (Teg), ДНК-полимеразы Thermus brockianus (Tbr) и ДНК-полимеразы Thermus flavus (Tfl).

В частности, эти флуоресцентно меченные зонды метят красителем, выбранным из группы, состоящей из FAM, VIC, NED, Флуоросцеина, FITC, IRD-700/800, CY3, CY5, CY3.5, CY5.5, HEX, ТЕТ, TAMRA, JOE, ROX, BODIPY TMR, Oregon Green, Rhodamine Green, Rhodamine Red, Texas Red, Yakima Yellow, Alexa Fluor и PET.

В частности, гибридизационным зондом является зонд LightCycler (Roche) или гидролизным зондом является зонд TaqMan (Roche). В других вариантах осуществления шпилечный зонд выбран из группы, состоящей из молекулярной метки, праймера Scorpion, праймера Sunrise, праймера LUX и праймера Amplifluor. Предпочтительными являются зонды TaqMan.

Это изобретение относится к картриджу замкнутой системы амплификации, содержащему один или несколько каналов или камер, содержащих праймеры и/или зонды, для амплификации и/или детектирования (i) гена tcdB цитотоксина, (ii) делеций 1,8 т.п.н. в гене tcdA, (iii) делеций 18 п.н. в SEQ ID NO: 1 от нуклеотида 330 до нуклеотида 347 гена tcdC, (iv) делеций 39 п.н. в SEQ ID NO: 1 от нуклеотида 340 до нуклеотида 378 гена tcdC, (v) делеций единственного нуклеотида в положении 117 SEQ ID NO: 1 и праймеры и/или зонды для детектирования гена cdtA/B бинарного токсина.

Это изобретение относится также к набору для выполнения способов этого изобретения, содержащему праймеры или зонды для амплификации и/или детектирования (i) гена tcdB цитотоксина, (ii) делеций 1,8 т.п.н. в гене tcdA gene, (iii) делеций 18 п.н. в SEQ ID NO: 1 от нуклеотида 330 до нуклеотида 347 гена tcdC, (iv) делеций 39 п.н. в SEQ ID NO: 1 от нуклеотида 340 до нуклеотида 37 8 гена tcdC, (v) делеций единственного нуклеотида в положении 117 SEQ ID NO: 1 и праймеры и/или зонды для (vi) детектирования гена cdtA/B бинарного токсина.

В предпочтительных вариантах осуществления этот набор дополнительно содержит ферменты, такие как полимераза, буфер и другие ингредиенты.

В одном варианте осуществления этот способ может выполняться в картридже, который предназначен для выполнения приготовления пробы и мультиплексной ПЦР реального времени. Имеются системы, способы и устройство для замкнутых мультистадийных реакций амплификации нуклеиновых кислот, в которых часть реакционной смеси предшествующей стадии служит в качестве пробы для реакции последующей стадии. Это изобретение обеспечивает способ, описанный в общих чертах выше, для контроля амплификации, предусматривающий стадии: (i) амплификации указанной мультиплексной реакции в присутствии флуоресцентного индикатора в реакционной смеси, причем этот флуоресцентный индикатор способен генерировать оптический сигнал для количественного определения ампликона в этой реакции амплификации; (ii) мониторинга этого оптического сигнала этого флуоресцентного индикатора в этой реакции амплификации.

Это изобретение относится также к картриджу замкнутой системы амплификации, содержащему один или несколько каналов или камер, содержащих праймеры и/или зонды, для амплификации и/или детектирования (i) гена tcdB цитотоксина, (ii) гена tcdC, (iii) делеций 18 п.н. в SEQ ID NO: 1 от нуклеотида 330 до нуклеотида 347, (iv) делеций 36 п.н. в SEQ ID NO: 1 от нуклеотида 301 до нуклеотида 336, (v) делеций 39 п.н. в SEQ ID NO: 1 от нуклеотида 340 до нуклеотида 378, (vi) делеций 54 п.н. в SEQ ID NO: 1 от нуклеотида 313 до нуклеотида 366, (vii) делеций единственного нуклеотида в положении 117 SEQ ID NO: 1. Такая замкнутая система описана, например, в WО 2006/047777. Этот картридж может дополнительно содержать одну или несколько камер для приготовления проб, например, лизиса клеток и/или экстракции нуклеиновых кислот. Предпочтительно, эти ПЦР-камеры включают в себя оптически прозрачную поверхность, такую как стеклянная, хрустальная или пластиковая поверхность, которая позволяет выполнять взаимосвязанное детектирование продукта амплификации.

После выделения этой ДНК в картридже ее повторно солюбилизируют в основной смеси, которая хранится в лиофилизированной форме внутри картриджа. Затем имеет место гомогенизация элюата в основном растворе. Наполнение по меньшей мере 3-5 ПЦР-камер (или их подмножества, если это требуется для данного применения) таким образом, что воздух не проникает в эти камеры, выполняется в картридже. Амплификация может требовать менее 5 камер, в этом случае используют соответствующий вариант картриджа. Требуемый объем элюции может быть адаптирован посредством протокола анализа. Выполняется закрытие этих камер во время амплификации, так чтобы ампликоны не могли выйти в окружающую среду, и воздух не мог проникнуть в эти камеры. Выполняется температурная циклизация камер. Эта циклизация является синхронизированной между всеми камерами, с индивидуальными заданными значениями температуры. Затем выполняется детектирование флуоресценции в 6 длинах волн. Детектирование может запускаться в любой момент в этом цикле. Расчет Ct-величин, исходных концентраций и конечных результатов теста выполняется на основании данных измерений и, возможно, дополнительных калибровочных данных. Результат теста генерируют на основании этих Ct-величин для мишеней этого изобретения.

Этот картридж выполняет ПЦР в устройстве. Контейнер с образцом или также описанный здесь картридж входит в систему управления, и пользователь регистрирует интерпретирующую программу (например, штриховой код, бумажную форму заказа и т.д.), ассоциированную с этим заказом. Система управления извлекает ассоциированный заказ из локальной консольной базы данных. Затем пользователь сканирует тег RFID этого картриджа. Этот картридж проверяют на его адекватность (например, насколько тип картриджа соответствует типу теста, срок окончания действия и т.д.). В случае допустимости применения картриджа, его присоединяют к заказу в базе данных системы управления. Главный сервис системы управления запрашивает доступный слот (паз) прибора. Подсистема управления прибора возвращает доступный слот (паз) после применения к нему балансирования нагрузки. После уведомления пользователя о вставлении этого картриджа пользователь вставляет картридж в предполагаемый слот. Подсистема управления прибора уведомляется о том, что картридж вставлен, и главная служба системы управления проверяет, связан ли этот картридж с данным заказом. В том случае, если картридж связан с этим заказом, принимающая база данных доступна для поиска запрошенных данных, соответствующих тест-типу в данном заказе. После приема этого подтверждения подсистема управления прибора дает команду о загрузке запрошенных данных и начинает испытание (тест) для слота, в который вставлен картридж. После завершения этого теста результат испытания получают с использованием подсистемы управления прибора и будут выполняться следующие стадии.

Этот результат испытания будет передаваться в сервер результата измерения. Этот сервер результата измерения будет хранить этот результат в базе данных системы управления. Затем этот результат будет отсылаться во внешнюю систему информации IS через подсистему информационного обмена внешней IS, и пользователь будет информирован, что это испытание завершено. Пользователь получает оптический и/или акустический результат, касающийся этого оценивания.

Как изображено на фиг.2, картридж разделен на 6 модулей. Эти модули объясняются детально в следующих абзацах. Модуль внутри картриджа определяется по его функциональности. Вся функциональная часть этого картриджа сгруппирована тесно, как только возможно, и осуществляется с минимальным количеством частей. Общая последовательность операций процесса является следующей: оператор заполняет пробой камеру лизиса вручную и закрывает крышку введения пробы. Этот картридж помещают на лоток слота и при помощи этого лотка загружают в этот слот. После загрузки в слот этот процесс начинается разжижением и лизисом пробы. Все это осуществляется при помощи, например, энергии HiFU в камере лизиса. К пробе добавляют различные реагенты один за другим таким образом, что конечный результат может быть промыт через мембрану для экстракции. Все эти стадии выполняются в одной камере для возможности манипулирования также пробами с высокой вязкостью, такими как стул (фекалии). Для всех этих процессов требуется только одна поверхность раздела и один источник HiFU. Транспорт реагентов в эту камеру выполняют при помощи модуля транспорта жидкости. В этом модуле реагенты хранятся в течение срока хранения, вынимаются из резервуаров и транспортируются в камеру лизиса. Этот модуль транспортирует также обработанную пробу из камеры лизиса через мембрану для экстракции в отходы. Таким же образом манипулируют промыванием модуля лизиса, модулем транспорта жидкости, модулем экстракции, ПЦР-модулем, мануальным введением пробы, закрыванием реагентов, взятых из резервуара и транспортируемых через мембрану в отходы. Посредством централизации активизации жидкости и манипулирования жидкостью минимизируются количество поверхностей раздела и количество компонентов в картридже для этой вспомогательной функции. Ранее упомянутая мембрана для экстракции реализована внутри модуля экстракции. Этот модуль гарантирует хороший поток через мембрану и хороший перенос тепла к этой мембране. Это тепло требуется для удаления этанола и элюции ДНК. Модуль манипулирования отходами используется для направления всех жидкостей, за исключением элюата, в отходы, и это выполняется таким же типом клапана, какой используется в модуле манипулирования жидкостями. Это осуществляется для минимизации различных способов, используемых внутри картриджа, для одной и той же функциональности. Второй функцией этого модуля является всасывание элюционного буфера через мембрану для экстракции. Активизация осуществляется этим модулем для минимизации риска загрязнения элюата. Этот риск мог бы быть более высоким при использовании модуля транспорта жидкости также для этой функции. Перед транспортировкой элюата в ПЦР-камеру сначала должна быть добавлена основная смесь и ДНК-содержимое должно быть гомогенизировано во всем общем объеме. Это также может быть выполнено в этом модуле. Наконец, эта жидкость транспортируется в ПЦР-камеру. Активизация выполняется тем же самым актюатором, используемым ранее для транспорта элюата через мембрану для экстракции. Для этой функции транспорта выбран также производимый давлением транспорт. Вскоре после этого функциональность для производимого давлением транспорта жидкости находится внутри картриджа. ПЦР-камеры, помещенные в ПЦР-модуле, должны заполняться без воздуха. Для гарантии этого помещают деаэрирующую мембрану внутри канала подачи для удаления прохождения пузырьков, образующихся при смешивании, в эту ПЦР-камеру. Эти ПЦР-камеры выполнены таким образом, что геометрия камеры ограничивает этот объем. Это гарантирует, что камеры наполняются из одного канала подачи. Эти камеры расположены параллельно в жидкостной структуре для предотвращения любой перекрестной наводки праймеров и/или зондов, которые являются специфическими, на камеру. Имеется также деаэрирующий фильтр для применения после наполнения.

Пробы или образцы, содержащие полинуклеотиды-мишени (Clostridum difficile), могут происходить из большого разнообразия источников для применения с данным изобретением, в том числе из культур клеток, тканей животного или человека, биопсий пациента, проб окружающей среды или т.п. Пробы готовят для анализов этого изобретения с использованием общепринятых способов, которые обычно зависят от источника, из которого берется проба или образец. Пробы или образцы берутся таким образом, чтобы минимизировать шанс загрязнения этой пробы или этого образца наружными элементами, или окружающей среды этой пробой, или этим образцом, если они содержат вредные компоненты. Обычно это выполняется введением пробы для анализа, например, ткани, крови, слюны и т.д., непосредственно в камеру сбора проб в замкнутой в отношении текучих сред системе. Обычно предотвращение перекрестного загрязнения этой пробы может выполняться прямой инжекцией этой пробы в камеру сбора проб посредством необязательно герметизируемого отверстия, например, инжекционного клапана, или перегородки. Обычно герметизируемые клапаны являются предпочтительными для уменьшения любой потенциальной угрозы подтекания во время или после инжекции пробы. Кроме вышеуказанного, часть сбора проб этого устройства/картриджа может также включать в себя реагенты и/или обеспечивать способы нейтрализации инфекционных агентов, стабилизации образца или пробы, коррекции рН и т.п. Способы для стабилизации и коррекции рН могут включать в себя, например, введение гепарина для предотвращения свертывания проб крови, добавление буферящих агентов, добавление протеазы, консервантов и т.п. Такие реагенты могут обычно храниться в камере сбора проб этого устройства/картриджа или могут храниться в отдельно доступной камере, причем эти реагенты могут добавляться к пробе или смешиваться с пробой после введения этой пробы в устройство. Эти реагенты могут быть включены в устройстве в жидкой или лиофилизированной форме в зависимости от природы и стабильности конкретного используемого реагента.

Здесь предпочтительной пробой являются фекалии человека или животного.

Перед проведением реакций амплификации на пробе часто будет желательным выполнение одной или нескольких операций приготовления пробы на этой пробе. Как правило, эти операции приготовления проб будут включать в себя такие манипуляции, как экстракция внутриклеточного материала, например, нуклеиновых кислот, из цельных проб и т.п. Одна или несколько из этих различных операций может быть легко включена в замкнутые относительно текучих сред системы, рассматриваемые данным изобретением.

Для вариантов, в которых анализируют цельные клетки или другие пробы тканей, обычно будет необходимо экстрагировать нуклеиновые кислоты из этих клеток, фекалий, крови или других жидкостей тела перед продолжением различных операций приготовления проб. Таким образом, после сбора проб нуклеиновые кислоты могут высвобождаться из собранных клеток в неочищенный экстракт, с последующими дополнительными обработками, для приготовления пробы для последующих операций, например, денатурации загрязняющих (ДНК-связывающих) белков, очистки, фильтрования, обессоливания и т.п. Выделение нуклеиновых кислот из клеток проб и денатурация ДНК-связывающих белков могут в основном выполняться химическими, физическими или электролитическими способами лизиса. Например, химические способы используют обычно лизирующие агенты для разрушения клеток и экстракции нуклеиновых кислот из этих клеток с последующей обработкой этого экстракта хаотропными солями, такими как гуанидинийизотиоцианат или мочевина, для денатурации любых загрязняющих и потенциально вредных белков. Как правило, при использовании химических способов экстракции и/или денатурации подходящие реагенты могут быть включены в камеру для приготовления проб, в отдельную доступную камеру или могут вводиться снаружи.

Для экстракции нуклеиновых кислот и денатурации ДНК-связывающих белков могут быть использованы физические способы. Патент США № 5304481 раскрывает использование физических выступов в микроканалах или частиц с острыми краями в камере или канале для прокалывания мембран клеток и экстрации их содержимого. Объединения таких структур с пьезоэлектрическими элементами для перемешивания могут обеспечивать подходящие сдвигающие усилия для лизиса. Такие элементы описаны более подробно в отношении фрагментации нуклеиновых кислот ниже. Более традиционные способы экстракции клеток также могут быть использованы, например, способы, использующие канал с ограничивающим поперечным размером, который вызывает лизис клеток. Альтернативно, экстракция клеток и денатурация загрязняющих белков могут проводиться приложением переменного тока к этой пробе. Более конкретно, пробу клеток пропускают через ряд микротрубочек при подаче переменного электрического тока сквозь поток жидкости. В устройстве данного изобретения могут быть использованы различные другие способы для выполнения лизиса/экстракции клеток, в том числе, например, подвергание клеток ультразвуковому перемешиванию или принудительное пропускание клеток через малые отверстия, с подверганием посредством этого этих клеток высокому стрессу сдвигом, приводящему к разрыву клеток.

После экстракции часто бывает желательным отделение нуклеиновых кислот от других элементов неочищенного экстракта, например денатурированных белков, частиц клеточных мембран, солей и т.п. Удаление материала макрочастиц обычно выполняют фильтрованием, флокуляцией или т.п. В это устройство могут быть включены различные типы фильтров. Далее, при использовании способов химической денатурации может быть желательным обессоливание пробы перед переходом к следующей стадии. Обессоливание пробы и выделение нуклеиновой кислоты может проводиться в единой стадии, например, связыванием нуклеиновых кислот с твердой фазой и вымыванием загрязняющих солей или выполнением гель-фильтрационной хроматографии на этой пробе, пропусканием солей через диализные мембраны и т.п. Подходящие твердые носители для связывания нуклеиновых кислот включают в себя, например, диатомовую землю, диоксид кремния (т.е. стекловату) или т.п. Подходящие гель-фильтрационные среды, также хорошо известные в данной области, могут быть также легко включены в устройство/картридж данного изобретения и коммерчески доступны, например, от Pharmacia и Sigma Chemical.

Выделение и/или гель-фильтрация/обессоливание могут проводиться в дополнительной камере, или, альтернативно, конкретные хроматографические среды могут быть включены в канал или проход для жидкости, ведущий в камеру следующей реакции. Альтернативно, внутренние поверхности одного или нескольких проходов для жидкости или камер могут быть сами дериватизованы для обеспечения функциональных групп, подходящих для желаемой очистки, например заряженных групп, групп аффинного связывания и т.п. Альтернативно, способы обессоливания могут обычно использовать преимущество высокой электрофоретической подвижности и отрицательного заряда ДНК в сравнении с другими элементами. Электрофоретические способы могут быть также использованы в очистке нуклеиновых кислот от других клеточных загрязнителей и остатков клеток. В одном примере разделительный канал или камера этого устройства находятся в жидкостной связи с двумя отдельными “полевыми” каналами или камерами, имеющими электроды, например платиновые электроды, расположенные в них. Эти два полевых канала отделены от канала разделения с использованием подходящего барьера или "улавливающей мембраны", которая делает возможным прохождение тока и препятствует прохождению нуклеиновых кислот или других больших молекул. Этот барьер обычно исполняет две основные функции: во-первых, этот барьер действует для удержания нуклеиновых кислот, которые мигрируют в направлении положительного электрода в камере для разделения; и, во-вторых, эти барьеры препятствуют переносу вредных эффектов, ассоциированных с электролизом при электроде, в камеру для реакции (например, действуя в качестве солевого сочленения). Такие барьеры могут включать в себя диализные мембраны, плотные гели, PEI-фильтры или другие подходящие материалы. После включения подходящего электрического поля нуклеиновые кислоты, присутствующие в пробе, будут мигрировать в направлении положительного электрода и становиться уловленными на улавливающей мембране. Затем загрязнения пробы, остающиеся свободными от этой мембраны, вымывают из этой камеры применением подходящего потока жидкости. После изменения полярности напряжения эти нуклеиновые кислоты высвобождаются из этой мембраны в существенно более чистой форме. Полевые каналы могут быть помещены на одной и той же стороне или на противоположных сторонах или концах камеры или канала разделения и могут использоваться вместе с описанными здесь смешивающими элементами для гарантии максимальной эффективности операции. Кроме того, на этих барьерах могут быть помещены фильтры грубой очистки во избежание засорения этих барьеров состоящим из частиц материалом, белками или нуклеиновыми кислотами, для позволения повторного использования. В сходном аспекте высокая электрофоретическая подвижность нуклеиновых кислот с их отрицательными зарядами может быть использована для отделения нуклеиновых кислот от загрязнителей с использованием короткой колонки геля или другого подходящего матрикса или геля, которые будут замедлять или ингибировать поток других загрязнителей, делая возможным более быстрое прохождение нуклеиновых кислот.

В одном предпочтительном варианте эти зонды и/или праймеры распределяются в каналах или камерах следующим образом. Конкретная смесь праймеров и зондов стабильно хранится в виде высушенного материала в каждой отдельной ПЦР-камере. При заполнении этой ПЦР-камеры предварительно смешанной реакционной смесью матрица/ПЦР эти хранящиеся праймеры/зонды образуют гомогенный раствор с концентрациями, оптимальными для их предполагаемых реакций.

1. Способ детектирования и характеризации токсиногенного штамма Clostridium difficile в пробе, в котором выполняют следующие стадии:

a. предоставляют пробу;

b. в мультиплексном ПЦР-анализе

i) эту пробу анализируют в отношении присутствия или отсутствия гена tcdB цитотоксина;

ii) эту пробу анализируют в отношении присутствия или отсутствия следующих делеций в гене tcdC:

a) делеций 18 п.н. в SEQ ID NO: 1 от нуклеотида 330 до нуклеотида 347;

b) делеций 39 п.н. в SEQ ID NO: 1, как представлено в SEQ ID NO: 14;

c) делеций единственного нуклеотида в положении 117 SEQ ID NO: 1,

где мультиплексная ПЦР-амплификация является количественной ПЦР реального времени,

где пробу дополнительно анализируют в отношении присутствия или отсутствия делеций 1,8 т.п.н. гена tcdA энтеротоксина,

где пробу дополнительно анализируют в отношении присутствия или отсутствия cdtA и/или cdtB бинарного токсина, и, где

a. если присутствует последовательность гена tcdB, отсутствует делеция tcdA, не присутствует ни делеция единственного нуклеотида в положении 117 SEQ ID NO: 1, ни делеция 18 п.н., ни делеция 39 п.н., то эта проба оценивается как токсиногенный штамм Clostridium difficile,

b. если присутствует последовательность гена tcdB, отсутствует делеция tcdA, присутствует делеция единственного нуклеотида в положении 117 SEQ ID NO: 1, присутствует делеция 18 п.н. и присутствует ген бинарного токсина cdtA/B, то эта проба оценивается как штамм риботипа 027 Clostridium difficile,

c. если присутствует последовательность гена tcdB, присутствует делеция tcdA, не присутствует ни делеция единственного нуклеотида в положении 117 SEQ ID NO: 1, ни делеция 18 п.н., ни делеция 39 п.н. в SEQ ID NO: 1, как представлено в SEQ ID NO: 14, и отсутствует ген cdtA/B бинарного токсина, то эта проба оценивается как штамм риботипа 017 Clostridium difficile, и

d. если присутствует последовательность гена tcdB, отсутствует делеция tcdA, присутствует делеция 39 п.н. в SEQ ID NO: 1, как представлено в SEQ ID NO: 14, присутствует ген cdtA/B бинарного токсина, то эта проба оценивается как штамм риботипа 078 Clostridium difficile.

2. Способ по п. 1, где эту пробу анализируют на:

a. присутствие или отсутствие всех из следующих делеций:

b. делеций 18 п.н. в SEQ ID NO: 1 от нуклеотида 330 до нуклеотида 347, делеций 39 п.н. в SEQ ID NO: 1, как представлено в SEQ ID NO: 14,

c. делеций единственного нуклеотида в положении 117 SEQ ID NO: 1,

d. присутствие или отсутствие гена tcdB цитотоксина,

e. присутствие или отсутствие делеций 1,8 т.п.н. tcdA и

f. присутствие или отсутствие гена cdtA/B бинарного токсина.

3. Способ по любому из пп. 1, 2, где мультиплексную реакцию амплификации выполняют в замкнутой системе в присутствии флуоресцентных индикаторов в реакционной смеси (реакционных смесях), причем эти флуоресцентные индикаторы способны генерировать оптический сигнал, связанный с присутствием и/или количеством каждого ампликона в этой реакции амплификации, и позволяют осуществлять мониторинг этого оптического сигнала флуоресцентных индикаторов в этой реакции амплификации.

4. Способ по п. 1, где мультиплексную реакцию амплификации выполняют в замкнутой системе в присутствии флуоресцентных индикаторов в реакционной смеси (реакционных смесях), причем эти флуоресцентные индикаторы способны генерировать оптический сигнал, связанный с присутствием и/или количеством каждого ампликона в этой реакции амплификации, и позволяют осуществлять мониторинг этого оптического сигнала флуоресцентных индикаторов в этой реакции амплификации.

5. Способ по п. 2, где мультиплексную реакцию амплификации выполняют в замкнутой системе в присутствии флуоресцентных индикаторов в реакционной смеси (реакционных смесях), причем эти флуоресцентные индикаторы способны генерировать оптический сигнал, связанный с присутствием и/или количеством каждого ампликона в этой реакции амплификации, и позволяют осуществлять мониторинг этого оптического сигнала флуоресцентных индикаторов в этой реакции амплификации.

6. Способ по п. 1, где мультиплексную реакцию амплификации выполняют в замкнутой системе в присутствии флуоресцентных индикаторов в реакционной смеси (реакционных смесях), причем эти флуоресцентные индикаторы способны генерировать оптический сигнал, связанный с присутствием и/или количеством каждого ампликона в этой реакции амплификации, и позволяют осуществлять мониторинг этого оптического сигнала флуоресцентных индикаторов в этой реакции амплификации.

7. Способ по п. 3, где эта замкнутая система дает оптические выходные данные для пользователя, указывающие оценивание пробы как штамм риботипа 027 Clostridium difficile, штамм риботипа 017 Clostridium difficile или штамм риботипа 078 Clostridium difficile.

8. Способ по любому из пп. 4-6, где эта замкнутая система дает оптические выходные данные для пользователя, указывающие оценивание пробы как штамм риботипа 027 Clostridium difficile, штамм риботипа 017 Clostridium difficile или штамм риботипа 078 Clostridium difficile.

9. Способ по п. 1, где продукты амплификации в мультиплексном ПЦР-анализе имеют размер от 60 до 200 п.н.

10. Способ по п. 1, где эта проба является фекалиями человека или животного.

11. Картридж замкнутой системы амплификации для осуществления способа по любому из пп. 1-10, содержащий праймеры и/или зонды, для амплификации и/или детектирования (i) гена tcdB цитотоксина, (ii) делеций 1,8 т.п.н. в гене tcdA, (iii) делеций 18 п.н. в SEQ ID NO: 1 от нуклеотида 330 до нуклеотида 347 гена tcdC, (iv) делеций 39 п.н. в SEQ ID NO: 1, как представлено в SEQ ID NO: 14 гена tcdC, (v) делеций единственного нуклеотида в положении 117 SEQ ID NO: 1 и праймеры и/или зонды для детектирования гена cdtA/B бинарного токсина.

12. Набор для выполнения способа по любому из пп. 1-10, содержащий праймеры и/или зонды для амплификации и/или детектирования (i) гена tcdB цитотоксина, (ii) делеций 1,8 т.п.н. в гене tcdA, (iii) делеций 18 п.н. в SEQ ID NO: 1 от нуклеотида 330 до нуклеотида 347 гена tcdC, (iv) делеций 39 п.н. в SEQ ID NO: 1, как представлено в SEQ ID NO: 14 гена tcdC, (v) делеций единственного нуклеотида в положении 117 SEQ ID NO: 1 и праймеры и/или зонды для (vi) детектирования гена cdtA/B бинарного токсина.



 

Похожие патенты:

Изобретение относится к молекулярной биологии и медицине. Способ представлен выявлением и идентификацией наиболее перспективных полиморфизмов генов, определяющих повышенный риск развития ишемического инсульта (РР ИИ).

Изобретение относится к области ветеринарии и молекулярной биотехнологии и предназначено для диагностики анаплазмоза рогатого скота методом полимеразной цепной реакции (ПЦР).
Изобретение относится к области клинической лабораторной диагностики. Предложен способ оценки готовности раневой поверхности к пластическому закрытию с использованием метода полимеразной цепной реакции (ПЦР).

Изобретение относится к области генной инженерии, конкретно к наборам синтетических олигонуклеотидов, и может быть использовано для определения уровней экспрессии основных изоформ гена PDLIM4.

Изобретение относится к медицинской микробиологии. Описан способ идентификации подвидов возбудителя туляремии Francisella tularensis subsp.

Изобретение относится к области медицины, в частности к стоматологии, и предназначено для получения точных количественных данных о видовом составе микроорганизмов пародонтальных карманов.

Изобретение относится к области медицины, в частности к иммунологии и педиатрии, и предназначено для диагностики тимомегалии у детей. Проводят ПЦР в режиме реального времени с использованием соответствующих праймеров и флюоресцентно-меченого олигонуклеотида с последующим расчетом числа копий Т-рецепторных эксцизионных колец (ТРЭК) по стандартной кривой, построенной по разведениям плазмиды, представленной SEQ ID NO: 1 с известной концентрацией ДНК ТРЭК.

Изобретение относится к области медицины, в частности к акушерству и гинекологии, и предназначено для прогнозирования высокого риска репродуктивных потерь в первом триместре беременности.

Изобретение относится к области медицины, в частности к молекулярной онкологии, и предназначено для прогнозирования выживаемости больных раком тела матки на основании уровня экспрессии гена ESR1.

Изобретения относятся к области определения последовательности нуклеиновой кислоты. Предложена группа изобретений, включающая устройство и способ для оптического контроля секвенирования нуклеиновой кислоты, машиночитаемый носитель с компьютерной программой и программный элемент, используемые в вышеуказанном способе, а также применение 5-метил-(2-(2-нитрофенил)пропил)карбонат-dUTP, 5-метил-(2-оксо-1,2-дифенилэтил)карбонат-dUTP в качестве блокатора в секвенировании ДНК в вышеуказанном способе.

Изобретение относится к области биотехнологии, конкретно к клеточным технологиям, и может быть использовано в медицине для получения лекарственного средства для лечения рака.

Настоящее изобретение относится к антисмысловым олигонуклеотидам, модулирующим экспрессию гена развития поджелудочной железы, в частности, путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами гена развития поджелудочной железы.

Изобретение относится к области генной инженерии, конкретно к наборам синтетических олигонуклеотидов, и может быть использовано для определения уровней экспрессии основных изоформ гена PDLIM4.

Изобретение относится к биохимии. Описан синтетический олигонуклеотид длиной от 19 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Изобретение относится к биохимии. Описаны олигонуклеотиды, повышающие экспрессию гена РНКазы H1 путем нацеленного контакта с природными антисмысловыми полинуклеотидами РНКазы H1.

Изобретение относится к биохимии. Описаны антисмысловые олигонуклеотиды, модулирующие экспрессию связывающего половые гормоны глобулина (ГСПГ), в частности, путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами связывающего половые гормоны глобулина (ГСПГ).

Изобретение относится к биохимии. Описан олигонуклеотид длиной приблизительно от 15 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Настоящее изобретение относится к антисмысловым олигонуклеотидам, модулирующим экспрессию и/или функцию интерферон-регуляторного фактора 8 (IRF8), в частности, путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами интерферон-регуляторного фактора 8 (IRF8).

Изобретение относится к биохимии. Описаны олигонуклеотиды длиной от 15 до 30 нуклеотидов, содержащие по меньшей мере одну модификацию, причем указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного фрагмента сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Изобретение относится к области биохимии, в частности к иммуногенной композиции, содержащей антиген и иммуностимулирующий олигонуклеотид, состоящий из нуклеотидной последовательности 5'TCGTCGTTTTTCGGTGCTTTT3', дополнительно содержащей фармацевтически приемлемый носитель.

Группа изобретений относится к области биохимии. Предложен способ извлечения целевых соединений из биомассы, гранулярная композиция и набор.
Наверх