Антитело к blys

Изобретение относится к области биохимии. Заявлено антитело к BLyS. Также изобретение относится к молекуле ДНК, кодирующей указанное антитело, вектору экспрессии и клетке-хозяину для получения указанного антитела. Также предложено применение антитела к BLyS в составе фармацевтической композиции и в способе предупреждения и/или лечения заболеваний, вызванных избыточной пролиферацией В-клеток, таких как системная красная волчанка. Изобретение позволяет связываться с BLyS с высокой аффинностью и ингибировать связывание с его рецептором BR3 с высокой специфичностью. 7 н. и 8 з.п. ф-лы, 10 ил., 4 табл., 10 пр.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение принадлежит к области биофармацевтики и относится к антителу к BLyS и его применению. Антитело к BLyS может связываться с фактором, стимулирующим В-лимфоциты, и может ингибировать связывание фактора, стимулирующего В-лимфоциты, с его рецептором - BR3-Fc. Кроме того, оно относится к гуманизированному антителу к BLyS, которое имеет низкую аффинность к фактору МНС II (главный комплекс гистосовместимости класса II), и к его применению.

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

Системная красная волчанка (SLE) представляет собой вид аутоиммунного заболевания, которое затрагивает многие системы органов организма, такие как кожа, суставы, сердце, легкое, почка, кровь и мозг, и оно является диффузно прогрессирующим с поочередно происходящими ремиссией и рецидивом. Системная красная волчанка, главным образом, поражает африкано-карибскую, азиатскую и латиноамериканскую популяции, демонстрируя слабое поражение европеоидов (белой расы). Согласно Американскому фонду волчанки (Lupus Foundation of America) по консервативному прогнозу системная красная волчанка поражает 300000 человек в Америке. По оценке компании Datamonitor в Китае, Индии и Мексике имеется 2,2 миллиона пациентов, страдающих от системной красной волчанки, где число пациентов, страдающих от системной красной волчанки, в Китае превышает 1 миллион, что является наивысшим показателем в мире. Поскольку исходные симптомы системной красной волчанки являются довольно замаскированными, реальное число пациентов может быть значительно большим, чем текущая оценка. Таким образом, в клинике имеется сильная потребность в диагностике и лечении SLE.

Причина SLE является сложной и неопределенной. Она не вызвана одним фактором и может быть связана с разными факторами, такими как наследственность, влияние среды, полового гормона, иммунитета и т.д. В настоящее время научным сообществом общепризнано, что патогенез SLE на клеточном уровне состоит в том, что В-клетки, реагирующие на собственный организм, слишком долго остаются в периферических тканях и продуцируют человеческий аутологический антиген, который вызывает аутоиммунитет. Следовательно, если возможно ингибирование роста и пролиферации исходной В-клетки, SLE можно лечить.

Стимулятор В-лимфоцитов (BLyS), также известный как Tall-1 (экспрессируемый лейкоцитами лиганд 1, родственный TNF и Apol), BAFF (активирующий В-клетки фактор, принадлежащий к семейству TNF), THANK (гомологи TNF, которые активируют апоптоз, NF-κВ и JNK), принадлежит к семейству фактора некроза опухоли (TNF) и представляет собой новый цитокин, впервые открытый и клонированный Hongbing Shu et al. в 1999 году. В качестве костимулятора клеток В-лимфоцитов BLyS, в присутствии антитела к IgM и IL-4 (интерлейкин-4), может непосредственно стимулировать пролиферацию и дифференциацию В-клеток, и он играет очень важную роль в гуморальном иммунитете. А его сверхэкспрессия в организме тесно связана с аутоиммунным заболеванием.

Эксперимент in vitro показывает, что после того, как В-клетки предактивируются IgM, BLyS может индуцировать массовую пролиферацию В-клеток и секрецию ими большого количества IgM и IgA. Однако для В-клеток в периоде покоя данная стимуляция не имеет явного эффекта. Дальнейшее исследование показывает, что BLyS, главным образом, действует на пред-В-лимфоциты, незрелые В-лимфоциты и активированные лимфоциты, не имея эффекта на плазмоциты и лимфатические плюрипотентные стволовые клетки. Подобно большинству цитокинов, BLyS стимулирует последующую передачу сигнала через поверхностный рецептор В-клеток. Многие исследовательские группы подтвердили, что рецепторами, связывающимися с BLyS, являются: рецептор фактора, активирующего В-клетки (BR3, рецептор 3 BLyS или BAFF-R), трансмембранный активатор (трансмембранный активатор-1, кальциевый модулятор и взаимодействующий с циклофилиновым лигандом, TACI) и антиген созревания В-клеток (ВСМА). Эта специфичность определяет то, что BLyS является очень хорошей мишенью для лечения аутоиммунных заболеваний, опосредованных антителами В-клеток, и рака лимфатической системы.

Было продемонстрировано in vivo и in vitro, что терапевтическое антитело к BLyS может эффективно ингибировать рост В-клеток и секрецию IgA и IgM, посредством чего достигается эффект лечения SLE (Edwards ВМ et al., The remarkable flexibility of the human antibody repertoire; isolation of over one thousand different antibodies to a single protein, BLyS. J Mol Biol. 2003 Nov 14; 334(1):103-18; Baker KP et al., Generation and characterization of LymphoStat-B, a human monoclonal antibody that antagonizes the bioactivities of В lymphocyte stimulator. Arthritis Rheum. 2003 Nov; 48(11): 3253-65). Бенлиста, антитело к BLyS, разработанное Human Genome Sciences Inc. из США, стало первым новым лекарственным средством для лечения SLE за последние 60 лет. Бенлиста нацелена только на В-клетки, стимулированные BLyS, и значительно уменьшает побочные эффекты во время терапии по сравнению с химиотерапевтическими лекарственными средствами, следовательно, обеспечивая безопасную и эффективную терапию для пациентов с SLE. В последние годы быстро развиваются исследование и клиническое применение таргетной терапии против BLyS, и большинство компаний, отличных от Human Genome Sciences Inc., используют слитые белки, модифицированные на основе BLyS или его рецептора. Компания из США Genentech разработала лекарственное средство BR3-FC, Zymogenetics разработала лекарственное средство TACI-FC и AMGEN разработала полипептид-FC. По сравнению с бенлиста данные лекарственные средства имеют низкую специфичность, слабую силу связывания, относительно плохой куративный эффект и более сильную токсичность. Исследования трех данных лекарственных средств были прекращены или остановлены на стадии II клинических испытаний. Следовательно, лекарственное средство на основе антитела к BLyS является полностью эффективным фармацевтическим лечением в отношении данной мишени.

Бенлиста производится посредством библиотеки фагового дисплея. А недостатками библиотеки фагового дисплея являются следующие: полагают, что образование пары тяжелых цепей и легких цепей является искусственным без отбора in vivo (Greg Winter, et al., Making Antibodies by Phage Display Technology. Annual Review of Immunology, Vol. 12: 433-455); библиотеку конструируют из незрелых человеческих РВМС (одноядерные клетки периферической крови), следовательно, антитела-кандидаты имеют низкую аффинность (Edwards ВМ, et al., The remarkable flexibility of the human antibody repertoire; isolation of over one thousand different antibodies to a single protein, BLyS. J Mol Biol. 2003 Nov 14; 334(1): 103-18); в большинстве случаев лекарственные средства-кандидаты из библиотеки фагового дисплея имеют недостатки низкого выхода, низкой стабильности и плохих фармакокинетических характеристик in vivo (Ponsel D, et al., High affinity, developability and functional size: the holy grail of combinatorial antibody library generation. Molecules. 2011 May 3; 16(5):3675-700).

В данной области все еще требуются антитела к BLyS со следующими свойствами: они продуцируются, например, с использованием методики гуманизированного мышиного антитела и т.д. без применения библиотеки фагового дисплея; они способны связываться со стимулятором В-лимфоцитов с высокой аффинностью и ингибировать связывание стимулятора В-лимфоцитов с его рецептором - BR3-Fc с высокой специфичностью; они имеют низкую иммуногенность и/или они имеют низкую аффинность с фактором МНС II, посредством чего при обеспечении аффинности минимизируется иммунный ответ.

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

В одном аспекте согласно изобретению предложено антитело к BLyS, в котором аминокислотные последовательности CDR1 (гипервариабельная область 1), CDR2 и CDR3 легких цепей, а также CDR1, CDR2 и CDR3 тяжелой цепи антитела к BLyS выбраны из одной из их следующих групп или функциональных вариантов:

В одном воплощении аминокислотная последовательность вариабельной области легкой цепи и аминокислотная последовательность вариабельной области тяжелой цепи антитела к BLyS выбрана из одной из следующих групп:

а: аминокислотные последовательности, показанные в SEQ ID NO. 31 и SEQ ID NO. 32, или их функциональные варианты;

б: аминокислотные последовательности, показанные в SEQ ID NO. 33 и SEQ ID NO. 34, или их функциональные варианты;

в: аминокислотные последовательности, показанные в SEQ ID NO. 35 и SEQ ID NO. 36, или их функциональные варианты;

г: аминокислотные последовательности, показанные в SEQ ID NO. 37 и SEQ ID NO. 38, или их функциональные варианты; и

д: аминокислотные последовательности, показанные в SEQ ID NO. 39 и SEQ ID NO. 40, или их функциональные варианты.

В предпочтительном воплощении антитело к BLyS по изобретению является гуманизированным.

В одном воплощении аминокислотная последовательность вариабельной области легкой цепи и аминокислотная последовательность вариабельной области тяжелой цепи антитела к BLyS выбрана из одной из следующих групп:

I: аминокислотные последовательности, показанные в SEQ ID NO. 41 и SEQ ID NO. 42, или их функциональные варианты;

II: аминокислотные последовательности, показанные в SEQ ID NO. 43 и SEQ ID NO. 44, или их функциональные варианты;

III: аминокислотные последовательности, показанные в SEQ ID NO. 45 и SEQ ID NO. 46, или их функциональные варианты; и

IV: аминокислотные последовательности, показанные в SEQ ID NO. 47 и SEQ ID NO. 48, или их функциональные варианты.

В некоторых предпочтительных воплощениях антитело к BLyS, кроме того, содержит константную область человеческой легкой цепи и константную область человеческой тяжелой цепи, и вариабельная область легкой цепи и вариабельная область тяжелой цепи соединены с константной областью человеческой легкой цепи и константной областью человеческой тяжелой цепи соответственно. В одном воплощении константная область человеческой легкой цепи представляет собой константную область κ человеческой легкой цепи. В одном воплощении константная область человеческой тяжелой цепи представляет собой фрагмент Fc человеческой тяжелой цепи.

Согласно данному изобретению, кроме того, предложена молекула ДНК, кодирующая антитело к BLyS по изобретению. Предпочтительно молекула ДНК имеет нуклеотидную последовательность, выбранную из SEQ ID NO. 49-58.

Согласно изобретению предложен вектор на основе рекомбинантной ДНК, содержащий молекулу ДНК антитела к BLyS по изобретению.

Согласно изобретению, кроме того, предложена клетка-хозяин, содержащая вектор на основе рекомбинантной ДНК по изобретению.

В другом аспекте согласно изобретению предложен способ предупреждения и/или лечения заболеваний, вызванных сверхпролиферацией В-клеток, который включает применение эффективной дозировки антитела к BLyS по любому из пп. 1-7. В некоторых воплощениях заболевания, вызванные сверхпролиферацией В-клеток, выбраны из SLE, ревматоидного артрита, анкилозирующего артрита или лимфомного В-клеточного рака.

Согласно изобретению, кроме того, предложена фармацевтическая композиция, которая содержит эффективную дозировку антитела согласно изобретению и фармацевтически приемлемый носитель.

Согласно изобретению, кроме того, предложен способ получения антитела к BLyS, который включает инкубирование клеток-хозяев по изобретению и получение антитела.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Если не определено иначе, все используемые здесь технические термины имеют такое же значение, что и термины, понятные специалистам в данной области. В том, что касается определений и терминов данной области, профессионалы могут конкретно сослаться на Current Protocols in Molecular Biology (Ausubel). Сокращением аминокислотного остатка является стандартный код из 3 букв и/или 1-буквенное обозначение одной из 20 обычно используемых в данной области L-аминокислот.

Одной целью изобретения является предложение антитела к BLyS, которое может связываться со стимулятором В-лимфоцитов и ингибировать его связывание с его рецептором BR3-Fc.

Для достижения цели изобретения в настоящем изобретении принимаются следующие технические решения.

Посредством методики генной инженерии экстрагируют РНК человеческой периферической крови и кДНК человеческого BLyS получают проведением обратной транскрипции с использованием РНК человеческой периферической крови в качестве матрицы. Затем получают сегмент гена человеческого BLyS путем амплификации, соответственно, с использованием кДНК человеческого BLyS в качестве матрицы. А очищенный белок человеческого BLyS получают путем клонирования сегмента гена человеческого BLyS в эукариотической системе экспрессии с трансфекцией клеток-хозяев и последующим проведением экспрессии и очистки.

Очищенный белок человеческого BLyS используют в качестве антигена для иммунизации мышей так, чтобы получить 2000 линий разных моноклональных гибридомных клеток, из которых отбираются всего 211 линий клонов, которые секретируют антитела, способные к связыванию с белком BLyS, посредством реакции мечения с ферментом. Из 211 линий моноклональных гибридомных клеток получают 5 линий моноклональных гибридомных клеток, которые секретируют антитела, способные с разными эффективностями ингибировать связывание BLyS, меченного биотином, с рецептором BLyS на BJAB путем тестирования способности BLyS к связыванию с рецептором на клетках BJAB, которые названы 1D12, 2В10, 2G3, 5А5 и 13G8 соответственно.

Для идентификации иммунологических характеристик антител, секретируемых полученными 5 линиями моноклональных гибридомных клеток, используют ELISA (твердофазный иммуноферментный анализ). Результат показывает то, что все антитела, секретируемые линиями моноклональных гибридомных клеток, отобранных по настоящему изобретению, являются специфичными к BLyS без отвечаемости на другие антигены семейства TNF, такие как TNF-α, TNF-β.

Далее экстрагируется РНК индивидуальных моноклональных гибридомных клеток и подвергается обратной транскрипции с получением кДНК, которая затем используется в качестве матрицы для амплификации последовательности ДНК в вариабельной области, соответствующей каждой моноклональной гибридомной клетке. После секвенирования проводится серийный анализ для полученных последовательностей согласно www.expasy.ch и классификационный анализ по Kabat проводится на основе полученных аминокислотных последовательностей так, чтобы определить области FR и области CDR легкой цепи и тяжелой цепи антител, секретируемых каждой моноклональной гибридомной клеткой.

Поскольку BLyS имеет эффект стимулирования роста В-клеток и поддержания их жизнеспособности, антитела, ингибирующие, особенно нейтрализующие эффект BLyS, будут ингибировать рост В-клеток. А В-клетки представляют собой особый тип клеток организмов для продукции антител, поэтому представляется затруднительным, чтобы В-клетки продуцировали антитела против собственного роста (Thomas Schirrmann, et al., Phage display for the generation of antibodies for proteome research, diagnostics and therapy, Molecules, 2011, 16, 412-426). Следовательно, посредством иммунизации мыши относительно сложно получать антитело к BLyS. Однако согласно данному изобретению получают антитело к BLyS посредством иммунизации мыши и сохраняют преимущества мышиного антитела.

В одном аспекте изобретение относится к антителу к BLyS, в котором аминокислотные последовательности CDR1, CDR2 и CDR3 легкой цепи, а также CDR1, CDR2 и CDR3 тяжелой цепи выбраны из одной из следующих групп или их функциональных вариантов:

В одном воплощении антитело к BLyS, секретируемое указанной моноклональной гибридомной клеткой 1D12, содержит вариабельную область легкой цепи аминокислотной последовательности, показанной в SEQ ID NO. 31, и вариабельную область тяжелой цепи аминокислотной последовательности, показанной в SEQ ID NO. 32, и оно названо моноклональным антителом 1D12.

В одном воплощении антитело к BLyS, секретируемое указанной моноклональной гибридомной клеткой 2В10, содержит вариабельную область легкой цепи аминокислотной последовательности, показанной в SEQ ID NO. 33, и вариабельную область тяжелой цепи аминокислотной последовательности, показанной в SEQ ID NO. 34, и оно названо моноклональным антителом 2В10.

В одном воплощении антитело к BLyS, секретируемое указанной моноклональной гибридомной клеткой 2G3, содержит вариабельную область легкой цепи аминокислотной последовательности, показанной в SEQ ID NO. 35, и вариабельную область тяжелой цепи аминокислотной последовательности, показанной в SEQ ID NO. 36, и оно названо моноклональным антителом 2G3.

В одном воплощении антитело к BLyS, секретируемое указанной моноклональной гибридомной клеткой 5А5, содержит вариабельную область легкой цепи аминокислотной последовательности, показанной в SEQ ID NO. 37, и вариабельную область тяжелой цепи аминокислотной последовательности, показанной в SEQ ID NO. 38, и оно названо моноклональным антителом 5А5.

В другом воплощении антитело к BLyS, секретируемое указанной моноклональной гибридомной клеткой 13G8, содержит вариабельную область легкой цепи аминокислотной последовательности, показанной в SEQ ID NO. 39, и вариабельную область тяжелой цепи аминокислотной последовательности, показанной в SEQ ID NO. 40, и оно названо моноклональным антителом 13G8.

Специалист в данной области, по существу без влияния на активность антитела, естественно, может заменять, добавлять и/или удалять одну или более чем одну (например, 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10 или более чем 10) аминокислоту в аминокислотных последовательностях по изобретению так, чтобы получать аминокислотную последовательность с эквивалентной функцией, т.е. функциональный вариант указанной аминокислотной последовательности. Все из них находятся в пределах объема данного изобретения. Например, аминокислоты в вариабельной области могут быть заменены аминокислотами, имеющими аналогичные характеристики.

Функциональный вариант аминокислотной последовательности по изобретению может иметь по меньшей мере 95%, 96%, 97%, 98% или 99% соответствия с его последовательностью-источником. Соответствие последовательности по изобретению можно измерять программой для анализа последовательности. Например, можно использовать компьютерные программы BLAST с параметрами по умолчанию, особенно BLASTP или TBLASTN.

Для дальнейшего уменьшения иммуногенности полученное мышиное антитело можно гуманизировать с получением гуманизированного антитела к BLyS. Способ получения гуманизированного антитела хорошо известен специалисту в данной области. Например, гуманизированное антитело к BLyS по изобретению можно получать путем переноса последовательности CDR по изобретению в вариабельную область человеческого антитела. Гуманизированное антитело не будет приводить к ответу на антитело (AAR) и ответу человеческих антител на мышиное антитело (НАМА), и оно не будет нейтрализоваться антителом на антитело и быстро удаляться, имея, посредством этого, иммунную функцию, такую как действие посредством ADCC (антителозависимая клеточная цитотоксичность) и CDC (комплементзависимая цитоксичность).

В одном воплощении аминокислотная последовательность вариабельной области легкой цепи и аминокислотная последовательность вариабельной области тяжелой цепи гуманизированного антитела к BLyS выбрана из одной из следующих групп:

I: аминокислотные последовательности, показанные в SEQ ID NO. 41 и SEQ ID NO. 42, или их функциональные варианты;

II: аминокислотные последовательности, показанные в SEQ ID NO. 43 и SEQ ID NO. 44, или их функциональные варианты;

III: аминокислотные последовательности, показанные в SEQ ID NO. 45 и SEQ ID NO. 46, или их функциональные варианты; и

IV: аминокислотные последовательности, показанные в SEQ ID NO. 47 и SEQ ID NO. 48, или их функциональные варианты.

Гуманизированное антитело к BLyS по изобретению не только способно связываться со стимулятором В-лимфоцитов так, чтобы ингибировать его связывание с его рецептором BR3-Fc, но также имеет низкую аффинность к фактору МНС II, минимизируя, посредством этого, иммунный ответ при сохранении аффинности.

В других предпочтительных воплощениях антитело к BLyS по изобретению, кроме того, содержит человеческую константную область легкой цепи и константную область тяжелой цепи, и вариабельная область легкой цепи и вариабельная область тяжелой цепи соединены с человеческой константной областью легкой цепи и константной областью тяжелой цепи соответственно. В одном воплощении гуманизированное антитело к BLyS содержит полную легкую цепь и полную тяжелую цепь, где полная легкая цепь образована путем соединения вариабельной области легкой цепи, содержащейся в антителе к BLyS, с константной областью человеческой легкой цепи, и полная тяжелая цепь образована путем соединения вариабельной области тяжелой цепи, содержащейся в антителе к BLyS, с константной областью человеческой легкой цепи.

Предпочтительно константная область человеческой легкой цепи представляет собой константную область κ человеческой легкой цепи.

Предпочтительно константная область тяжелой цепи представляет собой фрагмент Fc человеческой тяжелой цепи.

В одном воплощении и константная область κ человеческой легкой цепи, и фрагмент Fc человеческой тяжелой цепи происходят из В-лимфоцита здорового человека. Посредством методики генной инженерии вариабельную область и константную область соединяют посредством ПЦР с перекрывающимися праймерами для получения полной легкой цепи и тяжелой цепи гуманизированного антитела к BLyS.

Согласно изобретению, кроме того, предложены молекулы ДНК, кодирующие антитело к BLyS или гуманизированное антитело к BLyS по изобретению. Из-за вырожденности кодонов может быть много молекул ДНК, которые могут кодировать антитело по изобретению.

В одном воплощении согласно изобретению предложена молекула ДНК, кодирующая вариабельную область легкой цепи, имеющую аминокислотную последовательность, показанную в SEQ ID NO. 31, нуклеотидная последовательность которой показана в виде SEQ ID NO. 49.

В одном воплощении согласно изобретению предложена молекула ДНК, кодирующая вариабельную область тяжелой цепи, имеющую аминокислотную последовательность, показанную в SEQ ID NO. 32, нуклеотидная последовательность которой показана в виде SEQ ID NO. 50.

В одном воплощении согласно изобретению предложена молекула ДНК, кодирующая вариабельную область легкой цепи, имеющую аминокислотную последовательность, показанную в SEQ ID NO. 33, нуклеотидная последовательность которой показана в виде SEQ ID NO. 51.

В одном воплощении согласно изобретению предложена молекула ДНК, кодирующая вариабельную область тяжелой цепи, имеющую аминокислотную последовательность, показанную в SEQ ID NO. 34, нуклеотидная последовательность которой показана в виде SEQ ID NO. 52.

В одном воплощении согласно изобретению предложена молекула ДНК, кодирующая вариабельную область легкой цепи, имеющую аминокислотную последовательность, показанную в SEQ ID NO. 35, нуклеотидная последовательность которой показана в виде SEQ ID NO. 53.

В одном воплощении согласно изобретению предложена молекула ДНК, кодирующая вариабельную область тяжелой цепи, имеющую аминокислотную последовательность, показанную в SEQ ID NO. 36, нуклеотидная последовательность которой показана в виде SEQ ID NO. 54.

В одном воплощении согласно изобретению предложена молекула ДНК, кодирующая вариабельную область легкой цепи, имеющую аминокислотную последовательность, показанную в SEQ ID NO. 37, нуклеотидная последовательность которой показана в виде SEQ ID NO. 55.

В одном воплощении согласно изобретению предложена молекула ДНК, кодирующая вариабельную область тяжелой цепи, имеющую аминокислотную последовательность, показанную в SEQ ID NO. 38, нуклеотидная последовательность которой показана в виде SEQ ID NO. 56.

В одном воплощении согласно изобретению предложена молекула ДНК, кодирующая вариабельную область легкой цепи, имеющую аминокислотную последовательность, показанную в SEQ ID NO. 39, нуклеотидная последовательность которой показана в виде SEQ ID NO. 57.

В одном воплощении согласно изобретению предложена молекула ДНК, кодирующая вариабельную область тяжелой цепи, имеющую аминокислотную последовательность, показанную в SEQ ID NO. 40, нуклеотидная последовательность которой показана в виде SEQ ID NO. 58.

Используемый здесь термин «антитело к BLyS» включает любое антитело, или иммуноглобулин феногена, или антигенсвязывающий фрагмент, который сохраняет способность к специфичному связыванию с антигеном, включая фрагменты Fv, scFv («sc» означает «одноцепочечный»), Fab, F(ab')2, Fab', scFv-Fc, диатело, химерное антитело, одноцепочечное антитело и слитый белок, содержащий антигенсвязывающую часть антитела и белка, не являющегося антителом, но не ограничиваясь ими. Антитело можно метить и детектировать, например, посредством радиоактивного изотопа, фермента, который может продуцировать детектируемое вещество, флуоресцентного белка, биотина и т.д. Антитело также может связываться с твердофазным носителем, включающим полистирольную пластинку или шарик и т.д., но не ограничивающимся ими.

Кроме того, специалист в данной области может клонировать молекулу ДНК, кодирующую антитело к BLyS по изобретению, в вектор так, чтобы трансформировать клетки-хозяева. Следовательно, согласно изобретению, кроме того, предложен вектор на основе рекомбинантной ДНК, который содержит молекулу ДНК, кодирующую антитело к BLyS по изобретению.

Предпочтительно вектор на основе рекомбинантной ДНК представляет собой экспрессионный вектор, в который специалист в данной области клонирует молекулу ДНК указанного антитела так, чтобы трансформировать клетку-хозяина и получить одноцепочечное антитело путем индуцирования экспрессии.

В одном воплощении вектор на основе рекомбинантной ДНК по изобретению содержит молекулу ДНК, кодирующую гуманизированное антитело к BLyS по изобретению. Молекулу ДНК кодируемого гуманизированного антитела к BLyS можно рекомбинировать с конструированием вектора для транскрипции и экспрессии у млекопитающего. Экспрессионный вектор по изобретению содержит последовательность ДНК вариабельной области и константной области тяжелой цепи и легкой цепи кодируемого человеческого моноклонального антитела к BLyS. Однако можно конструировать два экспрессионных вектора соответственно: один - содержащий вариабельную область и константную область тяжелой цепи и другой - содержащий вариабельную область и константную область легкой цепи, для совместного трансфицирования млекопитающих.

В предпочтительном воплощении экспрессионный вектор, кроме того, содержит промотор и последовательность ДНК, кодирующую сигнальные пептиды секреции и по меньшей мере один ген устойчивости к медикаменту для скрининга. Использованный способ включает методику синтеза ДНК и методику генной инженерии in vitro.

Согласно изобретению, кроме того, предложена клетка-хозяин, содержащая вектор на основе рекомбинантной ДНК по изобретению. Клетка-хозяин по изобретению может быть прокариотической клеткой-хозяином, эукариотической клеткой-хозяином или бактериофагом.

В частности, прокариотическая клетка-хозяин может представлять собой Escherichia coli, Bacillus subtilis, Streptomyces или Proteus mirabilis. Эукариотическая клетка-хозяин может представлять собой грибок, такой как Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces, Trichoderma и т.д.; клетку насекомых, таких как травяные гусеницы; клетку растений, таких как табак и т.д.; и клетку млекопитающего, такую как клетка ВНК (почки новорожденного хомяка), клетка СНО (яичника китайского хомяка), клетка COS (почки обезьяны), миеломная клетка и т.д.

В некотором воплощении клетка-хозяин по изобретению предпочтительно представляет собой клетку млекопитающего, более предпочтительно клетку ВНК, клетку СНО, клетку NSO или клетку COS.

Иммунонейтрализующая активность указанного гуманизированного антитела к BLyS по изобретению анализируется цитологическими экспериментами in vitro. Результат показывает, что гуманизированное антитело к BLyS по изобретению может в разной степени ингибировать пролиферацию В-клеток. Следовательно, согласно изобретению предложен способ предупреждения и/или лечения заболеваний, вызванных сверхпролиферацией В-клеток, который включает применение эффективной дозировки антитела к BLyS по любому из пп. 1-7. Согласно изобретению, кроме того, предложено применение указанного антитела к BLyS или гуманизированного антитела к BLyS в получении лекарственных средств для предупреждения и/или лечения заболеваний, вызванных сверхпролиферацией В-клеток. Заболевания, вызванные сверхпролиферацией В-клеток, включают SLE, ревматоидный артрит, анкилозирующий артрит или В-клеточную лимфому, но не ограничиваются ими.

Согласно изобретению, кроме того, предложена фармацевтическая композиция, которая содержит эффективную дозировку любого из антител к BLyS или гуманизированных антител к BLyS по изобретению и фармацевтически приемлемый носитель. Фармацевтическую композицию можно получать смешиванием любого из антител к BLyS или гуманизированных антител к BLyS по изобретению и одного или более чем одного фармацевтически приемлемого носителя традиционным способом и можно получать в виде фармацевтического препарата. Термин «фармацевтически приемлемый носитель» означает один или более чем один органический или неорганический, природный или синтетический носитель, который хорошо известен специалисту в данной области, который может способствовать стабильности и клиническому применению антитела путем объединения с данным антителом. Подходящие носители включают фармацевтически приемлемый стерильный физиологический раствор и водный или безводный изоосмотический стерильный раствор и стерильную суспензию, известные специалисту в данной области. Эффективная дозировка и способ введения по изобретению зависят от многих факторов, включающих возраст, массу тела, пол, естественное состояние здоровья и пищевой статус пациента, степень активности соединения, время введения, скорость метаболизма, тяжесть заболевания и субъективное решение лечащих врачей. Согласно приведенным выше факторам решение по эффективной дозировке и способу введения может быть легко сделано специалистами в данной области.

Фармацевтическую композицию по изобретению можно получать с использованием подходящих носителей, эксципиентов и других реагентов, которые могут улучшать перенос, доставку, толерантность и т.д. Используемая композиция может включать, например, таблетку, порошок, пасту, мазь, гель, воск, масло, липид, липидсодержащую везикулу, конъюгат ДНК и т.д. Фармацевтическую композицию согласно изобретению можно вводить любым подходящим путем, например пероральным, интраназальным, внутрикожным, подкожным, внутримышечным или внутривенным.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

На Фиг. 1 показана картина детекции посредством SDS-PAGE (электрофорез в полиакриламидном геле с додецилсульфатом натрия) примера 1, где полоса А представляет собой белок, экспрессируемый рекомбинантной плазмидой по изобретению, полоса Б представляет собой рекомбинантную плазмиду с пустым вектором, полоса В представляет собой белковый маркер молекулярной массы.

На Фиг. 2 показан график проточной цитометрии комбинации рекомбинантного белка his-hBLyS, меченного биотином, в разных концентрациях и клеток BJAB из примера 2, где черная линия представляет собой группу рекомбинантного белка his-hBLyS, меченного биотином, в концентрации 200 нг/мл, красная линия представляет собой группу рекомбинантного белка his-hBLyS, меченного биотином, в концентрации 100 нг/мл, синяя линия представляет собой группу рекомбинантного белка his-hBLyS, меченного биотином, в концентрации 50 нг/мл, пурпурная линия представляет собой группу рекомбинантного белка his-hBLyS, меченного биотином, в концентрации 25 нг/мл, зеленая линия представляет собой группу рекомбинантного белка his-hBLyS без мечения биотином и содержащую только SA-APC.

На Фиг. 3 показан график проточной цитометрии комбинации сыворотки иммунизированных мышей и клеток BJAB из примера 3.

На Фиг. 4 показан график проточной цитометрии комбинации антитела, секретируемого моноклональной гибридомной клеткой, и рецептора BLyS на клетке BJAB из примера 4, где черная линия представляет собой группу IgG негативного контроля, красная линия представляет собой группу рекомбинантного белка his-hBLyS без мечения биотином и содержащую только SA-APC; пурпурная линия представляет собой группу моноклональной гибридомной клетки 3Н9, синяя линия представляет собой группу моноклональной гибридомной клетки 13G8.

На Фиг. 5 показан график проточной цитометрии комбинации антитела, секретируемого моноклональной гибридомной клеткой, и рецептора BLyS на клетке BJAB из примера 4, где черная линия представляет собой группу IgG негативного контроля, красная линия представляет собой группу моноклональной гибридомной клетки 1D12, пурпурная линия представляет собой моноклональную гибридомную клетку 2 В10, синяя линия представляет собой моноклональную гибридомную клетку 2G3;

На Фиг. 6 показан график проточной цитометрии комбинации антитела, секретируемого моноклональной гибридомной клеткой, и рецептора BLyS на клетке BJAB из примера 4, где черная линия представляет собой группу IgG негативного контроля, красная линия представляет собой группу моноклональной гибридомной клетки 5А5, пурпурная линия представляет собой группу моноклональной гибридомной клетки 1D7, синяя линия представляет собой группу моноклональной гибридомной клетки 4D3.

На Фиг. 7 показан результат твердофазного иммуноферментного анализа антител, секретируемых моноклональными гибридомными клетками 1D12, 2В10, 2G3, 5А5 и 13G8, рекомбинантного белка his-hBLyS и белка семейства фактора некроза опухоли (TNF).

На Фиг. 8 показан результат ингибирования пролиферации В-клеток in vitro гуманизированным антителом к BLyS из примера 9, где горизонтальная ось представляет концентрацию гуманизированного антитела к BLyS, вертикальная ось представляет значение флуоресценции.

На Фиг. 9 показан эффект ингибирования гиперплазии лимфатического узла, индуцированной BLyS, молекулой антитела-кандидата.

На Фиг. 10 показан эффект ингибирования увеличения сывороточного IgA, индуцированного BLyS, молекулой антитела-кандидата.

Конкретные воплощения

Воплощения изобретения раскрывают антитело к BLyS и его применения. Специалист в данной области может осуществлять их, обращаясь к данному содержанию и подходящим образом улучшая параметры процесса. Конкретно все аналогичные замены и модификации являются очевидными для специалиста и находятся в пределах объема изобретения. Продукт по изобретению описан посредством предпочтительных примеров, и специалисты в данной области могут модифицировать или изменять и объединять его подходящим образом согласно описанному здесь способу, не отступая от идеи, сущности и объема изобретения для осуществления и применения технологии по изобретению.

Для дополнительного понимания изобретения ниже приведены подробные описания изобретения в комбинации с примерами.

Пример 1: клонирование и экспрессия человеческого гена BLyS

Выделяли периферическую кровь здоровых людей и общую РНК экстрагировали и очищали с использованием имеющегося в продаже набора для РНК (Qiagen Company). Первую цепь кДНК синтезировали обратной транскрипцией с очищенной общей РНК, используемой в качестве матрицы. Реакционная система для получения кДНК была следующей:

dH2O (дистиллированная вода), не содержащая РНКазу 9,5 мкл
5х буфер для обратной транскриптазы (с 25 мМ Mg2+) 4 мкл
dNTP (дезоксинуклеотидтрифосфаты) (по 10 мМ каждого) 2 мкл
Ингибитор РНКазы (10 U/мкл) 0,5 мкл
Олиго (dT)20 (10 мкмоль/л) 1 мкл
Матрица в виде общей РНК 2 мкл
ReverTra Асе 1 мкл

В систему добавляли стерилизованную дистиллированную воду до общего объема 20 мкл.

Реакционные условия были следующими: 10 мин при 30°С, 30 мин при 42°С, 5 мин при 99°С, 5 мин при 4°С. Систему помещали в баню со льдом на 5 мин после того, как реакция была завершена.

На основе полноразмерной последовательности ДНК человеческого BLyS были разработаны и синтезированы праймеры Р1 и Р2 клонированного секретируемого BLyS. ПЦР-амплификацию проводили с использованием прямого праймера Р1 и обратного праймера Р2 с кДНК, синтезированной обратной транскрипцией, используемой в качестве матрицы. Нуклеотидные последовательности Р1 и Р2 были следующими:

Р1: 5'tacgaagctt gcatcatcat catcatcatg gcggcggctc cggcggcggc tccccgttca gggtccagaa gaa;

P2: 5'cgacgtcgac tcacagcagt ttcaatgcac caaaaaatgt gacatc.

Реакционная система ПЦР-амплификации была следующей:

Буфер 10х для Taq (с 1,5 мМ Mg2+) 5 мкл
dNTP (5 мМ) 4 мкл
Прямой праймер (100 нг/мкл) 1 мкл
Обратный праймер (100 нг/мкл) 1 мкл
Матрица (5-50 нг/мкл) 1 мкл
Фермент Taq (2 U/мкл) 0,5 мкл

В систему добавляли стерилизованную дистиллированную воду до общего объема 50 мкл.

Протокол ПЦР-реакции был следующим:

Продукт ПЦР-амплификации выделяли гель-электрофорезом, дважды расщепляли ферментами - Sal I и Hind III и клонировали в эукариотическую экспрессионную систему на основе плазмиды pCDNA3.1. С использованием плазмиды, трансформированной пустым вектором в качестве контроля, через 3 суток после трансфицирования клеток 293Т (Китайский центр коллекции типовых культур) собирали супернатант культуральной среды и очищали аффинной хроматографией в отношении His с получением очищенного белка his-hBLyS. Его анализировали SDS-PAGE. Результат показан на Фиг. 1.

Из результата на Фиг. 1 можно видеть, что белки экспрессировались рекомбинантной плазмидой по изобретению, тогда как для рекомбинантной плазмиды с пустым вектором не было обнаружено очевидной полосы экспрессии белка. Белок от рекомбинантной плазмиды по изобретению имел молекулярную массу, соответствующую приблизительно 23 кб, близкую к молекулярной массе, соответствующей 23 кб, выведенной согласно аминокислотной последовательности человеческого BLyS.

Пример 2: анализ способности к связыванию с рецептором на клетках BJAB

1. Мечение рекомбинантного белка his-hBLyS биотином

Очищенный рекомбинантный белок his-hBLyS, полученный из примера 1, смешивали с биотин-xx-NHS, растворенным в DMSO (диметилсульфоксид), в соотношении масса к объему 1:4 в нг/мл и оставляли при комнатной температуре в течение 1 часа. Реакционную смесь хроматографировали через колонку с гелем для выделения his-hBLyS, меченного биотином, и свободного биотина.

2. Связывание рекомбинантного белка his-hBLyS, меченного биотином, с клеткой BJAB

Выделенные рекомбинантные белки his-hBLyS, меченные биотином, делили на четыре группы, имеющие разные концентрации: 25 нг/мл, 50 нг/мл, 100 нг/мл и 200 нг/мл, смешивали с 1×106 клеток человеческой лимфомы Беркитта (BJAB) соответственно, инкубировали при 4°С в течение 15 мин, 3 раза промывали PBS (фосфатно-солевой буферный раствор), добавляли стрептавидин-аллофикоцианин (SA-APC) до достижения конечной концентрации 0,2 мкг/мл и инкубировали при 4°С в течение 20 мин. После промывки PBS 3 раза их анализировали проточным цитометром. Результат показан на Фиг. 2.

Из результата Фиг. 2 можно видеть, что рекомбинантный человеческий белок BLyS, меченный биотином, может связываться с клеткой BJAB при разных концентрациях.

Пример 3: иммунизирование мышей

Рекомбинантный белок his-hBLyS, полученный из примера 1, использовали в качестве антигена для смешивания с таким же количеством иммунологического адъюванта (адъювант Фрейнда). Тестировали 4 самок 6-недельных мышей FVB, 3 из которых иммунизировали, а другую одну использовали для контрольной имитации эксперимента. После первой иммунизации давали усиливающую иммунизацию один раз в неделю. Перед последней усиливающей иммунизацией из хвостовой вены иммунизированной мыши отбирали кровь. Сыворотку смешивали с рекомбинантным белком his-hBLyS, меченным биотином (с концентрацией 50 нг/мл), и инкубировали при комнатной температуре в течение 20 мин. Затем смесь инкубировали с клеткой BJAB при 4°С в течение 15 мин, 3 раза промывали нормальным физиологическим раствором, добавляли стрептавидин-аллофикоцианин в концентрации 0,2 мкг/мл и инкубировали при 4°С в течение 15 мин. После промывки нормальным физиологическим раствором 3 раза образец анализировали проточным цитометром для тестирования того, может ли сыворотка иммунизированной мыши ингибировать связывание BLyS с его рецептором BR3-Fc. Результат показан на Фиг. 3.

Из результата Фиг. 3 можно видеть, что сыворотка, полученная от мыши 1 из трех иммунизированных мышей, может эффективно ингибировать связывание рекомбинантного белка his-hBLyS, меченного биотином, с клеткой BJAB. Следовательно, мышь 1 выбирали в качестве экспериментального индивидуума для последующего наблюдения для поведения дальнейших экспериментов по слиянию.

Пример 4: слияние клеток и скрининг моноклональной гибридомной клетки

После последней усиливающей иммунизации у мыши отбирали паховый лимфатический узел и растирали в нормальном физиологическом растворе. Суспензию, обогащенную В-клетками, отбирали и сливали с миеломной клеткой SP2/0 путем электропорации с использованием традиционного способа. Слитые клетки распределяли в 96-луночном планшете и инкубировали в полной среде RPMI-1640, содержащей HAT (гипоксантин, аминоптерин и тимидин), в 5% CO2 при 37°С. Посредством способа мечения ферментом из разных моноклональных гибридомных клеток отбирали 211 клонов, которые секретировали антитела, способные к связыванию с белком BLyS.

Антитела, продуцируемые 211 клонами, которые могут связываться с белком BLyS, соответственно, смешивали с рекомбинантным белком his-hBLyS, меченным биотином, и инкубировали при комнатной температуре в течение 20 мин. Затем смесь инкубировали с клетками BJAB при 4°С в течение 15 мин, 3 раза промывали нормальным физиологическим раствором, добавляли 0,2 мкг/мл стрептавидин-аллофикоцианин и инкубировали при 4°С в течение 15 мин. После промывки 3 раза нормальным физиологическим раствором образец анализировали на проточном цитометре для отбора моноклональных гибридомных клеток, которые могут ингибировать связывание рекомбинантного белка his-hBLyS, меченного биотином, с клетками BJAB. В результате антитела, секретируемые 11 моноклональными гибридомными клетками, могут в разной степени ингибировать связывание рекомбинантного белка his-hBLyS, меченного биотином, с рецептором BLyS на BJAB, как показано в таблице 1. Ингибирующая способность антител, секретируемых моноклональными гибридомными клетками, названными 1D12, 2В10, 2G3, 5А5 и 13G8, была сильнее, чем ингибирующая способность антител, секретируемых моноклональными гибридомными клетками, названными 2Н9, 1D7 и 4D3. Результаты анализа 1D12, 2В10, 2G3, 5А5 и 13G8 показаны на Фиг. 4-6.

Таблица 1. Подтипы антител, секретируемых клетками, которые ингибируют связывание рекомбинантного белка his-hBLyS, меченного биотином, с рецептором BLyS на BJAB

Пример 5: тестирование связывания с другим белком семейства фактора некроза опухоли (TNF)

Для дальнейшего тестирования специфичности связывания с антителами-кандидатами в 96-луночные планшеты для ELISA вводили 1 мкг/мл рекомбинантного белка his-hBLyS, фактор некроза опухоли-α (TNF-α), фактор некроза опухоли-β (TNF-β) и BSA и выдерживали в течение ночи при 4°С в 0,05 М карбонатном покрывающем буфере с рН 9,0. На следующие сутки раствор в лунках удаляли и лунки 3 раза промывали промывочным буфером. Затем добавляли раствор PBS, содержащий 3% BSA (бычий сывороточный альбумин), и запечатывали на 20 мин. После промывки промывочным буфером 3 раза добавляли 100 мкл разбавленных антител, секретируемых моноклональными гибридомными клетками 1D12, 2В10, 2G3, 5А5 и 13G8, инкубировали в течение 1 часа при комнатной температуре и 3 раза промывали промывочным буфером. Антитело козы против антитела мыши поперечно сшивали с пероксидазой хрена (HRP), разводили в промывочном буфере 1:10000 и инкубировали в течение 1 часа при комнатной температуре. После промывки промывочным буфером 3 раза добавляли 50 мкл раствора субстрата - 3,3',5,5'-тетраметилбензидина (ТМВ) для развития окраски и проводили реакцию в течение 10 мин при комнатной температуре. Затем реакцию останавливали 25 мкл 0,5 М раствора серной кислоты. Считывали поглощение при 450 нм. Статистический результат показан на Фиг. 7.

Из Фиг. 7 можно видеть, что все антитела, секретируемые моноклональными гибридомными клетками 1D12, 2В10, 2G3, 5А5 и 13G8, распознают и связываются с BLyS, но ни одно из них не распознает TNF-α или TNF-β.

Пример 6: определение последовательности вариабельной области антитела, секретируемого моноклональной гибридомной клеткой

Инкубировали моноклональные гибридомные клетки 1D12, 2В10, 2G3, 5А5 и 13G8, полученные посредством скрининга. Клетки отбирали центрифугированием при 1000 об/мин. Первую цепь кДНК синтезировали посредством обратной транскрипции РНК индивидуальной гибридомной клетки, экстрагированной согласно способу из примера 1. Последовательность ДНК вариабельной области, соответствующей гибридомным клеткам, амплифицировали с синтезированной первой цепью кДНК, используемой в качестве матрицы. Последовательности праймеров, используемых в реакции амплификации, были следующими.

Праймеры, требующиеся для амплификации тяжелой цепи, были следующими:

праймер 1: 5'atg g(ag)a tg(cg) agctg(tg) gt(ca) at(cg) etc tt;

праймер 2: 5'ggg gatatc cacc atg (ag)ac ttc ggg (tc) tg age t(tg)g gtt tt; и

праймер 3: 5'ggg tatatc cacc atg get gtc ttg gggctg ctcttct.

Праймеры, требующиеся для амплификации легкой цепи, были следующими:

праймер 1: 5' atg gag аса gac аса ctcctgctat;

праймер 2: 5'atg gattttcaa gtg cag a tt tic ag;

праймер 3: 5'atg gag (ta)ca ca(gt)(ta)ct cag gtc ttt (ga)t а; и

праймер 4: 5'atg (gt)cc coat) (ga) ct cag (ct)t(ct) ct(tg)gt.

Реакционная система для амплификации была следующей:

10х буфер для ПЦР (с 25 мМ Mg2+) 5 мкл
dNTP (5 мМ) 1 мкл
Смесь праймеров тяжелой цепи или смесь праймеров легкой цепи (каждый праймер в концентрации 100 нг/мкл) 1 мкл
кДНК (5-50 нг/мл) 1 мкл
Фермент Taq (2 U/мкл) 1 мкл

В систему добавляли стерилизованную дистиллированную воду до достижения общего объема 50 мкл.

Методика ПЦР-реакции была следующей:

Продукт ПЦР-амплификации выделяли гель-электрофорезом и высылали в биологическую компанию для секвенирования. Проводили серийный анализ для полученных последовательностей согласно www.expasy.ch. Аминокислотные последовательности вариабельной области легкой цепи и вариабельной области тяжелой цепи показаны в таблице 2. Проводили классификационный анализ по Kabat на основе выведенных аминокислотных последовательностей для определения FR области и CDR области легкой цепи и тяжелой цепи индивидуальных гибридомных клеток 1D12, 2В10, 2G3, 5А5 и 13G8. Аминокислотные последовательности вариабельной области легкой цепи и аминокислотные последовательности вариабельной области тяжелой цепи индивидуальных гибридомных клеток 1D12, 2В10, 2G3, 5А5 и 13G8 показаны в таблице 2.

Таблица 2. Аминокислотные последовательности вариабельной области легкой цепи и вариабельной области тяжелой цепи антитела к BLyS

Пример 7: гуманизация антитела к BLyS

С последовательностями вариабельной области антител, секретируемых индивидуальными гибридомными клетками, проводили гуманизирующее превращение.

Методика гуманизирующего превращения, главным образом, включала следующие ключевые стадии.

A. Последовательности генов антител, секретируемых индивидуальными гибридомными клетками, сравнивали с последовательностями гена антитела человеческой эмбриональной системы для нахождения последовательностей, имеющих высокую гомологию.

Б. Аффинность с HLA-DR тестировали посредством анализа баз данных для отбора каркасной последовательности человеческой эмбриональной системы, имеющей низкую аффинность.

B. Каркасные аминокислотные последовательности вариабельной области и ее периферии анализировали посредством применения молекулярной стыковки с использованием технологии компьютерной симуляции для исследования формы стереоскопической комбинации. Путем расчета электростатических сил, вандерваальсовых сил, гидрофобных и гидрофильных свойств и значения энтропии в последовательности гена антитела, секретируемого индивидуальными гибридомными клетками, анализировали ключевых аминокислотных индивидов, которые могут взаимодействовать с BLyS и сохранять пространственный каркас, и пересаживали их обратно в выбранный каркас гена человеческой эмбриональной системы. На этой основе получили 4 разных гуманизированных антитела против BLyS. Их последовательности вариабельной области легкой цепи и вариабельной области тяжелой цепи показаны в таблице 3.

Пример 8: конструирование экспрессионного вектора гуманизированного антитела к BLyS

Константную область Fc фрагмента тяжелой цепи амплифицировали из клеток человеческой крови посредством применения прямого праймера VH5 и обратного праймера VH3. Константную область κ легкой цепи амплифицировали из клеток человеческой крови посредством применения прямого праймера VL5 и обратного праймера VL3. В тяжелую цепь вводили сайты эндонуклеаз Xho I и Age I. Во фрагмент легкой цепи вводили сайты эндонуклеаз Sma I и Dra III. Включали плазмиду pCDNA 3.1 и правильный клон подтверждали секвенированием. Все экспериментальные вещества для секвенирования получали путем экстракции из клеток, которые трансфицировали плазмидой данной серии. Нуклеотидные последовательности VH5, VH3, VL5 и VL3 были следующими:

VH5: 5'gcggaattc(c/g)a ggtg(a/c)agct(g/t)c a(c/g)(c/g)a(a/g)tc(a/t)gg;

VH3: 5'accgccggat ccaccaccgc ccg agccacc gccacctgcg gagacgatga cc(a/g)tgg tccc;

VL5: 5'ggtggtggatccggcggtgg cggttccgacattgtgatgacccagtctcca;

VL3: 5'ggatacagttggtgcagcctcgagctacc gttt.

Получали четыре гуманизированных антитела, которые называли BLyS-I, BLyS-II, BLyS-III и BLyS-IV соответственно.

Пример 9: гуманизированные антитела к BLyS ингибируют пролиферацию В-клеток in vitro

В-клетки экстрагировали посредством магнитных шариков MACS (магнитно-активированная сортировка клеток), меченных CD19, из человеческой периферической крови и субкультивировали в 96-луночном планшете в количестве 100000 на планшет и инкубировали. Рекомбинантный BLyS (10 нг/мл) и фрагмент Fab козы против человеческого IgM (4 мкг/мл) вводили в полную среду для стимуляции роста В-клеток. В среду вводили разные гуманизированные антитела к BLyS, полученные из примера 8, имеющие разные концентрации, и инкубировали в течение 6 суток. Затем В-клетки подсчитывали посредством Celltiter Glo от Promega Company. Значение (RLU) (относительные световые единицы) подсчитывали по флуоресценции. Результат показан на Фиг. 8.

Из Фиг. 8 можно видеть, что четыре гуманизированных антитела к BLyS: BLyS-I, BLyS-II, BLyS-III и BLyS-IV, полученных в примере 8, могут в разной степени ингибировать рост В-клеток.

Приведенные выше примеры используются лишь для того, чтобы помочь в понимании способа по изобретению и его идеи. Для обычного специалиста в данной области очевидно, что могут быть сделаны многие исправления и модификации изобретения, которые все еще попадают в объем изобретения без отступления от принципа изобретения.

Пример 10: фармакодинамическое исследование гуманизированного антитела к BLyS in vivo

1) Определение дозировки BLyS для стимулирования пролиферации В-клеток.

Рекомбинантный BLyS, имеющий разные концентрации, инъецировали в хвостовую вену мышей. Через неделю измеряли массу тела (граммы), массу селезенки (мг) и массу лимфатического узла (мг) мыши. Результаты показаны в таблице 4.

Результаты показали, что BLyS собственного производства в дозировке 0,3 мг/кг может эффективно стимулировать рост В-клеток in vivo. Массу лимфатического узла можно использовать в качестве главного индикатора фармакодинамической оценки для оценки пролиферации В-клеток, стимулируемой BLyS. Это, главным образом, было обусловлено тем, что на долю В-клеток приходится 50% массы лимфатического узла, и отношение массы В-клеток к массе лимфатического узла становилось выше после стимуляции BLyS.

2) Исследование in vivo ингибирующего эффекта антитела к BLyS на BLyS.

На этой основе BLyS в дозировке 0,3 мг/кг смешивали с мышиным 1D12, 2 В10, 2G3 и 5А5 и человеческим BLyS-l (13G8) в дозировке 0,05 мг/кг. Затем измеряли массу их лимфатического узла и содержание IgA в сыворотке (см. Фиг. 9 и Фиг. 10).

Результат показал: мышиные 1D12, 2В10, 2G3 и 5А5 и человеческое BLyS-I (13G8) могут эффективно ингибировать эффект BLyS.

1. Антитело к BLyS, в котором аминокислотные последовательности CDR1, CDR2 и CDR3 легких цепей и аминокислотные последовательности CDR1, CDR2 и CDR3 тяжелых цепей выбраны из одной группы из следующих групп:

2. Антитело к BLyS по п.1, в котором аминокислотные последовательности вариабельной области легкой цепи и аминокислотные последовательности вариабельной области тяжелой цепи антитела к BLyS выбраны из одной группы из следующих групп:

а: аминокислотные последовательности, показанные в SEQ ID NO. 31 и SEQ ID NO. 32;

б: аминокислотные последовательности, показанные в SEQ ID NO. 33 и SEQ ID NO. 34;

в: аминокислотные последовательности, показанные в SEQ ID NO. 35 и SEQ ID NO. 36;

г: аминокислотные последовательности, показанные в SEQ ID NO. 37 и SEQ ID NO. 38 и

д: аминокислотные последовательности, показанные в SEQ ID NO. 39 и SEQ ID NO. 40.

3. Антитело к BLyS по п.1, где оно является гуманизированным.

4. Антитело к BLyS по п.1, в котором аминокислотные последовательности вариабельной области легкой цепи и аминокислотные последовательности вариабельной области тяжелой цепи антитела к BLyS выбраны из одной группы из следующих групп:

I: аминокислотные последовательности, показанные в SEQ ID NO. 41 и SEQ ID NO. 42;

II: аминокислотные последовательности, показанные в SEQ ID NO. 43 и SEQ ID NO. 44;

III: аминокислотные последовательности, показанные в SEQ ID NO. 45 и SEQ ID NO. 46 и

IV: аминокислотные последовательности, показанные в SEQ ID NO. 47 и SEQ ID NO. 48.

5. Антитело к BLyS по п.3, отличающееся тем, что оно, кроме того, содержит константную область человеческой легкой цепи и константную область человеческой тяжелой цепи и вариабельная область легкой цепи и вариабельная область тяжелой цепи присоединены соответственно к константной области человеческой легкой цепи и константной области человеческой тяжелой цепи.

6. Антитело к BLyS по п.5, отличающееся тем, что константная область человеческой легкой цепи представляет собой константную область κ человеческой легкой цепи.

7. Антитело к BLyS по п.5 или 6, отличающееся тем, что константная область человеческой тяжелой цепи представляет собой фрагмент Fc человеческой тяжелой цепи.

8. Молекула ДНК, кодирующая антитело к BLyS по по любому из пп.1-7.

9. Молекула ДНК по п.8, где она включает нуклеотидную последовательность, выбранную из SEQ ID NO. 49-58.

10. Вектор на основе рекомбинантной ДНК для транскрипции и экспрессии у млекопитающих, отличающийся тем, что он содержит молекулу ДНК по п.8 или 9.

11. Клетка-хозяин для получения антитела к BLyS, отличающаяся тем, что она содержит вектор на основе рекомбинантной ДНК по п.10.

12. Способ предупреждения и/или лечения заболеваний, вызванных сверхпролиферацией В-клеток, включающий введение эффективной дозировки антитела к BLyS по любому из пп.1-7.

13. Способ по п.12, отличающийся тем, что заболевания, вызванные сверхпролиферацией В-клеток, выбраны из системной красной волчанки, ревматоидного артрита, анкилозирующего артрита или В-клеточной лимфомы.

14. Фармацевтическая композиция для предупреждения и/или лечения заболеваний, вызванных сверхпролиферацией В-клеток, отличающаяся тем, что она содержит эффективную дозировку антитела по любому из пп.1-7 и фармацевтически приемлемый носитель.

15. Способ получения антитела к BLyS, включающий:

инкубирование клеток-хозяев по п.11 и

получение антитела.



 

Похожие патенты:

Изобретение относится к биохимии. Описан способ получения антитела, включающий выделение антитела из среды культивирования эукариотической клетки, содержащей нуклеиновую кислоту, кодирующую антитело, причем нуклеиновую кислоту, кодирующую антитело, получают путем амплификации нуклеиновых кислот, кодирующих родственный вариабельный домен, используя в качестве матрицы в полимеразной цепной реакции (ПЦР) одноцепочечные кДНК, полученные из РНК антитело-секретирующей В-клетки, и вставки нуклеиновых кислот, кодирующих вариабельный домен, в эукариотическую экспрессионную плазмиду путем безлигазного клонирования, в котором для вставки используют пул нуклеиновых кислот, кодирующих вариабельный домен соответственно легкой и тяжелой цепей антитела, где В-клетка является отдельной единичной В-клеткой, и где В-клетка и ее потомство за 7 дней их совместного культивирования с питающими клетками, начиная с одной клетки, производят более 20 нг/мл антител выделения сегментов нуклеиновых кислот, кодирующих вариабельные домены антител, и введение выделенных сегментов нуклеиновых кислот в эукариотические экспрессионные плазмиды осуществляется без промежуточного выделения и анализа клональных промежуточных плазмид.

Изобретение относится к области биотехнологии, конкретно к противоопухолевым вакцинам на основе эпитопных пептидов MPHOSPH1, и может быть использовано в медицине. Получают пептид состоящий из аминокислотной последовательности SEQ ID NO: 120.

Изобретение относится к области биотехнологии и вирусологии. Описано получение оптимизированных полипептидов HA вируса гриппа H1N1, вызывающих иммунный ответ с широким спектром активности в отношении изолятов вируса гриппа H1N1.

Изобретение относится к биохимии. Описаны модифицированные олигонуклеотиды длиной от 15 до 30 нуклеотидов, содержащие по меньшей мере одну модификацию, причем указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного фрагмента сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Настоящее изобретение относится к области генной терапии для лечения заболеваний глаз, конкретно к применению векторов для условной экспрессии одного или более терапевтического белка под контролем системы модуляции генной экспрессии в присутствии активирующего лиганда при производстве лекарственного средства, и может быть использовано в медицине.

Изобретение относится к области биохимии. Предложен способ продления времени жизни мРНК трансгена vegf в клетке млекопитающего, трансфицированной генной конструкцией.

Изобретение относится к биохимии. Описан синтетический олигонуклеотид длиной от 19 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Изобретение относится к биохимии. Описаны олигонуклеотиды, повышающие экспрессию гена РНКазы H1 путем нацеленного контакта с природными антисмысловыми полинуклеотидами РНКазы H1.

Изобретение относится к биохимии. Описаны антисмысловые олигонуклеотиды, модулирующие экспрессию связывающего половые гормоны глобулина (ГСПГ), в частности, путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами связывающего половые гормоны глобулина (ГСПГ).

Изобретение относится к биохимии. Описан олигонуклеотид длиной приблизительно от 15 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Изобретение относится к области биохимии, в частности к моноклональному антителу или его антигенсвязывающему фрагменту, которые специфически связывают белок gB цитомегаловируса (CMV).

Изобретение относится к области биохимии. Заявлено моноклональное антитело, специфичное к синдекану-1, использующееся в качестве самостоятельного действующего вещества для терапии опухолевых заболеваний.

Настоящее изобретение относится к области биотехнологии и иммунологии. Предложены выделенные полинуклеотиды, кодирующие вариабельные области легкой и тяжелой цепи антитела против человеческого EGFR; анти-EGFR антитело и фрагмент антитела; а также вектор, клетка-хозяин и способ получения анти-EGFR антитела или его фрагмента.

Изобретение относится к области биотехнологии и иммунологии. Описано блокирующее AGR2 моноклональное антитело и, в частности, гуманизированное моноклональное антитело для блокирования AGR2.

Изобретение относится к области биотехнологии и иммунологии. Предложено гуманизированное антитело и его антиген-связывающий фрагмент, специфически связывающиеся с рецептором фолиевой кислоты 1 (FOLR1) человека и охарактеризованные аминокислотными последовательностями участков, определяющих комплементарность с антигеном (CDR).

Изобретение относится к области биохимии, в частности к антителу или его фрагменту, которые обладают иммунологической реактивностью в отношении белка CAPRIN-1. Также раскрыты конъюгат антитела, который специфически связывается с CAPRIN-1, фармацевтическая композиция, содержащая указанное антитело или его фрагмент или конъюгат, для лечения или профилактики злокачественной опухоли, ассоциированной с CAPRIN-1, ДНК, кодирующая указанное антитело.

Изобретение относится к биохимии. Описано выделенное антитело или его антиген-связывающий фрагмент, которые связываются с CD40 человека и являются агонистами CD40.

Изобретение относится к области иммунологии. Предложены способ получения антигенсвязывающего белка и клетка-хозяин для его получения.

Настоящее изобретение относится к области биотехнологии, конкретно к получению меченого альдегидом антитела для конъюгации с интересующим лекарственным средством, и может быть использовано в медицине.

Данное изобретение относится к области иммунологии. Предложены антитело и его антигенсвязывающий фрагмент, которые специфично связывают дельта-подобный лиганд 4 (DLL4) человека, охарактеризованные последовательностями определяющих комплементарность участков (CDR).

Изобретение относится к области биохимии. Предложено гуманизированное моноклональное антитело типа IgG, связывающееся с интерлейкином 17A человека.

Изобретение относится к области биохимии. Заявлено антитело к BLyS. Также изобретение относится к молекуле ДНК, кодирующей указанное антитело, вектору экспрессии и клетке-хозяину для получения указанного антитела. Также предложено применение антитела к BLyS в составе фармацевтической композиции и в способе предупреждения иили лечения заболеваний, вызванных избыточной пролиферацией В-клеток, таких как системная красная волчанка. Изобретение позволяет связываться с BLyS с высокой аффинностью и ингибировать связывание с его рецептором BR3 с высокой специфичностью. 7 н. и 8 з.п. ф-лы, 10 ил., 4 табл., 10 пр.

Наверх